COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..430122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(231..620) product DUF1310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1156..2673) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356617.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2989..4389 product Ktr system potassium uptake protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385738.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(4436..5710) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(5963..9502) product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene nifJ CDS complement(9508..10953) product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene gltA CDS complement(10946..11785) product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(11850..12293) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356612.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(12583..13413) product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene yqeB CDS complement(13392..14132) product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene yqeC CDS complement(14120..14377) product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387137.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(14393..14983) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356602.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene yedF CDS complement(15000..16022) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene selD CDS complement(16041..17192) product selenocysteine lyase SclA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene sclA CDS complement(17194..17793) product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene mocA CDS complement(17908..20481) product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene xdh CDS complement(20725..21753) product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(21750..22136) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(22425..23744) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(23844..24224) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(24254..25192) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene arcC CDS complement(25512..26705) product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene ygeW CDS complement(26813..28129) product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(28135..29328) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene dpaL CDS complement(29382..30764) product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene hydA CDS complement(30814..33825) product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene ygfK CDS complement(33864..35198) product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene ssnA CDS 35624..36262 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 36434..37771 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356584.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 37895..38590 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(38633..39607) product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene manA CDS complement(39650..40690) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(40726..41562) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(42005..43240) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(43237..43947) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436744.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(43959..45122) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(45370..45555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(45824..46411) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 46941..47855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(47915..49363) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(49515..51404) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359609.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(51586..52428) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 52708..53001 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 53143..53763 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(53809..54975) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(54980..55342) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356567.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(55588..56223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(56737..56913) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(56927..58225) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene murA CDS complement(58332..58568) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(58869..59288) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(59306..60712) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene atpD CDS complement(60856..61776) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(61792..63348) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene atpA CDS complement(63377..63919) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356554.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene atpH CDS complement(63906..64433) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365031.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene atpF CDS complement(65034..65246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(65289..65879) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene atpB CDS complement(66343..66807) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene smpB CDS complement(66825..69173) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene rnr CDS complement(69170..69934) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(70080..70316) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene secG CDS complement(70461..70736) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(70739..71011) product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(71164..72954) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(73396..75864) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646275.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 repeat_region 76121..76753 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactcactcaaatagagtgagac CDS complement(76941..77768) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287302.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene nadE CDS complement(77907..79379) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356538.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(79461..79871) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(79978..80610) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(80623..81714) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289599.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 81836..82768 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015509966.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 82783..83928 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 83915..85099 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296167.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(85224..85580) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 85741..86499 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287306.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(86696..87397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(87477..88328) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(88545..89615) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(89615..90646) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(90671..92350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(92373..93110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(93110..94081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(94078..96672) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(96746..97420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(97443..98177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(98204..98872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(98894..99946) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(100047..100862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(100893..101696) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(101700..102044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(102064..105168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(105227..106558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(106809..107531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(107901..109028) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 109723..110466 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(110723..111658) product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene lacC CDS complement(111721..112719) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene lacD CDS complement(112774..113949) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(114001..114723) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(114832..115857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(115847..116647) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704758.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene agaW CDS complement(116665..117141) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene agaV CDS complement(117183..117476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(117479..117919) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(118254..120182) product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382428.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(120261..125843) product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(125920..127071) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357814.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene nagA CDS complement(127837..129465) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362559.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene groL CDS complement(129531..129815) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene groES CDS 130066..130248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356530.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 130311..130991 product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(131044..131709) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 131926..133866 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 133887..134519 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356525.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 134467..134703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(134722..135411) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356006.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(135424..138111) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene acnA CDS 138196..139113 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026892922.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(139105..140472) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(140497..141636) product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 142253..143443 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069639775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 143436..145151 product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(145485..147920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(147914..148696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 148835..149467 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 149721..151691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(151923..152249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(152754..153695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 153893..154192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 154352..154651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 154666..154905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 154972..155139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 155504..157687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 157823..158632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 158613..158768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 158874..160535 product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene tndX CDS 160823..161410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(161717..163030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(163459..165900) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 166084..167244 product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(168372..169445) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021367800.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(169435..170124) product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene vanR CDS complement(170192..172294) product serine racemase VanT catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene vanT CDS complement(172284..172865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(172837..173895) product D-alanine--D-serine ligase VanG-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene vanG CDS complement(174633..175838) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(175881..176093) product DUF3173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(176548..176733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(176749..177156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(177213..177641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010767732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(177963..178685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 178950..179726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 179719..180261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(180716..180853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 note possible pseudo, frameshifted CDS complement(182889..183731) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(184195..185142) product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 note possible pseudo, internal stop codon CDS complement(186048..186311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 note possible pseudo, internal stop codon, frameshifted CDS 186775..187068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 note possible pseudo, internal stop codon, frameshifted CDS 187496..187684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 note possible pseudo, internal stop codon, frameshifted CDS complement(188239..189903) product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(189915..190718) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(190733..191959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(191989..193119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(193109..194818) product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(194811..195353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(195350..195868) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene dcd CDS complement(195898..197154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 197308..198117 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 198117..199100 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 199093..199899 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 200101..200676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 note possible pseudo, internal stop codon, frameshifted CDS 201009..201470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 note possible pseudo, frameshifted CDS 201556..201738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 201805..203391 product IS1182-like element ISSep1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(203311..205500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 note possible pseudo, internal stop codon CDS complement(205567..206481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 note possible pseudo, internal stop codon CDS complement(206536..207660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(207951..209024) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(209021..209857) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356512.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(209854..210663) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(210675..211760) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(211884..212426) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(212619..213137) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854121.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 213401..214393 product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 214408..215181 product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene coaB CDS 215178..215720 product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene coaC CDS 215737..216381 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(216495..217700) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(217858..218364) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 218600..219559 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(219751..220866) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906196.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(221009..223597) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379735.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(223630..224259) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 224463..224843 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383777.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(224898..225404) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene trmL CDS complement(225649..226494) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 226634..227266 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene cutC CDS complement(227409..227657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(227787..228425) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(228605..229966) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene mgtE CDS complement(229986..230879) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(230887..231684) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(231695..232375) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 232571..233155 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356483.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 233273..233923 product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368840.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(233978..235795) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene pepF CDS complement(235833..237023) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(237120..237770) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356478.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(238027..238425) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356477.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene spxA CDS 238789..239802 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene trpS CDS complement(239972..241687) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 241935..242282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 242200..242478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 242785..243495 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(243490..243669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(243883..247080) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(247101..250244) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(250246..251385) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706825.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(251545..252165) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 252324..252740 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389917.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 252771..253505 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356457.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 253495..253770 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304776.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 253864..254079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(254052..255152) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(255378..255926) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(255954..256646) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356454.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(256663..256959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(256956..257537) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356449.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(257736..258428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 258704..259369 product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356448.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 259589..260776 product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(261135..261461) product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899964.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(261458..262009) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 262350..263177 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 263202..263723 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(263935..265803) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(266413..267669) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene ilvA CDS complement(267757..268752) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene ilvC CDS complement(268807..269289) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene ilvN CDS complement(269291..270985) product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene ilvB CDS complement(270999..272690) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene ilvD CDS complement(273160..273675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(273685..273843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 273902..274498 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene clpP CDS 274602..275123 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(275579..276514) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene whiA CDS complement(276545..277543) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355627.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(277540..278424) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene rapZ CDS complement(279075..279281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(279711..282527) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene uvrA CDS complement(282719..284713) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene uvrB CDS 285172..287331 product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361277.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 287333..288070 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 288886..289314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(289428..290369) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773450.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(290572..290943) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(291117..292508) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(292746..293132) product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358717.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(293271..294614) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(294783..295052) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(295335..295766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(295850..296737) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(296730..297131) product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 297201..297335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(297540..298097) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(298097..299026) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(299337..299867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(299891..301900) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(301911..302576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(302560..303264) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(303257..303622) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721861.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 303923..304474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(304551..304805) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(304795..305100) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(305100..306752) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387331.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(306752..307066) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365287.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 307370..307939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 308338..308631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 308646..309290 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 309274..310692 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 311272..313608 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(313654..314736) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(314752..315039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(315451..315999) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272617.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 316114..316485 product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene fra CDS complement(318081..318659) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(318885..319121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 319349..319711 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(319938..320066) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(320068..321438) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene rlmD CDS complement(321571..322212) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(322235..322915) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene pnuC CDS complement(323237..324295) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355572.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(324312..325742) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene gatB CDS complement(325742..327211) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene gatA CDS complement(327211..327516) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene gatC CDS complement(327717..329762) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene ligA CDS complement(329965..332205) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene pcrA repeat_region 332370..334094 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactcactcaataaagagtgagac CDS complement(334371..335858) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905850.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 336044..336796 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 336793..337707 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358692.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene pfkB CDS 337956..339869 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 340078..340854 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(341261..342592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(342838..344076) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(344209..345576) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene allB CDS complement(345700..347160) product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(347338..348558) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358375.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(348611..349879) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(350092..351300) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387333.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 351671..353311 product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365289.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(353372..354310) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene arcC CDS complement(354323..355165) product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355250.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(355178..356446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 note possible pseudo, internal stop codon CDS complement(356462..358219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 note possible pseudo, internal stop codon CDS complement(358290..359339) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene allD CDS complement(359618..360685) product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene allD CDS complement(360706..361491) product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene allE CDS complement(361513..362739) product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene allC CDS 363274..364137 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(364216..365499) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene tig CDS 365763..365981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(366237..367241) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774220.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(367254..368303) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(368331..369161) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002401797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(369145..369933) product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357107.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(369948..370418) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(370438..370854) product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(370927..373698) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(373899..374867) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(375654..377381) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287603.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene ptsP CDS complement(377381..377647) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(377821..378012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366170.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 378342..380597 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386935.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 380801..381115 product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355547.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(381212..381871) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(382090..383667) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 384171..385661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(385714..387093) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363168.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(387338..388483) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(388704..388889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 389036..389470 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(389793..390326) product biofilm phosphatase Bph inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355538.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene bph repeat_region 390534..391642 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccactagctctaaacagagctagac CDS complement(391808..392983) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene mutY CDS complement(392973..393773) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene recX CDS 393911..395281 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rlmD CDS complement(395344..396768) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(396787..397131) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439961.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(397136..398389) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(398411..398731) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898152.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 398960..400858 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(400945..401187) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568375.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(401302..401565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(401723..402088) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rplL CDS complement(402150..402650) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rplJ CDS complement(402970..403659) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene rplA CDS complement(403770..404192) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rplK CDS 404482..405150 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene sdaAB CDS 405176..406063 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362308.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene sdaAA CDS complement(406111..406560) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(406635..407495) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053126304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(407663..408562) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rbsK CDS complement(408579..409046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(409082..410455) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene dcuC CDS complement(410471..411391) product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene rihC CDS complement(411536..412552) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(412589..413455) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(413568..414110) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene nusG CDS complement(414279..414449) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356409.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene secE CDS complement(414467..414619) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356408.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rpmG CDS 414768..415412 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365057.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene cbpA CDS complement(415451..416353) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene murB CDS complement(416425..417339) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 417745..418503 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 418788..419321 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 419409..420170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(420301..421326) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(421509..423197) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(423292..423855) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene ahpC CDS complement(424207..425058) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(425134..425760) product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(425836..426516) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(426728..427093) product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379381.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(427080..427415) product PadR family transcriptional regulator LftR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene lftR CDS complement(427606..428610) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(428623..429363) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 misc_feature complement(429526..>430122) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989519.1:MucBP domain-containing protein locus_tag LOCUS_03880 sequence02 source 1..142719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1791) product DUF1958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 2339..3100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 note possible pseudo, internal stop codon CDS 3233..4033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 note possible pseudo, internal stop codon CDS 4033..4251 product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 4268..5152 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 5223..5510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383233.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(5579..7027) product DUF1958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 7243..7485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 7418..8032 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene gmk CDS 8037..8342 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene rpoZ CDS 8561..10993 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene priA CDS 11054..11548 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene def CDS 11541..12482 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene fmt CDS 12488..13852 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene rsmB CDS 13868..14617 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 14614..16800 product serine/threonine protein kinase IreK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene ireK CDS 16990..17889 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene rsgA CDS 17903..18553 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene rpe CDS 18568..19194 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(19239..19427) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene rpmB CDS 19694..20056 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 20316..21989 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 22093..24129 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370092.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene recG CDS 24328..25326 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene plsX CDS 25470..25709 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene acpP CDS 25971..26978 product oligopeptide ABC transporter ATP-binding protein Opp2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene opp2D CDS 26978..27922 product oligopeptide ABC transporter ATP-binding protein Opp2F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene opp2F CDS 27922..28884 product oligopeptide ABC transporter permease Opp2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354943.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene opp2B CDS 28916..29821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287893.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 29839..31617 product oligopeptide ABC transporter substrate-binding protein Opp2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene opp2A CDS 31869..33065 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 33189..33311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 33326..33574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 33760..34158 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293327.