>Feature sequence01 3608 4354 gene locus_tag LOCUS_00010 3608 4354 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_00010 4351 5334 gene locus_tag LOCUS_00020 4351 5334 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839776.1 protein_id gnl|my_center|LOCUS_00020 7130 5343 gene locus_tag LOCUS_00030 7130 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7881 8219 gene locus_tag LOCUS_00040 7881 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8253 9596 gene locus_tag LOCUS_00050 8253 9596 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208613552.1 protein_id gnl|my_center|LOCUS_00050 9720 9646 gene locus_tag LOCUS_t00010 9720 9646 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9793 9721 gene locus_tag LOCUS_t00020 9793 9721 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9947 9874 gene locus_tag LOCUS_t00030 9947 9874 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10479 10054 gene locus_tag LOCUS_00060 10479 10054 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227152.1 protein_id gnl|my_center|LOCUS_00060 10913 10841 gene locus_tag LOCUS_t00040 10913 10841 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12473 11151 gene locus_tag LOCUS_00070 12473 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_00070 12421 12798 gene locus_tag LOCUS_00080 12421 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12728 13384 gene locus_tag LOCUS_00090 12728 13384 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_00090 13471 15495 gene locus_tag LOCUS_00100 gene thrS 13471 15495 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227149.1 protein_id gnl|my_center|LOCUS_00100 15505 16062 gene locus_tag LOCUS_00110 15505 16062 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_00110 16719 16135 gene locus_tag LOCUS_00120 16719 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16804 17286 gene locus_tag LOCUS_00130 16804 17286 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_00130 17346 17972 gene locus_tag LOCUS_00140 17346 17972 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227146.1 protein_id gnl|my_center|LOCUS_00140 17969 18910 gene locus_tag LOCUS_00150 17969 18910 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227145.1 protein_id gnl|my_center|LOCUS_00150 18933 20063 gene locus_tag LOCUS_00160 18933 20063 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227144.1 protein_id gnl|my_center|LOCUS_00160 20087 21127 gene locus_tag LOCUS_00170 20087 21127 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090088.1 protein_id gnl|my_center|LOCUS_00170 23243 21120 gene locus_tag LOCUS_00180 23243 21120 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227139.1 protein_id gnl|my_center|LOCUS_00180 23473 24378 gene locus_tag LOCUS_00190 gene pdxS 23473 24378 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_00190 24935 24384 gene locus_tag LOCUS_00200 24935 24384 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_00200 25010 25708 gene locus_tag LOCUS_00210 25010 25708 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_00210 25705 26052 gene locus_tag LOCUS_00220 25705 26052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26082 26708 gene locus_tag LOCUS_00230 gene pdxT 26082 26708 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_00230 26705 27454 gene locus_tag LOCUS_00240 26705 27454 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_00240 27913 27461 gene locus_tag LOCUS_00250 27913 27461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28103 29767 gene locus_tag LOCUS_00260 28103 29767 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_00260 29827 30432 gene locus_tag LOCUS_00270 29827 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30429 31199 gene locus_tag LOCUS_00280 30429 31199 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929266.1 protein_id gnl|my_center|LOCUS_00280 31271 31600 gene locus_tag LOCUS_00290 31271 31600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31590 33050 gene locus_tag LOCUS_00300 31590 33050 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_00300 33047 33709 gene locus_tag LOCUS_00310 33047 33709 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_00310 33770 34957 gene locus_tag LOCUS_00320 33770 34957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 34954 35436 gene locus_tag LOCUS_00330 34954 35436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35521 36249 gene locus_tag LOCUS_00340 35521 36249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38664 36238 gene locus_tag LOCUS_00350 38664 36238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38987 38661 gene locus_tag LOCUS_00360 38987 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39664 39047 gene locus_tag LOCUS_00370 39664 39047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39787 40305 gene locus_tag LOCUS_00380 39787 40305 CDS product DUF4262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878153.1 protein_id gnl|my_center|LOCUS_00380 40352 42088 gene locus_tag LOCUS_00390 40352 42088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42795 42064 gene locus_tag LOCUS_00400 42795 42064 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027023.1 protein_id gnl|my_center|LOCUS_00400 44447 42915 gene locus_tag LOCUS_00410 44447 42915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45305 44460 gene locus_tag LOCUS_00420 45305 44460 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_00420 46218 45295 gene locus_tag LOCUS_00430 46218 45295 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_00430 47494 46229 gene locus_tag LOCUS_00440 47494 46229 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218106651.1 protein_id gnl|my_center|LOCUS_00440 47659 48249 gene locus_tag LOCUS_00450 gene ruvC 47659 48249 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284467.1 protein_id gnl|my_center|LOCUS_00450 48246 48860 gene locus_tag LOCUS_00460 gene ruvA 48246 48860 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 protein_id gnl|my_center|LOCUS_00460 48867 49979 gene locus_tag LOCUS_00470 gene ruvB 48867 49979 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 protein_id gnl|my_center|LOCUS_00470 50006 50389 gene locus_tag LOCUS_00480 50006 50389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50546 52357 gene locus_tag LOCUS_00490 gene secD 50546 52357 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467234.1 protein_id gnl|my_center|LOCUS_00490 52360 53637 gene locus_tag LOCUS_00500 gene secF 52360 53637 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227118.1 protein_id gnl|my_center|LOCUS_00500 53640 54161 gene locus_tag LOCUS_00510 53640 54161 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227117.1 protein_id gnl|my_center|LOCUS_00510 54930 54166 gene locus_tag LOCUS_00520 54930 54166 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_00520 55007 57319 gene locus_tag LOCUS_00530 55007 57319 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227116.1 protein_id gnl|my_center|LOCUS_00530 58069 57332 gene locus_tag LOCUS_00540 58069 57332 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_00540 59779 58082 gene locus_tag LOCUS_00550 59779 58082 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_00550 60756 59914 gene locus_tag LOCUS_00560 60756 59914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60949 63195 gene locus_tag LOCUS_00570 60949 63195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 64137 63184 gene locus_tag LOCUS_00580 64137 63184 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_00580 64205 64780 gene locus_tag LOCUS_00590 64205 64780 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_00590 64973 65743 gene locus_tag LOCUS_00600 64973 65743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65827 66525 gene locus_tag LOCUS_00610 65827 66525 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_00610 66527 67156 gene locus_tag LOCUS_00620 66527 67156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227104.1 protein_id gnl|my_center|LOCUS_00620 69781 67703 gene locus_tag LOCUS_00630 69781 67703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 70065 70259 gene locus_tag LOCUS_00640 70065 70259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 70335 71042 gene locus_tag LOCUS_00650 gene pqqC 70335 71042 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467700.1 protein_id gnl|my_center|LOCUS_00650 71045 71302 gene locus_tag LOCUS_00660 gene pqqD 71045 71302 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229607.1 protein_id gnl|my_center|LOCUS_00660 71293 72399 gene locus_tag LOCUS_00670 gene pqqE 71293 72399 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229608.1 protein_id gnl|my_center|LOCUS_00670 72396 73286 gene locus_tag LOCUS_00680 gene pqqB 72396 73286 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229609.1 protein_id gnl|my_center|LOCUS_00680 73345 73920 gene locus_tag LOCUS_00690 gene idi 73345 73920 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_00690 74705 74214 gene locus_tag LOCUS_00700 74705 74214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74833 76659 gene locus_tag LOCUS_00710 74833 76659 CDS product intein-containing Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324692.1 protein_id gnl|my_center|LOCUS_00710 77147 78181 gene locus_tag LOCUS_00720 77147 78181 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222439.1 protein_id gnl|my_center|LOCUS_00720 79496 78552 gene locus_tag LOCUS_00730 79496 78552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_00730 79775 81556 gene locus_tag LOCUS_00740 gene aspS 79775 81556 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_00740 81561 82502 gene locus_tag LOCUS_00750 81561 82502 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466857.1 protein_id gnl|my_center|LOCUS_00750 82705 83835 gene locus_tag LOCUS_00760 82705 83835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224572.1 protein_id gnl|my_center|LOCUS_00760 84385 83840 gene locus_tag LOCUS_00770 84385 83840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 84501 85892 gene locus_tag LOCUS_00780 84501 85892 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224577.1 protein_id gnl|my_center|LOCUS_00780 86012 86422 gene locus_tag LOCUS_00790 86012 86422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 86419 86754 gene locus_tag LOCUS_00800 86419 86754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224581.1 protein_id gnl|my_center|LOCUS_00800 86829 89498 gene locus_tag LOCUS_00810 gene alaS 86829 89498 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224582.1 protein_id gnl|my_center|LOCUS_00810 89598 90083 gene locus_tag LOCUS_00820 gene ruvX 89598 90083 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051736371.1 protein_id gnl|my_center|LOCUS_00820 90080 91276 gene locus_tag LOCUS_00830 90080 91276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00830 91266 92195 gene locus_tag LOCUS_00840 91266 92195 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852947.1 protein_id