COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..4724316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1670 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014068246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1675..2775 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2775..3848 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 3877..6288 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene gyrB CDS complement(6318..7253) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 7367..8392 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 8506..9318 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene yidA CDS 9545..10234 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene dgoR CDS 10231..11109 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094784.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 11093..11710 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 11707..12855 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene dgoD CDS 13018..14310 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 14362..15591 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15588..15848) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 16236..16646 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177605.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene ibpA CDS 16783..17211 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094790.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene ibpB CDS 17403..19064 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(19032..19778) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 20001..21623 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 21620..22942 product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094794.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 23035..23382 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094795.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 23372..23719 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23752..25038) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene dsdA CDS complement(25163..25636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(26127..27278) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene emrD CDS complement(27487..28320) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(28383..28829) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 29485..29733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 29779..30222 product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560253.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene higA CDS 30528..32216 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene ilvB CDS 32220..32507 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ilvN CDS 32633..33226 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094809.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene uhpA CDS 33223..34728 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094810.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene uhpB CDS 34721..36031 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 36164..37555 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene uhpT CDS 37725..37937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 note possible pseudo, frameshifted CDS 37928..38242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 note possible pseudo, internal stop codon, frameshifted CDS 38255..38728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 note possible pseudo, internal stop codon CDS complement(38716..39618) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39718..40170 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 40268..40786 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 40955..42145 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene nepI CDS complement(42194..43099) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(43282..44661) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094819.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(44798..45100) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(45106..45366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 45379..45642 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 45669..46499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 note possible pseudo, frameshifted CDS 46710..47531 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 47600..48070 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene radC CDS 48083..48409 product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 48430..48750 product TA system toxin CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 49045..50601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(50641..50817) product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 50954..51295 product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 51398..51556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 note possible pseudo, internal stop codon, frameshifted CDS 51911..52273 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 52270..52569 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(52634..53623) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094868.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(53758..54237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094867.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(54239..54907) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 55861..56463 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094865.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 56516..57100 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 57154..57831 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 57855..60380 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094862.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 60371..60889 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094861.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 60889..61896 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123654.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(61898..62422) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 62540..63265 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418306.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 63365..63775 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094857.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene uraH CDS 63878..64837 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 64984..66072 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094854.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(66203..66358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(66434..66688) product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene yoeB CDS complement(66685..66936) product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene yefM CDS complement(67187..68437) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(68444..69193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(69190..71286) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(71354..71539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(71563..71757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094846.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(71831..72484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(72491..74089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(74067..76661) product CS1-pili formation C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(76668..77345) product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(77391..78014) product common pilus major fimbrillin subunit EcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 77902..78141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(78242..78727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(78731..79543) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094839.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 79918..80502 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 80555..81247 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 81263..83755 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 83786..84835 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(84842..85507) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 86048..86668 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 86744..87424 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094831.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(87458..88258) product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene nlpA CDS 88640..89113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(89182..89574) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(89578..89838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(89956..91455) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 91528..92181 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703860.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(92178..92597) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 92882..93352 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 93611..94621 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 94621..97731 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 97778..99094 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 99144..100301 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 100384..100680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(100729..101679) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 101973..102287 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 102299..103624 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094821.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 103642..104823 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(104850..105680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 note possible pseudo, frameshifted CDS complement(105707..105970) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(106004..106783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(107265..109598) product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017694613.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(109613..109933) product DUF5375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(109930..110190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(110259..110708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(110701..111000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(110993..111322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 note possible pseudo, frameshifted CDS complement(111541..111807) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 112354..113097 product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095390.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 113101..113319 product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 113348..113911 product phage polarity suppression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 114211..115896 product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(116125..116562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(116562..117512) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(117500..118540) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 tRNA complement(118852..118946) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 119234..120625 product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 120638..122956 product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene yicI CDS complement(123041..124735) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094876.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(124854..126245) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094877.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 126471..127673 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene gltS CDS complement(127677..129758) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094879.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene recG CDS complement(129762..130451) product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene trmH CDS complement(130456..132570) product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369143.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene spoT CDS complement(132590..132865) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene rpoZ CDS complement(132920..133543) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene gmk CDS 133794..135464 product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene ligB CDS 136584..137228 product lipoprotein GfcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene gfcB CDS 137225..137962 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 137962..140112 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 140099..141232 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295357.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 141220..141663 product protein-tyrosine-phosphatase Etp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene etp CDS 141686..143863 product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208668.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene etk CDS complement(143890..144507) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(144716..145579) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 145705..146421 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rph CDS 146488..147129 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene pyrE CDS complement(147212..147808) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818601.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene slmA CDS complement(147930..148388) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene dut CDS complement(148366..149580) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene coaBC CDS 149751..150416 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene radC CDS 150634..150870 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002436699.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rpmB CDS 150893..151060 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene rpmG CDS 151133..151942 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094894.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene mutM CDS complement(151945..152424) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094895.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene coaD CDS complement(152428..153198) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094896.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(153198..154472) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene waaA CDS complement(154539..155528) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(155540..156640) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(156643..157770) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(157767..158837) product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene rfaQ CDS 158988..159941 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(159980..160879) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(160885..161994) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(161998..162981) product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene rfaC CDS complement(162985..164031) product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene rfaF CDS complement(164034..164966) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rfaD CDS 165180..166376 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene kbl CDS 166386..167414 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene tdh CDS complement(167441..168355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131637243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(168371..169576) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023331731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 169782..170582 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152082698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(170594..171526) product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094917.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(171530..172495) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094918.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene envC CDS 172400..172759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(172823..174367) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene gpmM CDS 174616..175047 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 175059..175310 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene grxC CDS 175342..175809 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene secB CDS 175809..176828 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene gpsA CDS 176850..177725 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene cysE CDS complement(177780..178061) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene ppiC CDS 178147..180171 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rep CDS complement(180223..181707) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099280.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene gppA CDS complement(181714..182982) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene rhlB CDS 183127..183456 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene trxA CDS 183798..185057 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene rho CDS 185399..186403 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene wecA CDS 186414..187463 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene wzzE CDS 187565..188650 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene wecB CDS 188647..189909 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene wecC CDS 189906..190583 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene rffC CDS 190588..191718 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene rffA CDS 191720..192970 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene wzxE CDS 192967..194046 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 194043..195395 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene wzyE CDS 195408..196148 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene wecG CDS 196346..197731 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099268.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 tRNA 197834..197910 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 197978..198053 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 198075..198161 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 198206..198282 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(198788..199999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(200165..201364) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene hemY CDS complement(201367..202560) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene hemX CDS complement(202581..203321) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene hemD CDS complement(203318..204259) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene hemC CDS 204610..207153 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene cyaA CDS 207214..207411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(207431..207751) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene cyaY CDS 207887..208090 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 208126..208950 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene dapF CDS 208947..209654 product DUF484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 209651..210553 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene xerC CDS 210553..211269 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene yigB CDS 211319..213511 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene uvrD CDS 213868..214818 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501540.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene corA CDS complement(214902..215798) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rarD CDS complement(215850..216317) product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene yigI CDS 216478..217347 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene pldA CDS 217438..219267 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene recQ CDS 219329..219949 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene rhtC CDS complement(219946..220566) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099249.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene rhtB CDS 220678..221670 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene pldB CDS 221702..222502 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene yigL CDS 222585..223484 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(223372..224325) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099245.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene metR CDS 224442..226703 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene metE CDS complement(226751..227557) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 227817..228578 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene udp CDS 228718..230175 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene rmuC CDS 230242..230997 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene ubiE CDS 231011..231616 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene ubiJ CDS 231613..233253 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene ubiB CDS 233330..233584 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099238.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene tatA CDS 233588..234130 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene tatB CDS 234133..234903 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene tatC CDS 234933..235727 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099235.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene tatD CDS complement(235724..236215) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene rfaH CDS 236385..237881 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene ubiD CDS 237921..238622 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene fre CDS 238838..240457 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(240496..240783) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 241114..241824 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 242068..242280 product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene cspA CDS complement(242339..243313) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094975.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene ghrB CDS complement(243341..244621) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094976.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(244739..245677) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(245681..246415) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(246533..247549) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(247708..248370) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 248535..250862 product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(250831..251271) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(251249..251830) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094984.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene tag CDS 251991..252533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 252770..253978 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 254321..254845 product long polar fimbria major subunit LpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 254930..255628 product long polar fimbrial biogenesis chaperone LpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene lpfB CDS 255650..258178 product outer membrane usher protein LpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene lpfC CDS 258195..259259 product long polar fimbrial protein LpfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene lpfD CDS 259265..259792 product long polar fimbrial protein LpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene lpfE CDS 260086..261738 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene eptB tRNA 261830..261906 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 262555..264135 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 264297..265316 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938843.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene dppB CDS 265326..266228 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene dppC CDS 266239..267222 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene dppD CDS 267219..268232 product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene dppF CDS complement(268275..269225) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene coaA tRNA 269543..269618 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 269627..269711 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 269828..269902 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 269909..269984 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 270103..271287 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene tuf CDS 271515..271898 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene secE CDS 271900..272445 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862341.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene nusG CDS 272602..273030 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008808007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene rplK CDS 273034..273738 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene rplA CDS 274028..274525 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene rplJ CDS 274592..274957 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene rplL CDS 275277..279305 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503453.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene rpoB CDS 279382..283605 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene rpoC CDS complement(283664..283981) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(283981..284289) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023334100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(284470..286011) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883059.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(286351..287478) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095007.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene thiH CDS complement(287478..288245) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095008.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene thiG CDS complement(288247..288447) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095009.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene thiS CDS complement(288431..289186) product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(289173..289814) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene thiE CDS complement(289814..291709) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene thiC CDS complement(291953..292450) product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 292546..293319 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene nudC CDS 293358..294422 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene hemE CDS 294432..295103 product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095016.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene nfi CDS 295145..295735 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 295922..296194 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene hupA CDS 296200..296898 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(296952..298244) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095019.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene purD CDS complement(298260..299849) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene purH rRNA 300416..301953 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 302155..305056 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 305248..305358 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 305580..306509 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene metA CDS 306780..308381 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene aceB CDS 308398..309717 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095023.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene aceA CDS 309769..311520 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095024.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene aceK CDS complement(311544..312371) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene iclR CDS 312565..316248 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene metH CDS 316466..318097 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095027.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(318094..318387) product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(318388..318690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 note possible pseudo, internal stop codon CDS 318888..319760 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095030.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene rluF CDS complement(319761..320033) product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(320084..321028) product ketopantoate/pantoate/pantothenate transporter PanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene panS CDS complement(321122..322471) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene lysC CDS 322846..324495 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene pgi CDS 325168..325806 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095035.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 325803..326540 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095036.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 326540..328636 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 328815..329225 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene psiE CDS complement(329322..330212) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene malG CDS complement(330227..331771) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene malF CDS complement(331893..333083) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene malE CDS 333455..334564 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene malK CDS 334610..335914 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095047.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 336029..336967 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene malM CDS 337140..337637 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene ubiC CDS 337650..338516 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene ubiA CDS complement(338609..341029) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene plsB CDS 341184..341552 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095052.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 341661..342269 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene lexA CDS 342333..343670 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418457.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene dinF CDS 343790..343999 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(344047..344559) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene zur CDS 344672..345163 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 345332..346642 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 346725..347720 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095060.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene dusA CDS 347856..348098 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene pspG CDS complement(348283..349266) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095062.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 349327..350739 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene dnaB CDS 350756..351835 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene alr CDS 351945..353138 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene tyrB CDS 353402..354115 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095066.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene aphA CDS 354228..354644 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 354647..355000 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(355004..357826) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene uvrA CDS 358078..358602 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ssb1 CDS complement(358664..358885) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503385.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 358860..358982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 359389..360789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 361055..362620 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(362627..362953) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene soxS CDS 363052..363510 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene soxR CDS 363870..364541 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 364839..366188 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene ghxP CDS 366341..367975 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(368051..368938) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 369041..369451 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 369444..370133 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(370167..371816) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095079.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene actP CDS complement(371813..372127) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(372261..374219) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene acs CDS 374643..375956 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene gltP CDS complement(376041..376715) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(376837..376989) product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(377311..379458) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077681898.1 transl_table 11 codon_start 1 transl_except (pos:379039..379041,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_03580 gene fdhF CDS 379715..380446 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(380428..381447) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(381447..382307) product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(382318..383004) product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(383095..384036) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(384065..385060) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(385063..386577) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 386703..388982 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 389052..389375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(389430..390188) product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene phnP CDS complement(390198..390452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 note possible pseudo, internal stop codon, frameshifted CDS 390457..390690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(390659..391207) product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene phnN CDS complement(391207..392343) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene phnM CDS complement(392340..393020) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene phnL CDS complement(393128..393883) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095105.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene phnK CDS complement(393880..394725) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene phnJ CDS complement(394718..395782) product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(395782..396366) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene phnH CDS complement(396363..396815) product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene phnG CDS complement(396816..397541) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095110.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene phnF CDS complement(397562..398341) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene phnE CDS complement(398459..399481) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene phnD CDS complement(399499..400287) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene phnC CDS complement(400424..400870) product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene yjdN CDS complement(400951..401286) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095115.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 401878..404232 product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene crfC CDS 404229..405107 product diguanylate cyclase regulator RdcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(405141..406136) product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene kdgT CDS 406780..408282 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene proP CDS complement(408315..409199) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 rRNA 409774..411311 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 411397..411472 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 rRNA 411657..414558 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 414627..414737 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(414848..415087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(415198..416733) product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(416783..417130) product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene tnpB CDS complement(417590..417910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 tRNA complement(418024..418099) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 418269..419114 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 419152..419742 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(419739..420314) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(420364..422067) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(422043..422366) product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene cutA CDS complement(422480..423781) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(423898..425334) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene aspA CDS 425670..426134 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene fxsA CDS complement(426158..427405) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene yjeH CDS 427584..427877 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 427918..429564 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095260.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene groL CDS complement(429630..430793) product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene iadA CDS complement(430804..431265) product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418507.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(431262..431909) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 432143..432496 product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(432562..433590) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene epmB CDS 433631..434197 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855940.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene efp CDS 434255..434386 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 434495..434641 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene ecnB CDS complement(434679..435278) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095267.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 435541..435858 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095268.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene sugE CDS complement(435855..436385) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095269.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(436493..437740) product class C beta-lactamase CMH-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene blaCMH CDS 437771..438646 product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene ampR CDS complement(438676..439035) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095272.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene frdD CDS complement(439046..439441) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene frdC CDS complement(439452..440186) product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene frdB CDS complement(440179..441846) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095275.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene frdA CDS 442280..443257 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene epmA CDS 443435..444934 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene yjeM CDS complement(444971..448294) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene mscM CDS complement(448314..449282) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095278.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene asd CDS complement(449380..450432) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene rsgA CDS 450540..451085 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene orn tRNA 451282..451357 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 451403..451478 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 451524..451599 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(451870..453009) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene queG CDS 453008..454531 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene nnr CDS 454524..454985 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene tsaE CDS 455002..456342 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene amiB CDS 456352..458196 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene mutL CDS 458234..459139 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene miaA CDS 459225..459536 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095287.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene hfq CDS 459611..460891 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene hflX CDS 460948..462207 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene hflK CDS 462210..463214 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene hflC CDS 463286..463483 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 463587..464885 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006178975.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 465078..465503 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095292.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene nsrR CDS 465542..467983 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rnr CDS 468048..468779 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rlmB CDS 468892..469305 product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 469322..470020 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 470020..471105 product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 471086..471739 product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 471759..472151 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 472155..472775 product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 472778..473941 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(473975..475249) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 475445..477067 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(477064..478995) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(479166..479441) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139152684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene yjfN CDS complement(479590..479892) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071843255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene bsmA CDS 480057..480779 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095300.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene yjfP CDS complement(480776..481531) product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095301.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene ulaR CDS complement(481642..482706) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene ulaG CDS 483066..484466 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene ulaA CDS 484479..484784 product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004109091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene ulaB CDS 484794..485261 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene ulaC CDS 485274..485924 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095305.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene ulaD CDS 485934..486794 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 486787..487473 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095307.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(487610..487885) product DUF1471 family protein YjfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene yjfY CDS 488226..488621 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpsF CDS 488628..488942 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856035.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene priB CDS 488947..489174 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rpsR CDS 489216..489665 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene rplI CDS 489818..490747 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(490794..491432) product OapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 491664..492284 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene fklB CDS 492599..494008 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene cycA CDS complement(494095..494757) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095312.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene ytfE CDS 494839..495018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 495003..496652 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(496740..497705) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095314.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(497781..498605) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(498687..499535) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 499620..500006 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(500100..502043) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 502234..502974 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene cysQ CDS complement(502968..503525) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 503850..504056 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(504131..505468) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(505680..506195) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene msrA CDS 506546..508279 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene tamA CDS 508276..512052 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095334.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene tamB CDS 512055..512399 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(512541..513071) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene ppa CDS 513423..514337 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014882271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene ytfQ CDS 514440..515942 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095340.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 515956..516978 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 516989..517966 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene yjfF CDS 518060..519628 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(519666..520664) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene fbp CDS 520844..522217 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene mpl CDS complement(522322..522873) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501414.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene yjgA CDS 522982..524322 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095347.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene pmbA CDS 524365..524751 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene cybC CDS complement(524822..524977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 525413..525733 product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 525744..526106 product SFCGS family glycine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006179053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 526109..526408 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 526431..527207 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 527221..527862 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 527905..529038 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 529022..530140 product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 530137..530877 product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 530992..532128 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 532148..534058 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704203.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(534091..534555) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene nrdG CDS complement(534696..536834) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene nrdD CDS complement(537208..538851) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene treC CDS complement(538903..540324) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene treB CDS complement(540449..541396) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene treR CDS 541783..544491 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene mgtA CDS 544694..547078 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(547164..548612) product N-acetylglucosamine-binding protein GbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene gbpA CDS complement(548751..549137) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene ridA CDS complement(549211..549672) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095364.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene pyrI CDS complement(549685..550617) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene pyrB CDS complement(550857..551333) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(551417..552820) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(552867..553871) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene argF CDS complement(553991..554902) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(554913..556133) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene arcA CDS 556810..557262 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 557505..558413 product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene yagE CDS 558428..560395 product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene yagF CDS 560622..562004 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 562016..563626 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(563611..564372) product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene xynR CDS complement(564559..565563) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene argF CDS 565728..566153 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rraB CDS 566201..566959 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene miaE CDS 566990..567712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 tRNA 567819..567903 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 568438..569646 product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene dcm CDS 569643..570293 product Eco29kI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689649.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(570415..570990) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(571206..571520) product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(571530..571877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 572067..572273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 573456..573632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 573642..574562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(574847..575806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(575806..576075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(576679..576930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(577162..578148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 578869..581229 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038162489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 581229..581366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(581394..582248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 note possible pseudo, frameshifted CDS complement(582245..582544) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 582731..583843 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 583840..587088 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(587309..588820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 589404..589565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(589559..590251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(590277..591149) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 591449..591904 product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(591949..592950) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095402.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene trpS CDS complement(593145..594155) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095404.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 594341..595429 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 595475..596869 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(596910..598043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(598040..599893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(600124..600945) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095407.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(600976..602595) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095408.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(602592..603020) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095409.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(602999..604870) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095410.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 605091..605777 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 605839..606060 product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 606057..606317 product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 606341..606721 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 606731..612313 product ATP-binding sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(612317..612934) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 613234..613839 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095419.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 613974..615095 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(615175..616593) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 616770..616931 product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(617026..617280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(617363..618751) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 618854..619333 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 619515..619985 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095432.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 619985..621049 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 621039..622115 product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095434.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(622112..623383) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(623387..624040) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(624079..624831) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 624985..626355 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(626531..627076) product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 627477..628835 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 629055..630077 product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene waaO CDS 630835..631332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(631370..632323) product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene yjiA CDS complement(632334..632537) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(632603..634756) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095444.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(634962..635234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(635355..635864) product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095446.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(635882..637444) product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095447.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene hpaB CDS complement(637622..638554) product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene hpaA CDS complement(638526..639869) product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene hpaX CDS complement(639891..640685) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene hpaI CDS complement(640695..641498) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene hpaH CDS complement(641605..641985) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(641995..642846) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene hpaD CDS complement(642849..644315) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene hpaE CDS complement(644312..645589) product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene hpaG CDS 645859..646299 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene hpaR CDS 646383..648047 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene tsr CDS complement(648323..648832) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(648832..651123) product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene opgB CDS complement(651395..651877) product DUF2501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(651962..652699) product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene dnaC CDS complement(652696..653241) product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095462.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene dnaT CDS complement(653365..653793) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(653878..654318) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(654375..654848) product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(654839..655483) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 656005..656742 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688833.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 656688..657374 product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene bglJ CDS complement(657412..657870) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 658199..659545 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(659682..660470) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene fhuF CDS complement(660566..661195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 661886..662116 product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 tRNA complement(662159..662245) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(662278..662363) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(662392..662478) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(662624..663652) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene rsmC CDS 663755..664168 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095480.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 664137..664580 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene rimI CDS 664600..665277 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene yjjG CDS 665370..666959 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095483.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene prfC CDS 667264..667881 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene osmY CDS 668007..668168 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856556.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 668291..669343 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 669340..670122 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095486.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(670117..670929) product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(670952..672487) product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095488.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 672750..673529 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene deoC CDS 673629..674951 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene deoA CDS 675005..676228 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene deoB CDS 676354..677073 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene deoD CDS complement(677127..677822) product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(678073..679089) product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene lplA CDS complement(679129..679773) product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095494.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 679891..680859 product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene serB CDS 680935..682320 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095496.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene radA CDS 682356..683588 product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene nadR CDS complement(683662..684663) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 684772..685671 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(685800..687467) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095500.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene ettA CDS 687694..689631 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene sltY CDS 689687..690016 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene trpR CDS complement(690044..690559) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882672.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene yjjX CDS 690609..691256 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene gpmB CDS complement(691253..692122) product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene robA CDS 692323..692808 product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene creA CDS complement(692857..693573) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene arcA CDS 694209..694895 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095507.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 695256..697718 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095509.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene thrA CDS 697720..698649 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene thrB CDS 698653..699939 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095511.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene thrC CDS 700186..700473 product DUF2502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095512.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(700505..701278) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene yaaA CDS complement(701345..702778) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 703041..703994 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene tal CDS 704105..704692 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene mog CDS 704815..706137 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(706114..706680) product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene satP CDS 706976..708889 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095521.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene dnaK CDS 708977..710122 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502040.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene dnaJ CDS 710296..711471 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene nhaA CDS 711527..712429 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene nhaR CDS complement(712488..712751) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rpsT CDS 713080..714006 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene ribF CDS 714052..716868 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene ileS CDS 716868..717368 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene lspA CDS 717486..717935 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095528.