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene ndk CDS 34404..35096 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene rnc CDS 35120..38698 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene smc CDS 38722..39549 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 39550..40779 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387379.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene ftsY CDS complement(40842..41636) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(41659..42501) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 42658..43020 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(43432..44310) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354953.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(44496..44993) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 45220..47490 product bifunctional glutamate--cysteine ligase/glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene gshAB CDS complement(47644..48090) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287902.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 48317..49264 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 49261..50229 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 50226..50984 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 51133..52095 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(52168..53424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 54308..55984 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 56008..57243 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene pepT CDS 57818..58372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 58388..59752 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene trpE CDS 59749..60333 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 60326..61339 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene trpD CDS 61341..62099 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene trpC CDS 62096..62686 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 63397..64590 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723934.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene trpB CDS 64587..65354 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene trpA CDS 65437..66006 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 66039..66650 product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(66692..67237) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene lepB CDS 67420..68505 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 68521..69192 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296462.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 69202..69351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(69421..70032) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene rpsD CDS 70662..71459 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 71555..72202 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 72225..73001 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361040.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 73210..74181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(74277..74840) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene def CDS 75117..75386 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene rpsO CDS 75598..77712 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene pnp CDS 77839..78759 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene mreC CDS 78767..79276 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene mreD CDS 79521..80846 product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 81157..82458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(82567..84372) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 84489..84992 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 85188..85580 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 85659..85868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 86257..86982 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 87058..87585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 87608..88006 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(88155..89081) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(89100..89387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364844.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 89497..89718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 89715..90704 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene lacD CDS 91037..92149 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219410.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ald CDS 92259..92390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 92509..93003 product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 93114..94046 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 94321..95835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(95863..97353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 97586..98275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 98643..98957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 98989..100044 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641619.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 100046..100366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 100381..100605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 100674..101387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 101484..102506 product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene elrE CDS 102538..105066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 105131..105697 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 105797..106375 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 106397..106816 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 106907..107758 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 108022..108759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 108882..110276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(110360..111358) product penicillin V amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene yxeI CDS 111597..112463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(112743..113744) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484988.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(113828..114547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 114807..115484 product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145511.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 115669..117453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(117560..117946) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(118092..119516) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(119563..121461) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(121602..122450) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(123145..123753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(123842..124168) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 124525..125793 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379246.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 125919..126242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 126340..127848 product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 128412..128558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 128610..129455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 129439..130068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 130073..131026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 131042..132091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 132115..132795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 132801..133412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 133713..134018 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 134194..135246 product arsenite efflux transporter Acr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398718.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene acr3 CDS 135252..135653 product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene arsC CDS complement(136033..136911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 137175..138230 product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202342.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 138205..138888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 139006..140583 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 141450..142133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(142306..142662) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931406.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 sequence03 source 1..135570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..1021) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(1021..1770) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355079.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(1793..2290) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355078.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(2307..2714) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(3203..6025) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 6188..6667 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(6786..7403) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294697.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(7408..8271) product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(8296..8697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(8712..10001) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(10031..10336) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(10375..12459) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(12676..12876) product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(12913..13359) product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379040.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(13606..14124) product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(14140..15498) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene celB CDS complement(15520..15849) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357981.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(15874..16827) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(16993..17316) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(17406..18281) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721398.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 18613..19227 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(19297..20616) product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(20647..21369) product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(21446..22264) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(22412..22945) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(23107..23790) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(23787..24695) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene hemC CDS complement(24742..25527) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(25903..26883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(26886..27191) product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene nirD CDS complement(27194..29602) product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene nirB CDS complement(29815..30372) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(30369..30809) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(30919..31365) product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(31353..32090) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(32101..32748) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(32745..33764) product nitrate respiration regulation sensor histidine kinase NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene nreB CDS complement(33774..34202) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810452.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 34305..35819 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 35967..36737 product transcriptional regulator GenR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene genR CDS 36862..37281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 37523..38854 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene genB CDS 38979..40409 product 6-phospho-beta-glucosidase GenA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene genA CDS complement(40630..41163) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 41322..41723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 41727..41927 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(42031..42954) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(42954..43784) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(43784..45151) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(45175..45456) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(45453..47504) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(47696..48130) product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(48161..49048) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 49441..50040 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567793.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 50047..50859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 51082..52314 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748651.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene celB CDS 52388..53110 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(53166..54566) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922527.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(54711..55469) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene fetB CDS complement(55466..56107) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(56430..57422) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(57468..58907) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(59128..59877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(59874..60848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(60845..63448) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(63467..63919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(64101..64763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(64786..65451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(65471..66538) product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene elrE CDS complement(66635..67441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(67473..68276) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(68281..68610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(68628..72356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(72462..73151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(73738..74472) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 74474..74674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(74929..75774) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358647.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(75800..76396) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(76560..76925) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(76939..77577) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 77681..77992 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(78036..78977) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(79180..80463) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(80464..81144) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(81394..82524) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102099.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(82695..83381) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358569.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(83381..86041) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088934995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(86057..86587) product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(86690..88750) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene kdpB CDS complement(88771..90453) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene kdpA CDS complement(90684..92519) product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(92867..93340) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(93425..95761) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705665.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 95950..97146 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 97149..98567 product multidrug efflux MFS transporter NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 98560..99705 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(99879..101135) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(101548..102879) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(103114..103824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(103742..104956) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(105120..105953) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(106015..106938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(106989..107303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(107321..110137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(110443..111942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 112480..113007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(113117..114643) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(114687..115877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(115893..116672) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene phnE CDS complement(116672..117451) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene phnE CDS complement(117451..118215) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene phnC CDS complement(118299..119210) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 119971..120450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(120540..121547) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(121586..122350) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(122353..123444) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(123488..124093) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(124385..127285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(127757..128293) product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 128392..128601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(128841..133712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(133940..134992) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 sequence04 source 1..123368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..1334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 1349..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 2025..2192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(3071..3241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(3234..3425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 3723..4175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 4659..4946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 4943..5317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 5307..6026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(6215..8428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 9106..10395 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 10494..10766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 10895..12019 product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene anmK CDS 12103..12954 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(13109..14137) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 14327..15580 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357154.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene clpX CDS 15730..16314 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene yihA CDS complement(16357..16506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 16725..17015 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene yidD CDS 17035..17910 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 18283..19449 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 19564..20442 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 20452..21420 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 21401..22177 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 22177..22878 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 22883..23536 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 23784..24353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 24355..25125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 25144..25998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 26091..26324 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357806.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 tRNA 26462..26536 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 26553..26623 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 assembly_gap 26680..26735 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26989..27828 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 27984..29885 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 tRNA 30017..30090 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 30212..30397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(30474..31082) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 31275..35525 product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382252.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 35669..37747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 38225..38932 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357800.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(38995..39501) product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385866.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(39670..40434) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(40512..40748) product DUF2829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357284.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(40738..41397) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 41593..41880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357286.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 41993..42319 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 42721..44049 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774215.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 44084..44725 product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 44863..45414 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene raiA CDS 45736..48267 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289770.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene secA CDS 48465..49448 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene prfB CDS 49556..50242 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene ftsE CDS 50235..51119 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene ftsX CDS 51221..52669 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304589.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene cls CDS 52856..53710 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 54115..55035 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene pstC CDS 55035..55919 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene pstA CDS 55936..56736 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene pstB CDS 56747..57505 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene pstB CDS 57523..58194 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene phoU CDS 58410..59789 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene uhpT CDS 59805..60566 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 60638..61576 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356565.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 61789..62457 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene deoC CDS 62526..63707 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876181.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 63739..64920 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723601.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene deoB CDS 64942..66240 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181618.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 66496..68094 product daptomycin-sensing surface protein LiaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene liaX CDS 68244..68561 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 68561..68920 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(68968..69936) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 70139..71077 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene hprK CDS 71570..72400 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene lgt CDS 72566..73582 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 73604..74500 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene galU CDS 74720..75163 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289575.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 75188..75778 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(75838..76938) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 77153..78154 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene ccpA CDS 78348..78977 product galactoside O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640105.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene lacA CDS complement(79044..81476) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(81658..81999) product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 82163..82834 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 82848..83300 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 83606..84496 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 84839..85060 product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357397.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 85228..86979 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 86979..88763 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357399.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 89033..90376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 90571..91299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 91667..92602 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene trxB CDS 92901..93257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 94090..96702 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene mgtA CDS 97272..98387 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene pdhA CDS 98390..99367 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 99504..101150 product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 101158..102564 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene lpdA CDS complement(102685..102999) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(103632..104900) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021122.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene tyrS CDS 105541..106947 product tyrosine-tyramine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene tyrP CDS 107012..108865 product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355450.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene tdc CDS 109093..110460 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363118.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene nhaC CDS complement(110518..110946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 111070..112239 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 112347..112895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(113170..114213) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357754.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 114565..114936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 sequence05 source 1..114820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(156..1652) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene lysS CDS complement(1747..2751) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356263.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene dusB CDS complement(2764..3660) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene hslO CDS complement(3793..5955) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene ftsH CDS complement(6056..6601) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene hpt CDS complement(6807..8189) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379219.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene tilS CDS complement(8283..8759) product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(8803..9270) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(9334..9609) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(9614..11197) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361558.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(11325..14858) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene mfd CDS complement(14855..15040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(15030..15596) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene pth CDS 15933..16913 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356251.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(17440..17958) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(17981..18823) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(18825..19541) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 19770..20069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(20158..21303) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286837.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene queG CDS 21698..23644 product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(23815..24870) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 25093..26034 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304700.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 26037..27113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 27103..29271 product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095443517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(29359..30420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(30448..32097) product oligopeptide ABC transporter substrate-binding protein Opp1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene opp1A CDS 32320..33423 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286834.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(33509..34831) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(34815..36554) product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(36576..37640) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379352.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(37668..38708) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002413403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(38767..39546) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(39539..40375) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(40573..40968) product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 41157..42626 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355315.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(42683..43846) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701155.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(43991..44554) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene efp CDS complement(44958..49163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(49446..49922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(49919..51361) product putative allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(51386..52528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(52548..53972) product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083447.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(53969..55519) product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene fdrA CDS complement(55688..56575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 56745..58421 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002424949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(58482..58916) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene fabZ CDS complement(58919..60157) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358339.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene fabF CDS 60461..61213 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387650.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene fabI CDS complement(61363..62148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(62647..62802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(62799..63383) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(63376..63693) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(63821..64639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(64818..65651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(65700..66089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(66101..67642) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(68005..68847) product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 69188..69589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(69841..71268) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(71269..71874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(71979..76427) product fibrinogen-binding MSCRAMM adhesin Fss2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene fss2 CDS 76805..77476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 77476..78336 product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(78421..79638) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674763.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(79786..80250) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(80574..81086) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723013.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(81103..81516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(81503..83593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(83612..84817) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(84830..85495) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365285.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(85492..86547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(86562..87107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(87251..87991) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(87993..89216) product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(89596..89811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(90061..90300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(90542..90817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(90924..91376) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(91505..92608) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(92693..93061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(93208..94521) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(94915..95820) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(96249..96905) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(97053..97664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 97955..98827 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 98872..99777 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(99885..100628) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene truA CDS 100881..101213 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 101210..102160 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 102242..103012 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(103132..103641) product DinB family glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002375627.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene gst CDS complement(103879..105648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 106133..106669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 107787..108614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(108921..109934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(110033..110251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 110250..110369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(110366..110806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(111170..111640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(111630..111986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(112089..112601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(112989..113111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(113407..114447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(114608..114763) product lanthipeptide cytolysin subunit CylL-S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358181.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene cylL-S sequence06 source 1..114435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2625..3374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(3371..4345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(4342..6942) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(6961..7413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(7564..8244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(8267..8932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(8949..10016) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002311353.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(10297..11103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(11135..11941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(11946..12281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(12298..15117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(15236..15898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(16090..17208) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 17626..18384 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 18406..19674 product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 19752..20240 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 20356..21693 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361550.