gnl|my_center|LOCUS_00840 92205 92804 gene locus_tag LOCUS_00850 92205 92804 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461300.1 protein_id gnl|my_center|LOCUS_00850 93455 92808 gene locus_tag LOCUS_00860 93455 92808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93570 94757 gene locus_tag LOCUS_00870 gene aroC 93570 94757 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224602.1 protein_id gnl|my_center|LOCUS_00870 94761 95288 gene locus_tag LOCUS_00880 94761 95288 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_00880 95361 96470 gene locus_tag LOCUS_00890 95361 96470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 96494 97588 gene locus_tag LOCUS_00900 gene aroB 96494 97588 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224604.1 protein_id gnl|my_center|LOCUS_00900 97593 98069 gene locus_tag LOCUS_00910 gene aroQ 97593 98069 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_00910 98066 98962 gene locus_tag LOCUS_00920 98066 98962 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224606.1 protein_id gnl|my_center|LOCUS_00920 99048 100550 gene locus_tag LOCUS_00930 99048 100550 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224607.1 protein_id gnl|my_center|LOCUS_00930 100993 100571 gene locus_tag LOCUS_00940 100993 100571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 101025 102122 gene locus_tag LOCUS_00950 101025 102122 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_00950 102154 102717 gene locus_tag LOCUS_00960 gene efp 102154 102717 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_00960 102717 103136 gene locus_tag LOCUS_00970 gene nusB 102717 103136 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224611.1 protein_id gnl|my_center|LOCUS_00970 103223 104140 gene locus_tag LOCUS_00980 103223 104140 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_00980 104681 104193 gene locus_tag LOCUS_00990 104681 104193 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096372.1 protein_id gnl|my_center|LOCUS_00990 104941 105531 gene locus_tag LOCUS_01000 gene pyrR 104941 105531 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224613.1 protein_id gnl|my_center|LOCUS_01000 105528 106460 gene locus_tag LOCUS_01010 105528 106460 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224614.1 protein_id gnl|my_center|LOCUS_01010 106457 107752 gene locus_tag LOCUS_01020 106457 107752 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224615.1 protein_id gnl|my_center|LOCUS_01020 107832 108917 gene locus_tag LOCUS_01030 gene carA 107832 108917 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224617.1 protein_id gnl|my_center|LOCUS_01030 108904 112218 gene locus_tag LOCUS_01040 gene carB 108904 112218 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224620.1 protein_id gnl|my_center|LOCUS_01040 112215 113048 gene locus_tag LOCUS_01050 gene pyrF 112215 113048 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224621.1 protein_id gnl|my_center|LOCUS_01050 113460 113777 gene locus_tag LOCUS_01060 gene mihF 113460 113777 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_01060 113774 114382 gene locus_tag LOCUS_01070 gene gmk 113774 114382 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728781.1 protein_id gnl|my_center|LOCUS_01070 114379 114669 gene locus_tag LOCUS_01080 gene rpoZ 114379 114669 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224624.1 protein_id gnl|my_center|LOCUS_01080 114666 115895 gene locus_tag LOCUS_01090 gene coaBC 114666 115895 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831608.1 protein_id gnl|my_center|LOCUS_01090 115964 117166 gene locus_tag LOCUS_01100 gene metK 115964 117166 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_01100 117176 117553 gene locus_tag LOCUS_01110 117176 117553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 117557 119536 gene locus_tag LOCUS_01120 117557 119536 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_01120 119637 120185 gene locus_tag LOCUS_01130 gene def 119637 120185 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_01130 120188 121123 gene locus_tag LOCUS_01140 gene fmt 120188 121123 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224632.1 protein_id gnl|my_center|LOCUS_01140 121210 122559 gene locus_tag LOCUS_01150 121210 122559 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224633.1 protein_id gnl|my_center|LOCUS_01150 122583 123539 gene locus_tag LOCUS_01160 122583 123539 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_01160 123587 124261 gene locus_tag LOCUS_01170 gene rpe 123587 124261 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898866.1 protein_id gnl|my_center|LOCUS_01170 124262 124912 gene locus_tag LOCUS_01180 124262 124912 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_01180 124909 126153 gene locus_tag LOCUS_01190 124909 126153 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224641.1 protein_id gnl|my_center|LOCUS_01190 126271 126768 gene locus_tag LOCUS_01200 gene ribH 126271 126768 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_01200 126765 127208 gene locus_tag LOCUS_01210 126765 127208 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224643.1 protein_id gnl|my_center|LOCUS_01210 127679 127212 gene locus_tag LOCUS_01220 127679 127212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 127740 127940 gene locus_tag LOCUS_01230 127740 127940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 127937 128284 gene locus_tag LOCUS_01240 gene mazF9 127937 128284 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_01240 128381 128860 gene locus_tag LOCUS_01250 128381 128860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 129009 130043 gene locus_tag LOCUS_01260 129009 130043 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_01260 130620 130099 gene locus_tag LOCUS_01270 130620 130099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_01270 130731 132662 gene locus_tag LOCUS_01280 gene uvrC 130731 132662 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_01280 132659 133540 gene locus_tag LOCUS_01290 gene rapZ 132659 133540 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466867.1 protein_id gnl|my_center|LOCUS_01290 133537 134484 gene locus_tag LOCUS_01300 gene yvcK 133537 134484 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 protein_id gnl|my_center|LOCUS_01300 134573 135559 gene locus_tag LOCUS_01310 gene whiA 134573 135559 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224649.1 protein_id gnl|my_center|LOCUS_01310 135882 136886 gene locus_tag LOCUS_01320 gene gap 135882 136886 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_01320 136897 138096 gene locus_tag LOCUS_01330 136897 138096 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_01330 138093 138878 gene locus_tag LOCUS_01340 gene tpiA 138093 138878 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224668.1 protein_id gnl|my_center|LOCUS_01340 139018 139251 gene locus_tag LOCUS_01350 139018 139251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 139366 139659 gene locus_tag LOCUS_01360 139366 139659 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284344.1 protein_id gnl|my_center|LOCUS_01360 140857 139727 gene locus_tag LOCUS_01370 140857 139727 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_01370 141983 141219 gene locus_tag LOCUS_01380 gene pgl 141983 141219 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224672.1 protein_id gnl|my_center|LOCUS_01380 142954 141980 gene locus_tag LOCUS_01390 gene opcA 142954 141980 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224673.1 protein_id gnl|my_center|LOCUS_01390 144489 142951 gene locus_tag LOCUS_01400 gene zwf 144489 142951 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224674.1 protein_id gnl|my_center|LOCUS_01400 146093 144486 gene locus_tag LOCUS_01410 146093 144486 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_01410 147221 146103 gene locus_tag LOCUS_01420 gene tal 147221 146103 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_01420 149329 147218 gene locus_tag LOCUS_01430 gene tkt 149329 147218 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224677.1 protein_id gnl|my_center|LOCUS_01430 149529 150461 gene locus_tag LOCUS_01440 149529 150461 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224678.1 protein_id gnl|my_center|LOCUS_01440 150547 150885 gene locus_tag LOCUS_01450 150547 150885 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068923899.1 protein_id gnl|my_center|LOCUS_01450 150882 151388 gene locus_tag LOCUS_01460 150882 151388 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_01460 151689 151375 gene locus_tag LOCUS_01470 151689 151375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 152441 151749 gene locus_tag LOCUS_01480 152441 151749 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230413.1 protein_id gnl|my_center|LOCUS_01480 153200 152556 gene locus_tag LOCUS_01490 153200 152556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230412.1 protein_id gnl|my_center|LOCUS_01490 154042 153200 gene locus_tag LOCUS_01500 154042 153200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230411.1 protein_id gnl|my_center|LOCUS_01500 153963 154163 gene locus_tag LOCUS_01510 153963 154163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 154372 154980 gene locus_tag LOCUS_01520 154372 154980 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224685.1 protein_id gnl|my_center|LOCUS_01520 156002 155028 gene locus_tag LOCUS_01530 156002 155028 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224686.1 protein_id gnl|my_center|LOCUS_01530 156783 156040 gene locus_tag LOCUS_01540 156783 156040 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226358.1 protein_id gnl|my_center|LOCUS_01540 158017 157067 gene locus_tag LOCUS_01550 158017 157067 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224691.1 protein_id gnl|my_center|LOCUS_01550 158840 158064 gene locus_tag LOCUS_01560 158840 158064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224693.1 protein_id gnl|my_center|LOCUS_01560 159793 158885 gene locus_tag LOCUS_01570 159793 158885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224694.1 protein_id gnl|my_center|LOCUS_01570 161504 159831 gene locus_tag LOCUS_01580 gene mptB 161504 159831 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224695.1 protein_id gnl|my_center|LOCUS_01580 161557 162267 gene locus_tag LOCUS_01590 161557 162267 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_01590 162264 163706 gene locus_tag LOCUS_01600 gene sufB 162264 163706 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224697.1 protein_id gnl|my_center|LOCUS_01600 163707 164864 gene locus_tag LOCUS_01610 gene sufD 163707 164864 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224698.1 protein_id gnl|my_center|LOCUS_01610 164960 165175 gene locus_tag LOCUS_01620 164960 165175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 165195 165968 gene locus_tag LOCUS_01630 gene sufC 165195 165968 