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene fkpB CDS 717937..718887 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene ispH CDS 719093..719914 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene dapB CDS 720369..721517 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene carA CDS 721536..724760 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene carB CDS 724943..725176 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(725225..727837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 728628..729158 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095536.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene kefF CDS 729151..731016 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene kefC CDS 731131..731610 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene folA CDS complement(731649..732497) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene apaH CDS complement(732502..732879) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene apaG CDS complement(732883..733704) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rsmA CDS complement(733701..734687) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene pdxA CDS complement(734687..735973) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene surA CDS complement(736027..738378) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095543.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene lptD CDS 738618..739433 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene djlA CDS complement(739465..740124) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095545.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene rluA CDS complement(740137..743043) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418667.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rapA CDS complement(743171..745528) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene polB CDS complement(745645..746340) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095548.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene araD CDS complement(746427..747929) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095549.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene araA CDS complement(747940..749649) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene araB CDS 749987..750832 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene araC CDS 750951..751718 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(751747..752400) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene thiQ CDS complement(752429..754039) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095554.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene thiP CDS complement(754015..754998) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene thiB CDS complement(755188..756822) product HTH-type transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene sgrR CDS 756911..757063 product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene sgrT CDS 757185..758363 product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095558.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 758580..758732 product Hok/Gef family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427008.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(758824..759429) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene leuD CDS complement(759440..760840) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene leuC CDS complement(760843..761934) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene leuB CDS complement(761934..763505) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene leuA CDS 764294..765256 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095563.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene leuO CDS 765633..767357 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene ilvI CDS 767359..767850 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene ilvN CDS 768030..769034 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene cra CDS 769626..770084 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene mraZ CDS 770087..771028 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene rsmH CDS 771025..771390 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene ftsL CDS 771406..773172 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 773231..774646 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene murE CDS 774643..776001 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene murF CDS 775995..777077 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501985.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene mraY CDS 777080..778396 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene murD CDS 778396..779640 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095573.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene ftsW CDS 779637..780701 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene murG CDS 780761..782236 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene murC CDS 782229..783149 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095576.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 783151..783993 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene ftsQ CDS 783990..785246 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006173845.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene ftsA CDS 785310..786461 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501978.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene ftsZ CDS 786563..787480 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095578.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene lpxC CDS 787830..788264 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene secM CDS 788323..791028 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene secA CDS 791083..791478 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene mutT CDS complement(791513..791707) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene yacG CDS complement(791717..792460) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene zapD CDS complement(792460..793080) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene coaE CDS 793309..794352 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095585.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(794386..795570) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095586.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene hofC CDS complement(795560..796939) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095587.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene gspE CDS complement(796952..797389) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene ppdD CDS complement(797564..798457) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene nadC CDS 798545..799108 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene ampD CDS 799105..799959 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095591.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene ampE CDS complement(799978..800928) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(800939..802336) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(802501..803871) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene aroP CDS 804409..805173 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene pdhR CDS 805297..807960 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene aceE CDS 807975..809873 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095598.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene aceF CDS 810049..811473 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368220.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene lpdA CDS complement(811526..812317) product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(812328..813830) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 814276..816873 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene acnB CDS 817086..817448 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene yacL CDS complement(817480..818274) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene speD CDS complement(818275..819144) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095610.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene speE CDS complement(819246..819569) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830675.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 819739..821298 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene cueO CDS complement(821384..823774) product pyrroloquinoline quinone-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095613.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 823981..824517 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene hpt CDS complement(824603..825265) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene can CDS 825373..826299 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095616.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 826296..827066 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095617.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 827172..827612 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 827675..828922 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(828924..830000) product fimbrial protein StkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(830012..830620) product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(830635..831198) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095622.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(831225..831800) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(831829..834420) product outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(834503..835246) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(835327..835932) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(836201..836581) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856284.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene panD CDS complement(836614..837465) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene panC CDS complement(837477..838268) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene panB CDS complement(838392..838871) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095629.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene folK CDS complement(838868..840211) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene pcnB CDS complement(840308..841198) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene gluQRS CDS complement(841258..841713) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155232.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene dksA CDS complement(841890..842594) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095633.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene sfsA CDS complement(842584..843138) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene thpR CDS 843212..845641 product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene hrpB CDS 845786..848311 product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene mrcB CDS 848549..850759 product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene fhuA CDS 850810..851607 product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene fhuC CDS 851607..852497 product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene fhuD CDS 852494..854476 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene fhuB CDS complement(854588..855868) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene hemL CDS 856046..857446 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene clcA CDS 857532..857876 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene erpA CDS complement(857935..858558) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(858582..859391) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene btuF CDS complement(859384..860082) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene mtnN CDS 860165..861679 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene dgt CDS 861812..863245 product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene degP CDS 863362..864549 product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095649.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene cdaR CDS complement(864642..865028) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(865140..865964) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene dapD CDS complement(865997..868672) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095651.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene glnD CDS complement(868735..869529) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene map CDS 869851..870576 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene rpsB CDS 870694..871545 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene tsf CDS 871695..872420 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene pyrH CDS 872588..873145 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501909.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene frr CDS 873238..874437 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene ispC CDS 874875..875381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 875394..876251 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene cdsA CDS 876263..877615 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene rseP CDS 877647..880079 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene bamA CDS 880203..880697 product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene skp CDS 880701..881726 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene lpxD CDS 881831..882286 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010426706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene fabZ CDS 882290..883078 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene lpxA CDS 883078..884226 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095663.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene lpxB CDS 884223..884819 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene rnhB CDS 884858..888340 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene dnaE CDS 888353..889312 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene accA CDS 889413..891545 product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 891612..892001 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 892060..893346 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene tilS CDS complement(893373..893633) product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene rof CDS complement(893620..893820) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 894016..894561 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095672.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 894558..894974 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene arfB CDS 895014..895712 product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene nlpE CDS complement(895758..897476) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095675.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene proS CDS complement(897589..898296) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene tsaA CDS complement(898293..898697) product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene rcsF CDS complement(898804..899619) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene metQ CDS complement(899660..900313) product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(900306..901337) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene metN CDS 901526..902092 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene gmhB rRNA 902467..904004 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 904076..904152 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 904258..904333 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 rRNA 904507..907408 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 907476..907586 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 tRNA 907645..907721 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 907882..908685 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene dkgB CDS complement(908716..909621) product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene yafC CDS 909725..910900 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095683.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 911095..911838 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095684.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 911916..912689 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(912742..913926) product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene mltD CDS complement(914175..914933) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene gloB CDS 915020..915682 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(915683..916150) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene rnhA CDS 916215..916946 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene dnaQ tRNA 917079..917155 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(917256..918026) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(918134..920578) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095726.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene fadE CDS 920818..921396 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene lpcA CDS 921445..922212 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(922183..922923) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095729.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene dpaA CDS 923224..924567 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 924570..925805 product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 925798..926592 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 926585..927223 product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 927230..927826 product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene nqrE CDS 927837..929060 product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene nqrF CDS 929063..929263 product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686315.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene nqrM CDS 929370..930428 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene dinB CDS complement(930484..931941) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene pepD CDS 932201..932659 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene gpt CDS 932764..934008 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene frsA CDS 934065..934466 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025760274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene crl CDS complement(934598..935650) product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene phoE CDS 935956..937059 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene proB CDS 937071..938324 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene proA tRNA 938436..938511 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 938675..939586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 note possible pseudo, frameshifted CDS 939600..939872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 note possible pseudo, frameshifted CDS 940440..941162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(941317..943365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 943461..943724 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 943751..944581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 note possible pseudo, frameshifted CDS 944937..945575 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 note possible pseudo, frameshifted CDS 945973..946677 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 946674..947288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023654308.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 947377..947787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 947864..948100 product DUF905 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194654.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 948180..948638 product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 948650..949129 product RadC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001407480.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 949138..949359 product DUF987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 949377..949697 product type IV toxin-antitoxin system YeeU family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072690.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 949718..950086 product type IV toxin-antitoxin system toxin YpjF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene ypjF CDS complement(950432..951178) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(951189..951446) product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054380.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(951706..953643) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706014.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(953661..954155) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(954539..956323) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(956438..957547) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 957705..959105 product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095772.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene mmuP CDS 959092..960024 product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene mmuM CDS 960247..961209 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene tauA CDS 961220..961987 product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene tauB CDS 961984..962811 product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene tauC CDS 962808..963659 product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene tauD CDS complement(963739..965439) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095797.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(965568..966542) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene hemB CDS 966992..969766 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095799.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 969855..970481 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(970484..971644) product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene ampH CDS 971996..973216 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene sbmA CDS 973229..974326 product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(974327..974629) product DUF2755 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 974878..975099 product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095806.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(975103..976200) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095807.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene ddlA CDS 976305..976988 product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095808.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 977158..978372 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 978581..978841 product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene iraP CDS 979136..979456 product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene psiF CDS 979559..980662 product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene adrA CDS complement(980679..981488) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene proC CDS 981586..982044 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 982189..982713 product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene aroL CDS 982758..982949 product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095817.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene yaiA CDS 983186..983863 product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095818.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 983935..984222 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene ppnP CDS complement(984270..985196) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene rdgC CDS 985308..986213 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095821.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene mak CDS complement(986298..989429) product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene sbcC CDS complement(989426..990631) product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095823.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene sbcD CDS 990819..991508 product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene phoB CDS 991530..992825 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene phoR CDS 993235..994554 product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene brnQ CDS 994636..996009 product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene proY CDS 996173..997990 product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene malZ CDS 998082..1000691 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1000688..1002067 product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1002117..1002719) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1002847..1003428) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene acpH CDS 1003521..1004591 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene queA CDS 1004645..1005772 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095832.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene tgt CDS 1005795..1006127 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene yajC CDS 1006188..1008002 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095833.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene secD CDS 1008013..1008984 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene secF CDS 1009123..1009488 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 1009499..1010179 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1010268..1011158) product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025756198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1011421..1012023) product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 1012113..1012562 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503337.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene nrdR CDS 1012567..1013670 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene ribD CDS 1013758..1014228 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene ribE CDS 1014250..1014669 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene nusB CDS 1014747..1015718 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene thiL CDS complement(1015818..1016792) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095841.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1016855..1018717) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095842.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene dxs CDS complement(1018742..1019641) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene ispA CDS complement(1019642..1019884) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene xseB CDS 1020063..1021511 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene thiI CDS complement(1021606..1022199) product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene yajL CDS complement(1022162..1023073) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene panE CDS 1023199..1023690 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1023723..1025084) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095847.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1025200..1025847) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene fucA CDS complement(1025876..1026871) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1026932..1028521) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1028533..1029483) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(1029530..1030513) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(1030516..1032015) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene gguA CDS 1032424..1034202 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724159.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene fucI CDS 1034251..1035654 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001763972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene fucK CDS 1035647..1036075 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene fucU CDS complement(1036117..1037004) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene cyoE CDS complement(1037016..1037342) product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176899.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1037342..1037956) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061708214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(1037946..1039937) product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene cyoB CDS complement(1039954..1040901) product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene cyoA CDS complement(1041380..1042855) product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ampG CDS complement(1042901..1043479) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1043783..1044100 product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene bolA CDS 1044432..1045730 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene tig CDS 1045991..1046614 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene clpP CDS 1046742..1048016 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene clpX CDS 1048201..1050555 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene lon CDS 1050766..1051038 product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002444653.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene hupB CDS 1051251..1053122 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095860.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene ppiD CDS 1053271..1053651 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1053710..1054147 product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 1054195..1054545 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1054532..1054861 product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1054865..1055560) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene queC CDS complement(1055627..1057327) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 1057211..1057426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1057429..1058247 product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene cof CDS complement(1058290..1059336) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1059452..1059910 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095868.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 1059941..1061695 product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1061688..1063469 product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095870.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 1063681..1064019 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene glnK CDS 1064070..1065341 product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene amtB CDS complement(1065438..1066298) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene tesB CDS 1066502..1067029 product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1067067..1067378) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095875.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1067893..1068144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095876.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1068141..1068356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095877.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1068427..1069848) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095878.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1069933..1070544 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1070622..1071692 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095880.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1071796..1074885 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1074921..1075760) product nickel/cobalt efflux protein RcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 1075871..1076143 product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830896.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(1076136..1077704) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1077922..1078182 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1078322..1079044) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095885.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1079134..1080594 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1080566..1081033) product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1081150..1081701) product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene maa CDS complement(1081910..1082128) product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1082156..1082530) product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene tomB CDS complement(1083040..1086186) product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene acrB CDS complement(1086209..1087294) product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095891.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene acrA CDS 1087544..1088197 product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene acrR CDS 1088311..1091658 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene mscK CDS complement(1091660..1091836) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene rsmS CDS complement(1091849..1092376) product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene priC CDS 1092427..1092804 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1092956..1093507 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene apt CDS 1093596..1095524 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene dnaX CDS 1095578..1095910 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858972.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1095910..1096515 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene recR CDS 1096626..1098500 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095899.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene htpG CDS 1098712..1099356 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809841.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene adk CDS 1099481..1100443 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene hemH CDS 1100506..1101810 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1101904..1103580) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095902.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene ybaL CDS complement(1103813..1105033) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1105198..1106850 product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095904.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene ushA CDS complement(1106946..1107425) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene ybaK CDS complement(1107624..1108418) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1108469..1110967) product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418822.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene copA CDS 1111076..1111486 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene cueR CDS complement(1111483..1111935) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095908.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(1111932..1112846) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1113001..1113855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1113998..1114669 product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095909.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene fetA CDS 1114662..1115444 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene fetB CDS complement(1115496..1116350) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1116409..1117179) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1117199..1117864) product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095913.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene tesA CDS 1117802..1118488 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1118485..1120899 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095915.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1121082..1122227 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1122315..1123385) product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene mnmH CDS complement(1123470..1124537) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene purK CDS complement(1124534..1125043) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095919.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene purE CDS complement(1125163..1125885) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene lpxH CDS complement(1125889..1126383) product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene ppiB CDS 1126559..1127944 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095924.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene cysS CDS complement(1128034..1128573) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1128634..1129650) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene malI CDS complement(1129734..1131233) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1131515..1131727) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene ybcJ CDS complement(1131730..1132596) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095929.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene folD CDS 1132907..1133470 product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene fimA CDS 1133540..1134082 product type 1 fimbrial protein subunit FimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene fimI CDS 1134114..1134809 product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095932.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene fimC CDS 1134824..1137382 product fimbrial biogenesis usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1137375..1138382 product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene fimH CDS 1138392..1138913 product fimbria assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene sfmF CDS complement(1138964..1139596) product fimbria biosynthesis transcriptional regulator FimZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene fimZ CDS complement(1140406..1141122) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(1141147..1141845) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095938.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 tRNA 1142113..1142189 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(1142205..1143368) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103675015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1143687..1143866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1143876..1144115) product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095941.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(1144093..1144665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1144662..1144883) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1145150..1145497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1145494..1145712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1145715..1147937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1147934..1148086) product DUF1317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1148083..1148511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1148520..1149002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1148999..1149913) product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1149923..1150204) product host nuclease inhibitor GamL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene gamL CDS complement(1150282..1150488) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090135989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1150485..1150643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 1150919..1151128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1151115..1151297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1151735..1151932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(1151956..1152240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1152252..1152548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1152832..1153542) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133087235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1153660..1153881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1153960..1154454 product toxin YdaT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1154544..1154690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1154683..1155768 product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1155765..1157138 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 1157128..1157442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1157439..1157642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1157639..1158571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1159068..1159415 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene tnpB CDS 1159465..1161000 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1161601..1161840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1162092..1162547 product DNA base-flipping protein YbcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene ybcN CDS 1162547..1162717 product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1162681..1162854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1162997..1163359 product crossover junction endodeoxyribonuclease RusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705896.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene rusA CDS 1163469..1164158 product bacteriophage antitermination protein Q inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095969.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1164646..1165047 product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1165044..1165319 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1165323..1165763 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1165760..1166146 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1166443..1166961 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050716666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1167117..1167335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1167310..1167489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 1167501..1167920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1167917..1169170 product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1169368..1170717 product DUF1073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1170677..1171603 product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1171606..1172871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095981.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1172884..1173333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095982.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1173351..1174427 product DUF6260 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095983.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1174437..1174730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095984.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1174793..1175197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097717.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1175199..1175477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1175474..1175647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006820518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1175647..1176003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1176006..1176374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705871.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1176371..1176754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1176812..1177573 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1177632..1178315 product DUF6246 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1178377..1181868 product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 1181868..1182365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1182365..1182835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095995.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1182858..1183214 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1183201..1185678 product host specificity factor TipJ family phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1185737..1188181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1188211..1188645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1188551..1188877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1189295..1189576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1189665..1190582) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1190579..1190941) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017693214.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1191099..1192319 product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1192379..1192762 product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125351949.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1193211..1193486 product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene yahO CDS 1193688..1195871 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1195999..1197972 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1198075..1199460 product phenylalanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene pheP CDS 1199721..1200956 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1200972..1201997 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1201990..1203132 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 1203208..1204179 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1204180..1205424) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1205492..1206928) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097686.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1207036..1207905 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097685.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 1207954..1208160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1208141..1208428 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1208465..1209118) product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097682.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene nfsB CDS complement(1209239..1209607) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1209597..1210187) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1210379..1211482 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 1211482..1211856 product RamA family antibiotic efflux transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1211930..1214074) product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene fhuA CDS 1214225..1215766 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1215752..1216000) product DUF1158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1216489..1219197 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1219303..1220367 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1220377..1223532 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097674.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1223462..1224583) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1224689..1225579 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1225761..1226330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(1226725..1227180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418870.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1227611..1228492) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1228598..1229377 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831009.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene budA CDS 1229391..1231070 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097652.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene alsS CDS 1231091..1231861 product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1231992..1232465 product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097650.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1232535..1233239) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156927.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1233226..1234062) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1234055..1234888) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1234888..1235901) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640254.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1236000..1237568) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1237769..1238467 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704607.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(1238561..1240225) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene betA CDS complement(1240239..1241711) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene betB CDS complement(1241725..1242312) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene betI CDS 1242441..1244474 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene betT CDS 1244716..1245627 product iron/manganese ABC transporter substrate-binding protein SitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene sitA CDS 1245630..1246436 product iron/manganese ABC transporter ATP-binding protein SitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983722.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene sitB CDS 1246433..1247284 product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene sitC CDS 1247278..1248117 product iron/manganese ABC transporter permease subunit SitD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene sitD CDS complement(1248053..1248742) product enterobactin synthase subunit EntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene entD CDS complement(1248824..1251064) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1251211..1252410 product enterochelin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene fes CDS 1252421..1252633 product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1252630..1256487 product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene entF CDS complement(1256577..1257377) product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene fepC CDS complement(1257374..1258366) product iron-enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene fepG CDS complement(1258363..1259367) product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene fepD CDS 1259476..1260714 product enterobactin transporter EntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097636.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene entS CDS complement(1260776..1261735) product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097635.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene fepB CDS 1261924..1263099 product isochorismate synthase EntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene entC CDS 1263109..1264719 product (2,3-dihydroxybenzoyl)adenylate synthase EntE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene entE CDS 1264730..1265584 product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097632.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1265584..1266339 product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase EntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene entA CDS 1266339..1266752 product proofreading thioesterase EntH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene entH CDS 1266902..1269007 product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097628.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene cstA CDS 1269013..1269309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1269306..1269710) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1269682..1269987) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1270171..1270914) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097624.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1270972..1272060) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1272220..1273722 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097622.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1273719..1274714 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1274734..1275798 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1275882..1277123 product LVIVD repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097619.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1277176..1278375) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene mtnK CDS 1278478..1279494 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene mtnA CDS complement(1279786..1280328) product 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1280325..1281014) product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene mtnC CDS complement(1281011..1281625) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097612.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1281748..1282908 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1282909..1283547) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097610.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1283520..1284749) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882127.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1284909..1285814) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097608.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1286442..1287005 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene ahpC CDS 1287193..1288758 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene ahpF CDS 1289028..1289531 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1289528..1291804 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064331.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1291801..1292358 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1292358..1293125 product dimethyl sulfoxide reductase anchor subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417104.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1293166..1293594) product universal stress protein UspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene uspG CDS 1293776..1295014 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1294989..1295144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1295252..1295662) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097604.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rnk CDS 1295925..1296545 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1296547..1297401 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1297405..1299900) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene ptsP CDS complement(1299923..1300963) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene ypdE CDS complement(1300936..1302048) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene ypdF CDS complement(1302060..1303310) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1303338..1303661) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1303835..1304644) product ribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene rna CDS complement(1304739..1306106) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097601.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene dcuC CDS 1306105..1306278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1306496..1307269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1307316..1307540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 1307431..1308006 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170942738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene pagP CDS 1308197..1308406 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene cspE CDS complement(1308626..1308907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1309077..1309865 product deaminated glutathione amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1309991..1310194 product twin-arginine translocase subunit TatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097596.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene tatE CDS complement(1310274..1311239) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097595.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene lipA CDS complement(1311447..1312400) product YbeF family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097594.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1312438..1312587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1312692..1313333) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene lipB CDS complement(1313428..1313691) product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858718.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene ybeD CDS complement(1313799..1315010) product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene dacA CDS complement(1315150..1316256) product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene rlpA CDS complement(1316273..1317385) product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene mrdB CDS complement(1317388..1319289) product peptidoglycan DD-transpeptidase MrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene mrdA CDS complement(1319318..1319785) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858701.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene rlmH CDS complement(1319789..1320106) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene rsfS CDS complement(1320374..1321039) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene nadD CDS complement(1321032..1322063) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene holA CDS complement(1322063..1322632) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene lptE CDS complement(1322647..1325229) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097584.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene leuS CDS 1325441..1325926 product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831082.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1325981..1326922) product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene rihA CDS complement(1327042..1327767) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1327767..1328441) product glutamate/aspartate ABC transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097580.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene gltK CDS complement(1328442..1329182) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097579.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1329338..1330288) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1330624..1332162) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene lnt CDS complement(1332168..1333046) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene corC CDS complement(1333131..1333598) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene ybeY CDS complement(1333595..1334641) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097575.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(1334805..1336166) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene miaB CDS 1336365..1337540 product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097573.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene ubiF tRNA complement(1337649..1337723) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(1337758..1337832) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(1337874..1337950) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1337968..1338042) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(1338075..1338149) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(1338173..1338257) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(1338266..1338342) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(1338568..1340232) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene asnB CDS complement(1340483..1341235) product ribonucleotide monophosphatase NagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene nagD CDS complement(1341281..1342501) product N-acetylglucosamine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1342510..1343658) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene nagA CDS complement(1343714..1344514) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene nagB CDS 1344840..1346789 product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene nagE CDS 1346959..1348626 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene glnS CDS 1349074..1349703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 note possible pseudo, internal stop codon CDS 1349773..1350471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 note possible pseudo, internal stop codon CDS 1350516..1350845 product ChiQ/YbfN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene chiQ CDS complement(1350988..1351434) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene fur CDS 1351479..1351664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1351726..1352256) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene fldA CDS complement(1352412..1352699) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene ybfE CDS complement(1352828..1353601) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097562.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene ybfF CDS 1353785..1354330 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097561.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene seqA CDS 1354355..1355995 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene pgm CDS complement(1356139..1357452) product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097559.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene potE CDS complement(1357449..1359647) product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097558.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene speF CDS complement(1360286..1360963) product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097557.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene kdpE CDS complement(1360960..1363647) product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene kdpD CDS complement(1363648..1364223) product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097555.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene kdpC CDS complement(1364236..1366284) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene kdpB CDS complement(1366303..1367982) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097553.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene kdpA CDS 1368383..1368589 product YbfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097552.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 1369188..1370600 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097551.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene phrB CDS 1370608..1371354 product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1371369..1372025 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097549.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene pxpB CDS 1372019..1372951 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1372938..1373678 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097547.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene pxpA CDS 1373697..1374488 product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097546.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene nei CDS complement(1374608..1375891) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1376546..1376935 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene sdhC CDS 1376929..1377276 product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501088.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene sdhD CDS 1377276..1379042 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097543.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene sdhA CDS 1379058..1379774 product succinate dehydrogenase iron-sulfur subunit SdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene sdhB CDS 1380134..1382941 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene sucA CDS 1382956..1384182 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene odhB CDS 1384267..1385433 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809579.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene sucC CDS 1385433..1386302 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene sucD CDS complement(1386389..1387105) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097539.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1387277..1389193 product PTS 2-O-a-mannosyl-D-glycerate transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene mngA CDS 1389217..1391853 product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene mngB CDS 1392533..1394101 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene cydA CDS 1394117..1395256 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097535.