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene brnQ CDS 21952..23460 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594908.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(23531..24277) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene truA CDS complement(24299..25096) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(25093..25962) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(25938..26777) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359354.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(27132..28301) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(28317..29519) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356229.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(29807..30190) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356228.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene rplQ CDS complement(30218..31156) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(31237..31626) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rpsK CDS complement(31654..32019) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rpsM CDS complement(32187..32405) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356224.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene infA CDS complement(32600..33250) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(33337..34635) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene secY CDS complement(34635..35078) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene rplO CDS complement(35115..35294) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene rpmD CDS complement(35308..35808) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene rpsE CDS complement(35829..36185) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene rplR CDS complement(36282..36818) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene rplF CDS complement(36850..37248) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene rpsH CDS complement(37284..37469) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356214.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(37488..38027) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene rplE CDS complement(38054..38362) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288670.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene rplX CDS complement(38397..38765) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rplN CDS complement(38825..39091) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene rpsQ CDS complement(39115..39303) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene rpmC CDS complement(39293..39727) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene rplP CDS complement(39730..40386) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356207.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene rpsC CDS complement(40497..40844) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene rplV CDS complement(40866..41144) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene rpsS CDS complement(41187..42017) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene rplB CDS complement(42057..42347) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene rplW CDS complement(42347..42970) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene rplD CDS complement(42996..43625) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene rplC CDS complement(43650..43958) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene rpsJ CDS 44394..44720 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920200.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 44710..45258 product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(45415..46602) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene tuf CDS complement(46742..48829) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene fusA CDS complement(48912..49382) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene rpsG CDS complement(49439..49858) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene rpsL CDS 50211..50885 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene rpiA CDS 51009..51596 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 51847..52533 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene gpmA CDS complement(52713..53048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(53082..54272) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(54425..55132) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene deoD CDS complement(55159..55977) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356180.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(55988..57154) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene deoB CDS complement(57281..58243) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356172.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(58243..59376) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(59369..60934) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(61123..62220) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(62565..62960) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(62985..63647) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene deoC CDS complement(63665..64966) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(65090..66118) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356164.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(66323..66808) product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene ureI CDS 66988..67995 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368573.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene add CDS complement(68063..70813) product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236023556.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(70998..72305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(72298..73161) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(73180..75870) product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(75894..77183) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369315.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 77345..78379 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 78383..80524 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(80584..82080) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(82131..83861) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285976.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(83854..84468) product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(84644..86110) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(86232..87152) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(87168..88115) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 88309..88644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(88791..89813) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(89949..90575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(90674..93760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 93927..95366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(95427..96032) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(96043..96633) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 96872..97957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 98064..98987 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356160.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene coaA CDS 99093..100649 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene guaA CDS complement(100799..101185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(101452..104250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(104584..105324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(105709..105951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(106038..106280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 106421..106648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(106935..107198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(107237..107530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(107552..108910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(108910..109356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 109761..110075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 110505..111293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 111343..111621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(111953..112159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(112335..112757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 113174..113818 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 sequence07 source 1..89986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 17..340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 446..1084 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1122..1688 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1760..2500) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(2561..4153) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(4638..6413) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(6413..8155) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 8254..9021 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 9098..9430 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 9616..10452 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 10561..12453 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 12450..13874 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861842.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 13968..15323 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 15500..15877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 15920..17560 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 17746..19692 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485723.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 21077..22213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 22234..24018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 24040..25257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 25670..26242 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 26514..26798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 note possible pseudo, frameshifted CDS 26752..27342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 note possible pseudo, frameshifted CDS complement(27406..28032) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 28166..28840 product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene yeiL CDS 28988..30259 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623651.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 30778..31878 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 32144..32851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 32974..36888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 36904..37251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 37244..38047 product WxL domain-containing protein ElrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene elrC CDS 38078..38869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 38973..40064 product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene elrE CDS 40088..40756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 40798..41556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 41830..42282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 note possible pseudo, internal stop codon CDS 42352..44967 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288728.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 44993..46660 product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 46696..47430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 47839..50124 product chitinase ChiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene chiB CDS 50097..50276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(50252..50854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(50899..51690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 51853..53301 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 53505..54353 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 54358..56217 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 56269..57696 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440025.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 58149..59162 product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 59178..59909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 59906..60580 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 60598..61419 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(61676..63172) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(63416..63595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(63621..64826) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 64924..65118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 65084..65740 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 65911..66849 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262588.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 66908..67528 product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(67589..67861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 69479..71908 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 71953..72684 product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene cas5c CDS 72684..74606 product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene cas8c CDS 74610..75473 product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene cas7c CDS 75475..76128 product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene cas4 CDS 76125..77156 product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene cas1c CDS 77219..78112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 78134..78424 product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene cas2 repeat_region 78597..79372 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctagctctgtatagagctagtggatttaaat CDS 79902..80993 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 81244..81996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 82178..82744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 82779..83879 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 83882..84196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 84206..84430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 84519..85250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 85376..86413 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 sequence08 source 1..85147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(825..1187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1261..1629) product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1828..2994 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(3058..3645) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 3913..4926 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368301.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(4970..5212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 5298..5804 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(6205..7083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(7404..9020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(9010..10107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(10252..10761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 10915..11118 product DUF3173 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 11507..11659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 11720..12397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 12426..12836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 note possible pseudo, frameshifted CDS 12833..13615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 note possible pseudo, frameshifted CDS complement(13690..13989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 14146..14463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 tRNA complement(14628..14702) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(14813..14944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290587.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(14949..17102) product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene feoB CDS complement(17106..17573) product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 18058..18282 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 18284..18661 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene nrdI CDS 18636..20801 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene nrdE CDS 21097..22059 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene nrdF CDS complement(22161..23279) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 23446..24273 product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(24339..25043) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(25168..25869) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene nagB CDS complement(25998..27128) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(27377..28780) product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(28777..30126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(30138..31007) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(31027..32241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(32245..33294) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(33313..34035) product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(34057..34932) product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(34951..35835) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902062.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(35768..36412) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(36426..38234) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(38254..39018) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338482.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(39044..39745) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(39757..40593) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(40729..41559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(41639..42613) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene dapF CDS complement(42745..43353) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 43519..44331 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 44474..45565 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732336.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene ispG CDS 45665..46627 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(46752..47690) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378890.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 48099..49586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(49732..50043) product iron-sulfur cluster biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381169.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(50236..50901) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(51084..51716) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(51691..52794) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(52791..53522) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene liaF CDS complement(53723..54196) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355133.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene greA CDS complement(54449..55891) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene mltG CDS complement(56065..57402) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 57664..58167 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(58322..58972) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(58996..59865) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 60034..61005 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 61030..61650 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379044.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(61721..62086) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287966.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(62200..62691) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(62812..64578) product multidrug efflux ABC transporter subunit EfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365186.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene efrB CDS complement(64575..66305) product multidrug efflux ABC transporter subunit EfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene efrA CDS 66498..66890 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355126.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 67175..67387 product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 67389..69059 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(69305..69754) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 69933..70082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(70390..70590) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(70739..71440) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene radC CDS complement(71493..72152) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(72214..73533) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 73920..76487 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 76509..77102 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355114.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 77413..77865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 77884..80937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(81000..83645) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 84152..85081 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 sequence09 source 1..77124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..875 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1006..1767 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1797..2279 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173672.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 2448..2768 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 2787..4424 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 4547..5230 product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386953.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 5241..5762 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 5781..6233 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 6618..7049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381426.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(7324..7644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 8005..8706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 9021..12437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 12460..12798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 12795..13604 product WxL domain-containing protein ElrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385709.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene elrC CDS 13649..14422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 14544..15614 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989522.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 15645..16307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 16605..17036 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene lepB CDS 17413..18600 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene metK CDS 19092..20558 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 20803..21591 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(21646..22293) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 22564..24231 product multidrug ABC transporter ATP-binding protein/permease ErfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene erfC CDS 24224..25993 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285885.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(26074..26637) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368069.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(26637..27605) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(27620..28270) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355669.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(28451..29482) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(29484..30158) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381265.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 30435..32516 product autolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 33288..35801 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene leuS CDS 36392..37993 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286153.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 38394..41045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 41056..41586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 41650..42306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 42330..42653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 43215..44048 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219862.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 44220..46124 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 46256..46978 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 46982..48448 product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 48635..48952 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 49117..49722 product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene wrbA CDS complement(49803..50435) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(50432..52591) product DUF1430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(52687..53073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(53257..54075) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(54091..54726) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(54772..55413) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 56377..57099 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 57239..58885 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010709260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 59272..59835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 59850..60065 product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 60105..60575 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 60613..60861 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355684.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(60923..61243) product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(61604..62218) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 62862..63617 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289747.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 63607..64290 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(64341..64793) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 64939..65568 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355702.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene udk CDS 66168..66509 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 66772..67746 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174124611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 68447..70279 product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706696.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 70285..70623 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 70681..71034 product glycine-rich SFCGS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 71242..71616 product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355708.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 71617..72399 product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288309.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 72424..73086 product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 73210..74529 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 74584..74835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 74841..75929 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 75938..77047 product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 sequence10 source 1..65350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4239..5411) product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene essB CDS complement(5425..5685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(5700..6194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(6226..9606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(9841..10137) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(10452..10598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(11307..13457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(13482..14738) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(14802..14987) product YlcI/YnfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 15128..16006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(16076..16648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 16794..17006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 17078..17488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 17475..18821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 18990..20156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 20221..20409 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775147.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 20510..21571 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254116.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(21631..22023) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rpsI CDS complement(22037..22480) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene rplM CDS 22846..24048 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731945.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(24070..24207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 24350..25735 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene argH CDS complement(25789..26277) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354782.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(26401..27138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(27200..28729) product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399854.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(29565..30098) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene msrA CDS complement(30389..30952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(30980..31702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(31715..32611) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(32645..32851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(33253..34149) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 34394..35113 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990049.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(35162..38815) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354777.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene rpoC CDS complement(38953..42570) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389470.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene rpoB CDS complement(42936..43508) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 44001..44978 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289394.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 45075..46025 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 46025..46828 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289388.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(46912..47124) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(47338..47934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 48225..49211 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(49604..50557) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene menA CDS complement(50569..51642) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(51815..52744) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 53012..54919 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 55029..55451 product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354745.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 55468..56028 product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 56068..57054 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002372605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(57201..58553) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene gor CDS complement(58619..59860) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(59874..60794) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(61020..63509) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378875.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(63514..63981) product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 tRNA complement(64206..64279) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(64298..64373) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(64390..64464) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(64474..64547) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(64557..64632) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 assembly_gap 64629..64743 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(64752..64825) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(64869..64954) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(64965..65036) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(65045..65117) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(65148..65231) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(65242..65316) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence11 source 1..59874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..4551) product collagen binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(4699..5967) product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene dltD CDS complement(5967..6203) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene dltC CDS complement(6273..7478) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene dltB CDS complement(7475..8989) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356385.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene dltA CDS complement(9004..9153) product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(9427..11514) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(11504..12271) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356382.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 12582..14774 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene nrdD CDS 15084..15686 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene nrdG CDS complement(15849..17264) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(17369..18517) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene dinB CDS complement(18563..19540) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(19670..20011) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(20023..21240) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(21507..22373) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359438.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene rsmI CDS complement(22537..22884) product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(22877..23716) product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(23731..24717) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene holB CDS complement(24683..25012) product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356367.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(25027..25671) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene tmk CDS complement(25841..27583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 27810..28472 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(28708..29304) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene recR CDS complement(29900..30214) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(30230..31984) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356340.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene dnaX CDS complement(32160..32438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(32560..34053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 34293..35306 product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(35330..36316) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288449.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(36334..37815) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene galT CDS complement(37949..38935) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene galE CDS complement(38998..39156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 note possible pseudo, frameshifted CDS complement(39665..40057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 note possible pseudo, internal stop codon, frameshifted CDS 40347..40514 product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(40663..42528) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387211.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(42558..42926) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(43065..43463) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(43479..44450) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387212.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(44451..44669) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(44686..45396) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(45406..45945) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(46065..46997) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 47114..47659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(47691..49424) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(49801..50520) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(50522..52357) product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379559.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene glpO CDS complement(52375..53883) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene glpK CDS complement(54133..55605) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(55595..55948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 note possible pseudo, frameshifted CDS complement(55890..56930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 note possible pseudo, frameshifted CDS complement(57066..57980) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325723.