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224699.1 protein_id gnl|my_center|LOCUS_01630 165997 167253 gene locus_tag LOCUS_01640 165997 167253 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_01640 167250 167696 gene locus_tag LOCUS_01650 167250 167696 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_01650 167693 168082 gene locus_tag LOCUS_01660 167693 168082 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224702.1 protein_id gnl|my_center|LOCUS_01660 169041 168079 gene locus_tag LOCUS_01670 169041 168079 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223052.1 protein_id gnl|my_center|LOCUS_01670 169439 169038 gene locus_tag LOCUS_01680 169439 169038 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_01680 170527 169463 gene locus_tag LOCUS_01690 170527 169463 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124942.1 protein_id gnl|my_center|LOCUS_01690 170551 172104 gene locus_tag LOCUS_01700 gene dgt 170551 172104 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224725.1 protein_id gnl|my_center|LOCUS_01700 172264 175092 gene locus_tag LOCUS_01710 172264 175092 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224726.1 protein_id gnl|my_center|LOCUS_01710 175252 175686 gene locus_tag LOCUS_01720 175252 175686 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404726.1 protein_id gnl|my_center|LOCUS_01720 176473 175709 gene locus_tag LOCUS_01730 176473 175709 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224989.1 protein_id gnl|my_center|LOCUS_01730 176652 178280 gene locus_tag LOCUS_01740 176652 178280 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224728.1 protein_id gnl|my_center|LOCUS_01740 178412 178621 gene locus_tag LOCUS_01750 178412 178621 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221457660.1 protein_id gnl|my_center|LOCUS_01750 179924 178626 gene locus_tag LOCUS_01760 179924 178626 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224729.1 protein_id gnl|my_center|LOCUS_01760 180029 181897 gene locus_tag LOCUS_01770 180029 181897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_01770 182415 181900 gene locus_tag LOCUS_01780 182415 181900 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_01780 183353 182514 gene locus_tag LOCUS_01790 183353 182514 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_01790 184213 183350 gene locus_tag LOCUS_01800 184213 183350 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225433.1 protein_id gnl|my_center|LOCUS_01800 184460 184290 gene locus_tag LOCUS_01810 184460 184290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 184414 185112 gene locus_tag LOCUS_01820 184414 185112 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_01820 185109 185795 gene locus_tag LOCUS_01830 185109 185795 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224735.1 protein_id gnl|my_center|LOCUS_01830 185870 187078 gene locus_tag LOCUS_01840 185870 187078 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224737.1 protein_id gnl|my_center|LOCUS_01840 187538 187083 gene locus_tag LOCUS_01850 187538 187083 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 protein_id gnl|my_center|LOCUS_01850 187940 187719 gene locus_tag LOCUS_01860 187940 187719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 188660 188007 gene locus_tag LOCUS_01870 188660 188007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 189188 188799 gene locus_tag LOCUS_01880 189188 188799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 189288 192530 gene locus_tag LOCUS_01890 189288 192530 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_01890 192530 193408 gene locus_tag LOCUS_01900 192530 193408 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_01900 194993 193527 gene locus_tag LOCUS_01910 194993 193527 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_01910 196074 195103 gene locus_tag LOCUS_01920 196074 195103 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_01920 196205 197068 gene locus_tag LOCUS_01930 196205 197068 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226842.1 protein_id gnl|my_center|LOCUS_01930 197065 197670 gene locus_tag LOCUS_01940 197065 197670 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 protein_id gnl|my_center|LOCUS_01940 198302 197637 gene locus_tag LOCUS_01950 198302 197637 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125138.1 protein_id gnl|my_center|LOCUS_01950 198871 198350 gene locus_tag LOCUS_01960 198871 198350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 198897 199085 gene locus_tag LOCUS_01970 198897 199085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 199125 201713 gene locus_tag LOCUS_01980 199125 201713 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_01980 201800 202885 gene locus_tag LOCUS_01990 201800 202885 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230142.1 protein_id gnl|my_center|LOCUS_01990 202947 204200 gene locus_tag LOCUS_02000 202947 204200 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_02000 204391 205584 gene locus_tag LOCUS_02010 204391 205584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 206430 205603 gene locus_tag LOCUS_02020 206430 205603 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225774.1 protein_id gnl|my_center|LOCUS_02020 207319 206411 gene locus_tag LOCUS_02030 207319 206411 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_02030 208221 207316 gene locus_tag LOCUS_02040 208221 207316 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_02040 208253 209047 gene locus_tag LOCUS_02050 208253 209047 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_02050 209663 209052 gene locus_tag LOCUS_02060 209663 209052 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224770.1 protein_id gnl|my_center|LOCUS_02060 210757 209660 gene locus_tag LOCUS_02070 210757 209660 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_02070 211932 210754 gene locus_tag LOCUS_02080 211932 210754 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_02080 212381 211929 gene locus_tag LOCUS_02090 212381 211929 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_02090 213144 212389 gene locus_tag LOCUS_02100 gene fabG 213144 212389 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225006.1 protein_id gnl|my_center|LOCUS_02100 213727 213230 gene locus_tag LOCUS_02110 213727 213230 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227140.1 protein_id gnl|my_center|LOCUS_02110 213746 214636 gene locus_tag LOCUS_02120 gene nudC 213746 214636 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_02120 214677 215432 gene locus_tag LOCUS_02130 214677 215432 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 protein_id gnl|my_center|LOCUS_02130 215655 216302 gene locus_tag LOCUS_02140 215655 216302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 216299 217474 gene locus_tag LOCUS_02150 216299 217474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 220010 217497 gene locus_tag LOCUS_02160 220010 217497 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_02160 220810 220052 gene locus_tag LOCUS_02170 220810 220052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 222110 220812 gene locus_tag LOCUS_02180 222110 220812 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_02180 223105 222107 gene locus_tag LOCUS_02190 223105 222107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02190 225423 223102 gene locus_tag LOCUS_02200 225423 223102 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02200 226646 225420 gene locus_tag LOCUS_02210 226646 225420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_02210 227656 226643 gene locus_tag LOCUS_02220 227656 226643 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_02220 228942 227653 gene locus_tag LOCUS_02230 228942 227653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_02230 229111 229503 gene locus_tag LOCUS_02240 229111 229503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_02240 229500 230417 gene locus_tag LOCUS_02250 229500 230417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227650.1 protein_id gnl|my_center|LOCUS_02250 230439 231392 gene locus_tag LOCUS_02260 230439 231392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192779382.1 protein_id gnl|my_center|LOCUS_02260 232032 231373 gene locus_tag LOCUS_02270 232032 231373 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222860.1 protein_id gnl|my_center|LOCUS_02270 233156 232029 gene locus_tag LOCUS_02280 233156 232029 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222861.1 protein_id gnl|my_center|LOCUS_02280 233269 234006 gene locus_tag LOCUS_02290 233269 234006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_02290 234006 236408 gene locus_tag LOCUS_02300 234006 236408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_02300 236425 237633 gene locus_tag LOCUS_02310 236425 237633 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925892.1 protein_id gnl|my_center|LOCUS_02310 238464 237622 gene locus_tag LOCUS_02320 238464 237622 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_02320 238654 239637 gene locus_tag LOCUS_02330 238654 239637 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 protein_id gnl|my_center|LOCUS_02330 241436 239634 gene locus_tag LOCUS_02340 241436 239634 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972257.1 protein_id gnl|my_center|LOCUS_02340 242673 242954 gene locus_tag LOCUS_02350 242673 242954 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_02350 243685 243050 gene locus_tag LOCUS_02360 243685 243050 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_02360 244473 243694 gene locus_tag LOCUS_02370 244473 243694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 244397 245737 gene locus_tag LOCUS_02380 244397 245737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 245777 246316 gene locus_tag LOCUS_02390 245777 246316 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_02390 246796 246341 gene locus_tag LOCUS_02400 246796 246341 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229090.1 protein_id gnl|my_center|LOCUS_02400 246899 247489 gene locus_tag LOCUS_02410 246899 247489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 247529 247867 gene locus_tag LOCUS_02420 gene mmr 247529 247867 CDS product multidrug efflux SMR transporter Mmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415995.1 protein_id gnl|my_center|LOCUS_02420 247864 248424 gene locus_tag LOCUS_02430 247864 248424 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976902.1 protein_id gnl|my_center|LOCUS_02430 249936 248533 gene locus_tag LOCUS_02440 249936 248533 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_02440 250963 250040 gene locus_tag LOCUS_02450 250963 250040 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528010.1 protein_id gnl|my_center|LOCUS_02450 252313 251114 gene locus_tag LOCUS_02460 252313 251114 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893934.1 protein_id gnl|my_center|LOCUS_02460 254287 252416 gene locus_tag LOCUS_02470 