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene cydB CDS 1395384..1395674 product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097534.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene ybgE CDS 1395823..1396227 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097533.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene ybgC CDS 1396224..1396916 product Tol-Pal system protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097532.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene tolQ CDS 1396920..1397348 product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene tolR CDS 1397377..1398624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 1398725..1400017 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene tolB CDS 1400052..1400573 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene pal CDS 1400583..1401371 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene cpoB tRNA 1401533..1401608 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 1401636..1401711 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 1401715..1401790 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 1401832..1401907 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 1401939..1402014 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 1402245..1403288 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene nadA CDS 1403311..1404030 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene pnuC CDS complement(1404027..1404965) product CDF family zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene zitB CDS complement(1405065..1405424) product YbgS-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685076.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 1405729..1406781 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097523.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene aroG CDS complement(1406843..1407595) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene gpmA CDS complement(1407861..1408904) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene galM CDS complement(1408898..1410046) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene galK CDS complement(1410049..1411095) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene galT CDS complement(1411105..1412121) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene galE CDS complement(1412323..1413795) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene modF CDS complement(1413863..1414651) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene modE CDS 1414779..1414931 product AcrZ family multidrug efflux pump-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1415110..1415886 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene modA CDS 1415883..1416575 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene modB CDS 1416575..1417633 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene modC CDS complement(1417634..1418452) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097512.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 1418572..1419567 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene pgl CDS complement(1419670..1420953) product putative acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097510.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 1421177..1422400 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene hutI CDS 1422397..1423335 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097508.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene hutG CDS 1423355..1424089 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1424217..1425905 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097506.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene hutU CDS 1425902..1427422 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097505.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene hutH CDS complement(1427525..1428001) product kinase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097504.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1428049..1429338) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene bioA CDS 1429425..1430465 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene bioB CDS 1430462..1431619 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097501.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene bioF CDS 1431603..1432358 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene bioC CDS 1432336..1433052 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097499.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene bioD CDS complement(1433015..1433737) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1434486..1436501 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene uvrB CDS complement(1436580..1437488) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097495.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene yvcK CDS 1437836..1438825 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene moaA CDS 1438850..1439362 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene moaB CDS 1439366..1439851 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene moaC CDS 1439844..1440089 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene moaD CDS 1440091..1440543 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene moaE CDS 1440602..1441309 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428846.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1441436..1442398) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1442398..1443636) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene clsB CDS complement(1443633..1444394) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1444528..1444938 product YbhQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1444900..1446006) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1446064..1447197) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1447187..1448926) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1448919..1449914) product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene hlyD CDS complement(1449911..1450588) product transcriptional regulator CecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene cecR CDS 1450793..1452175 product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene rhlE CDS 1452273..1454450 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097478.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene dinG CDS complement(1454437..1454940) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1454946..1455929) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097476.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1455958..1458408) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(1458528..1459202) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097474.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1459272..1459808) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1460065..1461027 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene ybiB CDS complement(1461144..1461404) product DUF1471 family protein YbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097471.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene ybiJ CDS complement(1461690..1461959) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(1462080..1462343) product DUF1471 family periplasmic protein McbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene mcbA CDS 1462586..1463497 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene rlmF CDS complement(1463543..1465753) product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene ybiO CDS complement(1465872..1466594) product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene glnQ CDS complement(1466591..1467250) product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene glnP CDS complement(1467344..1468087) product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene glnH CDS complement(1468449..1468952) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene dps CDS complement(1469251..1470138) product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene rhtA CDS 1470493..1471011 product outer membrane protein OmpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene ompX CDS complement(1471128..1472711) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1472981..1473109) product manganase accumulation protein MntS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene mntS CDS 1473293..1473766 product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene mntR CDS 1473763..1474872 product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 1474974..1476068 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1476065..1477636 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097454.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1477636..1479159 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149366214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1479262..1480302 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1480464..1481840 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 1481892..1483214 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1483230..1483946 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1483987..1484907) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689864.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene ldtB CDS 1485130..1486725 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1486808..1489171) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1489189..1490490) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 1490777..1491850 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367564.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1491847..1493103) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1493255..1494070) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1494237..1496669) product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1496674..1497573) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1497701..1498363 product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene fsa CDS complement(1498569..1499321) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene moeB CDS complement(1499323..1500555) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene moeA CDS 1500745..1501683 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene iaaA CDS 1501695..1503566 product glutathione ABC transporter ATP-binding protein GsiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene gsiA CDS 1503590..1505128 product glutathione ABC transporter substrate-binding protein GsiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene gsiB CDS 1505134..1506054 product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene gsiC CDS 1506056..1506967 product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gsiD CDS complement(1507030..1508355) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene rimO CDS 1508573..1508956 product biofilm formation regulator BssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097430.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene bssR CDS 1509063..1510181 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1510182..1510808) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1511043..1512257 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene dacC CDS complement(1512344..1513102) product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene deoR CDS complement(1513170..1513778) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene ybjG CDS complement(1513786..1514445) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418992.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1514682..1515914 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097422.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1516395..1517207) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1517197..1518411) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1518494..1519045 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(1519067..1519498) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097418.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene arsC CDS complement(1519511..1520800) product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097417.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1520841..1521188) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1521416..1523188) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1523439..1523750 product inner membrane protein YbjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1523781..1524050) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1524236..1524958 product nitroreductase NfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene nfsA CDS 1525023..1525925 product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene rimK CDS 1525989..1526465 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1526816..1527928 product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene potF CDS 1528072..1529205 product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097371.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene potG CDS 1529215..1530168 product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene potH CDS 1530165..1531010 product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene potI CDS 1531077..1531550 product YbjO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1531591..1532721 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rlmC CDS 1533035..1533742 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1533729..1535195 product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1535274..1536005) product ABC transporter substrate-binding protein ArtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene artJ CDS complement(1536182..1536850) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene artM CDS complement(1536850..1537566) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene artQ CDS complement(1537573..1538304) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene artJ CDS complement(1538323..1539051) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene artP CDS complement(1539278..1539796) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097359.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1539894..1540217 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1540214..1541044 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1541314..1541937 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1541941..1542573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1542573..1544135) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419008.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1544436..1545167 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene gspC CDS 1545181..1547097 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene gspD CDS 1547112..1548590 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene gspE CDS 1548590..1549798 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene gspF CDS 1549802..1550251 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene gspG CDS 1550251..1550736 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene gspH CDS 1550729..1551109 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene gspI CDS 1551106..1551765 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene gspJ CDS 1551762..1552772 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene gspK CDS 1552788..1553921 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097344.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene gspL CDS 1553918..1554403 product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1554400..1555197 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097342.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1555451..1558153 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1558255..1558695 product type III secretion system invasion protein IagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097340.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene iagB CDS 1558830..1560656 product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097339.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1560801..1561850) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1561907..1563343) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1563354..1564355) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097336.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene ltaE CDS complement(1564394..1566112) product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene poxB repeat_region 1566392..1566781 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtgcaggcagcttagaaa CDS complement(1567158..1568126) product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene hcr CDS complement(1568137..1569789) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene hcp CDS complement(1569934..1570833) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1571010..1571801) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene aqpZ CDS 1571997..1573655 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1573652..1574608) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1574768..1575883 product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene macA CDS 1575880..1577820 product macrolide ABC transporter ATP-binding protein/permease MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene macB CDS complement(1577891..1578112) product cold shock-like protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene cspD CDS 1578380..1578700 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174393.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene clpS CDS 1578728..1581007 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene clpA CDS 1581477..1581917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 repeat_region 1582095..1582902 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtgcaggcagcttagaaa CDS 1583166..1584149 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene cas1f CDS 1584146..1587364 product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene cas3f CDS 1587754..1589064 product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene csy1 CDS 1589061..1589996 product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene csy2 CDS 1590010..1591008 product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene csy3 CDS 1591018..1591572 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene cas6f CDS complement(1591595..1592068) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(1592065..1592508) product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 repeat_region 1592748..1594280 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgcactgccgtacaggcagcttagaaa CDS complement(1594460..1594678) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene infA CDS complement(1594963..1595667) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene aat CDS complement(1595713..1597434) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene cydC CDS complement(1597434..1599200) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene cydD CDS complement(1599315..1600283) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene trxB CDS 1600827..1601321 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228469.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene lrp CDS 1601457..1605125 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 1605253..1605867 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097319.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene lolA CDS 1605877..1607220 product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rarA CDS 1607313..1608605 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499983.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene serS CDS 1608818..1611262 product dimethylsulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene dmsA CDS 1611273..1611890 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096798.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene dmsB CDS 1611892..1612755 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097315.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1613030..1614178 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097314.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1614396..1614566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1614563..1614823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1614860..1615600) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097312.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene pflA CDS complement(1615804..1618086) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097311.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene pflB CDS complement(1618138..1618995) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene focA CDS complement(1619401..1621161) product 30S ribosomal protein S12 methylthiotransferase accessory factor YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene ycaO CDS 1621289..1621981 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1622144..1623232 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene serC CDS 1623301..1624584 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene aroA CDS 1624770..1625453 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene cmk CDS 1625565..1627238 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene rpsA CDS 1627409..1627696 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858233.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene ihfB CDS 1628119..1630173 product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 1630210..1631958 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene msbA CDS 1631955..1632932 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097302.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene lpxK CDS 1632976..1634205 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1634251..1634433 product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene ycaR CDS 1634430..1635176 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097299.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene kdsB CDS 1635320..1636213 product YcbJ family phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1636190..1636969) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene elyC CDS 1637090..1637869 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097296.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene cmoM CDS 1637873..1639195 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene mukF CDS 1639176..1639880 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene mukE CDS 1639880..1644328 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572729.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene mukB CDS 1644508..1646331 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097291.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene ldtD CDS 1646507..1647058 product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097290.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1647079..1647726 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1647780..1648970) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1649155..1650213) product porin OmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene ompF CDS complement(1650819..1652219) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene asnS CDS complement(1652388..1653590) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene pncB CDS 1653845..1656457 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene pepN CDS complement(1656558..1657328) product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ssuB CDS complement(1657325..1658116) product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene ssuC CDS complement(1658126..1659271) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene ssuD CDS complement(1659268..1660230) product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1660223..1660798) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene ssuE CDS 1661048..1662058 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene pyrD CDS 1662225..1662767 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene zapC CDS complement(1662764..1663831) product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 1663972..1666080 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097266.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rlmKL CDS 1666093..1668000 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 1668014..1669267 product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene pqiA CDS 1669272..1670912 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097263.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene pqiB CDS 1670909..1671475 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene pqiC CDS complement(1671969..1672487) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097260.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene fabA CDS complement(1672556..1674316) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097259.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1674503..1674955 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene matP CDS complement(1675021..1676073) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883252.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene ompA CDS complement(1676430..1676993) product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097256.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene sulA CDS 1677157..1677783 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097255.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1677740..1679902) product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097254.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene yccS CDS complement(1679921..1680367) product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1680511..1682544 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419044.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene helD CDS complement(1682598..1683056) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene mgsA CDS complement(1683137..1683799) product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1683839..1683988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1683972..1684385 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1684418..1684735) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097248.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene hspQ CDS complement(1684796..1685986) product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene rlmI CDS 1686080..1686361 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene yccX CDS complement(1686358..1686693) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene tusE CDS complement(1686776..1687435) product FtsH protease modulator YccA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene yccA CDS 1687706..1689334 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 tRNA 1689479..1689566 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(1689627..1690388) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1690385..1691416) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419046.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(1691413..1692420) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1692594..1694207 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1694248..1694766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 tRNA 1695021..1695108 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(1695151..1696152) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097209.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1696542..1697045 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(1697047..1697796) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097207.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1697897..1698256 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 1698582..1699823 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene agp CDS complement(1699856..1700083) product YccJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1700102..1700698) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene wrbA CDS 1701090..1701260 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1701377..1702282 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1702348..1702626 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1702633..1703154 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095427.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1703213..1704535) product pyrimidine utilization transport protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene rutG CDS complement(1704557..1705048) product pyrimidine utilization flavin reductase protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene rutF CDS complement(1705061..1705651) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097197.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1705661..1706461) product pyrimidine utilization protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097196.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene rutD CDS complement(1706469..1706855) product pyrimidine utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene rutC CDS complement(1706867..1707556) product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene rutB CDS complement(1707556..1708647) product pyrimidine utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097193.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene rutA CDS 1708893..1709531 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene rutR CDS complement(1709528..1709923) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1710024..1713986) product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene putA CDS 1714409..1715917 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene putP CDS 1716015..1716413 product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1716486..1717670) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1717922..1718755 product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1718796..1719923 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1719927..1721210 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097184.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene efeB CDS 1721711..1722499 product phosphate starvation-inducible protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene phoH tRNA complement(1722729..1722816) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(1722954..1723631) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097181.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1723651..1724511) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097180.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 1724621..1725526 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 tRNA complement(1726179..1726266) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 1726496..1727434 product glyoxylate/hydroxypyruvate reductase GhrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097178.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene ghrA CDS 1727519..1728256 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097177.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1728276..1728830 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097176.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 1728927..1729409 product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072200468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1729453..1730286) product curli production assembly/transport protein CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene csgG CDS complement(1730313..1730729) product curli production assembly/transport protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene csgF CDS complement(1730756..1731145) product curli production assembly/transport protein CsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097172.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene csgE CDS complement(1731150..1731722) product biofilm master transcriptional regulator CsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097171.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene csgD CDS 1732544..1732999 product curli minor subunit CsgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene csgB CDS 1733039..1733494 product curli major subunit CsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene csgA CDS 1733551..1733883 product curli assembly chaperone CsgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene csgC CDS 1734037..1734357 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097167.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 1734438..1734974 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene ymdB CDS complement(1735016..1736155) product glucans biosynthesis protein MdoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene mdoC CDS 1736438..1737964 product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097164.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene mdoG CDS 1737957..1740485 product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene mdoH CDS 1740548..1740775 product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097162.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1740783..1741157) product MysB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1741237..1742472) product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene mdtG CDS complement(1742614..1743540) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1743759..1744808 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1744847..1745425) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1745427..1745993) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419093.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1746384..1747502) product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene solA CDS complement(1747617..1747871) product biofilm formation regulator BssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene bssS CDS complement(1748146..1748391) product DNA damage-inducible protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene dinI CDS complement(1748466..1749512) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097150.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene pyrC CDS complement(1749641..1750201) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1750300..1751508) product multidrug efflux MFS transporter MdtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097148.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene mdtH CDS 1751745..1752329 product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene rimJ CDS 1752339..1752989 product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097145.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1752992..1753915 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1754045..1755580 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene murJ CDS complement(1755640..1756065) product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene flgN CDS complement(1756070..1756363) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene flgM CDS complement(1756457..1757116) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene flgA CDS 1757274..1757690 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene flgB CDS 1757694..1758098 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097138.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene flgC CDS 1758110..1758820 product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene flgD CDS 1758847..1760055 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097136.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene flgE CDS 1760076..1760831 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1760843..1761625 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene flgG CDS 1761683..1762381 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857987.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene flgH CDS 1762394..1763491 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1763492..1764445 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene flgJ CDS 1764521..1766161 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene flgK CDS 1766178..1767131 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene flgL CDS complement(1767222..1768418) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097130.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 1768513..1769466 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1769511..1772627) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene rne CDS 1773198..1774145 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048027428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene rluC CDS complement(1774229..1774771) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1774954..1775475 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097124.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene yceD CDS 1775492..1775665 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857964.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene rpmF CDS 1775678..1776781 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063411321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene plsX CDS 1776788..1777741 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1777757..1778686 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097121.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene fabD CDS 1778699..1779433 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene fabG CDS 1779588..1779824 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene acpP CDS 1779916..1781157 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene fabF CDS 1781279..1782088 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene pabC CDS 1782091..1783113 product cell division protein YceG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097117.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene yceG CDS 1783103..1783744 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097116.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene tmk CDS 1783741..1784745 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene holB CDS 1784756..1785550 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1785848..1787281 product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene ptsG CDS complement(1787423..1789534) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene fhuE CDS 1789966..1790325 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene hinT CDS 1790327..1790701 product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097110.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1790712..1791359 product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene lpoB CDS 1791340..1792164 product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene thiK CDS 1792176..1793201 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene nagZ CDS 1793233..1793775 product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097106.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene ycfP CDS 1794012..1795316 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1795510..1796049 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1796109..1796744) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 1796990..1797247 product multiple stress resistance protein BhsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene bhsA CDS complement(1797325..1798290) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097101.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1798435..1801881) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene mfd CDS complement(1802027..1803100) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1803357..1804556 product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097098.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene lolC CDS 1804549..1805250 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097097.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene lolD CDS 1805250..1806494 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene lolE CDS 1806549..1807460 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene nagK CDS 1807475..1808296 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097094.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene cobB CDS complement(1808331..1809365) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene potD CDS complement(1809362..1810153) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097091.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene potC CDS complement(1810150..1811007) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene potB CDS complement(1810991..1812109) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097089.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene potA CDS 1812377..1813600 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene pepT CDS 1813702..1814193 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419118.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1814282..1815403) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1815495..1816958) product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene phoQ CDS complement(1816959..1817633) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097083.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene phoP CDS 1817600..1817824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1818025..1818417 product anti-adapter protein IraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene iraM CDS complement(1818504..1819874) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene purB CDS complement(1819894..1820523) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene hflD CDS complement(1820551..1821663) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene mnmA CDS complement(1821704..1822177) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1822177..1822689) product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097078.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene rluE CDS 1822957..1824207 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene icd CDS 1824283..1824528 product YmjA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1824533..1826032) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097072.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1826621..1826869 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1827142..1828170) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1828288..1828470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1828483..1828737 product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1828818..1829123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1829124..1829468) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1829620..1830327 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097066.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1830359..1831546) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1831646..1832437 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097064.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1832421..1832867) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1832974..1835010) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1835026..1836357) product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1836624..1836746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1836767..1837267) product YbaK/prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1837487..1837924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1838118..1838381 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1838408..1839238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 note possible pseudo, frameshifted CDS 1839299..1839796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1839846..1842227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1842267..1843055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1843339..1843590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1843709..1844626) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1844623..1844985) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017693214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1845098..1845337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1845337..1845657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1845916..1847199) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1847289..1849223) product protein kinase YeaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene yeaG CDS 1849656..1850402 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1850469..1851353) product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097054.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1851428..1852423) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene gapA CDS 1852765..1853178 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene msrB CDS 1853220..1853492 product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1853543..1854796) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1855017..1855658) product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097049.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene pncA CDS complement(1855668..1856774) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097048.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene ansA CDS complement(1856747..1858603) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene sppA CDS 1858771..1859322 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097046.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 1859439..1860482 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene selD CDS 1860487..1862409 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1862524..1863867) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097043.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene gdhA CDS 1864093..1864365 product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1864328..1864741) product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097041.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1864817..1865389 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1865379..1865996 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1865993..1867300) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097038.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1867374..1867994) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1867994..1869523) product thiamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1869496..1870665) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097035.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1870672..1871277) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1871362..1872168) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097033.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene xthA CDS 1872602..1873822 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097032.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1873819..1874853 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene astA CDS 1874850..1876337 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene astD CDS 1876324..1877649 product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097029.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene astB CDS 1877659..1878624 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene astE CDS 1878961..1879455 product ATP-independent periplasmic protein-refolding chaperone Spy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene spy CDS 1879623..1880180 product environmental stress-induced protein Ves inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097026.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene ves CDS complement(1880158..1881063) product excinuclease Cho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene cho CDS complement(1881152..1881979) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097024.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene nadE CDS 1882211..1882555 product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857836.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene osmE CDS 1882837..1883154 product PTS N,N'-diacetylchitobiose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene chbB CDS 1883235..1884593 product PTS N,N'-diacetylchitobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097022.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene chbC CDS 1884641..1884988 product PTS N,N'-diacetylchitobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene chbA CDS 1885018..1885836 product transcriptional regulator ChbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene chbR CDS 1885946..1887301 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097019.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 1887313..1888062 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene chbG CDS complement(1888190..1890289) product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097017.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene katE CDS 1890628..1890882 product cell division activator CedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097016.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene cedA CDS complement(1890936..1891745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 note possible pseudo, frameshifted CDS complement(1891778..1892293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 note possible pseudo, frameshifted CDS complement(1892375..1893766) product cystine/sulfocysteine:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene tcyP CDS complement(1893894..1894484) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(1894580..1895341) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene kduD CDS complement(1895470..1896141) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene hxpB CDS 1896284..1896820 product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1896857..1897717) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(1897823..1898113) product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene ghoS CDS complement(1898205..1899137) product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene pfkB CDS 1899434..1900192 product YdiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097007.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 1900459..1900692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1901466..1903394 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097005.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene thrS CDS 1903506..1903940 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023616141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene infC CDS 1904038..1904235 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene rpmI CDS 1904286..1904642 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene rplT CDS 1904947..1905930 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene pheS CDS 1905946..1908333 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097002.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene pheT CDS 1908338..1908637 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene ihfA CDS 1908741..1909721 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene btuC CDS 1909755..1910306 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1910306..1911061 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096997.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene btuD CDS 1911134..1911598 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 1911891..1912604 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1912666..1914108 product protein adenylyltransferase SelO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096994.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene selO CDS complement(1914105..1914884) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1914877..1915806) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096986.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(1915869..1916687) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096985.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1916684..1917712) product hematinate-forming heme oxygenase ChuS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096984.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene chuS CDS complement(1917748..1919730) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1919807..1919995) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene hemP CDS complement(1920205..1921251) product 3-deoxy-7-phosphoheptulonate synthase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene aroH CDS complement(1921402..1922235) product posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene ppsR CDS 1922571..1924949 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene ppsA CDS 1925184..1926584 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1926588..1928963 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1929286..1930401) product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene ydiK CDS 1930601..1933657 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1933654..1934064 product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096973.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene menI CDS 1934150..1934344 product YdiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1934391..1935020) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096971.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1935098..1935757) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1936163..1936642 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1936700..1937377 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096968.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1937405..1939948 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 1939950..1940897 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1940909..1941421 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1941463..1942116 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1942166..1944316) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene fdhF CDS 1944397..1944660 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 1944687..1945517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 note possible pseudo, frameshifted CDS complement(1945735..1946013) product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1946368..1946607) product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene ycgZ CDS 1946947..1948167 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 1948356..1949084 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096958.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1949194..1949652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1949652..1950014) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118257.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 1950507..1950875 product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene sufA CDS 1950884..1952374 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene sufB CDS 1952384..1953130 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene sufC CDS 1953105..1954376 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096954.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene sufD CDS 1954373..1955593 product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene sufS CDS 1955608..1956024 product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene sufE CDS 1956386..1957135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1957196..1957432) product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene lpp CDS complement(1957745..1959166) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751448.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene pykF CDS 1959278..1959514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(1959544..1960689) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(1960702..1962198) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 1962472..1963494 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 1963487..1964155 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096946.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 1964179..1964991 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096945.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 1965100..1965309 product fumarate hydratase FumD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene fumD CDS complement(1965290..1965976) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1965960..1966706) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1966706..1967521) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1967523..1968359) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 1969039..1970316 product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096942.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1970374..1970514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 1970640..1971422 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096937.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 1971495..1972130 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096936.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1972159..1973754) product FAD-NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 1974345..1974545 product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene glgS CDS 1974720..1975187 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 tRNA complement(1975366..1975442) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(1975447..1975523) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(1975677..1977050) product MdtK family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096934.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene mdtK CDS 1977276..1977917 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1977948..1979096) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene cfa CDS complement(1979395..1980594) product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene punC CDS 1980708..1981619 product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene punR CDS complement(1981637..1982662) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene purR CDS 1983211..1984377 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1984415..1984996) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene sodB CDS complement(1985119..1985853) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096925.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1986216..1986563 product monothiol glutaredoxin 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003832760.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene grxD CDS complement(1986642..1987301) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096924.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene rnt CDS complement(1987398..1987805) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene gloA CDS complement(1987905..1989002) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1989056..1989655) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1989697..1991481) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096920.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene eptA CDS 1991557..1991709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 1991758..1992654 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1992736..1993254 product superoxide dismutase [Cu-Zn] SodC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096917.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene sodC CDS complement(1993233..1995269) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096916.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1995266..1996135) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(1996129..1996365) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 1996559..1996993 product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene slyA CDS complement(1997029..1998357) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143830281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1998586..1999053) product outer membrane lipoprotein SlyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096912.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene slyB CDS 1999309..2000433 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene anmK CDS 2000527..2000850 product C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096910.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene mliC CDS 2000908..2001564 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096909.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene pdxH CDS 2001690..2002964 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831636.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene tyrS CDS 2003031..2003891 product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096907.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene pdxY CDS complement(2003981..2004586) product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene gstA CDS complement(2004692..2006200) product dipeptide/tripeptide permease DtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene dtpA CDS 2006458..2006646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2006814..2007449) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene nth CDS complement(2007446..2008132) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(2008135..2008755) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene rsxG CDS complement(2008766..2009818) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene rsxD CDS complement(2009819..2011840) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene rsxC CDS complement(2011833..2012411) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene rsxB CDS complement(2012411..2012992) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096898.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene rsxA CDS complement(2013069..2013509) product DUF2569 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2013595..2013810) product transcription modulator YdgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene ydgT CDS complement(2014040..2014201) product division septum protein Blr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168112406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene blr CDS 2014405..2015445 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(2015502..2016500) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene add CDS complement(2016597..2017769) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2017819..2019216) product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705244.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene malX CDS complement(2020583..2020831) product excisionase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215632.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2020948..2021199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2021209..2021448) product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2021426..2021998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2021995..2022213) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2022332..2023306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2023303..2023899) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337905.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2023889..2024530) product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2024527..2024679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2024676..2025104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705914.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2025113..2025595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2025592..2026506) product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459721.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2026516..2026797) product host nuclease inhibitor GamL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene gamL CDS complement(2026876..2027082) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090135989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(2027079..2027237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2027234..2027590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095951.