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 58547..59044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 sequence12 source 1..351762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 604..1080 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289618.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1159..1581 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009914084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1757..2083 product quaternary ammonium compound efflux SMR transporter QacH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010730188.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene qacH tmRNA 2222..2587 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 3112..3243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(4110..4982) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 5099..5689 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(5860..6462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 6617..6769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(7873..8787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(9236..9577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 9869..10186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 10621..10947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 10934..12934 product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 12939..13412 product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363905.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 13426..14007 product V-type ATPase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 14176..15177 product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774209.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 15167..15478 product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 15678..17459 product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371187.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 17452..18828 product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 18835..19470 product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(19517..20473) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 20679..22193 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287129.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 22209..22868 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(23015..24916) product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(24932..25744) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(25797..26432) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 26605..29214 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene ppdK CDS 29341..30432 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101277.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 30544..31845 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene lysA CDS 31970..32938 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 32954..33322 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 33319..33666 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 33773..33910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(34210..34551) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357660.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(34677..35243) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 35548..36612 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 36644..38014 product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 38038..39717 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 39959..41560 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(41605..43938) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360569.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(43928..44569) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388848.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene recU CDS 44631..45170 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 45268..45702 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene gpsB CDS 46256..47419 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 47430..48929 product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 48965..49681 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 49693..50340 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357985.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene nth CDS complement(50458..52263) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(52472..53071) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 53360..54727 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 54857..55381 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293716.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene rimM CDS 55371..56117 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293717.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene trmD CDS 56238..56453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 56651..56998 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357176.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene rplS CDS 57378..57791 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 57903..58886 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 58917..59330 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 59354..59668 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 59713..60861 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 61252..61938 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 62190..63431 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 63546..64430 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 64444..65274 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 65332..67479 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 67494..70799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 70813..71784 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363772.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 71723..71914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 72593..74041 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene dbpA CDS 74304..76115 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(76399..78123) product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene efbA CDS 78304..79248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(79296..80417) product vitamin B12 independent methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(80437..81555) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 82083..82739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 82852..83439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 83922..84911 product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene trpX CDS 84930..85817 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 85814..86599 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(87082..87537) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729316.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(87550..88311) product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 88552..88740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(88821..89594) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288592.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 89745..90464 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 90465..91934 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(92036..92587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(92592..93302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(93410..95527) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357869.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 95809..96981 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379363.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(97349..98245) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 98565..100622 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 100639..101517 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 101547..102749 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 102765..103520 product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene aroD CDS 103819..104307 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene ybaK CDS complement(104350..104745) product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 104829..105272 product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(105309..105509) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 105912..106295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 106295..106996 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360173.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 107003..107479 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene lspA CDS 107466..108371 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 108736..109293 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357409.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene pyrR CDS 109327..110613 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357410.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 110774..111700 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 111701..112993 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 112996..114096 product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360175.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 114075..117254 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene carB CDS 117322..118104 product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 118104..119030 product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 119027..119746 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene pyrF CDS 119743..120378 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene pyrE CDS 120562..121263 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381850.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 121278..122168 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 122333..122503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(122638..123696) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837142.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene hisC CDS 123921..125120 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365726.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 125527..126432 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(126615..128372) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109504.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(128369..129082) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 129228..129695 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 129698..130327 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 130392..130730 product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 130735..132153 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene ffh CDS complement(132434..133603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(133600..134499) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(134502..134882) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 135023..135583 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(135639..136190) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 136429..136599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 137015..137851 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 138088..138363 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rpsP CDS 138375..138620 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 138732..139277 product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(139339..139677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(139655..140983) product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 141225..141779 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(142434..142649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(142738..143259) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(143319..144083) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 144261..145355 product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 145473..146102 product NUDIX hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596108.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 146220..147152 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357629.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 147314..148204 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene xerD CDS 148236..148598 product protein RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 148637..149422 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 149419..150036 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene scpB CDS 150037..150753 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 151442..152050 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 152184..152909 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(153348..153560) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 153600..154631 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 154628..156070 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 156150..156698 product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 156821..157489 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene cmk CDS 157702..158913 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene rpsA CDS complement(159023..159799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 160056..161393 product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 161558..162868 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene der CDS 163116..163391 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 163652..164467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 164986..166032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 166035..167294 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 167303..167839 product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(167892..168785) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 168945..169292 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 169285..170073 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene dapB CDS 170070..171281 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365655.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 171287..171658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 171741..172193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 172269..173249 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287048.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 173260..173604 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 174002..174871 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene aroE CDS 174901..175926 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene aroF CDS 175993..177054 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene aroB CDS 177066..178232 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene aroC CDS 178261..179358 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 179485..180768 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025188841.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene aroA CDS 180783..181283 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 181296..182144 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene pheA CDS 182256..183401 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365661.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 183477..184325 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 184546..184737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 184793..185275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 185434..185712 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 185732..187795 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 187852..189738 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365663.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 189751..190698 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 190717..191217 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(191353..191973) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene lexA CDS 192280..192522 product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 192621..194615 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene tkt CDS 195010..195867 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289538.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(195925..196920) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990127.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 197259..198188 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene cysK CDS 198392..198829 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 198843..199223 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 199478..200827 product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 201628..203064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 note possible pseudo, internal stop codon, frameshifted CDS 203087..206332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 note possible pseudo, internal stop codon, frameshifted CDS 206376..207383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 note possible pseudo, frameshifted CDS 207570..208487 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene metA CDS 208836..210191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 210212..211435 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 211766..213109 product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(213163..213555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 213703..214014 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963519.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 214098..214523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 214563..214703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 214907..215164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(215330..216790) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene cls CDS 217002..217535 product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(217618..218553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(218659..219585) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360265.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(219682..220446) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene pflA CDS complement(220512..222758) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene pflB CDS complement(222861..223049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(223036..225516) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene parC CDS complement(225529..227607) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene parE CDS complement(227731..228156) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 228273..228899 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene plsY CDS complement(228965..229840) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(229853..230644) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene codY CDS complement(230891..232294) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene hslU CDS complement(232310..232858) product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357489.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene hslV CDS complement(233004..233903) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357488.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene xerC CDS complement(234128..235453) product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene trmFO CDS complement(235527..237605) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene topA CDS complement(237726..238607) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene dprA CDS complement(238673..239440) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(239430..240293) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357480.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ylqF CDS complement(240302..240760) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene lepB CDS complement(241020..242453) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(242551..242769) product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364020.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(242774..243283) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357448.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene msrA CDS complement(243304..243966) product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(243972..244859) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365717.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(245029..245871) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 246002..246655 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357443.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 246816..247016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(247081..247593) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357441.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(247597..249906) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109501.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene recJ CDS complement(250039..250479) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(250552..251352) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(251364..252296) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene rnz CDS complement(252365..253660) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(253653..254345) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(254446..255018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357436.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(255088..256962) product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(256972..257649) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(257639..258391) product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(258531..258677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(259014..260285) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene kynU CDS complement(260367..261548) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 261876..262319 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(262432..263745) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384537.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene obgE CDS complement(263943..264935) product DUF4003 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 265163..266173 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene gap CDS complement(266236..267264) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(267712..268197) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(268321..269190) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(269210..269536) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(269529..270233) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(270343..272322) product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(272481..273587) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360364.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene rpoD CDS complement(273663..275570) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361790.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene dnaG CDS complement(275826..276740) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674382.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(276793..277026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(277066..279402) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(279545..280150) product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 280338..281057 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 281068..283656 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002300997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene mprF CDS complement(283740..283946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(283965..284861) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242763.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(284977..286164) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene tuf CDS complement(286407..286568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(286583..286939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(287276..289270) product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene nagE CDS complement(289292..290125) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 290164..290505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(290432..291064) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene rpoE CDS complement(291140..291574) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(291696..292637) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(292640..293629) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(293626..294624) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 294818..295177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 295170..296018 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390086.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 296054..297424 product dNTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 297450..298256 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene yidA CDS complement(298397..300475) product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(300515..301168) product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(301181..302068) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene dapA CDS complement(302084..302698) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(302725..303984) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(304015..304293) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(304306..304752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(305323..305766) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 305941..306315 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369612.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 306468..307187 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(307245..308069) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(308558..309574) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 309715..310635 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386626.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(310684..311811) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189834.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(312205..313410) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(313407..314087) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(314080..315231) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(315397..316098) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386624.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene dapD CDS complement(316203..316700) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(316893..317408) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(317419..318768) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene rph CDS complement(318810..319661) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene racE CDS 320090..320818 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360585.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 320847..321671 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 321719..322417 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 322431..323087 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382114.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(323144..325567) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene pheT CDS complement(325574..326620) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene pheS CDS complement(326962..327306) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(327372..331166) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002416113.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene addA CDS complement(331159..334737) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(334868..335407) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene lepB CDS complement(335593..336324) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(336317..337789) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365496.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(337801..338562) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 339053..339385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 339327..339479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 339634..341106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(341290..343590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(344055..345404) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357685.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(345652..346998) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene gdhA CDS 347137..348426 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288576.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 348614..349039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(349403..350098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(350157..351269) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 sequence13 source 1..59026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..1137 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1130..2059 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366931.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene miaA CDS 2063..3304 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene hflX CDS 3700..4083 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388239.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 4127..5467 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356929.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene glnA CDS 5593..5901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 6041..7045 product DUF3114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387420.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 7219..10944 product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706520.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene nifJ CDS 11098..11985 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389035.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene cdaA CDS 11982..13130 product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 13216..14571 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene glmM CDS 14893..15750 product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528922.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 15761..16312 product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356937.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 16447..18156 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 18153..18989 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 19228..19350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 19506..21326 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene glmS CDS complement(21605..23104) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(23094..23792) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 23950..24294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(24657..25547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 25935..26516 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101243.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 26656..27747 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 27752..28423 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 28584..28874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379593.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 29010..29978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(30161..30397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 tRNA complement(30761..30834) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 30893..32218 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene rpoN CDS complement(32549..33043) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170995.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(33117..33284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 tRNA complement(33711..33783) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 34599..35447 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 35444..36514 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 36537..37217 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 37244..38077 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 38093..39283 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 40086..41624 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362078.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(41741..42670) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356954.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(42667..43524) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364373.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(43521..44276) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(44425..45609) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 45851..46816 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 46949..47845 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003734267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene rarD CDS 47930..49072 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 49158..49499 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 49952..51076 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene mnmA CDS complement(51103..51495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 51721..52086 product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(52133..52513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(52514..52720) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(52873..53586) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379308.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 53776..55857 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 55989..56474 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 sequence14 source 1..50144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(548..2122) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(2136..2576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(2573..2770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(2782..4512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(4828..5322) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378903.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene tpx CDS complement(5549..6196) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(6349..7554) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189885.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene thiI CDS complement(7845..8993) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(9135..10856) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene ezrA CDS complement(11086..11751) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 11946..13298 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 13426..14190 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 14183..15766 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296509.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(15913..16440) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(16513..17352) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287959.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(17390..18223) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(18365..19105) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706750.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 19302..20102 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(20182..21603) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(21590..22942) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene celB CDS 23378..24223 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388112.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 24447..25031 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 25056..26105 product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(26396..27019) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031837637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(27056..29197) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(29210..32323) product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(32742..35495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 35731..36606 product quorum-sensing system transcriptional regulator RopB/Rgg1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982409.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene ropB CDS complement(36628..38859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(38892..39551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(39621..40286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(40377..41249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(41303..42070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(42105..43151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(43232..43978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 44423..44992 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(45136..45450) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355223.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(45447..45782) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(46474..47802) product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 47948..48319 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 48337..49719 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 sequence15 source 1..45372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(346..738) product DUF4809 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(908..1951) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(2250..2852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(2889..5387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 6367..6819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(7102..7863) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109565.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(7947..8867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(9312..9461) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene rpmG CDS complement(9589..11706) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706862.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(11890..13830) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356319.