gene recQ 254287 252416 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 protein_id gnl|my_center|LOCUS_02470 255412 254291 gene locus_tag LOCUS_02480 255412 254291 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030012.1 protein_id gnl|my_center|LOCUS_02480 255555 255409 gene locus_tag LOCUS_02490 255555 255409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 255577 256548 gene locus_tag LOCUS_02500 255577 256548 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227839.1 protein_id gnl|my_center|LOCUS_02500 256627 257058 gene locus_tag LOCUS_02510 256627 257058 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_02510 257064 257480 gene locus_tag LOCUS_02520 257064 257480 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_02520 257549 258829 gene locus_tag LOCUS_02530 257549 258829 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 protein_id gnl|my_center|LOCUS_02530 259683 258826 gene locus_tag LOCUS_02540 259683 258826 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_02540 260628 259747 gene locus_tag LOCUS_02550 260628 259747 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_02550 260868 261503 gene locus_tag LOCUS_02560 260868 261503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966590.1 protein_id gnl|my_center|LOCUS_02560 261819 261517 gene locus_tag LOCUS_02570 261819 261517 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030953.1 protein_id gnl|my_center|LOCUS_02570 262005 263078 gene locus_tag LOCUS_02580 262005 263078 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_02580 263292 263095 gene locus_tag LOCUS_02590 263292 263095 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222786.1 protein_id gnl|my_center|LOCUS_02590 263409 264515 gene locus_tag LOCUS_02600 263409 264515 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_02600 264577 265521 gene locus_tag LOCUS_02610 264577 265521 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027351.1 protein_id gnl|my_center|LOCUS_02610 266059 265586 gene locus_tag LOCUS_02620 266059 265586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227041.1 protein_id gnl|my_center|LOCUS_02620 266217 266669 gene locus_tag LOCUS_02630 266217 266669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 266666 266839 gene locus_tag LOCUS_02640 266666 266839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 266832 267080 gene locus_tag LOCUS_02650 266832 267080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 267108 267812 gene locus_tag LOCUS_02660 267108 267812 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222957.1 protein_id gnl|my_center|LOCUS_02660 268435 267857 gene locus_tag LOCUS_02670 268435 267857 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227094.1 protein_id gnl|my_center|LOCUS_02670 268530 270134 gene locus_tag LOCUS_02680 268530 270134 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_02680 270150 270626 gene locus_tag LOCUS_02690 270150 270626 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_02690 270673 271776 gene locus_tag LOCUS_02700 270673 271776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 272145 271852 gene locus_tag LOCUS_02710 272145 271852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 274465 272273 gene locus_tag LOCUS_02720 274465 272273 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_02720 274625 275209 gene locus_tag LOCUS_02730 274625 275209 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224134.1 protein_id gnl|my_center|LOCUS_02730 276034 275180 gene locus_tag LOCUS_02740 276034 275180 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484806.1 protein_id gnl|my_center|LOCUS_02740 276097 276915 gene locus_tag LOCUS_02750 276097 276915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027142.1 protein_id gnl|my_center|LOCUS_02750 279441 277093 gene locus_tag LOCUS_02760 279441 277093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 279567 280361 gene locus_tag LOCUS_02770 279567 280361 CDS product trans-aconitate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230076.1 protein_id gnl|my_center|LOCUS_02770 280716 280345 gene locus_tag LOCUS_02780 280716 280345 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223515.1 protein_id gnl|my_center|LOCUS_02780 280854 281750 gene locus_tag LOCUS_02790 280854 281750 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_02790 282853 281714 gene locus_tag LOCUS_02800 282853 281714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 282344 282430 gene locus_tag LOCUS_t00050 282344 282430 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 282953 283990 gene locus_tag LOCUS_02810 282953 283990 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420436.1 protein_id gnl|my_center|LOCUS_02810 284736 283987 gene locus_tag LOCUS_02820 284736 283987 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_02820 285980 284733 gene locus_tag LOCUS_02830 285980 284733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_02830 286897 285977 gene locus_tag LOCUS_02840 286897 285977 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031768.1 protein_id gnl|my_center|LOCUS_02840 287793 286894 gene locus_tag LOCUS_02850 287793 286894 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_02850 288709 287795 gene locus_tag LOCUS_02860 288709 287795 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_02860 290025 288730 gene locus_tag LOCUS_02870 290025 288730 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385218.1 protein_id gnl|my_center|LOCUS_02870 290169 290936 gene locus_tag LOCUS_02880 290169 290936 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223274.1 protein_id gnl|my_center|LOCUS_02880 291080 292135 gene locus_tag LOCUS_02890 291080 292135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 292147 293952 gene locus_tag LOCUS_02900 292147 293952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 294023 294982 gene locus_tag LOCUS_02910 294023 294982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 296052 295057 gene locus_tag LOCUS_02920 gene sbnB 296052 295057 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225889.1 protein_id gnl|my_center|LOCUS_02920 296225 296752 gene locus_tag LOCUS_02930 296225 296752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 296769 297080 gene locus_tag LOCUS_02940 296769 297080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 297634 297095 gene locus_tag LOCUS_02950 297634 297095 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_02950 297965 297642 gene locus_tag LOCUS_02960 gene mhuD 297965 297642 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_02960 298033 298566 gene locus_tag LOCUS_02970 298033 298566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 299208 298573 gene locus_tag LOCUS_02980 299208 298573 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_02980 300833 299250 gene locus_tag LOCUS_02990 300833 299250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 301354 300830 gene locus_tag LOCUS_03000 301354 300830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 302007 301486 gene locus_tag LOCUS_03010 302007 301486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 302036 302794 gene locus_tag LOCUS_03020 302036 302794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 302844 303671 gene locus_tag LOCUS_03030 302844 303671 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730813.1 protein_id gnl|my_center|LOCUS_03030 305800 303689 gene locus_tag LOCUS_03040 305800 303689 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_03040 307040 305820 gene locus_tag LOCUS_03050 307040 305820 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129610996.1 protein_id gnl|my_center|LOCUS_03050 307378 307079 gene locus_tag LOCUS_03060 307378 307079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 307424 309127 gene locus_tag LOCUS_03070 307424 309127 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385793.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03070 309117 311273 gene locus_tag LOCUS_03080 309117 311273 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_03080 311333 311578 gene locus_tag LOCUS_03090 311333 311578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 311575 313296 gene locus_tag LOCUS_03100 311575 313296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 313293 314051 gene locus_tag LOCUS_03110 313293 314051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 314157 315371 gene locus_tag LOCUS_03120 314157 315371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 315371 316228 gene locus_tag LOCUS_03130 315371 316228 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_03130 316232 318040 gene locus_tag LOCUS_03140 316232 318040 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815513.1 protein_id gnl|my_center|LOCUS_03140 318037 318768 gene locus_tag LOCUS_03150 318037 318768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525180.1 protein_id gnl|my_center|LOCUS_03150 319563 318772 gene locus_tag LOCUS_03160 319563 318772 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_03160 320693 319575 gene locus_tag LOCUS_03170 320693 319575 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_03170 321909 320719 gene locus_tag LOCUS_03180 321909 320719 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038779.1 protein_id gnl|my_center|LOCUS_03180 323187 321913 gene locus_tag LOCUS_03190 323187 321913 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_03190 323254 323940 gene locus_tag LOCUS_03200 323254 323940 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_03200 323937 325220 gene locus_tag LOCUS_03210 323937 325220 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225002.1 protein_id gnl|my_center|LOCUS_03210 325343 325221 gene locus_tag LOCUS_03220 325343 325221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 326441 325383 gene locus_tag LOCUS_03230 gene corA 326441 325383 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_03230 327648 326533 gene locus_tag LOCUS_03240 327648 326533 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730154.1 protein_id gnl|my_center|LOCUS_03240 328726 327719 gene locus_tag LOCUS_03250 328726 327719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 328797 329552 gene locus_tag LOCUS_03260 328797 329552 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_03260 331104 329590 gene locus_tag LOCUS_03270 331104 329590 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071020870.1 protein_id gnl|my_center|LOCUS_03270 331508 331101 gene locus_tag LOCUS_03280 331508 331101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 331543 332394 gene locus_tag LOCUS_03290 331543 332394 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_03290 332423 333427 gene locus_tag LOCUS_03300 332423 333427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 333434 334135 gene locus_tag LOCUS_03310 333434 334135 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098468.1 protein_id gnl|my_center|LOCUS_03310 334306 335250 gene locus_tag LOCUS_03320 334306 335250 