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2027734..2027964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2028010..2028198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2028638..2028835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2028968..2029207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(2029209..2029688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2029698..2030111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2030224..2030934) product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2031038..2031226 product Cro/CI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098070.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2031313..2031597 product lambda phage CII family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 2031778..2032857 product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2032854..2034227 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095958.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2034217..2034531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 2034528..2035118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 2035115..2035453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2035456..2035632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 2035643..2036653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2036657..2037238 product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 2037238..2037477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2037729..2038178 product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095966.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2038171..2038341 product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 2038338..2038805 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2038802..2039440 product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 2039437..2039634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2039613..2039747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2039747..2040511 product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098059.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2040809..2041090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2041457..2041858 product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816186.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2041855..2042130 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2042134..2042574 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2042571..2042957 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705888.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2043254..2043772 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050716666.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2043928..2044146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095974.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2044121..2044300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2044312..2044962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 2044959..2046530 product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2046535..2047938 product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019209140.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 2047940..2049046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816475.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2049050..2049259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 2049367..2050119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2050136..2051272 product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2051312..2051569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2051572..2052054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2052056..2052409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211716.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2052412..2053011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2053181..2053447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2053494..2054426 product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816468.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2054570..2055361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2055426..2055764 product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2055782..2056069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2056069..2059143 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2059194..2059586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2059779..2060147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2060261..2060434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2060508..2061137 product P22AR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211451.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2061206..2061955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2062010..2062360 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816464.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 2062360..2063130 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2063143..2063874 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2063862..2064455 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2064511..2068374 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096345.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2068417..2068731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 2068732..2069403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2069490..2069744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2069803..2071077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2071160..2071399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096002.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 2071399..2071722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2071905..2073710 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene lepA CDS 2073726..2074700 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene lepB CDS 2074990..2075604 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene rnc CDS 2075601..2076506 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene era CDS 2076524..2077231 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098316.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene recO CDS 2077307..2078038 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098315.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene pdxJ CDS 2078038..2078418 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098314.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene acpS CDS complement(2078415..2078675) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2078732..2079580) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 2079699..2080595 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene murQ CDS 2080605..2081969 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 2081973..2082608 product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098310.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene yfhb CDS 2082666..2083172 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene tadA CDS complement(2083060..2084610) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene mltF CDS 2084878..2088765 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098307.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene purL CDS 2089343..2090731 product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420402.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene qseE CDS 2090728..2091480 product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098305.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene qseG CDS 2091477..2092814 product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene glrR CDS 2092895..2093233 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene glnB CDS complement(2093310..2094500) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098303.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene hmpA CDS 2094805..2096058 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098302.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2096112..2096534) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098301.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2096707..2097846 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098300.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2097847..2099124) product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098299.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene csiE CDS 2099250..2099888 product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098298.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 2099879..2100859 product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2100921..2101724) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 gene suhB CDS 2101857..2102582 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098295.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene trmJ CDS 2102819..2103310 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098294.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene iscR CDS 2103430..2104644 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene iscS CDS 2104669..2105055 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860661.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene iscU CDS 2105069..2105392 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860659.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene iscA CDS 2105469..2105984 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098293.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene hscB CDS 2105999..2107849 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene hscA CDS 2107851..2108186 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene fdx CDS 2108188..2108388 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene iscX CDS 2108442..2109728 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene pepB CDS 2109870..2110646 product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098290.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene sseB CDS complement(2110664..2111434) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098289.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(2111434..2112279) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene sseA CDS complement(2112369..2113736) product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2113749..2115293) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2115580..2120532 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2120534..2122861 product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098284.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene pbpC CDS 2122950..2125328 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2125325..2125954 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098282.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene dmsB CDS 2125947..2126726 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(2126903..2127427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2127726..2128157 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860625.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene ndk CDS 2128305..2129471 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2129541..2129789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2129763..2130773 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene rodZ CDS 2130800..2131918 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098277.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene ispG CDS 2132000..2133274 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene hisS CDS 2133288..2133908 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098275.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2133919..2135097 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098274.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene bamB CDS 2135210..2136682 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene der CDS 2136981..2138522 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2138581..2138802 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098270.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2138799..2139149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2139149..2140168) product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(2140227..2141522) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene xseA CDS 2141760..2143226 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene guaB CDS 2143294..2144871 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098264.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene guaA CDS complement(2144974..2145351) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2145665..2146840 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 2146864..2150016 product multidrug efflux RND transporter permease subunit OqxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene oqxB CDS complement(2150082..2150561) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2150729..2152117) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(2152117..2152794) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096743.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2153064..2153834 product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096744.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(2154223..2154411) product YfgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528036.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2154762..2157002 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2157007..2158545) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832869.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene ppx CDS complement(2158549..2160609) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene ppk1 CDS complement(2160609..2160854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2160838..2161479) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene purN CDS complement(2161476..2162513) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene purM CDS 2162780..2164210 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2164427..2165053 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene upp CDS 2165136..2166425 product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098238.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene uraA CDS 2166630..2167223 product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247065.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(2167354..2168772) product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2168772..2169728) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(2169732..2171051) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene celB CDS 2171199..2172023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2172020..2172376) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene arsC CDS complement(2172390..2173853) product beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098231.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene bepA CDS 2174074..2175138 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2175278..2175748) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene bcp CDS complement(2175748..2176317) product glycine cleavage system transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098228.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 2176463..2177341 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098227.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene dapA CDS 2177358..2178392 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene bamC CDS 2178502..2179215 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501631.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2179336..2180205 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2180205..2182151 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2182225..2182920 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098223.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene ypfH CDS complement(2183018..2183215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(2183240..2184367) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098221.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene dapE CDS complement(2184371..2184727) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098220.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2185284..2188397) product multidrug efflux RND transporter permease AcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098219.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene acrD CDS complement(2188539..2190182) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene narQ CDS complement(2190230..2190502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 2190386..2192362 product formate-dependent uric acid utilization protein AegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene aegA CDS 2192430..2193023 product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098216.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene nudK CDS 2193226..2194173 product DUF1176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2194267..2196255) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene tkt CDS complement(2196275..2197225) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene tal CDS 2197512..2199791 product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene maeB CDS complement(2199871..2200770) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098211.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene hemF CDS complement(2200770..2201645) product N-acetylmuramoyl-L-alanine amidase AmiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098210.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene amiA CDS 2201858..2202283 product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098209.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2202270..2202719 product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2202783..2203358 product RpoE-regulated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098207.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2203451..2204350 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 2204512..2205525 product thiosulfate/sulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098205.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene cysP CDS 2205525..2206358 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene cysT CDS 2206358..2207233 product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene cysW CDS 2207223..2208317 product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene cysA CDS 2208436..2209347 product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene cysM CDS 2209353..2210189 product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene pdxK CDS complement(2210234..2210743) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene crr CDS complement(2210784..2212511) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene ptsI CDS complement(2212557..2212814) product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene ptsH CDS complement(2213132..2214103) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene cysK CDS complement(2214267..2215028) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene cysZ CDS 2215016..2215207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(2215315..2215509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2215508..2215846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2215852..2216253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2216322..2218337 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene ligA CDS 2218339..2218554 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861328.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2218551..2219546) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098194.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2219636..2220577 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098193.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2220568..2220909) product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098192.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 tRNA complement(2221047..2221122) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(2221127..2221202) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(2221232..2221307) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(2221349..2221424) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 2221683..2223098 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene gltX CDS complement(2223151..2223516) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098190.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2223539..2223901) product putative DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098189.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 tRNA 2224119..2224194 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 2224236..2224311 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 2224559..2226712 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(2226759..2227946) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 2228355..2229530 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2229564..2229911) product DUF2502 domain-containing protein YpeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene ypeC CDS complement(2230038..2231036) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene mgrA CDS 2231223..2232881 product indolepyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene ipdC CDS complement(2232882..2234117) product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098182.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2234323..2235288 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098181.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene glk CDS complement(2235324..2236055) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2236069..2237748) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098179.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2238044..2239048) product IS110-like element IS4321 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2239480..2240715 product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098178.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene alaC CDS complement(2241205..2242122) product kdo(2)-lipid IV(A) palmitoleoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene lpxP CDS 2242394..2243773 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098174.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 tRNA complement(2243786..2243858) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(2243934..2244863) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2245178..2245930 product phospholipid-binding lipoprotein MlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene mlaA CDS complement(2245975..2247264) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene fadL CDS 2247631..2247915 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2248144..2249454 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene fadI CDS 2249454..2251601 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene fadJ CDS 2251811..2252296 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832802.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene sixA CDS complement(2252343..2252894) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene smrB CDS 2253040..2253972 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene prmB CDS 2254033..2255118 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098151.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 gene aroC CDS 2255121..2255945 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098150.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene mepA CDS 2255945..2256754 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2256754..2257299 product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2257313..2257588 product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2257650..2259647) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098146.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene mnmC CDS 2259806..2261023 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098145.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene fabB CDS 2261092..2262270 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098144.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2262358..2263362) product flagella biosynthesis regulator Flk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene flk CDS 2263474..2264610 product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098142.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene pdxB CDS 2264678..2265691 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 2265691..2266503 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene truA CDS 2266532..2267191 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2267346..2268251 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene accD CDS 2268322..2269590 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene folC CDS 2269580..2270266 product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene dedD CDS 2270521..2271009 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene cvpA CDS 2271043..2272560 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene purF CDS 2272650..2273219 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 2273510..2274292 product lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098132.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene argT CDS 2274401..2274616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2274519..2275301 product histidine ABC transporter substrate-binding protein HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502592.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene hisJ CDS 2275390..2276076 product histidine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2276073..2276786 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2276793..2277569 product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020690627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene hisP CDS complement(2277473..2277709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2277710..2278210) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2278255..2279148) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098128.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2279162..2279530) product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene folX CDS complement(2279606..2280235) product GSH-dependent disulfide bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene yfcG CDS 2280376..2281020 product glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene yfcF CDS 2281077..2281628 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene yfcE CDS 2281684..2282250 product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098123.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene yfcD CDS complement(2282254..2283273) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098122.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 2283510..2283953 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 2284033..2284305 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098120.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 2284321..2285718 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 2285715..2286545 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 2286538..2287491 product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2287606..2289747) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098116.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene pta CDS complement(2289823..2291025) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098115.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene ackA CDS 2291363..2291818 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098114.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene yfbV CDS 2291911..2292405 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 2292417..2293076 product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 2293152..2294984 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2295065..2295664) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098110.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene yfbR CDS complement(2295782..2296996) product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098109.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene alaA CDS 2297954..2298868 product transcriptional regulator LrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881734.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 gene lrhA CDS 2299500..2299940 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014171000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene nuoA CDS 2299956..2300630 product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene nuoB CDS 2300720..2302522 product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene nuoC CDS 2302525..2303025 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861486.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene nuoE CDS 2303022..2304359 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861487.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene nuoF CDS 2304414..2307137 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098105.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene nuoG CDS 2307134..2308111 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene nuoH CDS 2308126..2308668 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861491.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene nuoI CDS 2308679..2309233 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500212.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene nuoJ CDS 2309230..2309532 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene nuoK CDS 2309529..2311370 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene nuoL CDS 2311447..2312976 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098102.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene nuoM CDS 2312983..2314440 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098101.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene nuoN CDS complement(2314546..2315550) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2315615..2316532) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098099.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene rnz CDS 2316604..2317065 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420256.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 2317119..2317424 product stress response protein ElaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028061.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene elaB CDS 2317511..2318806 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098096.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene menF CDS 2318895..2320565 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098095.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene menD CDS 2320562..2321338 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene menH CDS 2321335..2322192 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene menB CDS 2322192..2323157 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene menC CDS 2323154..2324515 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene menE CDS complement(2324516..2326030) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(2326042..2326473) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098089.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2326485..2327465) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098088.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 2327618..2328292 product transcriptional regulator TctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098025.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene tctD CDS 2328279..2329688 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098024.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 2329836..2330360 product YfaZ family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 2330455..2331654 product nicotinamide mononucleotide deamidase-related protein YfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098022.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2331686..2332876) product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene glpC CDS complement(2332873..2334090) product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene glpB CDS complement(2334080..2335708) product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098019.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene glpA CDS 2335959..2337311 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098018.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene glpT CDS 2337323..2338384 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene glpQ CDS complement(2338468..2338722) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene yfaE CDS complement(2338722..2339852) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098012.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene nrdB CDS complement(2339953..2342238) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene nrdA CDS complement(2342587..2343315) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene ubiG CDS 2343462..2346098 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene gyrA CDS 2346234..2349080 product two-component system sensor histidine kinase RcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098008.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rcsC CDS complement(2349165..2349815) product response regulator transcription factor RcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene rcsB CDS complement(2349832..2352504) product phosphotransferase RcsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene rcsD CDS 2353249..2354340 product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 2354454..2355509 product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098005.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene apbE CDS 2355579..2356640 product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098004.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene ada CDS 2356640..2357290 product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098003.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene alkB CDS 2357421..2359010 product multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 2359151..2360587 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098001.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene mgtE CDS complement(2360550..2361947) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 2362042..2363682 product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene mqo CDS complement(2364251..2364751) product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420230.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene eco CDS 2364960..2365220 product DUF2534 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097997.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 tRNA complement(2365287..2365363) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(2365437..2367197) product LPS biosynthesis-modulating metalloenzyme YejM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097996.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene yejM CDS complement(2367217..2367444) product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135586.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2367579..2368586 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097995.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene yejK CDS complement(2368638..2368922) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene rplY CDS complement(2369048..2370808) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2370960..2371667 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene rsuA CDS 2371683..2372882 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097989.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 2373159..2373503 product YejG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2373507..2375096) product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097987.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene yejF CDS complement(2375098..2376123) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097986.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2376123..2377217) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2377227..2379056) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097984.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2379108..2380661) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097983.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2380789..2381253) product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023619753.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene mepS CDS complement(2381774..2382487) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136374357.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2382521..2383507) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2383631..2385097) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2385303..2386493 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097978.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene uxuA CDS complement(2386610..2387182) product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene yeiP CDS 2387347..2387601 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365691.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2387598..2388779) product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097970.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene setB CDS 2389138..2390268 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097968.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene fruB CDS 2390268..2391206 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500936.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene fruK CDS 2391223..2392908 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene fruA CDS complement(2392984..2393841) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene nfo CDS complement(2393906..2394952) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2395050..2395916 product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097962.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene yieE CDS 2396156..2397556 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097961.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(2397611..2399596) product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2399866..2400693) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene fghA CDS 2400831..2401979 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097958.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2402082..2402750 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene folE CDS 2402769..2403926 product DUF418 domain-containing protein YeiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene yeiB CDS 2404082..2405104 product HTH-type transcriptional regulator GalS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene galS CDS 2405400..2406398 product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene mglB CDS 2406478..2407998 product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883073.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene mglA CDS 2408014..2409024 product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097952.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene mglC CDS complement(2409063..2409500) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032472658.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2409497..2410846) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2410981..2411691) product outer membrane permeability protein SanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097950.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene sanA CDS complement(2411819..2412703) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene cdd CDS complement(2412832..2413527) product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(2413524..2413919) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2414088..2415023 product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097946.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene dusC CDS 2415402..2416775 product multidrug resistance outer membrane protein MdtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097945.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene mdtQ CDS 2416826..2417590 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2417635..2418207) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097943.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 2418365..2418952 product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2419120..2420043 product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097940.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene pbpG CDS complement(2420140..2420694) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097939.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2420797..2422554) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene dld CDS 2422744..2425041 product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097937.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene bglX CDS 2425178..2426095 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2426108..2427265 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097935.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2427258..2428208 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097934.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2428192..2428929 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2429087..2429827) product HTH-type transcriptional regulator MlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420186.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene mlrA CDS 2430046..2431731 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097931.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2431725..2432444 product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene btsR CDS 2432491..2432967 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(2433072..2435114) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097928.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene metG CDS 2435243..2436352 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene apbC CDS complement(2436442..2436921) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017899343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(2436872..2437204) product RcnB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097925.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2437790..2438824 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420177.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 2438824..2439273 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2439273..2441471 product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097922.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene etk CDS complement(2441516..2442982) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2443001..2444374) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2444692..2445132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2445318..2446418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2447158..2447928 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene thiM CDS 2447925..2448725 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097912.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene thiD CDS 2448768..2449514 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2449488..2450441) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097910.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2450438..2451442) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097909.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2451439..2452716) product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 2452965..2454017 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene fbaB CDS complement(2454075..2454974) product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097907.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene yegS CDS complement(2455223..2456584) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene yegQ CDS complement(2456736..2457167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(2457824..2458546) product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097904.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene baeR CDS complement(2458543..2459946) product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene baeS CDS complement(2459943..2461358) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2461359..2464436) product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097901.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene mdtC CDS complement(2464437..2467559) product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(2467559..2468761) product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2468978..2470330) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097890.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene yegD CDS 2470461..2471333 product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097889.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene alkA CDS complement(2471298..2474627) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420943.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 2474970..2475611 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500855.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene udk CDS 2475703..2476284 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene dcd CDS 2476308..2478158 product outer membrane assembly protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene asmA CDS complement(2478271..2479854) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 2480641..2481684 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 2481691..2482134 product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene wzb CDS 2482137..2484299 product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 gene wzc CDS 2484347..2485252 product colanic acid biosynthesis glycosyltransferase WcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097880.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene wcaA CDS 2485252..2485743 product colanic acid biosynthesis acetyltransferase WcaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene wcaB CDS 2485740..2486957 product colanic acid biosynthesis glycosyltransferase WcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097878.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene wcaC CDS 2486932..2488152 product colanic acid polymerase WcaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097877.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene wcaD CDS 2488169..2488915 product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene wcaE CDS 2488932..2489486 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene wcaF CDS 2489508..2490629 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene gmd CDS 2490632..2491597 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097874.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2491600..2492079 product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 2492076..2493299 product colanic acid biosynthesis fucosyltransferase WcaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097872.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene wcaI CDS 2493303..2494739 product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene cpsB CDS 2494849..2496219 product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene cpsG CDS 2496320..2497660 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097870.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene wcaJ CDS 2497662..2499140 product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene wzxC CDS 2499156..2500436 product colanic acid biosynthesis pyruvyl transferase WcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene wcaK CDS 2500433..2501653 product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene wcaL CDS 2501666..2503063 product colanic acid biosynthesis protein WcaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097866.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene wcaM CDS 2503246..2504241 product N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans,octacis-undecaprenol 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999466.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2504457..2505353 product GalU regulator GalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene galF CDS 2505638..2506735 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 2506732..2507520 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 2507517..2508401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 2508391..2509626 product O83 family O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245921.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene wzy CDS 2509598..2510179 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787337.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 2510176..2511339 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 2511887..2512549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2512568..2513581 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene galE CDS 2513708..2515114 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043519.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene gndA CDS complement(2515213..2515458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 2515396..2516289 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097852.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene rfbB CDS 2516290..2517171 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene rfbA CDS 2517411..2518577 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene ugd CDS complement(2518627..2519631) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 2519824..2520804 product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097848.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene wzzB CDS complement(2520843..2521454) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene hisIE CDS complement(2521448..2522224) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097847.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene hisF CDS complement(2522206..2522943) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097846.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene hisA CDS complement(2522943..2523533) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene hisH CDS complement(2523533..2524600) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene hisB CDS complement(2524597..2525658) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097844.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene hisC CDS complement(2525655..2526959) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097843.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene hisD CDS complement(2526965..2527864) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886595.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene hisG CDS 2528232..2529056 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097842.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 2529098..2530027 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 2530299..2531657 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2531779..2533203) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645258.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene sbcB CDS 2533413..2534579 product serine-type D-Ala-D-Ala carboxypeptidase DacD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097838.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene dacD CDS 2534744..2535964 product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 2536022..2536495 product DNA gyrase inhibitor SbmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097837.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene sbmC CDS 2536557..2537645 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097836.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 2537793..2538128 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432067.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 tRNA complement(2538276..2538351) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 2538578..2539996 product multidrug efflux MATE transporter EmmdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120727113.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene emmdR tRNA 2540100..2540175 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 2540208..2540378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(2540307..2541761) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2541838..2543154) product shikimate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene shiA CDS 2543411..2543986 product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene pagP CDS complement(2543983..2544948) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816843.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2544945..2547995) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815495.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(2547995..2549080) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209199.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2549137..2549319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2549340..2549489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 2549554..2549985 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 2550033..2552726 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2552789..2553712 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097830.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene ldtA tRNA complement(2553805..2553880) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 2554201..2555118 product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene nac CDS 2555215..2556165 product HTH-type transcriptional regulator Cbl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097829.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene cbl CDS 2556356..2556709 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 2556714..2557016 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 tRNA complement(2557062..2557137) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(2557305..2559494) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2559521..2560846) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2560843..2562585) product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097824.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2562582..2563529) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097823.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2563529..2565271) product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097822.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2565410..2566609 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420064.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(2566613..2567410) product DgsA anti-repressor MtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029881844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene mtfA CDS 2567677..2568579 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097764.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(2568551..2569339) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097763.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(2569346..2570647) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(2570908..2572203) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097761.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2572311..2573204 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058660535.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(2573193..2574842) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene fumA CDS complement(2574895..2576331) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097758.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 2577012..2579792 product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097757.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 2579851..2580813 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(2580794..2581513) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene dcuR CDS complement(2581510..2583126) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097754.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 2583280..2584143 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097753.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2584198..2585361) product porin OmpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene ompC CDS 2585646..2586347 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097750.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 2586409..2587824 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097749.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 2587805..2588215 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097748.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 note possible pseudo, internal stop codon CDS complement(2588268..2589182) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene yedA CDS 2589385..2590272 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 2590350..2590532 product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097745.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 2590590..2592317 product cellulose biosynthesis regulator diguanylate cyclase DgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097744.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene dgcQ CDS complement(2592302..2593102) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097743.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2593398..2593625) product YodD family peroxide/acid resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene yodD CDS 2593754..2593942 product protein DsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097741.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene dsrB CDS complement(2594042..2594665) product transcriptional regulator RcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097740.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene rcsA CDS complement(2594963..2595748) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097739.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene fliR CDS complement(2595755..2596024) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene fliQ CDS complement(2596035..2596772) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097738.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene fliP CDS complement(2596772..2597146) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 gene fliO CDS complement(2597149..2597562) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500318.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene fliN CDS complement(2597559..2598563) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097736.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene fliM CDS complement(2598568..2599038) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832480.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene fliL CDS complement(2599145..2600356) product flagellar hook length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene fliK CDS complement(2600353..2600796) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097733.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene fliJ CDS complement(2600818..2602188) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene fliI CDS complement(2602188..2602895) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097731.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 gene fliH CDS complement(2602888..2603886) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500327.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene fliG CDS complement(2603879..2605561) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097730.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene fliF CDS 2605790..2606104 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097729.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene fliE CDS 2606177..2606593 product lipoprotein YedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096004.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 gene yedD CDS complement(2606696..2608183) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene amyA CDS complement(2608282..2608653) product flagella biosynthesis regulatory protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057842.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene fliT CDS complement(2608653..2609063) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene fliS CDS complement(2609094..2610506) product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene fliD CDS 2610776..2611993 product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 2612187..2612876 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096018.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 2612931..2613482 product flagella biosynthesis regulatory protein FliZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene fliZ CDS 2613569..2614369 product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene tcyJ CDS 2614473..2615459 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096021.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene dcyD CDS 2615481..2616149 product cystine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096022.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene tcyL CDS 2616146..2616898 product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene yecC CDS complement(2617113..2617301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 2617323..2617844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(2617909..2618133) product DUF2594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096025.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 2618598..2619254 product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene uvrY CDS 2619251..2621083 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene uvrC CDS 2621140..2621688 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096028.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene pgsA tRNA 2621852..2621927 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 2621979..2622052 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 2622064..2622150 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 2622401..2623327 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096731.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2623333..2623803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096730.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(2623964..2624680) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096030.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(2624677..2625552) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096031.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(2625549..2626823) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096032.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene livM CDS complement(2626835..2627749) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096033.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(2627818..2628939) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096034.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 2629351..2630019 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096035.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(2630048..2631190) product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene tyrP CDS 2631451..2631687 product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377238.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(2631724..2632221) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene ftnA CDS complement(2632422..2632760) product YecR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene yecR CDS 2633006..2633644 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(2633687..2635105) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705969.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 2635511..2635762 product DUF2766 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096041.