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene thrS CDS complement(14212..14391) product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(14482..14655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(15011..16483) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362470.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(16894..17748) product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381386.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 17905..18486 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359392.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(18672..19745) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399431.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(19890..20627) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386939.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(20689..22893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(23353..24072) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(24166..25335) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394037.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(25460..26197) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(26199..26441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(26600..27190) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene yqeK CDS complement(27180..27824) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(27843..28154) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene yhbY CDS complement(28186..29301) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene yqeH CDS complement(29298..29825) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(30213..30647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(31045..31830) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(31833..32699) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene accD CDS complement(32714..34084) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(34092..34511) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene fabZ CDS complement(34636..35127) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379800.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene accB CDS complement(35129..36364) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356284.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene fabF CDS complement(36391..37128) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356283.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene fabG CDS complement(37132..38061) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene fabD CDS complement(38106..39005) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene fabK CDS complement(39240..39464) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356278.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(39514..40473) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365153.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(40489..40929) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(41392..41622) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(41723..42613) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(42688..43911) product cell wall glycolipid biosynthesis glucosyltransferase BgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706866.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene bgsB CDS complement(43932..44978) product cell wall glycolipid biosynthesis glucosyltransferase BgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene bgsA tRNA complement(45263..45338) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 sequence16 source 1..40953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..2829) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(2869..4149) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379207.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(4177..5178) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(5187..5927) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002318601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene sfsA CDS 6145..6543 product DUF4828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(6739..7050) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721355.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene hisE CDS complement(7101..7406) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene hisI CDS complement(7403..8158) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene hisF CDS complement(8148..8873) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene hisA CDS complement(8851..9477) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene hisH CDS complement(9478..10062) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene hisB CDS complement(10171..11451) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene hisD CDS complement(11448..12089) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263173.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene hisG CDS complement(12092..13276) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(14303..16843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(16840..17883) product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 gene elrE CDS complement(17995..18732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(18805..19029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(19071..20165) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(20162..20824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 21375..22121 product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357468.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(22201..22563) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722027.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(22553..22951) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(22994..23794) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(23829..25334) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene glpK CDS 25677..26324 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 26397..27917 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene zwf CDS complement(28185..30974) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene ileS CDS complement(31345..32064) product cell division protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355904.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene divIVA CDS complement(32084..32866) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(32889..33161) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(33172..33777) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393457.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(33791..34468) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358890.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(34484..35740) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene ftsZ CDS complement(35767..37089) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355898.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene ftsA CDS complement(37251..38213) product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(38307..39398) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379204.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene murG CDS complement(39406..40776) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379203.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene murD sequence17 source 1..38888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..1364 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 1367..1684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1694..1918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2008..2700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 2836..3861 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989522.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 4113..6947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 7535..8242 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836321.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 8279..9673 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371458.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(9759..10709) product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(10774..11532) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288287.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 11734..12204 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288286.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 12197..12499 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 12638..13993 product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288281.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 14020..14277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 14284..15042 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 15322..16038 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene rsmG CDS 16054..16815 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 16808..17701 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 18719..19546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 19584..20378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 20396..21520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 21844..23013 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 23194..24417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 24765..25868 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(25959..27476) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 27818..28015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 28019..29119 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene ychF CDS 29220..29903 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 30139..31815 product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 31974..33458 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene guaB CDS complement(33503..34996) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382901.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(35138..36409) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene serS CDS complement(36845..37996) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363566.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(37986..38675) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355963.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 sequence18 source 1..37812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..213) product lanthipeptide cytolysin subunit CylL-S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene cylL-S CDS complement(259..1629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1654..3813) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(3829..6903) product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 7287..7442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(7876..8016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(8069..8188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 tRNA complement(8237..8307) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(8346..8951) product accessory gene regulator ArgB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(9051..9494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 9755..11050 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963407.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 11064..11795 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(12145..12624) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355021.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rlmH CDS 13049..14368 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385251.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(14544..15161) product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361057.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(15344..15805) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(15867..16181) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355015.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(16192..17268) product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355013.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene pepA CDS 17522..17863 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399791.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(18177..18833) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371476.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene trmB CDS complement(18948..19727) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(19837..20700) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene dat CDS complement(20703..21920) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371475.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(21922..22659) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 22795..23223 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 23223..23564 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286203.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 23864..24877 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371473.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(24921..25382) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(25401..26345) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(26342..29044) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(29041..30273) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(30431..31561) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(31554..32423) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(32445..33050) product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(33474..33815) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(33884..36046) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 36571..37527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 sequence19 source 1..36829 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..502 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355919.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 633..2087 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286601.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2160..2378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355915.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 2400..2597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2597..3010 product DUF3284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 3345..4748 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725004.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 4974..6170 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 6641..6763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 tRNA 6930..7005 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(7116..7766) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289449.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(7829..9067) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286469.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 9323..9895 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(9963..10406) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356885.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 10755..11519 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene map CDS 11545..12459 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 12592..13728 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366956.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 13953..14735 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383765.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 14735..15568 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383764.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 15569..16285 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 16406..17275 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene rfbA CDS 17289..17861 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene rfbC CDS 17884..18912 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359895.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 gene rfbB CDS 19116..19946 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380528.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene rfbD CDS 20106..21275 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 21686..22486 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 22489..23718 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 23778..26864 product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 26839..28203 product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775199.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 28206..29462 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837187.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 29680..30474 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 30495..31223 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 31223..31573 product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120772943.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 31577..32680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 32673..33674 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 33772..35214 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 sequence20 source 1..20526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..1026) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene mraY CDS complement(1087..2913) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(2968..3369) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358883.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene ftsL CDS complement(3386..4345) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene rsmH CDS complement(4359..4790) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene mraZ CDS complement(5073..5444) product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 5630..6586 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(6893..8584) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene recN CDS complement(8602..9051) product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358881.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(9373..10188) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364633.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(10205..11092) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(11092..11331) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(11336..12679) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene xseA CDS complement(12689..13534) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(13854..14303) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene nusB CDS complement(14296..14721) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(15213..16277) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391500.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 16453..17262 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(17332..17478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(17701..18105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(18286..18750) product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 19355..19642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 19649..19858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 sequence21 source 1..13849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 61..131 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 147..232 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 300..2711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2793..3320) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287456.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 3462..4673 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(4719..7382) product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963704.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 7637..7972 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379638.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 7998..8300 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639490.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 8325..9584 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene celB CDS 9594..10649 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 10913..11749 product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 11875..13758 product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 sequence22 source 1..8527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 474..2918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 3873..4964 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 5235..5984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 6101..6754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 6789..7892 product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 7895..8212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 8222..8446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 sequence23 source 1..282991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1154..2647) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2659..3345) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355954.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(3495..4916) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene gndA CDS complement(5159..5338) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene rpmF CDS complement(5398..5964) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363429.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 6123..6902 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(6968..8755) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356683.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene recQ CDS complement(9008..10843) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356682.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene typA CDS complement(11066..11839) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(11841..12119) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356679.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(12116..13423) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 13745..15100 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(15173..15676) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356666.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(15976..16935) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360063.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 17052..17660 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(17701..19182) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(19203..19727) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(19958..23386) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(23393..24094) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 24259..24927 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 24992..25378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357813.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(25428..26576) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357814.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene nagA CDS complement(26679..27506) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381942.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 27699..27875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(27957..29174) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(29438..31087) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(31191..31847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 tRNA complement(31975..32059) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(32133..32858) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(33128..33622) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(33625..35817) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(35943..36680) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 36834..37748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 37761..38453 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 38469..39692 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(39765..40172) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(40194..40613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(40728..41102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(41126..41824) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(41817..43490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 44665..45603 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(45654..46820) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene dnaJ CDS complement(47028..48857) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357825.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene dnaK CDS complement(48923..49465) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene grpE CDS complement(49529..50572) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene hrcA CDS complement(50755..51915) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene hemW CDS complement(52142..54802) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene mgtA CDS 55680..56561 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 56588..57481 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(57655..58590) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene ribF CDS complement(58608..59528) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene truB CDS complement(59755..61011) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(61305..61454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(61623..62132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(62246..62593) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene rbfA CDS complement(62627..65194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(65207..65509) product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(65502..65798) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(65817..66986) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene nusA CDS complement(67114..67587) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene rimP CDS 67918..68841 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386662.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene rnhC CDS complement(69083..69796) product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene budA CDS complement(69810..71474) product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289620.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene alsS CDS 72559..72975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 72972..74153 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288740.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 74150..75328 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356636.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 75663..76166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 76190..76375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(76890..77198) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357933.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(77244..77672) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene ruvX CDS complement(77669..77938) product regulatory phosphoprotein IreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357937.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene ireB CDS 78236..78508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 note possible pseudo, internal stop codon, frameshifted CDS complement(78930..79862) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989752.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene argF CDS complement(79859..81046) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(81043..81795) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene argB CDS complement(81850..82881) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene argC CDS complement(83063..83452) product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(83552..84250) product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567846.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 84479..85231 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379344.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 85284..85760 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 85848..86279 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(86347..87189) product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(87204..88109) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(88498..89304) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357943.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(89357..90238) product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365516.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(90238..91545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(91542..93371) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379340.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene walK CDS complement(93378..94121) product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene yycF CDS 94270..95229 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(95281..95646) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930407.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 95745..96488 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263787.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(96570..97235) product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(97430..98287) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357950.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(98280..98849) product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(99015..99662) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386635.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(99664..100434) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(100441..101100) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(101135..102514) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287155.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 102609..103067 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289775.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(103158..103580) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(103608..103841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(103854..104417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(104586..105767) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355262.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(106031..107719) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(107751..108623) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene dapA CDS complement(108815..109870) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 110106..111752 product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003297558.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 111845..112303 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(112351..113211) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 113330..115057 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288384.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene spxB CDS complement(115106..115360) product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(115455..116057) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(116173..117114) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 117199..117642 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(118103..119143) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048947622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene galM CDS complement(119388..122018) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(122212..122481) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(122580..123872) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene rho CDS complement(123869..125149) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357969.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(125442..126308) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290335.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(126512..126961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(126961..127734) product MurR/RpiR family transcriptional regulator GlvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene glvR CDS complement(127834..129165) product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(129188..130804) product PTS maltose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene malP CDS complement(131117..131716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 131995..132309 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(132378..133307) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381974.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 133581..134075 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357974.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(134166..135356) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732150.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(135551..136516) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357976.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(136681..139047) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396915.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(139172..140329) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966302.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene argJ CDS complement(140570..141250) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(141243..141725) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357164.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(141861..143198) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357163.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene murC CDS complement(143609..145969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(146354..147262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(147435..148751) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288767.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene asnS CDS complement(148785..149975) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(150074..150580) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(150657..153425) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(153761..154483) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(154862..156385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(157076..158509) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(159145..159780) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene thiE CDS complement(159777..160586) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene thiD CDS complement(160583..161392) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene thiM CDS complement(161385..162056) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379778.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene tenA CDS complement(162410..163447) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360426.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(163478..163756) product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(163840..164748) product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288343.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(164881..166110) product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene pepT CDS complement(166133..167251) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(167241..167951) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(168119..170026) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399157.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(170384..171820) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene glgA CDS complement(171823..172971) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene glgD CDS complement(172961..174124) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563805.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(174181..176061) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene glgB CDS 176370..177116 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(177304..179943) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357736.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene alaS CDS complement(180267..181373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 181516..181956 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(182062..183414) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379408.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(183481..184656) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 184843..185175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(185285..188641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(189066..189410) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(189523..190365) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721303.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(190566..191516) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(191528..192850) product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382281.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 193343..194779 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(194857..195240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(195418..195837) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 196166..196543 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379404.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 196551..197228 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714168.