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_03320 335311 336108 gene locus_tag LOCUS_03330 335311 336108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_03330 336105 336959 gene locus_tag LOCUS_03340 336105 336959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_03340 336980 338005 gene locus_tag LOCUS_03350 336980 338005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803989.1 protein_id gnl|my_center|LOCUS_03350 338848 338048 gene locus_tag LOCUS_03360 338848 338048 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036341485.1 protein_id gnl|my_center|LOCUS_03360 340495 338954 gene locus_tag LOCUS_03370 340495 338954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 340625 341428 gene locus_tag LOCUS_03380 340625 341428 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 protein_id gnl|my_center|LOCUS_03380 341425 342972 gene locus_tag LOCUS_03390 341425 342972 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 protein_id gnl|my_center|LOCUS_03390 344098 343280 gene locus_tag LOCUS_03400 344098 343280 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036341485.1 protein_id gnl|my_center|LOCUS_03400 344211 345155 gene locus_tag LOCUS_03410 344211 345155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054291694.1 protein_id gnl|my_center|LOCUS_03410 345152 347062 gene locus_tag LOCUS_03420 345152 347062 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385805.1 protein_id gnl|my_center|LOCUS_03420 347059 347937 gene locus_tag LOCUS_03430 347059 347937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 347949 349484 gene locus_tag LOCUS_03440 347949 349484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385803.1 protein_id gnl|my_center|LOCUS_03440 349484 351595 gene locus_tag LOCUS_03450 349484 351595 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921515.1 protein_id gnl|my_center|LOCUS_03450 351588 352316 gene locus_tag LOCUS_03460 351588 352316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 353308 352313 gene locus_tag LOCUS_03470 353308 352313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 354408 353305 gene locus_tag LOCUS_03480 354408 353305 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225002.1 protein_id gnl|my_center|LOCUS_03480 355921 354398 gene locus_tag LOCUS_03490 355921 354398 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893590.1 protein_id gnl|my_center|LOCUS_03490 356057 357202 gene locus_tag LOCUS_03500 356057 357202 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224027.1 protein_id gnl|my_center|LOCUS_03500 357199 357939 gene locus_tag LOCUS_03510 gene fabG 357199 357939 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_03510 357936 359153 gene locus_tag LOCUS_03520 357936 359153 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_03520 359150 360172 gene locus_tag LOCUS_03530 359150 360172 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_03530 360991 360182 gene locus_tag LOCUS_03540 360991 360182 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173129680.1 protein_id gnl|my_center|LOCUS_03540 361955 361032 gene locus_tag LOCUS_03550 361955 361032 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229868.1 protein_id gnl|my_center|LOCUS_03550 362075 363193 gene locus_tag LOCUS_03560 362075 363193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 363299 363613 gene locus_tag LOCUS_03570 363299 363613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 363712 364038 gene locus_tag LOCUS_03580 363712 364038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 364035 364748 gene locus_tag LOCUS_03590 364035 364748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 364759 365484 gene locus_tag LOCUS_03600 364759 365484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 365481 367367 gene locus_tag LOCUS_03610 365481 367367 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815500.1 protein_id gnl|my_center|LOCUS_03610 367357 368601 gene locus_tag LOCUS_03620 367357 368601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 368598 369107 gene locus_tag LOCUS_03630 368598 369107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 369179 370054 gene locus_tag LOCUS_03640 369179 370054 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_03640 370079 370723 gene locus_tag LOCUS_03650 370079 370723 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031706.1 protein_id gnl|my_center|LOCUS_03650 371276 370779 gene locus_tag LOCUS_03660 371276 370779 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803711.1 protein_id gnl|my_center|LOCUS_03660 371299 372489 gene locus_tag LOCUS_03670 371299 372489 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970063.1 protein_id gnl|my_center|LOCUS_03670 372706 372993 gene locus_tag LOCUS_03680 372706 372993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 374499 372976 gene locus_tag LOCUS_03690 374499 372976 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 protein_id gnl|my_center|LOCUS_03690 376340 374496 gene locus_tag LOCUS_03700 376340 374496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 379489 376337 gene locus_tag LOCUS_03710 379489 376337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 380044 379502 gene locus_tag LOCUS_03720 380044 379502 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086837759.1 protein_id gnl|my_center|LOCUS_03720 381641 380229 gene locus_tag LOCUS_03730 381641 380229 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090583.1 protein_id gnl|my_center|LOCUS_03730 383481 381658 gene locus_tag LOCUS_03740 383481 381658 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083709.1 protein_id gnl|my_center|LOCUS_03740 383784 384524 gene locus_tag LOCUS_03750 gene fabG 383784 384524 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_03750 384521 386239 gene locus_tag LOCUS_03760 384521 386239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 386236 386694 gene locus_tag LOCUS_03770 gene accB 386236 386694 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_03770 386691 388079 gene locus_tag LOCUS_03780 gene accC 386691 388079 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_03780 388076 389725 gene locus_tag LOCUS_03790 388076 389725 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110774.1 protein_id gnl|my_center|LOCUS_03790 389752 390864 gene locus_tag LOCUS_03800 389752 390864 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 protein_id gnl|my_center|LOCUS_03800 390861 392129 gene locus_tag LOCUS_03810 390861 392129 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110778.1 protein_id gnl|my_center|LOCUS_03810 392146 392634 gene locus_tag LOCUS_03820 392146 392634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 392634 392873 gene locus_tag LOCUS_03830 392634 392873 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027681.1 protein_id gnl|my_center|LOCUS_03830 392873 394090 gene locus_tag LOCUS_03840 392873 394090 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_03840 394099 394887 gene locus_tag LOCUS_03850 gene fabI 394099 394887 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_03850 394884 395363 gene locus_tag LOCUS_03860 394884 395363 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225720.1 protein_id gnl|my_center|LOCUS_03860 395439 396191 gene locus_tag LOCUS_03870 395439 396191 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086127.1 protein_id gnl|my_center|LOCUS_03870 396271 397956 gene locus_tag LOCUS_03880 396271 397956 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_03880 397980 400313 gene locus_tag LOCUS_03890 397980 400313 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_03890 400459 401994 gene locus_tag LOCUS_03900 gene phoD 400459 401994 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_03900 402057 402392 gene locus_tag LOCUS_03910 402057 402392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 402389 403426 gene locus_tag LOCUS_03920 402389 403426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 403457 403927 gene locus_tag LOCUS_03930 403457 403927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 403938 404291 gene locus_tag LOCUS_03940 403938 404291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 404636 405811 gene locus_tag LOCUS_03950 404636 405811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225785.1 protein_id gnl|my_center|LOCUS_03950 407077 405866 gene locus_tag LOCUS_03960 407077 405866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 408568 407087 gene locus_tag LOCUS_03970 408568 407087 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223428.1 protein_id gnl|my_center|LOCUS_03970 408793 409593 gene locus_tag LOCUS_03980 408793 409593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 409590 410399 gene locus_tag LOCUS_03990 409590 410399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 410396 411022 gene locus_tag LOCUS_04000 gene tmk 410396 411022 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_04000 412083 411025 gene locus_tag LOCUS_04010 412083 411025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 protein_id gnl|my_center|LOCUS_04010 413033 412080 gene locus_tag LOCUS_04020 413033 412080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 414127 413039 gene locus_tag LOCUS_04030 414127 413039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_04030 414355 415236 gene locus_tag LOCUS_04040 414355 415236 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_04040 415493 415245 gene locus_tag LOCUS_04050 415493 415245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 416728 415490 gene locus_tag LOCUS_04060 416728 415490 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225484.1 protein_id gnl|my_center|LOCUS_04060 417891 416725 gene locus_tag LOCUS_04070 417891 416725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 418708 417914 gene locus_tag LOCUS_04080 418708 417914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 419489 418719 gene locus_tag LOCUS_04090 419489 418719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 420463 419489 gene locus_tag LOCUS_04100 420463 419489 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_04100 420884 422089 gene locus_tag LOCUS_04110 420884 422089 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804661.1 protein_id gnl|my_center|LOCUS_04110 422086 422901 gene locus_tag LOCUS_04120 422086 422901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 422898 424025 gene locus_tag LOCUS_04130 422898 424025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 424127 427465 gene locus_tag LOCUS_04140 424127 427465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 427734 429560 gene locus_tag LOCUS_04150 427734 429560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 429545 432205 gene locus_tag LOCUS_04160 429545 432205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 432213 434081 gene locus_tag LOCUS_04170 432213 434081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 434078 435778 gene locus_tag LOCUS_04180 434078 