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(2635843..2637186) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(2637675..2638178) product non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 2638683..2639240 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754799.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 2639536..2640546 product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene araF CDS 2640618..2642132 product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096045.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene araG CDS 2642147..2643127 product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096046.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene araH CDS 2643281..2644084 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096047.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene otsB CDS 2644059..2645483 product alpha,alpha-trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096048.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene otsA CDS complement(2645499..2645927) product universal stress protein UspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419943.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene uspC CDS 2646715..2647074 product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096050.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene flhD CDS 2647077..2647655 product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096051.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene flhC CDS 2647779..2648666 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene motA CDS 2648663..2649592 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096052.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene motB CDS 2649603..2651606 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene cheA CDS 2651626..2652129 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096054.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene cheW CDS complement(2652227..2653486) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096055.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 2653914..2654486 product spore coat protein U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 2654494..2655042 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027938.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 2655059..2655820 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 2655796..2658180 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 2658177..2659139 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096060.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 2659225..2660892 product methyl-accepting chemotaxis protein II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene tar CDS 2660937..2662538 product methyl-accepting chemotaxis protein IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene tap CDS 2662558..2663424 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene cheR CDS 2663421..2664470 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 2664488..2664877 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene cheY CDS 2664882..2665532 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene cheZ CDS complement(2665573..2666325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(2666288..2666551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(2666582..2667412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 note possible pseudo, frameshifted CDS complement(2667439..2667702) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(2667771..2668961) product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003513.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene dgt CDS 2669198..2670346 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096066.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene flhB CDS 2670339..2672417 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene flhA CDS 2672417..2672809 product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096068.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 2673071..2674654 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 2674656..2675798 product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(2675833..2677566) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene argS CDS 2677805..2678365 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 2678444..2679187 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene cutC CDS complement(2679362..2680333) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096075.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene cmoB CDS complement(2680330..2681073) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene cmoA CDS complement(2681114..2681509) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2681561..2682379) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096078.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(2682376..2682942) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096079.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2683206..2684978 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096080.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene aspS CDS 2684980..2685423 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620451.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene nudB CDS 2685451..2686191 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365987.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 2686226..2686747 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096083.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene ruvC CDS 2686828..2687442 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096085.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene ruvA CDS 2687451..2688461 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene ruvB CDS complement(2688521..2689306) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096087.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene znuB CDS complement(2689303..2690058) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832401.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene znuC CDS 2690019..2691080 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096089.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene znuA CDS 2691096..2692415 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene mepM CDS 2692533..2693504 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419920.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene lpxM CDS complement(2693548..2694990) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene pyk CDS complement(2695105..2695974) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 2696331..2697806 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene zwf CDS 2698040..2699851 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene edd CDS 2699891..2700532 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2700607..2701785) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419918.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene purT CDS 2701957..2702607 product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096098.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 2702683..2704758 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene ptrB CDS complement(2704740..2705402) product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096100.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene exoX CDS complement(2705427..2706077) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2706189..2706419) product DNA polymerase III subunit theta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096102.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2706548..2706928 product CopC domain-containing protein YobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096103.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene yobA CDS 2706930..2707799 product copper homeostasis membrane protein CopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096104.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene copD CDS 2707816..2708154 product YebY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096105.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(2708279..2708476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(2708522..2709502) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096111.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 2709670..2710314 product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096112.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene pphA CDS complement(2710349..2710588) product YebV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(2710695..2712137) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096114.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene rsmF CDS complement(2712215..2714848) product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419908.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(2714817..2715875) product membrane integrity lipid transport subunit YebS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 gene yebS CDS 2716233..2716730 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096117.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 2716827..2717513 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096118.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene proQ CDS 2717533..2719581 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096119.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene prc CDS 2719775..2720656 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096120.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene htpX CDS complement(2720708..2722081) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096121.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2722260..2723051 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096122.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene kdgR CDS complement(2723115..2723354) product YobH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096123.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 2723733..2724020 product YebO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 2724847..2725056 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene cspE CDS 2725426..2727018 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096128.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene ftsI CDS 2727058..2727873 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene rlmA CDS complement(2727870..2728472) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene mntP CDS complement(2728836..2729294) product DUF986 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(2729349..2730200) product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175979.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(2730213..2731013) product PTS mannose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859914.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene manY CDS complement(2731061..2732029) product PTS mannose transporter subunit IIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096132.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene manX CDS 2732492..2734051 product CNNM family cation transport protein YoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096133.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene yoaE CDS complement(2734058..2735656) product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096134.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2735786..2737150) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419892.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene sdaA CDS complement(2737335..2737913) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096136.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(2737910..2739244) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096137.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene pabB CDS 2739306..2739488 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500497.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(2739494..2739838) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096138.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 2739972..2741882 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096139.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 2741949..2742644 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096140.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene tsaB CDS 2742682..2743263 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 2743467..2745152 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene fadD CDS 2745197..2746351 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 gene rnd CDS complement(2746438..2746704) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene minE CDS complement(2746708..2747520) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096144.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 gene minD CDS complement(2747543..2748250) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096145.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene minC CDS 2748374..2748649 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096146.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 2748697..2749356 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 2749451..2749891 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832353.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(2749991..2750470) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028084.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene dsbB CDS complement(2750568..2752106) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020690847.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene nhaB CDS 2752308..2753027 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096152.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene fadR CDS complement(2753137..2754669) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096153.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 2754991..2756289 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096155.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 2756299..2757369 product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096156.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene dadX CDS complement(2757466..2759199) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096157.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2759297..2760211) product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096158.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene ldcA CDS 2760427..2760930 product membrane-bound lytic murein transglycosylase EmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096159.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene emtA CDS complement(2760968..2761699) product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2761860..2763962 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419884.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(2764053..2765735) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096163.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(2765896..2766852) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096166.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 2767058..2768155 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096167.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(2768197..2769207) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096168.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene gap CDS complement(2769286..2770266) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096169.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 2771114..2771608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 2771632..2772135 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 gene tssJ CDS 2772164..2773507 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096176.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene tssK CDS 2773525..2774763 product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096177.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 2774766..2778386 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096178.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene tssM CDS 2778403..2779119 product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096179.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene tagF CDS 2779131..2780147 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096180.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene tssA CDS 2780223..2780747 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502644.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene tssB CDS 2780751..2782250 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096181.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene tssC CDS 2782316..2782822 product type VI secretion system amidase effector protein Tae4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268807.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 2782819..2783244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 2783425..2783907 product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502640.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 2783984..2784973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034790757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 2784967..2785383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 2785474..2787249 product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096184.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene tagH CDS 2787246..2788043 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 2788060..2789046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 2789056..2789868 product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096187.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 2789861..2790424 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene tssE CDS 2790427..2792298 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420938.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene tssF CDS 2792295..2793338 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096190.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene tssG CDS 2793377..2795992 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096191.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene tssH CDS 2796017..2797450 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096192.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 2797471..2798274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 2798782..2801343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 2801343..2802041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 2802123..2802563 product DcrB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131636999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 2802567..2806937 product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 2806949..2807431 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096214.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 2807737..2808072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 2808434..2808784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 note possible pseudo, internal stop codon CDS 2808818..2809471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 note possible pseudo, internal stop codon CDS 2809428..2810216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 2810457..2810705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(2810765..2811859) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169097.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene ychF CDS complement(2811986..2812570) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 gene pth CDS 2812845..2813120 product stress-induced protein YchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096227.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene ychH CDS 2813241..2814299 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096228.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(2814285..2815964) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096229.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene dauA CDS complement(2816090..2817037) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 gene prs CDS complement(2817163..2818032) product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096230.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 gene ispE CDS complement(2818029..2818640) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096231.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene lolB CDS 2818842..2820098 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 gene hemA CDS 2820140..2821222 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096233.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 gene prfA CDS 2821222..2822052 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096234.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 gene prmC CDS 2822049..2822441 product invasion regulator SirB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096235.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene sirB2 CDS 2822445..2823254 product invasion regulator SirB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene sirB1 CDS 2823291..2824145 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096237.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 gene kdsA CDS complement(2824261..2825361) product sodium-potassium/proton antiporter ChaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096238.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene chaA CDS 2825630..2825860 product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene chaB CDS 2826038..2826733 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(2826764..2827003) product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(2827198..2828982) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(2829089..2829442) product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096245.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 2829516..2830688 product nitrate regulatory protein NasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096246.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 gene nasR CDS 2830956..2832164 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 2832167..2833045 product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene ntrB CDS 2833055..2833843 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 2833856..2837842 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096251.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene nirB CDS 2837839..2840316 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096252.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 2840584..2841906 product YchO/YchP family invasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419841.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(2841908..2842558) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene narL CDS complement(2842551..2844347) product nitrate/nitrite two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene narX CDS 2844813..2846054 product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 2846436..2850179 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096256.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 2850176..2851711 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene narH CDS 2851708..2852418 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene narJ CDS 2852418..2853095 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene narI tRNA complement(2853321..2853405) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA complement(2853440..2853524) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 CDS complement(2853682..2854524) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096262.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene purU CDS complement(2854566..2855030) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883447.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 2855144..2856046 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene rssA CDS 2856136..2857149 product two-component system response regulator RssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene rssB CDS 2857349..2858254 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene galU CDS complement(2858457..2858870) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502781.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene hns CDS 2859511..2860035 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene tdk CDS complement(2860105..2862786) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 gene adhE CDS 2863267..2863914 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 2864684..2866315 product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 gene oppA CDS 2866398..2867318 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096271.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene oppB CDS 2867331..2868239 product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene oppC CDS 2868251..2869264 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096273.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 2869261..2870265 product murein tripeptide/oligopeptide ABC transporter ATP-binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096274.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene oppF CDS 2870311..2871147 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045367413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(2871179..2871508) product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096276.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(2871542..2873002) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096277.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene cls CDS 2873146..2873319 product YciY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309467.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 2873574..2873984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 2874052..2874687 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene leuE CDS complement(2874721..2875017) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096279.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 2875239..2875967 product TonB system transport protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367050.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene tonB CDS complement(2876006..2876401) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096281.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene yciA CDS complement(2876500..2878578) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705755.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2878867..2879406) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(2879420..2880163) product YciC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096283.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 2880876..2881508 product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene ompW CDS complement(2881795..2882028) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096288.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene yedF CDS complement(2882025..2883236) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene yedE CDS complement(2883411..2884220) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096355.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene trpA CDS complement(2884220..2885413) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene trpB CDS complement(2885424..2886782) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene trpCF CDS complement(2886786..2888381) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096358.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene trpD CDS complement(2888381..2889943) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883574.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 2890210..2891103 product RNase AM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096361.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene rnm CDS 2891100..2891720 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096362.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 2891818..2892693 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene rluB CDS complement(2892730..2893320) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene cobO CDS complement(2893317..2894078) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096365.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 2894331..2895377 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096366.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene sohB CDS complement(2895413..2895664) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 2896063..2898660 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096367.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene topA CDS 2898847..2899821 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006175683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene cysB CDS 2900170..2900298 product YmiA family putative membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908596.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 2900301..2900471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 2900873..2903548 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096371.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene acnA CDS complement(2903584..2904174) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene ribA CDS 2904339..2905139 product phosphatidylglycerophosphatase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420925.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene pgpB CDS 2905288..2905596 product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 2905603..2906772 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene lapB CDS 2906963..2907700 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene pyrF CDS 2907700..2908026 product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096377.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene yciH CDS complement(2908131..2908349) product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene osmB CDS complement(2908612..2909364) product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096378.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(2909402..2909584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 2909932..2910645 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(2910642..2912630) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096381.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene pdeR CDS complement(2912838..2914772) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096382.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(2914861..2915847) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(2916000..2916788) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096384.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 gene fabI CDS 2917182..2918528 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409834.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(2918531..2919352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(2919400..2919801) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 2919934..2920524 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402250.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2920521..2921327) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096393.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene sapF CDS complement(2921329..2922321) product peptide ABC transporter ATP-binding protein SapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene sapD CDS complement(2922321..2923211) product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096395.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 gene sapC CDS complement(2923198..2924163) product putrescine ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene sapB CDS complement(2924160..2925800) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096397.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene sapA CDS complement(2925889..2926866) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096402.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene pspF CDS 2927033..2927701 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene pspA CDS 2927751..2927975 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene pspB CDS 2927975..2928334 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene pspC CDS 2928347..2928571 product phage shock protein PspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096406.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene pspD CDS 2928779..2930464 product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 2930478..2931770 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096408.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 2931792..2932673 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096409.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 2932660..2933502 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096410.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 2933531..2934583 product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 2934601..2935389 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 2935404..2936459 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 2936453..2938732 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096414.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 2938722..2939387 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096415.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene pgmB CDS 2939401..2940483 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096416.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 2940549..2941463 product OmpG family monomeric porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419574.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(2941497..2942507) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096418.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS 2942663..2944060 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096419.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 2944057..2945109 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 2945221..2946762 product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096421.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene tyrR CDS complement(2946797..2947303) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096423.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene tpx CDS 2947410..2948375 product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096424.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene ycjG CDS complement(2948366..2949079) product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096425.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene mpaA CDS 2949263..2950879 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096426.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 2951494..2951985 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096428.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene tssB CDS 2952020..2953561 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023324775.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene tssC CDS 2953575..2954915 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211664.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene tssK CDS 2954912..2955565 product type VI secretion system protein TssL, short form inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210015.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene tssL CDS 2955569..2957275 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120158270.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 2957281..2957772 product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene hcp CDS 2957946..2960585 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene tssH CDS 2960587..2961192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS 2961189..2961416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 2961497..2964133 product type VI secretion system Vgr family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061709398.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 2964354..2964665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 2964674..2965756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(2965792..2967081) product ISL3-like element ISPpu12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(2967103..2967615) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004863699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene lspA CDS complement(2967619..2968374) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 2968611..2969018 product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004364961.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene cadR CDS 2969248..2969958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 2969955..2970623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 2970652..2971125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 2971130..2971354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 2971384..2971650 product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226101.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 2971654..2972814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 2973023..2976217 product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211936.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 2976217..2977794 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene tssA CDS 2977827..2979590 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155110255.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene tssF CDS 2979545..2980639 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373315.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 gene tssG CDS 2980614..2981144 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074160625.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene tssJ CDS 2981141..2981587 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705635.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene tssE CDS 2981611..2982927 product VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096445.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 2982956..2983444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 2983935..2984891 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062729484.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 2984982..2985965 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096452.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene zntB CDS complement(2985904..2986101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 2986240..2986392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 2986450..2987823 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096453.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene dbpA CDS complement(2987867..2988802) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 gene ttcA CDS 2989060..2989251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 2989472..2989669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 2989673..2990095 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(2990130..2991245) product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096462.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(2991633..2995157) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096463.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene nifJ CDS complement(2995696..2996133) product heat shock protein HslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096466.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene hslJ CDS complement(2996385..2997395) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096468.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene cydB CDS complement(2997401..2998795) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096469.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 2998817..2998939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS 2999189..2999377 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096470.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 2999460..3000884 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096471.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 3001024..3002448 product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 gene patD CDS complement(3002484..3002666) product DUF1869 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513734.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(3002670..3003023) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene yeaR CDS complement(3003051..3003377) product DUF1971 domain-containing protein YeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene yeaR CDS 3003621..3003794 product GhoT/OrtT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 3003881..3004639 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096479.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(3004673..3006847) product virulence factor SrfC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419532.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(3006844..3009825) product virulence factor SrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096481.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(3009830..3011167) product SrfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 3011450..3013048 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705554.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 3013150..3013383 product DUF2526 family protein YdcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018633.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene ydcY CDS complement(3013387..3013836) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096484.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3013833..3014351) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096485.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 3014500..3015075 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096486.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 3015142..3016176 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096487.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 3016436..3017104 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3017227..3019344) product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 gene pqqU CDS 3019591..3020652 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096490.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(3020745..3022241) product L-asparagine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 gene ansP CDS complement(3022569..3023459) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705545.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 3023572..3023970 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690482.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 3024042..3024581 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 3024691..3025692 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096493.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 3025689..3026810 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096494.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 3026827..3028143 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096495.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 3028158..3029225 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(3029201..3029431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 3029384..3029608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 3029618..3030544 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096498.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 3030528..3031301 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096499.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 3031311..3032198 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096500.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 3032240..3032857 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096501.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 3032895..3033125 product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096502.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene pptA CDS 3033312..3034313 product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096503.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 3034404..3034913 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096506.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 note possible pseudo, frameshifted CDS complement(3035037..3035336) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 3035498..3037597 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096508.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene fusA CDS complement(3037646..3038218) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096509.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 3038324..3039169 product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene nhoA CDS 3039264..3039713 product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene yidI CDS complement(3039802..3040482) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene narI CDS complement(3040479..3041174) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096513.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene narW CDS complement(3041174..3042718) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene narH CDS complement(3042715..3046455) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096515.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(3046523..3047908) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096516.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(3048119..3048694) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 3048811..3050301 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(3050347..3051420) product porin OmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(3052047..3052925) product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419505.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 gene yddG CDS 3053146..3056193 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154231912.1 transl_table 11 codon_start 1 transl_except (pos:3053731..3053733,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_28800 gene fdnG CDS 3056205..3057089 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096525.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene fdxH CDS 3057082..3057738 product formate dehydrogenase-N subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705520.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 gene fdnI CDS complement(3057798..3058616) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096528.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene ppk2 CDS 3058778..3059953 product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 gene araJ CDS complement(3059993..3061195) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703745.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 3061326..3061835 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(3061875..3062885) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096530.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene adhP CDS complement(3063082..3064791) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096531.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(3065168..3066865) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096532.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(3067042..3067179) product stationary-phase-induced ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096533.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene sra CDS complement(3067275..3067490) product biofilm-dependent modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096534.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene bdm CDS complement(3067632..3068153) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026192141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(3068205..3069062) product Vmh family MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 3069168..3070055 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096536.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 3070125..3070553 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096537.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(3070599..3071525) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096540.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(3071518..3072504) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096541.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(3072501..3073397) product D,D-dipeptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096542.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(3073394..3074416) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096543.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(3074440..3075972) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096544.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(3075988..3076560) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096545.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 gene ddpX CDS complement(3076573..3077427) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096546.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 3077695..3078702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 note possible pseudo, internal stop codon CDS 3078727..3079182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 note possible pseudo, internal stop codon CDS 3079254..3080465 product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096959.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 3080554..3081450 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 3081622..3083139 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096550.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 3083206..3084576 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096551.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 3084576..3085982 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096552.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 3086011..3087027 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(3087473..3087610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(3087969..3088142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 3088178..3088777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(3088787..3089617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 note possible pseudo, internal stop codon, frameshifted CDS complement(3089644..3089769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 note possible pseudo, internal stop codon CDS complement(3089788..3089907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 note possible pseudo, internal stop codon CDS complement(3090238..3091587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 3092127..3092540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096556.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 3092537..3093103 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080292718.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 3093145..3093921 product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096561.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene dsbG CDS complement(3093961..3095154) product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419480.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(3095258..3095545) product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096563.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(3095676..3097157) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096564.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 3097269..3098153 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096565.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(3098144..3099052) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096566.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(3099054..3100031) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(3100139..3101023) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705352.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(3101135..3101662) product streptothricin N-acetyltransferase SatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242546.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene satA CDS 3101794..3103581 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096569.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene treZ CDS 3103578..3106046 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096570.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene treY CDS 3106062..3108137 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096571.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene glgX CDS complement(3108134..3108682) product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096572.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 3108907..3109629 product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096573.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 3109626..3110612 product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096574.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 3110622..3111617 product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096575.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(3111639..3113027) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705407.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 3113157..3114086 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 3114150..3114416 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540086.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 3114404..3114889 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087269.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(3115067..3116359) product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303183.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(3116464..3117222) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS 3117309..3117893 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096593.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 3117978..3118736 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096594.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene tam CDS complement(3118743..3119933) product cytochrome c biogenesis protein/redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096595.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 3119952..3120179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(3120069..3121364) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096596.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(3121361..3122101) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096597.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(3122146..3123141) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096598.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(3123287..3123727) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(3123740..3124207) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096600.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 3124327..3124875 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3124863..3125777) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096603.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3125979..3127430) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096604.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(3127548..3128075) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096605.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(3128158..3129123) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(3129182..3129544) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(3129544..3130470) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096610.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 gene glsB CDS complement(3130533..3132122) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096611.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(3132250..3133632) product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene sad CDS 3133732..3134610 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096613.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(3134607..3135419) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3135442..3136230) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 3136407..3137603 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(3137697..3138362) product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096626.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 3138589..3139053 product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096627.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene marR CDS 3139074..3139454 product MDR efflux pump AcrAB transcriptional activator MarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502237.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 gene marA CDS 3139487..3139702 product multiple antibiotic resistance protein MarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096628.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene marB CDS complement(3139741..3140640) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096629.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene eamA CDS 3140882..3142051 product efflux MFS transporter YdeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096630.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene ydeE CDS complement(3142098..3142736) product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 gene zinT CDS complement(3142789..3143487) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096632.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene urtE CDS complement(3143497..3144294) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096633.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene urtD CDS complement(3144294..3145367) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096634.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene urtC CDS complement(3145367..3146941) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096635.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 gene urtB CDS complement(3146964..3148235) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene urtA CDS 3148125..3148430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(3148437..3149540) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(3149697..3150107) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096638.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 3150202..3151179 product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420910.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene ftrA CDS complement(3151328..3151690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096640.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 3151934..3152167 product DUF2554 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096641.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(3152164..3154128) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096642.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(3154209..3154736) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096643.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 3154829..3155995 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(3155975..3156847) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096645.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 3157022..3157918 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096646.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3157953..3158627) product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(3158762..3160339) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419397.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 3160469..3161698 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096649.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene pepT CDS complement(3161695..3162288) product tellurite resistance methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096650.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 gene tehB CDS complement(3162288..3163232) product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096651.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 gene tehA CDS 3163405..3164385 product YdcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096652.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 gene ydcK CDS complement(3164380..3164919) product 50S ribosomal protein L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene rimL CDS complement(3164984..3166639) product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(3166870..3167643) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096655.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(3167654..3168823) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096656.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3168937..3169779 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(3169861..3171270) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096659.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(3171313..3172656) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 3172884..3173807 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096674.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(3173849..3175540) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419375.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(3175700..3176818) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(3176851..3177126) product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(3177343..3178131) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090120423.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(3178224..3179054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 note possible pseudo, frameshifted CDS complement(3179081..3179344) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 3179570..3180094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 3180281..3180553 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096686.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 3180740..3180979 product regulatory protein YcgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene ycgZ CDS 3181098..3181397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 3181421..3181699 product biofilm development regulator YmgB/AriR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096961.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(3181784..3183241) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 3183704..3184411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096689.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(3184445..3184726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 note possible pseudo, frameshifted CDS complement(3184723..3185619) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 note possible pseudo, frameshifted CDS complement(3185616..3187781) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096691.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(3187853..3192592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 note possible pseudo, internal stop codon, frameshifted CDS complement(3192602..3205297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 note possible pseudo, internal stop codon CDS complement(3205986..3207197) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 3208057..3208800 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096693.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 3208814..3209881 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096694.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(3209924..3210454) product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096695.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene cybB CDS complement(3210542..3211981) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115947.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 gene aldA CDS complement(3212180..3212974) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096700.