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 197512..199029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 199785..200117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 200117..200275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 200406..200885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 200933..201106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 201181..201744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(201823..202392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(202394..202879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(203215..203952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 204149..204733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 204759..204965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(205008..205760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(205753..206145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(206243..207025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(207025..207156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(207160..209889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(209898..210263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(210277..215133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(215166..215453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(215558..215974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(216048..216494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(216507..216881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(216883..217428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(217412..217768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(217765..218100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(218116..218400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(218414..219523) product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922218.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(219535..219912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(219926..220582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(220769..222052) product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928179.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(222053..222481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(222474..223889) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(223893..225179) product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047636.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(225180..225998) product phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene terS CDS complement(226047..226751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(227086..227598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(227717..227872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(228201..228668) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(228884..229165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(229140..229352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(229352..229870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(229870..230040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(230040..230366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(230432..230650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(230667..231191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399993.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(231169..231732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(231729..231953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(231954..232733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(232748..232927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(232931..233119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(233116..233538) product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399989.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(233531..233893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(233886..234110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(234116..234304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(234301..235011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714107.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 235074..235787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(235788..235925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(235937..236404) product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706850.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(236394..236564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(236566..236799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(236787..237188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(237200..238042) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370005.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(238046..238906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(238929..239657) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(239654..240529) product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(240730..240870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(240874..241167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(241171..243114) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(243111..243479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(243511..243789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(243771..243968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(243970..244164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(244157..244411) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(244413..244631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(244637..244933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(244946..245137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 245217..245414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(245392..245538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 245736..246089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(246086..246205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(246198..247022) product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010622329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 247322..247690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 248481..249395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 249526..249981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 250112..251254 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 251807..252937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365588.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 253411..253611 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288762.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(253725..255002) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene icd CDS complement(254999..256144) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723251.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene citZ CDS complement(256612..259320) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene acnA CDS complement(260264..261655) product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(261657..262193) product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene citX CDS complement(262186..263715) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene citF CDS complement(263717..264604) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene citE CDS complement(264592..264900) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene citD CDS complement(264913..265908) product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene citC CDS complement(265922..266047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(266081..267196) product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(267239..267640) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(267980..268309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356004.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 268709..270052 product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566195.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 270183..270887 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 270871..271758 product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene citG CDS complement(271826..272554) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069661899.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 272665..274515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 274687..275901 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382277.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(275953..276294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(276291..277589) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(278016..278381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(278453..278893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(278910..279560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(279988..280458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(280458..280931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(280928..281647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(281897..282622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 sequence24 source 1..7339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..1134) product quorum-sensing system transcriptional regulator RopB/Rgg1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982409.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene ropB CDS 1271..2035 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2040..4379 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178939948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 4397..5647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 5662..6255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 6245..7012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 sequence25 source 1..3618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 188..508 product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 620..1900 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355920.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 2030..3427 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355921.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 sequence26 source 1..3558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1610..2416) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365061.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2427..3509) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 sequence27 source 1..3339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 28..1032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(1012..3312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 sequence28 source 1..2280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(726..1166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(1382..2194) product WxL domain-containing protein ElrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362542.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene elrD sequence29 source 1..1822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1051..1461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 sequence30 source 1..1693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence31 source 1..1510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 note possible pseudo, frameshifted CDS 631..1449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 note possible pseudo, frameshifted sequence32 source 1..1432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 547..708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 sequence33 source 1..1290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence34 source 1..199020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..1026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 1230..1997 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 1987..3216 product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(3735..4703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(4894..5940) product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444602.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 7134..11423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 11938..13431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 13964..18250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(19269..20027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(20092..20436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(20752..22650) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene mnmG CDS complement(22664..24061) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379284.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene mnmE CDS 24389..24730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303984.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(25373..26140) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(26156..26983) product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356010.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(26999..27343) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene rnpA CDS complement(28122..28256) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356012.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene rpmH CDS 29074..30417 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356013.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene dnaA CDS 30617..31747 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356014.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene dnaN CDS complement(31836..32438) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922666.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(32448..32756) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 33097..33339 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene yaaA CDS 33326..34453 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene recF CDS 34450..36399 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359210.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene gyrB CDS 36419..38938 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene gyrA CDS 39085..39516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(39780..40187) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(40224..40634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 41207..41590 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 41878..43395 product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(43439..43984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 44130..45062 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(45221..45484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 46048..46863 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene menB CDS 46882..48351 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 48348..49730 product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364946.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 49714..51438 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene menD CDS 51435..52265 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819179.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene menH CDS 52287..53396 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene menC CDS complement(53449..54978) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 55286..55588 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene rpsF CDS 55636..56187 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379277.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene ssb CDS 56213..56452 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356021.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene rpsR CDS 56620..58596 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356022.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 58633..59085 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356023.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene rplI CDS 59227..60600 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381331.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene dnaB CDS complement(60662..61144) product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene ureI CDS 61453..62745 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 62903..63769 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 64188..64466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 64579..64998 product RinA family phage transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379371.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 65670..65981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 66024..66266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 66320..66469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 66485..67807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 68315..68872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 68956..69177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 69415..73914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 74056..74553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 74634..75716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 75733..76650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 76668..77588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 77637..78218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 78218..79003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 79008..81584 product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 81584..82246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109519.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 82251..82442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 82432..82908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 82901..84073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 84311..84988 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714168.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(85051..86682) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359215.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 86979..89876 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387433.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 90084..90578 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385473.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 90860..91858 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 91892..92698 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 92722..93633 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356032.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 93762..94136 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356033.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(94197..95003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(95006..95335) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 95730..96257 product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356034.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 96276..96677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(96813..97013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294340.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 97178..97756 product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288651.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 98122..100263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 100463..101011 product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910868.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene dhaS CDS complement(101071..102063) product DhaKLM operon coactivator DhaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene dhaQ CDS 102398..103381 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722647.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene dhaK CDS 103437..104024 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene dhaL CDS 104017..104385 product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene dhaM CDS 104409..105539 product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948659.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS 105690..108281 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387438.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene mprF CDS 108398..108730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819188.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 108871..109794 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene rihC CDS complement(109886..111019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(111012..111530) product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene sigM CDS complement(111899..114535) product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(114963..115790) product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene hisJ CDS complement(115893..117140) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385467.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(117163..117957) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389550.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene proB CDS complement(118191..119435) product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(119435..120622) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009918143.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(120623..121714) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931650.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene serC CDS complement(121969..122664) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113849253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 122708..123325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387231.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 123339..124655 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 124795..126162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 126274..126753 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389647.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 126857..128227 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361473.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 gene radA CDS 128313..129455 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS 129442..130164 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene ispD CDS 130165..130647 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367570.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene ispF CDS 130663..132120 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene gltX CDS 132560..133108 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356054.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene cysE CDS 133092..134504 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774249.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene cysS CDS 134501..134899 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 134889..135728 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387444.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene rlmB CDS 135800..136330 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356058.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 136418..136978 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356059.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 137112..137357 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356060.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 137527..138108 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(138181..139701) product polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989999.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 140058..140909 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356061.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene ispE CDS 141061..142023 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 142101..142781 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356064.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 142754..143596 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383493.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 143857..144684 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene purR CDS complement(144731..146080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 146308..147453 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(147554..148468) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(148446..149159) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100873.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(149161..149490) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 149767..149940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(151489..151767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 151890..152765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 152876..153070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(153439..154086) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774153.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS 154405..155787 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene glmU CDS complement(155849..159622) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714156.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 159993..160112 product epipeptide YydF family RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226979.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 160419..161183 product YydG family radical SAM peptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242609.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 161167..161919 product zinc metalloprotease LiaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243055.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene liaK CDS 161931..162563 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242913.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 162568..163284 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379198.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 163488..164459 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387396.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 164953..166242 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene rsxC CDS 166242..167195 product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(167266..168612) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene celB CDS complement(168628..170019) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890696.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(170191..170964) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 171178..173535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 173587..173850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 174025..175227 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368095.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 175227..175889 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene sdaAB CDS 175909..176784 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene sdaAA CDS 176850..178280 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972982.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 178488..179060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 179170..179940 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 179937..181082 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722368.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene nagA CDS complement(181136..181927) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472607.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 182047..182556 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(182640..183575) product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(183678..185441) product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(185808..186632) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943655.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(186805..187455) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene pgmB CDS complement(187476..190184) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 190391..191104 product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354877.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene treR CDS 191139..191924 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325086.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 191961..192302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 192349..192780 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS complement(192913..193167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(193326..193778) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354883.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene mscL CDS 193983..195251 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387388.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 195244..196536 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387387.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 196868..197809 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 197963..198571 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene pgsA sequence35 source 1..1215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 sequence36 source 1..1173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence37 source 1..920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 sequence38 source 1..863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence39 source 1..813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..626) product DUF1310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990075.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 sequence40 source 1..697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence41 source 1..696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(527..667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 sequence42 source 1..658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence43 source 1..635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..635) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 sequence44 source 1..607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence45 source 1..196701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 318..686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS 1736..1969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(1974..3836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 5093..5401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(5454..5876) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(6043..7113) product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047979901.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(7113..8234) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875883.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(9081..9356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(9370..9672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS complement(9676..10959) product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(10961..11359) product DUF1310 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(12163..12432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(12452..12832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(12836..12970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(13088..13834) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(13912..14499) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723155.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene leuD CDS complement(14499..15875) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene leuC CDS complement(15877..16923) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989858.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene leuB CDS complement(16920..18452) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(19107..20387) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 20935..21291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 21324..21485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383115.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(21848..22282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(22431..23018) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(23198..25909) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(26367..26531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(26647..27861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 27990..28958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(29027..29416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(29441..30199) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(30217..32052) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(32156..33190) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(33467..34435) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(34432..35169) product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(35489..36565) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(37408..37548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(37583..37852) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085659.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene rpsN CDS complement(37942..38631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(38910..41717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(41747..42775) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(42790..43482) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296472.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(43535..44200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(44310..45011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(45083..45313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(45364..45708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(45714..46850) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 47311..48084 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 48074..49429 product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS 49651..50934 product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(50996..51865) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(51986..52969) product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357245.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene lacD CDS complement(52973..53428) product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(53453..54862) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355535.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(54864..55802) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355534.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene pfkB CDS 55964..56707 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363162.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(56794..56949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(57084..58220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(58217..59113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(59337..60338) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379414.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(60341..61006) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360415.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene modB CDS complement(61016..61834) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382290.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene modA CDS complement(61859..62833) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379413.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(62849..63322) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361756.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(63315..63749) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(63755..64720) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene moaA CDS complement(64745..65242) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene moaC CDS complement(65579..66781) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819376.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(66796..69516) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371207.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene fdhF CDS complement(69518..70816) product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371208.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(70828..71316) product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357722.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(71313..71873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(71884..72693) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(72706..73236) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 73556..74254 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905450.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(74314..75261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 75485..75802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(75810..75998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(76149..76829) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002347025.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(76830..77675) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(77685..79145) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(79380..84233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(84469..85503) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989522.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(85620..86351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(86441..86665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(86674..86991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(86991..88097) product transmembrane protein ElrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387174.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene elrE CDS complement(88124..88483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(88888..89634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(89907..90998) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 91555..91743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(91882..92403) product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene paiA CDS complement(92584..93075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(93319..93744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(94281..94787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(94893..95363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(95546..95875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 97496..97789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(97852..98817) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804173.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(98873..101917) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(101930..103192) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167385843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(103185..104969) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124860.