435778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 435788 436576 gene locus_tag LOCUS_04190 435788 436576 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_04190 436573 436935 gene locus_tag LOCUS_04200 436573 436935 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_04200 437057 438547 gene locus_tag LOCUS_04210 437057 438547 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061275.1 protein_id gnl|my_center|LOCUS_04210 438544 439710 gene locus_tag LOCUS_04220 438544 439710 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 protein_id gnl|my_center|LOCUS_04220 439728 441539 gene locus_tag LOCUS_04230 439728 441539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_04230 441536 443320 gene locus_tag LOCUS_04240 441536 443320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_04240 443317 444564 gene locus_tag LOCUS_04250 443317 444564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 444575 448339 gene locus_tag LOCUS_04260 444575 448339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 448336 453105 gene locus_tag LOCUS_04270 448336 453105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 454613 453111 gene locus_tag LOCUS_04280 454613 453111 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172209.1 protein_id gnl|my_center|LOCUS_04280 455100 454615 gene locus_tag LOCUS_04290 455100 454615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 456100 455105 gene locus_tag LOCUS_04300 456100 455105 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 protein_id gnl|my_center|LOCUS_04300 456181 457635 gene locus_tag LOCUS_04310 gene tcuA 456181 457635 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_04310 457671 457868 gene locus_tag LOCUS_04320 457671 457868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 457976 460225 gene locus_tag LOCUS_04330 457976 460225 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_04330 460782 460234 gene locus_tag LOCUS_04340 460782 460234 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_04340 460845 462065 gene locus_tag LOCUS_04350 460845 462065 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466614.1 protein_id gnl|my_center|LOCUS_04350 462191 462520 gene locus_tag LOCUS_04360 462191 462520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 462621 463877 gene locus_tag LOCUS_04370 462621 463877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 463880 464635 gene locus_tag LOCUS_04380 463880 464635 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_04380 464632 465525 gene locus_tag LOCUS_04390 464632 465525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 465527 465850 gene locus_tag LOCUS_04400 465527 465850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 466643 465852 gene locus_tag LOCUS_04410 466643 465852 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228059.1 protein_id gnl|my_center|LOCUS_04410 467559 466630 gene locus_tag LOCUS_04420 467559 466630 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223370.1 protein_id gnl|my_center|LOCUS_04420 468790 467621 gene locus_tag LOCUS_04430 468790 467621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223893.1 protein_id gnl|my_center|LOCUS_04430 469338 468787 gene locus_tag LOCUS_04440 469338 468787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228866.1 protein_id gnl|my_center|LOCUS_04440 469862 469446 gene locus_tag LOCUS_04450 469862 469446 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228867.1 protein_id gnl|my_center|LOCUS_04450 470029 471045 gene locus_tag LOCUS_04460 470029 471045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 471872 471051 gene locus_tag LOCUS_04470 471872 471051 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804229.1 protein_id gnl|my_center|LOCUS_04470 473640 471874 gene locus_tag LOCUS_04480 473640 471874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223891.1 protein_id gnl|my_center|LOCUS_04480 473792 474820 gene locus_tag LOCUS_04490 473792 474820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 474882 475364 gene locus_tag LOCUS_04500 474882 475364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 475357 475665 gene locus_tag LOCUS_04510 475357 475665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 475668 476723 gene locus_tag LOCUS_04520 475668 476723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 476783 477244 gene locus_tag LOCUS_04530 476783 477244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 477305 477562 gene locus_tag LOCUS_04540 477305 477562 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_04540 477643 479298 gene locus_tag LOCUS_04550 477643 479298 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223371.1 protein_id gnl|my_center|LOCUS_04550 479295 480716 gene locus_tag LOCUS_04560 479295 480716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_04560 480753 483125 gene locus_tag LOCUS_04570 480753 483125 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_04570 483136 484278 gene locus_tag LOCUS_04580 483136 484278 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_04580 484283 485185 gene locus_tag LOCUS_04590 484283 485185 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_04590 485414 485905 gene locus_tag LOCUS_04600 485414 485905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 486091 485930 gene locus_tag LOCUS_04610 486091 485930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 486289 487014 gene locus_tag LOCUS_04620 486289 487014 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_04620 487324 488589 gene locus_tag LOCUS_04630 487324 488589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 488596 489471 gene locus_tag LOCUS_04640 488596 489471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 490911 489475 gene locus_tag LOCUS_04650 490911 489475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 492370 490955 gene locus_tag LOCUS_04660 492370 490955 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860163.1 protein_id gnl|my_center|LOCUS_04660 495118 492419 gene locus_tag LOCUS_04670 495118 492419 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222319.1 protein_id gnl|my_center|LOCUS_04670 495310 496464 gene locus_tag LOCUS_04680 495310 496464 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_04680 497724 496501 gene locus_tag LOCUS_04690 497724 496501 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_04690 499936 497726 gene locus_tag LOCUS_04700 499936 497726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 500866 499946 gene locus_tag LOCUS_04710 500866 499946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041127763.1 protein_id gnl|my_center|LOCUS_04710 501630 500866 gene locus_tag LOCUS_04720 501630 500866 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972638.1 protein_id gnl|my_center|LOCUS_04720 502541 501627 gene locus_tag LOCUS_04730 502541 501627 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_04730 502705 502959 gene locus_tag LOCUS_04740 502705 502959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 502956 504179 gene locus_tag LOCUS_04750 502956 504179 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_04750 504176 505159 gene locus_tag LOCUS_04760 504176 505159 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225892.1 protein_id gnl|my_center|LOCUS_04760 505156 505989 gene locus_tag LOCUS_04770 505156 505989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 505982 506719 gene locus_tag LOCUS_04780 gene fabG 505982 506719 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_04780 507453 506674 gene locus_tag LOCUS_04790 507453 506674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 508499 507459 gene locus_tag LOCUS_04800 508499 507459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 509101 508496 gene locus_tag LOCUS_04810 509101 508496 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_04810 509385 509098 gene locus_tag LOCUS_04820 509385 509098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 510874 509375 gene locus_tag LOCUS_04830 510874 509375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 514134 510871 gene locus_tag LOCUS_04840 514134 510871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 516014 514128 gene locus_tag LOCUS_04850 516014 514128 CDS product class I tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030917.1 protein_id gnl|my_center|LOCUS_04850 517069 516035 gene locus_tag LOCUS_04860 517069 516035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 517398 517066 gene locus_tag LOCUS_04870 517398 517066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 518774 517395 gene locus_tag LOCUS_04880 518774 517395 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103033.1 protein_id gnl|my_center|LOCUS_04880 520394 519024 gene locus_tag LOCUS_04890 520394 519024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 521224 520409 gene locus_tag LOCUS_04900 521224 520409 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_04900 522117 521224 gene locus_tag LOCUS_04910 522117 521224 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_04910 523404 522121 gene locus_tag LOCUS_04920 523404 522121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727005.1 protein_id gnl|my_center|LOCUS_04920 524453 523437 gene locus_tag LOCUS_04930 524453 523437 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_04930 528131 524499 gene locus_tag LOCUS_04940 528131 524499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 528541 528134 gene locus_tag LOCUS_04950 528541 528134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976032.1 protein_id gnl|my_center|LOCUS_04950 528682 529836 gene locus_tag LOCUS_04960 528682 529836 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_04960 530033 530320 gene locus_tag LOCUS_04970 530033 530320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 531180 530317 gene locus_tag LOCUS_04980 531180 530317 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_04980 532779 531298 gene locus_tag LOCUS_04990 532779 531298 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456653.1 protein_id gnl|my_center|LOCUS_04990 533901 532783 gene locus_tag LOCUS_05000 533901 532783 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456654.1 protein_id gnl|my_center|LOCUS_05000 534956 533901 gene locus_tag LOCUS_05010 534956 533901 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859004.1 protein_id gnl|my_center|LOCUS_05010 535705 534995 gene locus_tag LOCUS_05020 535705 534995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_05020 536466 535702 gene locus_tag LOCUS_05030 536466 535702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090547.1 protein_id gnl|my_center|LOCUS_05030 537650 536463 gene locus_tag LOCUS_05040 537650 536463 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_05040 537863 538576 gene locus_tag LOCUS_05050 537863 538576 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258130.1 protein_id gnl|my_center|LOCUS_05050 538587 539372 gene locus_tag LOCUS_05060 538587 539372 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225682.1 