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 3213190..3214842 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096701.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 3214865..3215947 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096702.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 3215944..3217323 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(3217858..3221730) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420907.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene hrpA CDS 3221964..3222569 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096706.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene azoR CDS 3222660..3223346 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(3223354..3223866) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096708.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 3224062..3225036 product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096709.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 3225062..3226090 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096710.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(3226094..3227026) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096711.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 3227125..3227559 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 3227564..3228022 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096713.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(3228019..3228552) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096714.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3228549..3229073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096715.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3229070..3229555) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096716.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(3229552..3230772) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096717.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(3230769..3231491) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096718.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(3231493..3232752) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096719.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(3232749..3233468) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(3233465..3233899) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096721.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 3234159..3234356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096722.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 3234358..3235110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096723.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(3235167..3237143) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 3237346..3237981 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(3238024..3238629) product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene paaY CDS complement(3238639..3239565) product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883661.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 gene paaX CDS complement(3239708..3241024) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096752.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 gene paaF CDS complement(3241051..3242256) product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096753.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 gene pcaF CDS complement(3242256..3242678) product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene paaI CDS complement(3242668..3244092) product 3-hydroxyacyl-CoA dehydrogenase PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene paaC CDS complement(3244094..3244879) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528139.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene paaG CDS complement(3244882..3245649) product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096757.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(3245646..3246716) product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096758.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene paaK CDS complement(3246724..3247221) product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene paaJ CDS complement(3247233..3247979) product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 gene paaC CDS complement(3247988..3248275) product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857353.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene paaB CDS complement(3248288..3249217) product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096761.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene paaA CDS 3249503..3251554 product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096762.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene paaZ CDS 3251768..3252250 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 3252253..3252657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS 3252635..3253030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 3253299..3255464 product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419319.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene tynA CDS 3255633..3257606 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096766.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 3257715..3258764 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096767.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(3258789..3260288) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096768.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 3260530..3261438 product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene feaR CDS complement(3261439..3261756) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028066.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(3261764..3261955) product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(3261952..3264108) product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096772.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 note possible pseudo, internal stop codon CDS complement(3264133..3264591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30740 note possible pseudo, internal stop codon CDS 3264802..3265791 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096773.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 3266062..3266898 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704638.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(3266995..3267168) product addiction module toxin, GnsA/GnsB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083582.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(3267464..3267742) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367862.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 3267971..3268561 product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039271.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(3268635..3270731) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(3270742..3271107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 3271738..3273003 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819223.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 3273099..3274319 product ISL3-like element ISKox3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 3274415..3274654 product DinI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096351.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 3274804..3275199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(3275192..3276022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 note possible pseudo, frameshifted CDS complement(3276049..3276312) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 3276410..3276712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(3276773..3277264) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(3277557..3279590) product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096778.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene dcp CDS 3279734..3280480 product bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096779.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene ydfG CDS 3280571..3281257 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096780.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3281293..3281724) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 3282012..3282215 product putative selenium delivery protein YdfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096785.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene ydfZ CDS complement(3282260..3283723) product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096786.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(3283947..3285287) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(3285400..3286422) product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096790.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(3286434..3287648) product starvation-sensing protein RspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene rspA CDS complement(3287760..3288086) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096792.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 3288237..3288575 product DUF1283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 3288575..3289135 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096794.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene speG CDS complement(3289153..3289863) product YnfC family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 3290055..3290909 product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144136388.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 3291012..3291317 product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096796.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 3291448..3292536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 note possible pseudo, frameshifted CDS 3292466..3293887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 note possible pseudo, frameshifted CDS 3293898..3294515 product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene dmsB CDS 3294517..3295371 product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096799.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 3295416..3296030 product Tat proofreading chaperone DmsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096800.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 gene dmsD CDS 3296140..3296451 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096736.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(3296566..3296880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(3296919..3297596) product type A-1 chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412211.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene catA CDS complement(3297682..3298566) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 3298750..3299808 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 3299866..3301050 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171064.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 3301197..3301946 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014831711.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 3302197..3302907 product osmoprotectant ABC transporter permease OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096821.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene osmY CDS 3302926..3303825 product osmoprotectant ABC transporter substrate-binding protein OsmX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene osmX CDS 3303834..3304481 product osmoprotectant ABC transporter permease OsmW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene osmW CDS 3304481..3305629 product osmoprotectant ABC transporter ATP-binding protein OsmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene osmV CDS 3305734..3307044 product voltage-gated ClC-type chloride channel ClcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096825.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene clcB CDS complement(3306979..3307674) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096826.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene bioD CDS complement(3307806..3309026) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096827.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(3309148..3310053) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096828.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 3309997..3310161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 3310175..3311428 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096829.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 3311503..3312987 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096839.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 3313131..3313442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 3313721..3314542 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096841.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(3314548..3314877) product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096842.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 gene mdtI CDS complement(3314864..3315256) product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882799.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene mdtJ CDS 3315647..3316687 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096844.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(3316684..3317631) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705616.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(3317624..3318658) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 3318866..3319213 product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006808895.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 gene yajD CDS 3319473..3320738 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 3320843..3321862 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366530.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 3322128..3323045 product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366528.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene pqqB CDS 3323048..3323803 product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705480.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene pqqC CDS 3323806..3324084 product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366526.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene pqqD CDS 3324071..3325213 product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705481.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene pqqE CDS 3325219..3327495 product pyrroloquinoline quinone biosynthesis protein PqqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705482.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene pqqF CDS complement(3327582..3330011) product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046033636.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(3330468..3330917) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394197.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 3331228..3331428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(3331475..3332341) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096857.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 3332487..3334148 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096858.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(3334181..3334744) product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096859.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene smrA CDS complement(3335095..3336000) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096860.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 3336176..3337486 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 3337486..3338931 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096862.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 3339051..3340502 product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096863.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene abgT CDS 3340512..3341027 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096864.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene ogt CDS 3341211..3341963 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006174991.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene fnr CDS 3342101..3343051 product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene uspE CDS complement(3343090..3344202) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096867.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(3344315..3345124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 note possible pseudo, frameshifted CDS complement(3345157..3345672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 note possible pseudo, frameshifted CDS complement(3345755..3347143) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096868.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene pntB CDS complement(3347154..3348683) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene pntA CDS 3349219..3350163 product DUF1471 family protein YdgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096870.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene ydgH CDS 3350349..3351731 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 3351771..3352493 product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene folM CDS complement(3352490..3352825) product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096873.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 3352953..3353669 product two-component system response regulator RstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096874.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene rstA CDS 3354108..3354479 product anti-adapter protein IraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704054.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene iraM CDS 3354867..3355091 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705675.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 3355518..3355745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434226.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 3356027..3357325 product two-component system sensor histidine kinase RstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096876.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene rstB CDS 3357400..3358329 product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096877.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene tus CDS complement(3358330..3359724) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 gene fumC CDS complement(3359907..3361553) product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene fumA CDS 3361753..3362928 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096880.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene manA CDS 3363028..3364554 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096881.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(3364657..3365685) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096882.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 3365865..3366239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(3366199..3366522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096003.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(3366522..3366761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096002.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(3366844..3368118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(3368177..3368401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(3368518..3369189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3369190..3369504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS complement(3369547..3373410) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096345.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(3373466..3374059) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019209165.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(3374047..3374778) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096343.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(3374791..3375561) product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211709.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(3375561..3375911) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816464.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 3376078..3376305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(3376319..3376576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(3376675..3377085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095992.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(3377148..3377372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(3377372..3380506) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082401.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(3380506..3380793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3380811..3381149) product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816467.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(3381215..3382006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(3382150..3383082) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816468.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(3383129..3383395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(3383565..3384164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816470.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(3384167..3384520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211716.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(3384522..3385004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175627995.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(3385007..3385264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705695.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(3385304..3386440) product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(3386457..3387209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705697.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(3387317..3387526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(3387530..3388636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816475.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(3388638..3390041) product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019209140.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(3390046..3391617) product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816477.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(3391614..3392264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705883.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(3392276..3392455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(3392430..3392648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095974.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(3392804..3393322) product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050716666.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(3393619..3394005) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705888.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3394002..3394442) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(3394446..3394721) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166766.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(3394718..3395119) product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816186.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(3395486..3395767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(3396065..3396829) product antitermination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098059.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(3396829..3396963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705894.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(3396942..3397139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(3397136..3397774) product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097725.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(3397771..3398238) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039430.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(3398235..3398405) product NinE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095967.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(3398398..3398847) product recombination protein NinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095966.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(3399099..3399338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(3399338..3399919) product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS complement(3399923..3400933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(3400944..3401120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(3401123..3401461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(3401458..3402048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(3402045..3402359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026094290.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(3402349..3403722) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095958.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(3403719..3404804) product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095957.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(3404791..3404958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095956.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(3405044..3405589) product toxin YdaT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(3405607..3405870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 3405992..3406690 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(3406704..3407078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 3407661..3407891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 3408035..3408391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095951.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 3408388..3408546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095950.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 3408543..3408749 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090135989.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 3408828..3409109 product host nuclease inhibitor GamL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene gamL CDS 3409119..3410033 product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 3410030..3410512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 3410521..3410949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705914.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 3410946..3411098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 3411095..3411736 product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095944.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 3411726..3412322 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 3412319..3413293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 3413412..3413630 product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032665755.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 3413627..3413848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 3413826..3414065 product DUF4222 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095941.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 3414074..3414304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705919.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 3414411..3414695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(3414673..3415902) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218286.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(3416334..3416810) product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene rseC CDS complement(3416807..3417760) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene rseB CDS complement(3417760..3418410) product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098323.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene rseA CDS complement(3418442..3419017) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006176728.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene rpoE CDS 3419443..3421062 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098324.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene nadB CDS complement(3421047..3421784) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098325.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 3421917..3423245 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene srmB CDS complement(3423297..3423680) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098327.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene grcA CDS 3423996..3424685 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098328.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene ung CDS complement(3424725..3425810) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703188.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 3426015..3426434 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098330.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene trxC CDS 3426679..3427203 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098331.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene tapT CDS 3427239..3429902 product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098332.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 gene pat CDS 3430009..3431367 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882218.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene pssA CDS 3431414..3431737 product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020685902.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(3431734..3433041) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(3433193..3433549) product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 rRNA complement(3433777..3433887) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(3434079..3436980) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(3437165..3437240) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 rRNA complement(3437326..3438863) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(3439313..3441886) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098336.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 gene clpB CDS complement(3442016..3442747) product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098337.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 gene yfiH CDS complement(3442744..3443724) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 gene rluD CDS 3443856..3444593 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 gene bamD CDS 3444861..3445202 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene raiA CDS 3445463..3446623 product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene pheA CDS complement(3446620..3447492) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098341.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(3447553..3448674) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098342.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene tyrA CDS complement(3448685..3449755) product 3-deoxy-7-phosphoheptulonate synthase AroF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098343.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene aroF CDS 3449968..3450342 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098344.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 3450417..3450599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 3450544..3451032 product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 3451124..3452245 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098346.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 gene dgcN CDS 3452258..3452743 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098347.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(3452746..3454116) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(3454155..3454559) product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098349.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(3454692..3455039) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914145.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene rplS CDS complement(3455083..3455850) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 gene trmD CDS complement(3455882..3456418) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 gene rimM CDS complement(3456437..3456685) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863133.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 gene rpsP CDS complement(3456802..3458163) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098351.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene ffh CDS 3458255..3459121 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014832951.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 3459186..3460427 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028086.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(3460480..3461097) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098354.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene grpE CDS 3461268..3462074 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098356.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 gene nadK CDS 3462160..3463821 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098357.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 gene recN CDS 3463960..3464298 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863121.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene bamE CDS complement(3464360..3464647) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863119.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(3464637..3465113) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502504.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 3465231..3465713 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502505.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene smpB tmRNA 3465803..3466166 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 3466351..3467568 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210713.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 3467565..3469508 product PHD finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922228.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(3469753..3470316) product phage polarity suppression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095388.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(3470345..3470563) product ogr/Delta-like zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(3470566..3471309) product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095390.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 3471848..3472114 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 3472474..3472668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 3472665..3472892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216603.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 3472889..3473209 product DUF5375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795388.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 3473224..3475557 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783716.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS 3475685..3476530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 3476543..3476842 product contact-dependent growth inhibition system immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094874.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 3477513..3478751 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467088.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene rbsK CDS 3478948..3479796 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 3479796..3480695 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 3480710..3482110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 3482107..3483318 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS 3483320..3484375 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972369.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 gene ugpC CDS complement(3484448..3485644) product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921522.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 gene iaaH CDS 3485582..3485812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(3485809..3487104) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975852.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 gene hisD CDS complement(3487105..3488247) product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969925.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(3488353..3489324) product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969925.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(3489321..3490391) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 3490700..3491692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 note possible pseudo, frameshifted CDS 3491643..3491939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 3492015..3492566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 note possible pseudo, frameshifted CDS 3492572..3493336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 note possible pseudo, frameshifted CDS 3493340..3494104 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612357.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 3494113..3494856 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209982.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 3494838..3495629 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 3495638..3496816 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969921.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(3496735..3496914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(3496917..3497336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(3497344..3497682) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(3497672..3498886) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(3498895..3499794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(3499805..3501022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 3501300..3502304 product IS110-like element IS4321 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427623.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 3502632..3504446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 3504443..3505774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 3505771..3507318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 3507303..3508697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 3508694..3509128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 3509131..3511839 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982246.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 3511808..3514006 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229242.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(3514045..3514212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 3514227..3514466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(3514506..3515228) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970694.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 3515327..3516244 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687183.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 3516261..3516464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 3517139..3528562 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098386.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 3528645..3530048 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 3530045..3532237 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098388.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 3532218..3533417 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086528237.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(3533484..3534665) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098395.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(3534686..3535573) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098396.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 3535671..3536273 product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098397.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(3536385..3537764) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098403.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(3537766..3538722) product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098404.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(3538719..3540299) product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098405.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(3540311..3541726) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098406.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(3541726..3543267) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098407.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene fdrA CDS complement(3543376..3543981) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098408.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 3544302..3545231 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098409.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(3545228..3545386) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098410.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 3545566..3546084 product rhodanese family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098411.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS 3546168..3546347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098412.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(3546385..3546789) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098413.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene stpA CDS 3547286..3547735 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098416.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene alaE CDS complement(3547768..3548112) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098417.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS 3548271..3548597 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883716.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 3548841..3549080 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098419.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene nrdH CDS 3549077..3549487 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098420.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene nrdI CDS 3549460..3551604 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098421.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene nrdE CDS 3551614..3552573 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098422.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene nrdF CDS 3552907..3554109 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098423.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene proV CDS 3554102..3555166 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098424.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene proW CDS 3555176..3556171 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098425.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene proX CDS complement(3556070..3556297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS 3556406..3557545 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098426.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS 3557851..3558390 product transcriptional repressor MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098427.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene mprA CDS 3558521..3559693 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098428.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene emrA CDS 3559710..3561257 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098429.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene emrB CDS 3561443..3563098 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098430.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene leuA CDS complement(3563085..3563888) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(3563903..3564418) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098432.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 gene luxS CDS complement(3564571..3566115) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098433.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 gene gshA CDS complement(3566199..3566627) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152081995.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS complement(3566624..3567190) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098435.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 gene yqaB tRNA complement(3567308..3567384) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(3567414..3567490) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(3567520..3567596) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 3567649..3567721 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA complement(3567661..3567737) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(3567742..3567834) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 CDS complement(3568177..3568362) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene csrA CDS complement(3568604..3571231) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098436.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 gene alaS CDS complement(3571363..3571809) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098437.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene recX CDS complement(3571932..3572990) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098438.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene recA CDS complement(3573080..3573577) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098439.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene pncC CDS complement(3573708..3574586) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883886.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS complement(3574601..3575461) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098441.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS complement(3575458..3576111) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098442.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(3576401..3577501) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645252.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene mltB CDS 3577753..3578316 product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573335.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene srlA CDS 3578313..3579272 product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098445.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 3579285..3579647 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098446.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene srlB CDS 3579662..3580441 product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098447.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene srlD CDS 3580509..3580868 product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098448.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene gutM CDS 3580932..3581705 product DNA-binding transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 3581698..3582663 product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098450.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene gutQ CDS complement(3582660..3584174) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098451.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene norR CDS 3584362..3585810 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098452.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene norV CDS 3585807..3586940 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 gene norW CDS complement(3587068..3588090) product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(3588092..3590308) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene hypF CDS complement(3590315..3590860) product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833044.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 gene hydN CDS complement(3590993..3592006) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420952.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 3592220..3593671 product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098459.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 gene ascF CDS 3593690..3595114 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098460.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(3595203..3595658) product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098461.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 gene hycI CDS complement(3595651..3596061) product formate hydrogenlyase maturation HycH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098462.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(3596058..3596825) product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098463.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(3596825..3597367) product formate hydrogenlyase complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098464.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(3597377..3599086) product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098465.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene hycE CDS complement(3599102..3600025) product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098466.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(3600027..3601841) product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098467.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene hycC CDS complement(3601838..3602446) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098468.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(3602519..3602983) product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene hycA CDS 3603194..3603544 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098471.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene hypA CDS 3603548..3604411 product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098472.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene hypB CDS 3604402..3604674 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098473.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 3604678..3605799 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098474.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 gene hypD CDS 3605796..3606806 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098475.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 gene hypE CDS 3606869..3608941 product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098476.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 gene flhA CDS 3609092..3610090 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 3610090..3611127 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 3611127..3611888 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 3611904..3613124 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS complement(3613130..3613501) product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098481.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 3613650..3613880 product SymE family type I addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098482.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 3613994..3616555 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene mutS CDS complement(3616696..3616917) product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098486.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(3616928..3618355) product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098487.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS complement(3618345..3618947) product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098488.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 3619121..3619528 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098489.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS complement(3619525..3620412) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098490.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 3620522..3621724 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098491.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 3621721..3622098 product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098492.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(3622149..3623141) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098493.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene rpoS CDS complement(3623201..3624031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 3624135..3624347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS complement(3624442..3625068) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098496.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(3625062..3625823) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883175.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene surE CDS complement(3625804..3626853) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene truD CDS complement(3626850..3627329) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene ispF CDS complement(3627329..3628039) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 gene ispD CDS complement(3628059..3628370) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 gene ftsB CDS complement(3628450..3628776) product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098502.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(3628835..3629440) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 gene cysC CDS complement(3629440..3630864) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene cysN CDS complement(3630874..3631782) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene cysD CDS complement(3631792..3633150) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene cysG CDS 3633388..3634431 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098506.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(3634527..3635261) product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098507.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene cysH CDS complement(3635361..3637073) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene cysI CDS complement(3637073..3638878) product NADPH-dependent assimilatory sulfite reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098509.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene cysJ CDS 3639185..3639547 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434567.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene queD CDS complement(3639532..3641886) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 3642058..3643227 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366269.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 3643255..3644652 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705664.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(3644670..3645341) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098510.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 gene queE CDS complement(3645396..3646103) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(3646103..3647662) product maltose/glucose-specific PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098512.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 3647829..3648653 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(3648706..3650004) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098515.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene eno CDS complement(3650087..3651724) product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098516.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene pyrG CDS complement(3651948..3652739) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098517.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene mazG CDS complement(3652807..3655038) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098518.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene relA CDS complement(3655090..3656388) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098519.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 gene rlmD CDS 3656446..3659205 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098520.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene barA CDS complement(3659256..3660401) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098521.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(3660479..3661816) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098522.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene gudD CDS complement(3661832..3663175) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098523.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(3663172..3664527) product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098524.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene gudP CDS complement(3664493..3664693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(3664836..3665285) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098525.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(3665301..3666086) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098526.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene truC CDS complement(3666083..3666412) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098527.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 3666734..3666961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(3667045..3667590) product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098528.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 gene syd CDS 3667660..3668502 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098529.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene queF CDS 3668619..3669983 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098530.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 gene ppnN CDS 3670488..3671777 product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098531.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 3671840..3673207 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 3673320..3674075 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420510.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene xni CDS complement(3674133..3675233) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098534.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 gene rlmM CDS complement(3675226..3675621) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862756.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(3675661..3676578) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369945.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene gcvA CDS complement(3676929..3677156) product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499648.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 3677348..3678553 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098537.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene csdA CDS 3678553..3678999 product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622033.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 gene csdE CDS complement(3678990..3679796) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098539.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 gene tcdA CDS complement(3679872..3680969) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098540.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene mltA tRNA 3681178..3681254 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA 3681426..3681502 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 3681547..3681623 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 CDS complement(3681714..3682910) product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098541.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene amiC CDS 3683195..3684526 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 gene argA CDS complement(3684560..3686380) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098543.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 gene recD CDS complement(3686377..3689919) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098544.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 gene recB CDS complement(3689916..3692798) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene ptrA CDS complement(3692938..3696312) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098546.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 gene recC CDS complement(3696325..3696612) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098547.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(3696633..3697031) product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098548.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(3697028..3697588) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098549.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(3697579..3698085) product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(3698228..3699022) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098550.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene thyA CDS complement(3699029..3699904) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098551.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 gene lgt CDS complement(3700134..3702380) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098552.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene ptsP CDS complement(3702393..3702776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 3703607..3704299 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098554.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 gene mutH CDS 3704428..3704646 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098555.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 3704779..3705819 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098556.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(3705913..3707106) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620430.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 gene lplT CDS complement(3707099..3709258) product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene aas CDS 3709498..3709719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 3709876..3710898 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098559.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 gene galR CDS complement(3710853..3711329) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(3711326..3712099) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(3712178..3713605) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098562.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(3713613..3714938) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098563.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 3715238..3716275 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098564.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(3716245..3717507) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098565.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene lysA CDS 3717628..3718554 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098566.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(3718549..3719241) product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 3719377..3719700 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(3719734..3720870) product LPS O-antigen length regulator Wzz(fepE) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098569.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 gene wzz(fepE) CDS 3721414..3722304 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098570.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 3722297..3723199 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 3723212..3724339 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene ugpC CDS 3724353..3725639 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(3725724..3727112) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098574.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(3727452..3728213) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098575.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 gene kduD CDS complement(3728277..3729113) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 gene kduI CDS 3729414..3730589 product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098577.