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(105362..105724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(105736..106500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(106522..106827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 107000..107440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(107461..108516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 108882..109877 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379301.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene galE CDS complement(110035..110214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(110687..111043) product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(111107..111370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(111380..111673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(111779..112948) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(113093..114292) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930971.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(114801..115064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(115225..116160) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030277.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 116234..118459 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(118587..118874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(118956..120002) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386205.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(120027..120728) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355236.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(120742..122205) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023877.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(122261..123220) product DUF4822 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036609.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(123422..124129) product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296566.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(124419..126185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(126185..127459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(127652..128950) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene eno CDS complement(129109..129864) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357096.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene tpiA CDS complement(129980..131173) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295135.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(131310..132311) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357093.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene gap CDS complement(132352..133389) product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(133849..134754) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 134956..136410 product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 136410..137753 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene celB CDS complement(137775..138566) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373191.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(138657..139391) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722126.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 139504..140403 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254084.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(140465..141325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(141315..142238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 142337..142510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(142523..144292) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene aspS CDS complement(144323..145624) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366882.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene hisS CDS complement(146278..147081) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387594.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene folP CDS complement(147078..147674) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379022.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(147687..148253) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene folE CDS complement(148258..148746) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354734.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene folK CDS complement(148743..149108) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354733.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene folB CDS 149300..150235 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(150864..151310) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357080.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene dtd CDS complement(151323..153536) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357079.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(153754..154401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(154419..155168) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289095.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(155170..156117) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene prmA CDS complement(156131..156616) product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002388170.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(156613..157251) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 157509..158798 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 159124..159402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 159500..159976 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293649.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(160058..161245) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357064.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(161272..162279) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(162522..162884) product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357061.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene comGG CDS complement(162877..163350) product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene comGF CDS complement(163316..163639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(163614..164069) product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317395.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene comGD CDS complement(164066..164350) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene comGC CDS complement(164347..165393) product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356990.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene comGB CDS complement(165347..166309) product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364362.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene comGA CDS complement(166833..168170) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362058.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(168305..169012) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295327.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(169005..169865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 note possible pseudo, frameshifted CDS complement(169871..170509) product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(170628..170807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(170874..171173) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(171301..172779) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(172795..173253) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(173269..174333) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288825.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene ulaG CDS 174530..175294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 175309..176076 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 176257..177186 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222592.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(177364..178434) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293986.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene rlmN CDS complement(178753..180579) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383725.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(180569..181318) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381711.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(181427..182128) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364244.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(182442..184814) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(184923..186311) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene nhaC CDS complement(186616..187827) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360017.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(187858..188763) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 188882..189862 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360015.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(190039..191799) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383727.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene cydC CDS complement(191799..193529) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 gene cydD CDS complement(193526..194551) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379582.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene cydB CDS complement(194548..195963) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356974.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 sequence46 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence47 source 1..582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence48 source 1..567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence49 source 1..532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence50 source 1..506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence51 source 1..398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 8..97 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 231..306 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 sequence52 source 1..371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence53 source 1..314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence54 source 1..184857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 805..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(1160..1447) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355868.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene rpmA CDS complement(1460..1804) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355867.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(1838..2146) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene rplU tRNA 2416..2491 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(2555..4453) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(4437..6182) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(6170..6634) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(6919..7440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(7440..7760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(7757..7987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(7987..8862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(8888..11695) product phage tail spike protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(11692..12459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(12473..14473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(14489..14713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(14830..15171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(15277..15786) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071876606.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(15783..15977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 16254..16727 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020866.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 16748..16894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 16907..17269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 note possible pseudo, internal stop codon CDS 17288..18082 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066517.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 18123..18875 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726690.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(18901..20220) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721330.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(20403..20924) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(20921..21394) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002395673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 gene tsaE CDS complement(21520..22500) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320882.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene pta CDS complement(22654..23337) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 23526..24395 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383369.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 24433..24951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355833.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(24974..25543) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(25682..26848) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355830.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(27086..27931) product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387023.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 28310..30034 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 30031..31794 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(31850..32386) product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(32722..33144) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289508.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene mgsA CDS 33330..34439 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene ugpC CDS complement(34483..35115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355821.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(35350..37014) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(37050..38237) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(38404..39786) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene lpdA CDS complement(40104..41549) product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene gcvPB CDS complement(41546..42862) product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene gcvPA CDS complement(42866..43249) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene gcvH CDS complement(43274..44359) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene gcvT CDS complement(44675..45667) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994302.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(45710..46903) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(47105..47986) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358849.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene rsmA CDS complement(48013..48579) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene rnmV CDS complement(48576..49346) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 49499..51673 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189825.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 52691..53920 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 54174..54998 product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 55109..56296 product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949084.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(56424..57650) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(57847..59856) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355813.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene metG CDS complement(60125..61303) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(61334..62698) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene fumC CDS complement(62833..64221) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379190.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(64304..65167) product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(65552..66577) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379189.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(66592..67266) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(67414..67623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355808.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(68596..69096) product mep operon protein MepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058773.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(69668..70024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(70227..71045) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373539.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 71156..72202 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355805.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(72338..72787) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355869.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene psiE CDS 73155..74477 product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene celB CDS complement(74545..75048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(75328..76338) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(76341..76850) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(76834..79287) product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(79411..80727) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(80724..81431) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(81473..82576) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476416.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene glf CDS complement(82757..85687) product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(85928..86287) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene rplT CDS complement(86385..86585) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene rpmI CDS complement(86633..87154) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene infC CDS complement(87466..88266) product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295901.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene ybjI CDS complement(88281..89066) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(89334..90455) product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene tnpB CDS complement(91004..91963) product oligopeptide ABC transporter ATP-binding protein Opp1F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene opp1F CDS complement(91963..93024) product oligopeptide ABC transporter ATP-binding protein Opp1D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene opp1D CDS complement(93030..94082) product oligopeptide ABC transporter permease Opp1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355787.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene opp1C CDS complement(94082..95023) product oligopeptide ABC transporter permease Opp1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene opp1B CDS 95105..95452 product DUF3899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(95531..97207) product oligopeptide ABC transporter substrate-binding protein Opp1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399736.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 gene opp1A CDS 97656..98714 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 98754..99389 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294161.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 99581..99808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 99808..101166 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 101184..102128 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379181.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene mvk CDS 102128..103126 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109469.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene mvaD CDS 103123..104220 product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355777.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS 104204..105250 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399734.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene fni CDS complement(105413..105586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(105647..106507) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379188.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(106622..107386) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene map CDS complement(107421..107849) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(107940..110537) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355775.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene adhE CDS complement(110727..110900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(111090..111452) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene yajC CDS complement(111535..112680) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene tgt CDS complement(112848..113936) product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358821.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 114161..115624 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358820.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 115617..116339 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 116437..117588 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355768.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(117680..118381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(118409..118612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(118725..121367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(121377..121997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(122010..122852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(122869..123594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(123636..124886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(124959..125876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(126439..127305) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene metF CDS complement(127306..129570) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905853.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene metE CDS complement(129723..130448) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189145.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(130486..131403) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125593511.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 131703..131921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(132090..133388) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289278.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(133601..135610) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387003.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(136110..138746) product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355749.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 139445..139699 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381292.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 139719..140051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(140109..140282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(140364..143264) product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(143483..144487) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989687.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(144489..145097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(145098..145832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 146447..146845 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356477.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 gene spxA CDS complement(146972..148003) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355747.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene queA CDS 148166..149056 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355746.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(150039..151595) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025868375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(151595..151912) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 153018..154211 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355745.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 154216..154851 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS 154851..155783 product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355743.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 155783..156457 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363261.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(156827..157735) product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(157878..159701) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379167.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(159947..161608) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(161722..162063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(162211..163374) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386999.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(163605..163766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(163968..166667) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379165.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(166920..167147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(167651..168994) product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361833.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 169185..170666 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773705.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(170882..171739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(171909..172274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(172307..173662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386995.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(173697..174398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378072.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(174808..175188) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355729.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS complement(175204..176322) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355728.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene alr CDS complement(176448..176801) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379159.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene acpS CDS complement(177033..178568) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355724.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(178904..180271) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189821.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(180383..181459) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774177.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(181960..182409) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379156.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(182437..183447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363239.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(183646..184656) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379155.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 sequence55 source 1..173073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1205 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321119.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(1250..2770) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(2808..3263) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371463.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene argR CDS complement(3420..4217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 4306..6492 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(6618..8231) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775656.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(8221..10182) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641781.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 10431..11912 product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100912.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS 11926..12909 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363973.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(13093..14043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 15381..15665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(15734..17251) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(17253..18206) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386926.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(18530..18871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(18893..19969) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989514.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(20157..20867) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(20893..21561) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296472.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(21587..22267) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(22376..25519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS 25698..25871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 25829..27337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(27642..31862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(32269..33684) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene pepV CDS 33836..34687 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289318.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(34691..35341) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641758.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(35341..36162) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732024.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(36159..37046) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010679823.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(37182..37904) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285969.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(38152..39801) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 40259..41776 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(41954..42862) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(43175..44368) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 44286..44495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 44674..45681 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459859.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 45725..46084 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 46189..46860 product NAD(P)H-dependent flavin oxidoreductase FrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373527.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene frxA CDS complement(46969..49434) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(49637..50647) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286379.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(50782..51456) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286375.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene pgmB CDS complement(51449..53728) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 53972..56149 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286368.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 56235..57056 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370688.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(57337..58638) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265226.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(58640..58972) product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265227.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(58966..60081) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267479.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 60410..61258 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 61840..62475 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379063.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(62509..63348) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(63357..64712) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(64825..66060) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 66434..68299 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379398.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 68220..69872 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382265.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 69940..71613 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382266.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(71692..72312) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS 72454..72876 product Hg(II)-responsive transcriptional regulator MerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425271.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene merR CDS 72879..73229 product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172064.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS complement(73428..74906) product polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 75297..76757 product M protein trans-acting positive regulator PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837580.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(77024..77779) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(77814..78566) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405005.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 78688..79260 product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(79299..79859) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378947.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(80013..80711) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355326.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(80870..81634) product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355000.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 81876..82241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354999.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 82347..82823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 82931..83431 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234962.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 83422..83805 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 83901..84635 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563450.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 84677..85075 product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386965.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(85287..85529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(85553..86881) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358780.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(86902..88284) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 88484..89251 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726690.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS complement(89313..90095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354996.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(91656..91829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(91829..92734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 94333..95070 product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354994.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(95131..95352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(95776..97470) product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(97579..98154) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(98241..100766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS complement(100931..101989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(102295..103305) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381340.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene ruvB CDS complement(103318..103929) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359241.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 gene ruvA CDS complement(103981..104136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(104087..105760) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356069.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(105947..106384) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene msrB CDS complement(106482..106979) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(107010..107564) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354869.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(107591..109672) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 gene mutL CDS complement(109712..112279) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378992.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene mutS CDS complement(112282..112650) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354866.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(112858..113922) product DUF916 and DUF3324 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642360.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(114008..114592) product WxL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355609.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(114593..114868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(114882..117287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(117580..119085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(119261..120058) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354864.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 120877..121074 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(121316..121552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(121575..121730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(121882..122481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(123086..123268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 note possible pseudo, internal stop codon, frameshifted CDS 123639..124151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(124297..124482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(124513..125022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(125658..125939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(126098..126349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29160 note possible pseudo, frameshifted CDS complement(126498..128150) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355011.