protein_id gnl|my_center|LOCUS_05060 539348 540268 gene locus_tag LOCUS_05070 539348 540268 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_05070 540571 540335 gene locus_tag LOCUS_05080 540571 540335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 541594 540593 gene locus_tag LOCUS_05090 541594 540593 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_05090 542625 541591 gene locus_tag LOCUS_05100 542625 541591 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_05100 542774 544009 gene locus_tag LOCUS_05110 gene ribB 542774 544009 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803671.1 protein_id gnl|my_center|LOCUS_05110 544003 544530 gene locus_tag LOCUS_05120 544003 544530 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_05120 544537 545643 gene locus_tag LOCUS_05130 544537 545643 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_05130 545640 546521 gene locus_tag LOCUS_05140 545640 546521 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089437.1 protein_id gnl|my_center|LOCUS_05140 546518 547603 gene locus_tag LOCUS_05150 546518 547603 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_05150 547626 549170 gene locus_tag LOCUS_05160 547626 549170 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_05160 549236 549928 gene locus_tag LOCUS_05170 549236 549928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103336743.1 protein_id gnl|my_center|LOCUS_05170 549945 550679 gene locus_tag LOCUS_05180 549945 550679 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_05180 550676 551479 gene locus_tag LOCUS_05190 550676 551479 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808186.1 protein_id gnl|my_center|LOCUS_05190 551479 552363 gene locus_tag LOCUS_05200 551479 552363 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_05200 552360 553172 gene locus_tag LOCUS_05210 552360 553172 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257279.1 protein_id gnl|my_center|LOCUS_05210 554059 553157 gene locus_tag LOCUS_05220 554059 553157 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803726.1 protein_id gnl|my_center|LOCUS_05220 554577 554056 gene locus_tag LOCUS_05230 554577 554056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 555358 554591 gene locus_tag LOCUS_05240 555358 554591 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_05240 555454 556614 gene locus_tag LOCUS_05250 555454 556614 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064534.1 protein_id gnl|my_center|LOCUS_05250 556611 556952 gene locus_tag LOCUS_05260 556611 556952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 556954 558279 gene locus_tag LOCUS_05270 556954 558279 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064536.1 protein_id gnl|my_center|LOCUS_05270 558269 559447 gene locus_tag LOCUS_05280 558269 559447 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459846.1 protein_id gnl|my_center|LOCUS_05280 559447 560853 gene locus_tag LOCUS_05290 559447 560853 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230649.1 protein_id gnl|my_center|LOCUS_05290 560846 561595 gene locus_tag LOCUS_05300 560846 561595 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084111.1 protein_id gnl|my_center|LOCUS_05300 561592 562332 gene locus_tag LOCUS_05310 561592 562332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 562325 564352 gene locus_tag LOCUS_05320 562325 564352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 564358 565113 gene locus_tag LOCUS_05330 564358 565113 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412728.1 protein_id gnl|my_center|LOCUS_05330 565110 566006 gene locus_tag LOCUS_05340 565110 566006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229432.1 protein_id gnl|my_center|LOCUS_05340 566087 566266 gene locus_tag LOCUS_05350 566087 566266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 567330 566275 gene locus_tag LOCUS_05360 567330 566275 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 protein_id gnl|my_center|LOCUS_05360 567963 567391 gene locus_tag LOCUS_05370 567963 567391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 568151 569485 gene locus_tag LOCUS_05380 568151 569485 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_05380 570144 569482 gene locus_tag LOCUS_05390 570144 569482 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086436.1 protein_id gnl|my_center|LOCUS_05390 570209 570991 gene locus_tag LOCUS_05400 570209 570991 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_05400 571256 572104 gene locus_tag LOCUS_05410 571256 572104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_05410 572167 573183 gene locus_tag LOCUS_05420 572167 573183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 573185 574624 gene locus_tag LOCUS_05430 573185 574624 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040015.1 protein_id gnl|my_center|LOCUS_05430 574624 575391 gene locus_tag LOCUS_05440 574624 575391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 575414 576241 gene locus_tag LOCUS_05450 575414 576241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_05450 576238 577605 gene locus_tag LOCUS_05460 576238 577605 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_05460 577619 578194 gene locus_tag LOCUS_05470 577619 578194 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765323.1 protein_id gnl|my_center|LOCUS_05470 578194 580545 gene locus_tag LOCUS_05480 578194 580545 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728713.1 protein_id gnl|my_center|LOCUS_05480 580542 581354 gene locus_tag LOCUS_05490 580542 581354 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728714.1 protein_id gnl|my_center|LOCUS_05490 581351 581815 gene locus_tag LOCUS_05500 581351 581815 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_05500 581854 582255 gene locus_tag LOCUS_05510 581854 582255 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170906.1 protein_id gnl|my_center|LOCUS_05510 582252 584192 gene locus_tag LOCUS_05520 582252 584192 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_05520 584212 584565 gene locus_tag LOCUS_05530 584212 584565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 584562 586997 gene locus_tag LOCUS_05540 584562 586997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 586997 587830 gene locus_tag LOCUS_05550 586997 587830 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_05550 587827 589275 gene locus_tag LOCUS_05560 587827 589275 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_05560 589268 590737 gene locus_tag LOCUS_05570 589268 590737 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040326.1 protein_id gnl|my_center|LOCUS_05570 590734 591534 gene locus_tag LOCUS_05580 590734 591534 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_05580 592269 591517 gene locus_tag LOCUS_05590 592269 591517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 592884 594104 gene locus_tag LOCUS_05600 592884 594104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 594195 595454 gene locus_tag LOCUS_05610 594195 595454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 595451 596167 gene locus_tag LOCUS_05620 595451 596167 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_05620 596164 597312 gene locus_tag LOCUS_05630 596164 597312 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246392.1 protein_id gnl|my_center|LOCUS_05630 597294 598535 gene locus_tag LOCUS_05640 597294 598535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 598532 600148 gene locus_tag LOCUS_05650 598532 600148 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205212.1 protein_id gnl|my_center|LOCUS_05650 600145 601092 gene locus_tag LOCUS_05660 600145 601092 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_05660 601089 601865 gene locus_tag LOCUS_05670 601089 601865 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_05670 601981 602553 gene locus_tag LOCUS_05680 601981 602553 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_05680 602581 603798 gene locus_tag LOCUS_05690 602581 603798 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127180013.1 protein_id gnl|my_center|LOCUS_05690 603860 605017 gene locus_tag LOCUS_05700 603860 605017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 609495 605023 gene locus_tag LOCUS_05710 609495 605023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 610459 609710 gene locus_tag LOCUS_05720 610459 609710 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_05720 610643 611704 gene locus_tag LOCUS_05730 610643 611704 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533016.1 protein_id gnl|my_center|LOCUS_05730 611701 613449 gene locus_tag LOCUS_05740 611701 613449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 613446 614591 gene locus_tag LOCUS_05750 613446 614591 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027053.1 protein_id gnl|my_center|LOCUS_05750 614584 615630 gene locus_tag LOCUS_05760 614584 615630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 615627 616400 gene locus_tag LOCUS_05770 615627 616400 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_05770 616447 619197 gene locus_tag LOCUS_05780 616447 619197 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227072.1 protein_id gnl|my_center|LOCUS_05780 619246 620031 gene locus_tag LOCUS_05790 619246 620031 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_05790 620045 621304 gene locus_tag LOCUS_05800 620045 621304 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445390.1 protein_id gnl|my_center|LOCUS_05800 621378 622382 gene locus_tag LOCUS_05810 621378 622382 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266622.1 protein_id gnl|my_center|LOCUS_05810 622379 623893 gene locus_tag LOCUS_05820 622379 623893 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_05820 623890 624939 gene locus_tag LOCUS_05830 gene rbsC 623890 624939 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_05830 624903 625727 gene locus_tag LOCUS_05840 624903 625727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 625753 626763 gene locus_tag LOCUS_05850 625753 626763 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726990.1 protein_id gnl|my_center|LOCUS_05850 626760 627788 gene locus_tag LOCUS_05860 626760 627788 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338705.1 protein_id gnl|my_center|LOCUS_05860 627781 628944 gene locus_tag LOCUS_05870 627781 628944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 628937 629314 gene locus_tag LOCUS_05880 628937 629314 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878426.1 protein_id gnl|my_center|LOCUS_05880 629551 629859 gene locus_tag LOCUS_05890 629551 629859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 630101 631432 gene locus_tag LOCUS_05900 630101 631432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 631555 631944 gene locus_tag LOCUS_05910 631555 631944 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_05910 633959 631941 gene locus_tag LOCUS_05920 633959 631941 