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(3730836..3731519) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(3731837..3733015) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620438.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(3733108..3733974) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098580.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 3734076..3734540 product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020687112.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 3734657..3735886 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420528.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(3735920..3736192) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(3736203..3736433) product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098586.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene yjdI CDS 3736887..3737075 product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004150795.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 3737166..3737663 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096661.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 3737726..3738187 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096663.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 3738238..3738513 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 3738558..3738935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(3739131..3739799) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(3740059..3740202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 3740615..3741424 product DUF4225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004959820.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(3741421..3741735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 3741991..3742254 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 3742281..3743111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 note possible pseudo, frameshifted CDS 3743848..3745005 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862885.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 3745262..3745933 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119916272.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(3745975..3747837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891726.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(3747837..3748025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(3748136..3749176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999102.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(3749193..3749570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(3749574..3749804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS complement(3750450..3750767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(3750757..3750966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS complement(3750959..3751339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532776.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS complement(3751351..3751629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS complement(3751642..3752400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS complement(3752397..3753320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(3753330..3753518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 3754048..3754230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 3754821..3755051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS 3755038..3755616 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS 3755610..3755825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 tRNA complement(3756914..3756987) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 CDS complement(3757068..3757709) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098606.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene actS CDS 3757972..3758514 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098607.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene idi CDS complement(3758563..3760080) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene lysS CDS complement(3760090..3760971) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095908218.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene prfB note possible pseudo, frameshifted CDS complement(3761279..3763012) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098610.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene recJ CDS complement(3763018..3763731) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098611.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene dsbC CDS complement(3763760..3764656) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098612.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene xerD CDS 3764758..3765279 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene fldB CDS complement(3765281..3765691) product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244769.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(3765672..3765938) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098615.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene sdhE CDS 3766233..3767213 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098616.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene ygfZ CDS complement(3767325..3767984) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863433.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 3768245..3768982 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098618.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 3769099..3770532 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098619.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 3770657..3771016 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369786.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 3771065..3773074 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703424.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 3773076..3773678 product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703425.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 3773668..3774168 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703426.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS complement(3774171..3774914) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098620.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(3774985..3777858) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene gcvP CDS complement(3777986..3778375) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene gcvH CDS complement(3778399..3779493) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028158.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene gcvT CDS complement(3779891..3781093) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098624.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene ubiI CDS complement(3781106..3782284) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098625.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene ubiH CDS complement(3782281..3783600) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098626.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene pepP CDS complement(3783626..3784210) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098627.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 3784372..3784701 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811891.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene zapA CDS 3784951..3785547 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098628.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(3785655..3786887) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098629.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene serA CDS complement(3787153..3787812) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098630.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene rpiA CDS 3787940..3788833 product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499727.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 gene argP CDS complement(3788876..3789598) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098631.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(3789691..3790380) product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098632.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 gene argO CDS complement(3790472..3791326) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098633.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(3791512..3792591) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098634.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 gene fbaA CDS complement(3792684..3793847) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098635.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 gene pgk CDS complement(3793897..3794916) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098636.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene epd CDS complement(3795209..3795919) product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687742.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(3795916..3796425) product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224135.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene fumE CDS complement(3796441..3797412) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987297.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene glpX CDS complement(3797409..3798686) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(3798710..3800089) product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428807.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene cmtA CDS complement(3800117..3800560) product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237038.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 gene cmtB CDS complement(3800874..3802865) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420542.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene tkt CDS 3803138..3803896 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098638.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS complement(3803942..3805582) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098641.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(3805596..3807065) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098642.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(3807075..3807845) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098643.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(3807855..3808649) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098644.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(3808633..3809403) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098645.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(3809413..3809943) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(3809954..3811210) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098647.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(3811236..3812423) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098648.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(3812420..3813346) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098649.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(3813425..3814216) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028063.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(3814226..3814975) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098651.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(3814975..3815997) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098652.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS complement(3816008..3816316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098653.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(3816313..3816636) product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098654.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS 3816980..3818263 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098655.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(3818267..3819187) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105561.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene speB CDS complement(3819474..3821372) product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833212.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene speA CDS 3822251..3823405 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098658.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene metK CDS 3823849..3825246 product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene galP CDS 3825347..3825802 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860035.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 3825897..3826604 product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098661.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene endA CDS 3826641..3827387 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098662.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene rsmE CDS 3827419..3828366 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098663.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene gshB CDS 3828441..3829001 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098664.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 3829001..3829417 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006811925.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 gene ruvX CDS complement(3829428..3830408) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883139.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 3830426..3831127 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098666.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 3831149..3831715 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098667.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 3831712..3832008 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 gene yggU CDS 3832012..3832605 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098669.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 3832598..3833746 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098670.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 gene hemW CDS 3833797..3834141 product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(3834222..3834938) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098671.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS complement(3834996..3835322) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862421.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(3835322..3836041) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098672.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 gene trmB CDS 3836180..3837238 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645253.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene mutY CDS 3837265..3837537 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098674.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 3837659..3838738 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098675.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene mltC CDS 3839008..3840264 product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098677.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(3840344..3841147) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098678.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene citG CDS complement(3841125..3841664) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098679.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene citX CDS complement(3841661..3843184) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098680.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 gene citF CDS complement(3843195..3844070) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098681.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene citE CDS complement(3844067..3844360) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098682.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene citD CDS complement(3844377..3845399) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098683.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene citC CDS complement(3845413..3846276) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS complement(3846294..3847655) product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098685.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 3848001..3849638 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045909943.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS 3849628..3850320 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098687.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(3850397..3852592) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 3852717..3853430 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 tRNA 3853526..3853601 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 CDS complement(3853676..3855460) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098692.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(3855457..3856089) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098693.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 3856265..3856579 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098694.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 3856694..3859756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(3859818..3860138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 3861068..3863452 product poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420571.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene pgaA CDS 3863461..3865398 product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098697.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 gene pgaB CDS 3865391..3866722 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098698.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene pgaC CDS 3866719..3867153 product poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098699.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene pgaD CDS complement(3867206..3869068) product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098700.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene gss CDS 3869252..3870118 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098701.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene yghU CDS 3870195..3870944 product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene fucR CDS complement(3870947..3872494) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098705.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 3872646..3873686 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023622102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(3873759..3874247) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098707.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(3874291..3874794) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098708.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 3874897..3875301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098709.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 3875303..3875728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098710.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(3875809..3876234) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833267.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene exbD CDS complement(3876239..3876970) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098712.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 gene exbB CDS 3877222..3878409 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098713.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene metC CDS 3878552..3879211 product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098714.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene yghB CDS complement(3879257..3880156) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703501.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS 3880352..3881515 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene yqhD CDS 3881621..3882448 product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene dkgA CDS complement(3882535..3883560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(3883660..3883989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(3884194..3886908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS complement(3887033..3887887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37010 note possible pseudo, frameshifted CDS complement(3887884..3888183) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165821.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 3888809..3889156 product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609174.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene tnpB CDS 3889206..3890741 product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000402.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(3890748..3891161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 3891524..3891733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 3892020..3892316 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099275.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 3892740..3893396 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145474.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(3893459..3894442) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390710.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 3894843..3895118 product IS1-like element transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069256.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 3895247..3895540 product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087249.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 3895654..3895929 product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene frmR CDS 3895964..3897073 product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene frmA CDS 3897117..3897515 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 3897580..3898416 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419039.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene fghA CDS complement(3898695..3899423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 note possible pseudo, internal stop codon, frameshifted CDS 3899639..3899947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(3900035..3900355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 3900366..3903017 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(3903032..3903355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS complement(3903958..3905091) product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104138.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 3905220..3905420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS complement(3905912..3906742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 note possible pseudo, frameshifted CDS complement(3906769..3907032) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 3907465..3908046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37250 note possible pseudo, internal stop codon CDS complement(3908160..3908819) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766140.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(3909114..3909815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(3910026..3910877) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460847.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(3910984..3911859) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387789.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(3911942..3912916) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089270.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 3913135..3914259 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112378.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 3914355..3914663 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(3915620..3915898) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132230.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(3915989..3916417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047043.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(3916421..3918538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(3918526..3920292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222725.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(3920279..3920767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 3921507..3921740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 3922140..3922775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(3922803..3924086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(3924238..3925650) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098721.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene ftsP CDS complement(3925712..3926449) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098722.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 gene plsC CDS complement(3926613..3928871) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098723.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene parC CDS complement(3928990..3929391) product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020689494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 3929531..3930190 product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene qseB CDS 3930187..3931536 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098726.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene qseC CDS 3931641..3932222 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098727.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 3932253..3932567 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098728.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 3932719..3933159 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 gene lysM CDS complement(3933192..3934379) product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098730.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(3934408..3935673) product oligosaccharide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098731.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(3935705..3937465) product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098732.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 3937686..3938522 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098733.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(3938642..3940534) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098740.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 gene parE CDS complement(3940563..3941144) product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene yqiA CDS complement(3941144..3941971) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene cpdA CDS complement(3941999..3942421) product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862516.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(3942418..3943050) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098743.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene nudF CDS 3943254..3944732 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098744.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 gene tolC CDS 3944945..3945592 product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098745.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 3945595..3946755 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098746.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(3946838..3947626) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098747.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 gene ygiD CDS 3947757..3948530 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098748.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene zupT CDS 3948797..3949357 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098753.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 3949431..3951875 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172645261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 3951885..3952646 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098755.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 3952630..3953691 product type 1 fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098756.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(3953736..3954389) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502964.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene ribB CDS 3954766..3955062 product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098757.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene ubiK CDS complement(3955140..3956570) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098758.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene hldE CDS complement(3956611..3959466) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098759.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene glnE CDS complement(3959488..3960789) product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098760.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 3961027..3961647 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098761.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 3961708..3962949 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098762.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(3962963..3963784) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene bacA CDS complement(3963891..3964262) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098764.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene folB CDS 3964367..3964981 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098765.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene plsY CDS 3965212..3966540 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703523.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 3966697..3967524 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098766.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 3967535..3967837 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 3967848..3968162 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 3968155..3969858 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098768.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene ureC CDS 3969868..3970326 product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene ureE CDS 3970336..3970875 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098770.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS 3970875..3971549 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098771.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 3971559..3972176 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098772.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene ureG CDS complement(3972209..3974233) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098773.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 3974543..3975223 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883055.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(3975255..3976268) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098775.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene tsaD CDS 3976505..3976720 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene rpsU CDS 3976836..3978581 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098776.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene dnaG CDS 3978735..3980579 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369628.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene rpoD CDS complement(3980669..3981175) product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098778.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene mug tRNA 3981300..3981375 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 CDS complement(3981826..3982293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(3982271..3982663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 3982870..3983361 product type VI secretion system effector Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366299.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene hcp CDS 3983818..3984987 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098822.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS complement(3984988..3985752) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098823.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 3985898..3986392 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(3986389..3987828) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098825.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(3988189..3989709) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098826.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 3990222..3991511 product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene ygjG CDS complement(3991597..3992178) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098828.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(3992260..3992418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 3992383..3992931 product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098829.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(3993129..3993422) product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 gene lsrG CDS complement(3993419..3994306) product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene lsrF CDS complement(3994317..3995318) product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098847.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene lsrB CDS complement(3995320..3996297) product autoinducer 2 ABC transporter permease LsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098848.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 gene lsrD CDS complement(3996298..3997329) product autoinducer 2 ABC transporter permease LsrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098849.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene lsrC CDS complement(3997326..3998813) product autoinducer 2 ABC transporter ATP-binding protein LsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene lsrA CDS 3999029..4000000 product transcriptional regulator LsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098851.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene lsrR CDS 4000033..4001613 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098852.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene lsrK CDS 4001798..4003819 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098853.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(4003952..4005088) product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098854.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 gene rlmG CDS 4005172..4005675 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098855.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS 4005746..4006744 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098856.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 4006996..4007961 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098857.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(4007927..4008112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 4008236..4009477 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098858.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 gene sstT CDS complement(4009572..4011059) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098859.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(4011077..4012489) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098860.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene uxaC CDS 4012965..4014263 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098861.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(4014406..4015215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 note possible pseudo, frameshifted CDS complement(4015248..4015763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 note possible pseudo, frameshifted CDS 4015905..4016681 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098862.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 gene exuR CDS 4017024..4017686 product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098863.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 gene yqjA CDS 4017689..4018072 product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098864.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 gene mzrA CDS 4018216..4018584 product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098865.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS 4018614..4018919 product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098866.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS 4018922..4019320 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098867.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 4019317..4019613 product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098868.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 4019971..4020252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 note possible pseudo, frameshifted CDS 4020325..4021311 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098870.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS 4021418..4021783 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(4021822..4022724) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098872.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS 4022829..4023530 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098873.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(4023623..4024927) product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098874.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(4024948..4026216) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420680.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(4026554..4028848) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098876.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 gene pflB CDS complement(4028864..4030072) product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098877.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene tdcD CDS complement(4030103..4031434) product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098878.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene tdcC CDS complement(4031445..4032434) product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098879.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene tdcB CDS complement(4032531..4033451) product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098880.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene tdcA CDS complement(4034533..4035678) product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706461.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene garK CDS complement(4035735..4036625) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098882.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene garR CDS complement(4036647..4037417) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene garL CDS 4037785..4039356 product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098885.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene garD CDS complement(4039403..4040206) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098886.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS 4040458..4041753 product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098887.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene kbaZ CDS 4041773..4042246 product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098888.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene agaV CDS 4042257..4043036 product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098889.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 gene agaW CDS 4043026..4043904 product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098890.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 gene agaE CDS 4043922..4044356 product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098891.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene agaF CDS 4044353..4045486 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098892.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 gene nagA CDS 4045733..4046878 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098893.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 4046891..4047763 product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098894.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 gene kbaY CDS 4047881..4049452 product maltose/glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387436.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene malX CDS 4049465..4050637 product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861570.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 4050654..4052543 product enterotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420958.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(4052611..4053474) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098896.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 gene rsmI CDS 4053650..4055674 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098897.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS 4055632..4056027 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 4056049..4056639 product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861754.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 gene diaA CDS 4056649..4057224 product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098899.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 gene dolP CDS complement(4057275..4058312) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420692.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(4058353..4058997) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098901.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 4059126..4059644 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098902.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(4059624..4060058) product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098903.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 4060115..4060402 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098904.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(4060389..4060892) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098905.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS complement(4060886..4061410) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098906.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS 4061632..4062627 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS 4062635..4063513 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098908.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 4063592..4064599 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098909.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(4064689..4065933) product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098910.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 gene mtr CDS complement(4066076..4067980) product DEAD/DEAH family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098911.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(4068152..4069036) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098912.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 gene nlpI CDS complement(4069147..4071285) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098913.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 gene pnp CDS complement(4071528..4071797) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098914.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene rpsO CDS complement(4071952..4072902) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098915.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene truB CDS complement(4072902..4073306) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003024988.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene rbfA CDS complement(4073413..4076100) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38830 gene infB CDS complement(4076125..4077627) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098917.1 transl_table 11 codon_start 1 locus_tag LOCUS_38840 gene nusA CDS complement(4077656..4078078) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833432.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 gene rimP tRNA complement(4078316..4078392) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS 4078679..4080025 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098918.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene argG tRNA complement(4080179..4080265) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 CDS complement(4080275..4080607) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861803.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene secG CDS complement(4080830..4082167) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098919.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene glmM CDS complement(4082160..4083008) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098920.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 gene folP CDS complement(4083107..4085050) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098921.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 gene ftsH CDS complement(4085144..4085770) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861812.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 gene rlmE CDS 4085859..4086191 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196654.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 gene yhbY CDS complement(4086343..4086819) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369513.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 gene greA CDS 4087048..4088481 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420697.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene dacB CDS 4088484..4089146 product two-component system response regulator PmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098925.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene pmrA CDS 4089143..4090186 product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098926.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene pmrB CDS complement(4090220..4091395) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098927.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 gene cgtA CDS complement(4091411..4092376) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098928.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(4092472..4092729) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004385076.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene rpmA CDS complement(4092749..4093060) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025032.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene rplU CDS 4093318..4094289 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene ispB CDS 4094489..4094806 product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098930.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene sfsB CDS complement(4094870..4096129) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098931.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene murA CDS complement(4096180..4096434) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501458.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene ibaG CDS complement(4096561..4096854) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098932.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene mlaB CDS complement(4096854..4097489) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098933.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene mlaC CDS complement(4097508..4098056) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098934.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene mlaD CDS complement(4098061..4098843) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436044.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 gene mlaE CDS complement(4098851..4099663) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098935.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene mlaF CDS 4099891..4100868 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098936.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 4100882..4101868 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098937.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 gene kdsD CDS 4101883..4102449 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 gene kdsC CDS 4102446..4103021 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098939.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene lptC CDS 4102990..4103544 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098940.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene lptA CDS 4103551..4104276 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098941.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene lptB CDS 4104336..4105757 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098942.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 gene rpoN CDS 4105780..4106067 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098943.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene hpf CDS 4106150..4106641 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098944.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene ptsN CDS 4106687..4107541 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243746.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene rapZ CDS 4107538..4107810 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861872.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 gene npr CDS complement(4107850..4108575) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene mtgA CDS complement(4108572..4109225) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098947.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene elbB CDS complement(4109458..4111791) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098948.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene arcB CDS complement(4111929..4113011) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098949.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene lptG CDS complement(4113011..4114111) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 gene lptF CDS 4114377..4115888 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098951.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 gene pepA CDS 4116006..4116449 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502815.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 gene holC CDS 4116449..4119304 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098952.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 4119428..4119931 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098953.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 4120015..4121034 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098954.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(4121127..4122773) product glycerone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 4122911..4124413 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098956.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(4124393..4125376) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097533874.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(4125671..4125865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(4125880..4126080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS 4126022..4130482 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098958.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene gltB CDS 4130492..4131910 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098959.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene gltD CDS complement(4131967..4132638) product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(4132864..4133430) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098960.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(4133427..4135628) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098961.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(4135859..4136563) product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098962.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS complement(4136675..4137355) product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098963.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(4137727..4138218) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366112.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 gene sspB CDS complement(4138230..4138868) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098965.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene sspA CDS complement(4139176..4139568) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 gene rpsI CDS complement(4139584..4140012) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098967.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 gene rplM CDS complement(4140362..4141486) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098968.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene zapE CDS 4141676..4142074 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502832.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 gene zapG CDS 4142245..4143612 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098969.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 gene degQ CDS 4143705..4144772 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098970.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 gene degS CDS complement(4144824..4145762) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098971.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene mdh CDS 4146190..4146630 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098972.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene argR CDS 4147009..4147272 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098973.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene yhcN CDS complement(4147332..4147604) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098975.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(4147650..4149104) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098976.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(4149191..4151158) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098977.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 gene aaeB CDS complement(4151164..4152096) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098978.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene aaeA CDS complement(4152104..4152307) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860416.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene aaeX CDS 4152487..4153413 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098979.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene aaeR CDS 4153633..4154247 product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019920.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 CDS complement(4154293..4155738) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098980.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene tldD CDS complement(4155823..4159629) product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098981.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 gene yhdP CDS complement(4159672..4161141) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833490.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 gene rng CDS complement(4161131..4161724) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098984.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS complement(4161734..4162222) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098985.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene mreD CDS complement(4162222..4163238) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098986.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 gene mreC CDS complement(4163301..4164344) product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene mreB CDS complement(4164627..4166363) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098987.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene csrD CDS 4166752..4167726 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098988.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS 4167804..4168805 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098989.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene msrP CDS 4168806..4169405 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098990.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 gene msrQ CDS 4169640..4170092 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098991.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 gene aroQ CDS 4170114..4170578 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 gene accB CDS 4170589..4171938 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860388.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 gene accC CDS 4172047..4172289 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098993.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS 4172279..4173730 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098994.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 gene panF CDS 4173742..4174623 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098995.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 gene prmA CDS 4174761..4175501 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094853.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 4175831..4176796 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098996.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene dusB CDS 4176820..4177116 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 gene fis CDS complement(4177274..4177582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(4177733..4179394) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127900.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(4179378..4179734) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113645.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(4179692..4179883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS complement(4180010..4180453) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(4180453..4180746) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123184.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(4180743..4181081) product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020662.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(4181078..4182313) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267612.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(4182315..4182875) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504050.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 CDS complement(4182927..4184093) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137336.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 4184356..4184868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(4184917..4185252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(4185595..4187730) product DUF927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786266.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS complement(4187730..4188095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(4188092..4188460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS complement(4188457..4188771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS complement(4188764..4188949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(4188942..4189154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS 4189345..4189530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(4189654..4190433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS complement(4190442..4190726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(4190887..4191792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS complement(4191885..4193111) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085257.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 4193478..4193642 product DUF2556 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098997.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 4193783..4195867 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098998.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS complement(4195862..4196509) product acrEF/envCD operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446923.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 gene envR CDS 4196561..4196710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS 4197068..4198048 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098999.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 4198060..4201173 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099000.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 4201422..4201643 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099001.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 rRNA complement(4201987..4202097) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA complement(4202143..4202218) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 rRNA complement(4202236..4202346) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA complement(4202418..4205319) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA complement(4205504..4205579) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 rRNA complement(4205665..4207202) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 CDS 4207683..4208237 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099006.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(4208213..4208461) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420723.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(4208458..4209276) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420960.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 gene aroE CDS complement(4209281..4209853) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420961.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene tsaC CDS complement(4209846..4210400) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099010.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(4210427..4210900) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099011.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 gene smg CDS complement(4210872..4211180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS 4211535..4211873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 4212124..4212633 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099013.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 gene def CDS 4212799..4213605 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099014.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 gene fmt CDS 4213682..4214944 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420962.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 gene rsmB CDS 4214967..4216343 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099016.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 gene trkA CDS 4216490..4216903 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene mscL CDS complement(4216904..4217119) product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 gene arfA CDS complement(4217177..4217602) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099019.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 gene zntR CDS complement(4217605..4217973) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099020.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(4218081..4218464) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 gene rplQ CDS complement(4218505..4219494) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919219.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 gene rpoA CDS complement(4219520..4220140) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919224.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 gene rpsD CDS complement(4220173..4220562) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003031137.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 gene rpsK CDS complement(4220579..4220935) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099021.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 gene rpsM CDS complement(4221230..4222561) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863305.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 gene secY CDS complement(4222569..4223003) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099022.