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(128317..129873) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene rny CDS complement(130132..131184) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene recA CDS complement(131292..132539) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189782.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 132719..133894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367468.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(133959..134747) product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987086.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 134960..135811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(135910..136533) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189783.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(136602..137024) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 137214..138020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706768.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 138221..139993 product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361446.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(140095..140685) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385850.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene yqeK CDS complement(140847..141413) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476379.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(141425..142504) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417572.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(142541..142963) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376235.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS 143152..144147 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(144343..145155) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363318.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene proC CDS complement(145178..146164) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS 146358..147311 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376144.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(147520..148647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(148661..149338) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(149550..150218) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(150271..151653) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722689.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(152116..152526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901533.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(152528..153157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(153168..153896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(153900..154109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(154118..154660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(154738..154926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS complement(155086..155553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(155935..156588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(156752..156892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(156889..157467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(157994..158302) product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837102.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(158295..158888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(158885..160312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(160342..161052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS complement(161052..161363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(161386..161823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(161856..162179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(162376..162666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 162772..162981 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381043.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(163254..163685) product type II toxin-antitoxin system antitoxin YxxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244256.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 gene yxxD CDS complement(163742..164341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061673381.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(164506..164952) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052204.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(164965..165276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(165269..165562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(165820..166254) product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060032.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(166486..166656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(166919..167305) product immunity 22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451794.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(167311..169305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS complement(169394..169600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(169718..169990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(170008..171573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(171603..172313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS complement(172313..172606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(172630..173067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 sequence56 source 1..156553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 1041..1538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(1570..2019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 2163..2429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS 3753..3956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 4108..4494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29790 note possible pseudo, frameshifted CDS complement(4701..5213) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362126.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene tadA CDS 5293..6156 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383772.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(6248..6583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356871.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(6657..7361) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 7543..7905 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387247.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(7949..8953) product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(9201..10667) product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383776.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene treP CDS 10908..12272 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304549.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(12957..13157) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293303.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS complement(14041..15876) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene lepA CDS 16346..17566 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356813.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 17605..17859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 17870..18349 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288352.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 18392..19069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366175.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(19112..19516) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355332.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(19692..20132) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924543.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(20340..22943) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356811.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene clpB CDS complement(23804..24304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(24334..24969) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(25093..25251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(25658..26128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(26230..27159) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355760.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 gene dnaI CDS complement(27159..28565) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379174.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(28578..29063) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381296.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 gene nrdR CDS complement(29426..30022) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 gene coaE CDS complement(30026..30862) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355756.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene mutM CDS complement(30960..33605) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene polA CDS complement(33924..34835) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288005.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(34859..36373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(36447..38504) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224561157.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(38655..39218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 39580..40398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 40600..41946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 42077..42511 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289110.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(42686..43444) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817589.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(43601..43963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(44189..45475) product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027805.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(45489..46286) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028344.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(46376..47698) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168860.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 gene celB CDS complement(47720..50347) product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 gene mngB CDS complement(50597..50932) product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(50935..52365) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(52365..53060) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125982028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(53035..53652) product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS complement(53649..54821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(55112..55756) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene pcp CDS complement(55889..56833) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(56830..57531) product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287083.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(58057..59553) product ABC-F type ribosomal protection-like protein Eat(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296175.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 gene eat(A) CDS 60022..60405 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687566.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 60433..61272 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990045.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 61547..62398 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990044.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(62488..63666) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 63872..64270 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354951.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(65045..66346) product multidrug efflux MFS transporter EfmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291207.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene efmA CDS complement(66796..67059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(67112..68035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(68025..68567) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948534.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(68702..69304) product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287348.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene thiT CDS 69746..70846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(71197..71658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355960.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 71884..72327 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287091.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene nrdI CDS complement(72466..73437) product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(73526..75112) product phosphatase PAP2/LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379014.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(75657..77498) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(77515..79896) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986473.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(79896..80342) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(80627..81958) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905313.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(82038..82319) product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene eutM CDS complement(82340..83002) product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986618.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(83019..84542) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986619.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(84553..85068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(85072..85680) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986621.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(85696..85959) product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361873.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(85953..86246) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358168.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(86258..87097) product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986622.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 gene eutJ CDS complement(87069..87626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(87626..88768) product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS complement(88783..89214) product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815261.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(89211..89555) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358362.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(89572..90522) product choline TMA-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986624.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene cutD CDS complement(90540..93077) product choline trimethylamine-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358179.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene cutC CDS complement(93102..94541) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS complement(94545..94865) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986626.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(94883..95179) product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358244.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(95192..95476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986627.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(95478..96482) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986628.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(96512..96787) product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene eutM CDS complement(97306..98163) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(98937..99320) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359784.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 99726..99986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 99991..100794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(101058..102740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(103231..104442) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597374.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(104445..105596) product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(105609..105962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(105976..106899) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674092.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene yhfZ CDS complement(106905..107999) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674094.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(107996..108889) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003597368.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(108913..110220) product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(110225..110593) product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573501.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 110938..112500 product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989519.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(113088..114044) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(114022..114690) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(115081..115503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(115661..116974) product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948242.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(116967..117884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(117892..118767) product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948240.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(118764..119081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(119139..119882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(119882..120772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(120825..120974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS complement(121349..123658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(123652..124356) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779440.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 125179..125445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS complement(125676..126050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS complement(126384..127031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(127694..129361) product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211850673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(129425..131575) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(131582..132535) product DUF1837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837429.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(132930..133175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(133816..135210) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene sufB CDS complement(135262..135726) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356768.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(135713..136948) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS complement(136945..138231) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364433.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene sufD CDS complement(138246..139016) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356763.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 gene sufC CDS 139355..140296 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene hemH CDS complement(140343..141194) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287678.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(141231..141920) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287674.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(141910..142947) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(143423..143746) product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(143746..144102) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359675.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(144121..145305) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356636.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 145552..146304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(146440..146625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355495.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(146792..148210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 tRNA complement(148459..148533) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 148671..148907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381528.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(148998..149627) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene upp CDS complement(149707..150945) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS complement(151001..152038) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(152058..152891) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379699.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene prmC CDS complement(152884..153957) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289676.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene prfA CDS complement(154019..154612) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387135.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(154957..155223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(155224..155589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 misc_feature complement(155589..>156553) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930426.1:DUF2974 domain-containing protein locus_tag LOCUS_31250 sequence57 source 1..156080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 715..885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 952..1155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31270 note possible pseudo, internal stop codon CDS 1188..1400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 2006..2152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS 2706..3473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(3549..3740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(3819..4055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 4405..4674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(4827..5372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 5574..5771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(5865..6668) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379689.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(6665..7837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(7945..9177) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 9453..11489 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 11617..12336 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385746.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene tsaB CDS 12320..12868 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 gene rimI CDS 12873..13334 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370458.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene rimI CDS 13331..14365 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370457.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 gene tsaD CDS 15095..16786 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370456.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 gene argS CDS complement(16973..17926) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382786.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 18246..18767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356797.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 18788..18988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS 19082..19705 product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 19734..20441 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356802.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 20707..21288 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356804.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 21291..22619 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819529.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 22774..23262 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303771.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 gene purE CDS 23255..24376 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene purK CDS 24395..25690 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359782.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene purB CDS complement(26091..26477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297115.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 26781..27482 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369269.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 27505..27753 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295474.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene purS CDS 27755..28438 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302316.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene purQ CDS 28435..30657 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288015.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene purL CDS 30642..32090 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene purF CDS 32139..33179 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288011.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene purM CDS 33182..33766 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288010.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene purN CDS 33763..35304 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288009.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene purH CDS 35317..36591 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288007.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene purD CDS 36740..37234 product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294835.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(37699..38511) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355941.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 38628..39287 product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386206.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 39371..41647 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775266.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 41930..43336 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355943.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 43473..44669 product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(44780..44971) product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355945.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 45145..48477 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379216.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene dnaE CDS 48649..49611 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355947.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 gene pfkA CDS 49708..51465 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 gene pyk CDS 51656..52675 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649137.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene adhP CDS 53087..53242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427864.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 53511..53813 product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356684.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 53817..55010 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356686.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 55109..58537 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706553.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 58555..59676 product CAP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706552.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 59679..60110 product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356689.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 60100..60450 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359714.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 60559..61122 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 gene rsmD CDS 61115..61615 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356693.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene coaD CDS 61608..62669 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382735.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(62754..63575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(63613..64137) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965073.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 64237..64863 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 65022..65531 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356697.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 65557..67836 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083241703.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 67886..68917 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 gene holA CDS complement(69338..69592) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292188.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene rpsT CDS 69836..70849 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 70862..71485 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356705.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 71597..72235 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289185.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(72379..74349) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS complement(74601..75431) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 75610..76101 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706547.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 76370..77434 product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 77436..78323 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356712.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene murQ CDS 78344..79780 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362674.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 80009..80866 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385762.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(80959..81660) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(81761..82387) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356716.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 82853..83830 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287992.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene guaC CDS 84047..84907 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778349.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 85166..85495 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356722.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 85495..86469 product permease prefix domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387089.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(86526..87074) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642750.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(87079..87909) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721779.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene pdxK CDS 88221..89663 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387088.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 89692..90417 product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837376.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 90530..92254 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706546.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 92333..93109 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387085.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene proC CDS 93232..93537 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 93671..94960 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359742.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 94964..96022 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 gene thrC CDS 96019..96882 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387081.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene thrB CDS complement(96936..97793) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356735.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 97892..98320 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287322.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 98528..98704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 98730..99182 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 99351..101843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 102207..103175 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356743.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 103208..105406 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356744.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 105406..105882 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene ybeY CDS 105860..106267 product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382764.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 106280..107182 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359745.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene era CDS 107276..108097 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359746.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 gene recO CDS 108581..109489 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 gene glyQ CDS 109491..111572 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene glyS CDS 111978..112382 product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912062.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 112390..114198 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989525.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 114200..114973 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732640.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 114986..115792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 115855..116427 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295080.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(116469..117398) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 gene yidC CDS complement(117518..117793) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706543.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 117913..118680 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356757.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 119020..119808 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356759.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 gene rpsB CDS 120160..121041 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356760.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene tsf CDS 121178..121900 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356761.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene pyrH CDS 121904..122461 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356762.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene frr CDS 122691..124157 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 124170..124844 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 124837..126399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 126623..127426 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362225.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 127423..128223 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359680.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 128258..129442 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 129439..130707 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359768.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene rseP CDS 130776..132488 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382780.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 132864..137216 product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382781.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 137484..140498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 140833..141276 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357706.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene zapA CDS 141294..141842 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357705.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 141916..144282 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382291.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 144373..144687 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357703.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene trxA CDS 144869..146671 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357701.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene uvrC CDS 146842..147078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 147352..147717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS 147934..148833 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295091.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 148826..150088 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357698.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(150122..151117) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379419.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 151295..152689 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357694.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(152747..154219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 154589..154819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 155034..155213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670