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene rplO CDS complement(4223007..4223186) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863301.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 gene rpmD CDS complement(4223193..4223693) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 gene rpsE CDS complement(4223708..4224061) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099023.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 gene rplR CDS complement(4224071..4224604) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099024.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene rplF CDS complement(4224617..4225009) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 gene rpsH CDS complement(4225040..4225345) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099026.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 gene rpsN CDS complement(4225360..4225899) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096206.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 gene rplE CDS complement(4225914..4226228) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 gene rplX CDS complement(4226239..4226610) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613954.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene rplN CDS complement(4226777..4227031) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438707.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene rpsQ CDS complement(4227031..4227222) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099027.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene rpmC CDS complement(4227222..4227632) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919759.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene rplP CDS complement(4227645..4228346) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 gene rpsC CDS complement(4228364..4228696) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919773.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 gene rplV CDS complement(4228711..4228989) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 gene rpsS CDS complement(4229006..4229827) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301859.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 gene rplB CDS complement(4229845..4230147) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617546.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 gene rplW CDS complement(4230144..4230749) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 gene rplD CDS complement(4230760..4231389) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863274.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 gene rplC CDS complement(4231422..4231733) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 gene rpsJ CDS 4232114..4232587 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099028.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(4232571..4233047) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 gene bfr CDS complement(4233120..4233314) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099030.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene bfd CDS complement(4233493..4234677) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023620081.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 gene tuf CDS complement(4234747..4236861) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099032.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 gene fusA CDS complement(4236958..4237428) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861706.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 gene rpsG CDS complement(4237525..4237899) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene rpsL CDS complement(4238024..4238311) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 gene tusB CDS complement(4238319..4238678) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099034.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 gene tusC CDS complement(4238678..4239064) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099035.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 gene tusD CDS complement(4239064..4239786) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861697.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(4239954..4240772) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099036.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 gene fkpA CDS 4241011..4241229 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(4241281..4241871) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861345.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 gene slyD CDS complement(4241966..4242166) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099038.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(4242180..4243985) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene kefB CDS complement(4243985..4244536) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099040.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 gene kefG CDS 4244669..4246573 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099041.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 4246589..4247521 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099042.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(4247617..4248513) product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420731.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene mdcH CDS complement(4248513..4249130) product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099044.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(4249133..4250092) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099045.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(4250216..4251019) product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099046.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene mdcE CDS complement(4251016..4251849) product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099047.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(4251842..4252141) product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099048.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 gene mdcC CDS complement(4252151..4253008) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099049.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS complement(4253008..4254663) product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 gene mdcA CDS 4254892..4255914 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099052.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 4255911..4256129 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 4256160..4257029 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099054.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(4257125..4257529) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027906.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 4257610..4257804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 4257840..4258472 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242758.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 gene crp CDS 4258530..4260617 product YccS/YhfK family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099057.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(4260614..4261849) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833535.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(4261922..4262485) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099059.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene pabA CDS complement(4262516..4263100) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099060.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(4263206..4263778) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099061.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 gene ppiA CDS complement(4263825..4264025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 4264057..4265241 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099062.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 gene tsgA CDS 4265500..4268043 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099064.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 gene nirB CDS 4268040..4268366 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099065.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 gene nirD CDS 4268501..4269874 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099066.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 gene cysG CDS 4270017..4270187 product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503029.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS complement(4270319..4271323) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099067.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 gene trpS CDS complement(4271316..4272077) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099068.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 gene gph CDS complement(4272070..4272747) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503032.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 gene rpe CDS complement(4272787..4273599) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099069.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene dam CDS complement(4273667..4274971) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099070.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 gene damX CDS complement(4275064..4276041) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420740.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 gene aroB CDS complement(4276210..4276731) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861630.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 gene aroK CDS complement(4277018..4278256) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420741.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 gene hofQ CDS complement(4278168..4278572) product HofP DNA utilization family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099075.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(4278562..4279014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420743.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(4279018..4279509) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099077.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(4279509..4280282) product pilus assembly protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099078.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 4280403..4282955 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene mrcA CDS complement(4283050..4283610) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099080.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 gene nudE CDS 4283938..4286076 product intracellular growth attenuator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099081.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 4286141..4286824 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099082.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 gene yrfG CDS 4286821..4287222 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099083.1 transl_table 11 codon_start 1 locus_tag LOCUS_41140 gene hslR CDS 4287247..4288125 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099084.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 gene hslO CDS complement(4288248..4290005) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099085.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 4290382..4291998 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099086.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 gene pckA CDS complement(4292090..4293427) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882169.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 gene envZ CDS complement(4293433..4294152) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 gene ompR CDS 4294381..4294854 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 gene greB CDS 4294942..4297272 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099091.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 4297592..4297819 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436417.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 gene feoA CDS 4297850..4300168 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099092.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 gene feoB CDS 4300180..4300416 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099093.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 gene feoC CDS complement(4300391..4301173) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099094.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 gene bioH CDS 4301197..4301412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS complement(4301510..4301842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 4301952..4302527 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369356.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene nfuA CDS 4302833..4304149 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099097.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 gene gntT CDS complement(4304236..4306317) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099098.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 gene malQ CDS complement(4306327..4308720) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099099.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 gene malP CDS 4309292..4311997 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420753.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 gene malT CDS complement(4312060..4312818) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099103.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(4312835..4313665) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099104.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 gene glpG CDS complement(4313713..4314045) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833569.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 gene glpE CDS 4314331..4315839 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099107.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 gene glpD CDS complement(4315930..4318377) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099108.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 gene glgP CDS complement(4318396..4319829) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099109.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene glgA CDS complement(4319829..4321124) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099110.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene glgC CDS complement(4321142..4323115) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099111.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene glgX CDS complement(4323112..4325298) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099112.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 gene glgB CDS complement(4325538..4326641) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099113.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 gene asd CDS 4326820..4327413 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861574.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene yhgN CDS 4327808..4328254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099115.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(4328408..4329748) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833577.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 gene gntU CDS complement(4329752..4330240) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420757.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 gene gntK CDS complement(4330406..4331401) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833579.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 gene gntR CDS complement(4331493..4332188) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639796.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS complement(4332312..4333349) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236295.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 4333661..4334149 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099120.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 gene yhhY CDS complement(4334237..4335982) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene ggt CDS 4336105..4336476 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099122.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS complement(4336466..4337206) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099123.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene ugpQ CDS complement(4337203..4338273) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099124.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(4338275..4339120) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099125.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene ugpE CDS complement(4339117..4340004) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099126.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene ugpA CDS complement(4340162..4341478) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 gene ugpB CDS complement(4341727..4342440) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099128.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 gene livF CDS complement(4342442..4343206) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099129.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 gene livG CDS complement(4343203..4344480) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099130.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene livM CDS complement(4344477..4345403) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099131.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene livH CDS complement(4345450..4346559) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099132.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 gene livK CDS 4346984..4347373 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099135.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 gene panM CDS complement(4347464..4348558) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833593.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 gene livJ CDS complement(4348762..4350027) product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099137.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(4350164..4351021) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500093.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 gene rpoH CDS complement(4351272..4352327) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099139.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 gene ftsX CDS complement(4352320..4352985) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 gene ftsE CDS complement(4352988..4354448) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099141.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene ftsY CDS 4354575..4355177 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883606.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 gene rsmD CDS 4355161..4355442 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099143.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS complement(4355526..4355885) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420764.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS 4356015..4356641 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099145.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 4356718..4358889 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099146.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 gene zntA CDS complement(4358983..4360269) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099149.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(4360280..4360789) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099148.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(4360802..4361773) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(4362008..4362250) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833603.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 gene tusA CDS 4362420..4363085 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099151.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 4363158..4363715 product DcrB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099152.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 4363851..4364900 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099154.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 4365026..4365748 product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099155.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 4365745..4366560 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099156.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 4366541..4366798 product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010436544.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 4366810..4367061 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099157.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 4367033..4367632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099158.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 4367625..4368971 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099159.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 4368958..4369308 product hydroxymyristoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099160.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS 4369299..4370990 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099161.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 4370994..4371416 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099162.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS 4371413..4372018 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099163.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 4372005..4374308 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149367168.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 4374305..4374883 product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099165.1 transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS 4374885..4376051 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216358298.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 4376051..4376524 product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099167.1 transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 4376521..4377249 product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099168.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 4377246..4378475 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099169.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 4378478..4379071 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284366.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 gene acpT CDS complement(4379130..4379636) product phenolic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099178.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 4379736..4380617 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420773.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 4380650..4381444 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099180.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 4381551..4382213 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS complement(4382274..4383299) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099182.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 4383685..4384962 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214577462.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS complement(4384999..4385736) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099184.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 4385906..4386598 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099185.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 4386598..4387542 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099186.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS complement(4387912..4388346) product copper resistance system metallochaperone PcoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723069.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 gene pcoE CDS complement(4388564..4389964) product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211180.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene pcoS CDS complement(4389961..4390641) product copper response regulator transcription factor PcoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188930.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 gene pcoR CDS complement(4390696..4391625) product copper resistance inner membrane protein PcoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998778.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene pcoD CDS complement(4391630..4392010) product copper resistance system metallochaperone PcoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025662.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 gene pcoC CDS complement(4392050..4392946) product copper resistance outer membrane transporter PcoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378118.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 gene pcoB CDS complement(4392946..4394769) product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925242.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 gene pcoA CDS 4394998..4395447 product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023257.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS 4395736..4396473 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287501.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 CDS complement(4396507..4396704) product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843494.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS complement(4396745..4398550) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001378038.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 4398923..4399138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS complement(4399319..4399759) product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758228.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS complement(4399846..4402992) product Cu(+)/Ag(+) efflux RND transporter permease subunit SilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087115.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene silA CDS complement(4403003..4404295) product Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087116.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene silB CDS complement(4404409..4404762) product cation efflux system protein CusF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246153.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 gene cusF CDS complement(4404791..4406176) product Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475506.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 gene silC CDS 4406366..4407046 product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 gene silR CDS 4407039..4408520 product copper/silver sensor histidine kinase SilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555736.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene silS CDS 4408765..4409196 product silver-binding protein SilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790485.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene silE CDS 4409344..4409694 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647571.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(4409863..4411689) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239419.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(4412252..4412551) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097216.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(4415143..4415973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 note possible pseudo, frameshifted CDS complement(4416000..4416263) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745635.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS complement(4416297..4417280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS complement(4417267..4417755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 4417819..4418061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(4418252..4419454) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420964.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 4419683..4421182 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099193.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene pitA CDS complement(4421237..4421572) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861224.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene uspB CDS 4421856..4422293 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861223.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene uspA CDS complement(4422386..4423138) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017384177.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene rsmJ CDS complement(4423146..4425188) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099196.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 gene prlC CDS 4425366..4426208 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099197.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 4426279..4427631 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099198.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 gene gorA CDS 4427803..4428090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS 4428332..4429981 product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099199.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(4430081..4431664) product STY4199 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099200.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 4431814..4432347 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099201.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 4432425..4432763 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099202.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS complement(4432742..4433344) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420781.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(4433519..4434277) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099204.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 4434415..4435296 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS 4435341..4436372 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099206.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 gene yhjD CDS 4436633..4437955 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099207.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(4438466..4440463) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099208.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(4440574..4441347) product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099209.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 gene pdeH CDS 4441578..4442507 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099211.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(4442558..4444048) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099212.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(4444271..4445557) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099213.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(4445717..4447690) product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene hmsP CDS complement(4447844..4451326) product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099215.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 gene bcsC CDS complement(4451308..4452309) product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099216.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 gene bcsZ CDS complement(4452421..4454844) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099217.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene bcsB CDS complement(4454855..4456198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 note possible pseudo, internal stop codon CDS complement(4456211..4457470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 note possible pseudo, internal stop codon CDS complement(4457467..4458219) product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099219.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene bcsQ CDS complement(4458231..4458419) product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099220.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 gene bcsR CDS 4458594..4460156 product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099221.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 gene bcsE CDS 4460153..4460347 product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099222.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 gene bcsF CDS 4460340..4462019 product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099223.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 gene bcsG CDS complement(4462052..4463014) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099224.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene birA CDS complement(4463011..4464039) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099225.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 gene murB rRNA complement(4464177..4464287) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA complement(4464364..4467266) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 tRNA complement(4467440..4467515) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(4467621..4467697) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 rRNA complement(4467769..4469306) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 CDS complement(4469665..4470210) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099226.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 gene hemG CDS complement(4470221..4471672) product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099227.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 gene trkH CDS complement(4471714..4472328) product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099228.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(4472328..4473659) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099229.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 gene pepQ CDS 4473850..4476039 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099230.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene fadB CDS 4476049..4477212 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099231.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 gene fadA CDS complement(4477358..4479427) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094970.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene glyS CDS complement(4479437..4480348) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860141.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene glyQ CDS complement(4480509..4480715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 4480999..4481994 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094968.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS complement(4482047..4483501) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094965.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 gene xylB CDS complement(4483561..4484883) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014830210.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 gene xylA CDS 4485255..4486247 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094963.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene xylF CDS 4486320..4487861 product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094962.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 4487839..4489020 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094961.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 gene gguB CDS 4489054..4490232 product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094960.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS complement(4490268..4490840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 4491407..4493437 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418400.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 4494062..4495315 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094957.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 gene avtA CDS 4495383..4495670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(4495782..4496600) product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094955.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 gene yiaJ CDS 4496825..4497823 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094954.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 gene yiaK CDS 4497834..4498301 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094953.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 4498328..4499254 product DUF4862 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094952.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS 4499300..4500619 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094951.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 4500696..4502201 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094950.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 4502198..4502851 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094949.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene ulaD CDS 4502854..4503714 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094948.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 4503708..4504403 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094947.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 gene araD CDS complement(4504404..4505009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 4505449..4506849 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094945.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 4506860..4508809 product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(4508947..4510485) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094940.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS 4510652..4511536 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188270.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(4511540..4513378) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094939.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 gene selB CDS complement(4513375..4514760) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094938.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene selA CDS complement(4514864..4515472) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094937.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 4515909..4517816 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 4517918..4519066 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094932.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 gene mtlD CDS 4519063..4519653 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094931.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 gene mtlR CDS 4519712..4520074 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369186.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS complement(4520107..4521201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(4521211..4523691) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129197795.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS complement(4523696..4524295) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815806.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(4524401..4524991) product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098749.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 4526082..4527737 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094927.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 gene lldP CDS 4527734..4528507 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686511.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 gene lldR CDS 4528504..4529691 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094925.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 gene lldD CDS 4529872..4531212 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094924.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 4531258..4531731 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 gene trmL CDS complement(4531770..4533245) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099283.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 gene ilvC CDS 4533389..4534288 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099284.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 gene ilvY CDS complement(4534334..4535881) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833732.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 gene ilvA CDS complement(4535881..4537731) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099286.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 gene ilvD CDS complement(4537792..4538721) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene ilvE CDS complement(4538740..4539003) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860184.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene ilvM CDS complement(4539000..4540646) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099288.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene ilvG CDS 4541225..4542745 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099289.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(4542773..4543111) product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 4543218..4544051 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099291.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 gene hdfR tRNA complement(4544151..4544226) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA complement(4544279..4544355) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 rRNA complement(4544414..4544524) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA complement(4544716..4547617) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 tRNA complement(4547791..4547866) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(4547972..4548048) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 rRNA complement(4548120..4549657) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 CDS complement(4550046..4550897) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420807.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene murI CDS complement(4550842..4552689) product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703958.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 gene btuB CDS 4553036..4554136 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099295.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 gene trmA CDS complement(4554217..4554576) product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501783.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(4554586..4555221) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501784.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 gene fabR CDS 4555421..4556821 product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833741.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 gene sthA CDS complement(4556804..4557721) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099297.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 gene oxyR CDS complement(4558037..4559410) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099298.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 gene argH CDS complement(4559516..4560289) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686923.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 gene argB CDS complement(4560299..4561303) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099300.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 gene argC CDS 4561392..4562543 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene argE CDS 4562815..4565466 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099302.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 gene ppc CDS 4565466..4565660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 4565673..4566776 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099305.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(4566868..4569048) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099306.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 gene katG CDS complement(4569193..4570083) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099307.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 gene metF CDS complement(4570310..4572742) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099308.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(4572745..4573905) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099309.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene metB CDS 4574181..4574498 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862042.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene metJ CDS complement(4574541..4575221) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378721.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(4575554..4576363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 note possible pseudo, frameshifted CDS complement(4576396..4576911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43530 note possible pseudo, frameshifted CDS complement(4576987..4577199) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862040.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 gene rpmE CDS 4577400..4579595 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099310.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 gene priA CDS 4579708..4580733 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099311.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene cytR CDS 4580931..4581794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 4581889..4582419 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501802.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 gene hslV CDS 4582429..4583760 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099313.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 gene hslU CDS 4583829..4584749 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099314.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 gene menA CDS 4584842..4585327 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703948.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 gene rraA CDS complement(4585914..4586153) product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099316.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 gene zapB CDS 4586553..4587398 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099317.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS 4587420..4588928 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099318.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 gene glpK CDS 4589050..4590060 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099319.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 gene glpX CDS 4590157..4590903 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099320.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 gene fpr CDS complement(4590904..4591323) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099321.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS 4591475..4592032 product DUF1454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099322.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS 4592144..4592911 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862019.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene tpiA CDS complement(4592993..4594297) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099324.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(4594371..4595114) product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099325.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(4595226..4596215) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099326.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(4596433..4597395) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099327.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 gene pfkA CDS complement(4597580..4598464) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099328.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 gene fieF CDS complement(4598618..4599124) product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099329.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 gene cpxP CDS 4599341..4599973 product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862004.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 gene cpxR CDS 4599970..4601343 product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099331.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 gene cpxA CDS complement(4601397..4602071) product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099332.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 gene yiiM CDS complement(4602138..4602758) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861999.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 gene sodA CDS 4603047..4604081 product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099333.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene rhaT CDS complement(4604082..4604930) product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099334.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 gene rhaR CDS complement(4605004..4605840) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099335.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 gene rhaS CDS 4606142..4607611 product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099337.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 gene rhaB CDS 4607608..4608867 product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099338.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 gene rhaA CDS 4608964..4609794 product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099339.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 gene rhaD CDS 4609877..4610863 product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004436001.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene rhaS CDS 4610970..4612472 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968715.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 4612472..4613476 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973085.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 4613473..4614477 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 4614575..4615723 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099340.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 gene fucO CDS 4615720..4616034 product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099341.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 gene rhaM CDS complement(4616022..4617299) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099342.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(4617344..4619467) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420832.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(4619573..4620568) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099344.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(4620586..4621134) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099345.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS 4621238..4621897 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099346.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 4621897..4622220 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099347.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS complement(4622263..4622862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099348.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(4622853..4625276) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099349.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(4625307..4625990) product fimbria/pilus chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099350.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(4626068..4626775) product DUF1120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099351.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(4627225..4627437) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099352.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(4627552..4628388) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099353.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 gene fdhD CDS 4628760..4631810 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086527976.1 transl_table 11 codon_start 1 transl_except (pos:4629345..4629347,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_44040 gene fdnG CDS 4631823..4632725 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099356.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene fdxH CDS 4632722..4633357 product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099357.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene fdoI CDS 4633354..4634283 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099358.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 gene fdhE CDS complement(4634323..4634694) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238494.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(4634697..4634939) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001523745.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 4635138..4636058 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099361.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS complement(4636067..4637008) product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099362.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 gene fabY CDS complement(4637053..4637490) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099363.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 gene dtd CDS complement(4637487..4638368) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099364.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS complement(4638362..4638961) product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099365.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 gene yihX CDS complement(4639080..4639880) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099366.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(4639915..4640811) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420843.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 4640967..4641857 product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 gene yihU CDS 4641875..4642750 product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420844.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 gene yihT CDS 4642765..4644006 product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099370.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 gene yihS CDS 4644023..4646047 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099371.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 4646093..4647475 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099372.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 4647519..4648952 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420847.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(4649134..4650138) product IS110-like element IS4321 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427623.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS 4650344..4651030 product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099374.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 gene ompL CDS complement(4651111..4652934) product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368970.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 gene typA CDS 4653312..4654721 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 gene glnA CDS 4654889..4655938 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501857.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 gene glnL CDS 4655950..4657362 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099377.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 gene glnG CDS complement(4657684..4659057) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099379.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 gene hemN CDS complement(4659246..4659761) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099380.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 gene yihI CDS 4660341..4660970 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099382.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 gene yihA CDS complement(4661282..4663960) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 gene polA CDS 4664006..4664236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS 4664673..4665422 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099384.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(4665445..4666068) product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099385.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 gene dsbA CDS complement(4666096..4667082) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099386.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(4667158..4667427) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099387.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS 4667553..4668080 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099388.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 gene mobA CDS 4668077..4668580 product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099389.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 gene mobB rRNA complement(4668683..4668793) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 rRNA complement(4668865..4671766) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 tRNA complement(4671952..4672027) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 rRNA complement(4672113..4673650) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 CDS 4674104..4674811 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099390.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS 4674808..4676241 product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099391.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 gene mdtD CDS complement(4676207..4677199) product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099392.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 gene rbsR CDS complement(4677203..4678132) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420966.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 gene rbsK CDS complement(4678241..4679131) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099394.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 gene rbsB CDS complement(4679159..4680124) product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099395.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 gene rbsC CDS complement(4680129..4681634) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099396.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 gene rbsA CDS complement(4681642..4682061) product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099397.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 gene rbsD CDS complement(4682259..4684127) product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099398.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 gene kup CDS 4684350..4685846 product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099399.1 transl_table 11 codon_start 1 locus_tag LOCUS_44490 gene ravA CDS 4685840..4687291 product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099400.1 transl_table 11 codon_start 1 locus_tag LOCUS_44500 gene viaA CDS complement(4687292..4688284) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099401.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 gene asnA CDS 4688436..4688894 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 gene asnC CDS 4688985..4689434 product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099402.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 gene mioC CDS 4689809..4691698 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500196.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 gene mnmG CDS 4691806..4692429 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 gene rsmG CDS 4693046..4693426 product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500194.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene atpI CDS 4693435..4694250 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099405.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 gene atpB CDS 4694300..4694539 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 gene atpE CDS 4694588..4695058 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099406.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 gene atpF CDS 4695073..4695606 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099407.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 gene atpH CDS 4695619..4697160 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 gene atpA CDS 4697212..4698075 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862364.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 gene atpG CDS 4698107..4699489 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862362.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 gene atpD CDS 4699510..4699929 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006177560.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS 4700068..4701438 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099408.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 gene glmU CDS 4701664..4703493 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099409.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 gene glmS CDS 4703825..4704349 product long polar fimbria major subunit LpfA-O113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827808.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS 4704445..4705128 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989263.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS 4705149..4707632 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168513.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS 4707642..4708694 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046010.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS 4708941..4709981 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099410.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 gene pstS CDS 4710110..4711069 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099411.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 gene pstC CDS 4711069..4711959 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212190.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 gene pstA CDS 4712007..4712780 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 gene pstB CDS 4712807..4713532 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500182.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 gene phoU CDS complement(4713577..4714242) product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099413.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 gene yieH CDS 4714408..4715745 product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023621401.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 gene adeP CDS complement(4715834..4716400) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099415.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(4716437..4717030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099416.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(4717306..4718277) product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749373.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 gene yidZ CDS complement(4718246..4719421) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120159032.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(4719604..4719846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(4720171..4721535) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099418.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 gene mnmE CDS complement(4721608..4723251) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099419.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 gene yidC CDS complement(4723475..4723801) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099420.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 gene rnpA