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060585.1 protein_id gnl|my_center|LOCUS_05920 634946 634242 gene locus_tag LOCUS_05930 634946 634242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 635645 635055 gene locus_tag LOCUS_05940 635645 635055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 636749 635727 gene locus_tag LOCUS_05950 636749 635727 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_05950 637707 636727 gene locus_tag LOCUS_05960 637707 636727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_05960 638564 637704 gene locus_tag LOCUS_05970 638564 637704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538206.1 protein_id gnl|my_center|LOCUS_05970 639487 638561 gene locus_tag LOCUS_05980 639487 638561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743977.1 protein_id gnl|my_center|LOCUS_05980 640554 639484 gene locus_tag LOCUS_05990 640554 639484 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_05990 642104 640578 gene locus_tag LOCUS_06000 642104 640578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_06000 642443 642108 gene locus_tag LOCUS_06010 642443 642108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 643430 642450 gene locus_tag LOCUS_06020 643430 642450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 643720 644889 gene locus_tag LOCUS_06030 643720 644889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 645927 644923 gene locus_tag LOCUS_06040 645927 644923 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393144.1 protein_id gnl|my_center|LOCUS_06040 646544 645924 gene locus_tag LOCUS_06050 646544 645924 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259011.1 protein_id gnl|my_center|LOCUS_06050 648010 646541 gene locus_tag LOCUS_06060 648010 646541 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 protein_id gnl|my_center|LOCUS_06060 649491 648007 gene locus_tag LOCUS_06070 649491 648007 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168723.1 protein_id gnl|my_center|LOCUS_06070 649673 650464 gene locus_tag LOCUS_06080 649673 650464 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969785.1 protein_id gnl|my_center|LOCUS_06080 650501 651868 gene locus_tag LOCUS_06090 650501 651868 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225213.1 protein_id gnl|my_center|LOCUS_06090 655196 651879 gene locus_tag LOCUS_06100 655196 651879 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_06100 655309 656853 gene locus_tag LOCUS_06110 655309 656853 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_06110 657670 656906 gene locus_tag LOCUS_06120 657670 656906 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222527.1 protein_id gnl|my_center|LOCUS_06120 657802 658992 gene locus_tag LOCUS_06130 657802 658992 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_06130 658989 662660 gene locus_tag LOCUS_06140 658989 662660 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_06140 662660 664276 gene locus_tag LOCUS_06150 gene narH 662660 664276 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_06150 664273 664902 gene locus_tag LOCUS_06160 664273 664902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 664899 665630 gene locus_tag LOCUS_06170 gene narI 664899 665630 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_06170 665761 666081 gene locus_tag LOCUS_06180 665761 666081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 666202 666372 gene locus_tag LOCUS_06190 666202 666372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 666574 669378 gene locus_tag LOCUS_06200 666574 669378 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_06200 669390 670553 gene locus_tag LOCUS_06210 669390 670553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 669727 669632 gene locus_tag LOCUS_t00060 669727 669632 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 671083 670595 gene locus_tag LOCUS_06220 671083 670595 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971313.1 protein_id gnl|my_center|LOCUS_06220 671514 671080 gene locus_tag LOCUS_06230 671514 671080 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_06230 672487 671591 gene locus_tag LOCUS_06240 672487 671591 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_06240 672605 673312 gene locus_tag LOCUS_06250 672605 673312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 673773 673327 gene locus_tag LOCUS_06260 673773 673327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 673863 674297 gene locus_tag LOCUS_06270 673863 674297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 674904 674281 gene locus_tag LOCUS_06280 674904 674281 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 protein_id gnl|my_center|LOCUS_06280 674986 676320 gene locus_tag LOCUS_06290 674986 676320 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551357.1 protein_id gnl|my_center|LOCUS_06290 676903 676250 gene locus_tag LOCUS_06300 676903 676250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 677236 678429 gene locus_tag LOCUS_06310 677236 678429 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_06310 679979 678630 gene locus_tag LOCUS_06320 679979 678630 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_06320 680057 680845 gene locus_tag LOCUS_06330 680057 680845 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 protein_id gnl|my_center|LOCUS_06330 680862 681653 gene locus_tag LOCUS_06340 680862 681653 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_06340 682242 681667 gene locus_tag LOCUS_06350 682242 681667 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_06350 683480 682266 gene locus_tag LOCUS_06360 683480 682266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 684526 683483 gene locus_tag LOCUS_06370 684526 683483 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037683496.1 protein_id gnl|my_center|LOCUS_06370 684664 688338 gene locus_tag LOCUS_06380 684664 688338 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_06380 688472 689602 gene locus_tag LOCUS_06390 688472 689602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 689599 689979 gene locus_tag LOCUS_06400 689599 689979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 691390 689981 gene locus_tag LOCUS_06410 691390 689981 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_06410 691580 691395 gene locus_tag LOCUS_06420 691580 691395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 692276 691590 gene locus_tag LOCUS_06430 692276 691590 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229068.1 protein_id gnl|my_center|LOCUS_06430 693250 692282 gene locus_tag LOCUS_06440 693250 692282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 693462 693776 gene locus_tag LOCUS_06450 693462 693776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 693773 694867 gene locus_tag LOCUS_06460 693773 694867 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225912.1 protein_id gnl|my_center|LOCUS_06460 694867 695859 gene locus_tag LOCUS_06470 694867 695859 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225916.1 protein_id gnl|my_center|LOCUS_06470 695856 696899 gene locus_tag LOCUS_06480 695856 696899 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313601.1 protein_id gnl|my_center|LOCUS_06480 696896 700288 gene locus_tag LOCUS_06490 696896 700288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06490 700275 703352 gene locus_tag LOCUS_06500 700275 703352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06500 703345 709449 gene locus_tag LOCUS_06510 703345 709449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 709440 710312 gene locus_tag LOCUS_06520 709440 710312 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225910.1 protein_id gnl|my_center|LOCUS_06520 710309 710479 gene locus_tag LOCUS_06530 710309 710479 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_06530 710484 711560 gene locus_tag LOCUS_06540 710484 711560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 711557 712501 gene locus_tag LOCUS_06550 711557 712501 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_06550 713977 712532 gene locus_tag LOCUS_06560 713977 712532 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167861.1 protein_id gnl|my_center|LOCUS_06560 714476 713961 gene locus_tag LOCUS_06570 714476 713961 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719756.1 protein_id gnl|my_center|LOCUS_06570 715221 714463 gene locus_tag LOCUS_06580 gene catA 715221 714463 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 protein_id gnl|my_center|LOCUS_06580 716747 715218 gene locus_tag LOCUS_06590 716747 715218 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_06590 718369 716741 gene locus_tag LOCUS_06600 718369 716741 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707155.1 protein_id gnl|my_center|LOCUS_06600 718556 719176 gene locus_tag LOCUS_06610 718556 719176 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_06610 719173 719784 gene locus_tag LOCUS_06620 719173 719784 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521981.1 protein_id gnl|my_center|LOCUS_06620 719899 721152 gene locus_tag LOCUS_06630 719899 721152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838062.1 protein_id gnl|my_center|LOCUS_06630 721156 722193 gene locus_tag LOCUS_06640 gene hisC 721156 722193 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 protein_id gnl|my_center|LOCUS_06640 724978 722198 gene locus_tag LOCUS_06650 724978 722198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 725868 725059 gene locus_tag LOCUS_06660 725868 725059 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 protein_id gnl|my_center|LOCUS_06660 726707 725865 gene locus_tag LOCUS_06670 726707 725865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 727891 726704 gene locus_tag LOCUS_06680 727891 726704 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_06680 729315 727885 gene locus_tag LOCUS_06690 gene hemL 729315 727885 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929733.1 protein_id gnl|my_center|LOCUS_06690 729500 730228 gene locus_tag LOCUS_06700 729500 730228 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_06700 730487 732475 gene locus_tag LOCUS_06710 730487 732475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 732488 734596 gene locus_tag LOCUS_06720 732488 734596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 734589 735848 gene locus_tag LOCUS_06730 734589 735848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_06730 735878 737101 gene locus_tag LOCUS_06740 735878 737101 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454961.1 protein_id gnl|my_center|LOCUS_06740 737164 738069 gene locus_tag LOCUS_06750 737164 738069 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_06750 738066 738896 gene locus_tag LOCUS_06760 738066 738896 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258534.1 protein_id gnl|my_center|LOCUS_06760 738899 739921 gene locus_tag LOCUS_06770 738899 739921 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_06770 739923 740915 gene locus_tag LOCUS_06780 739923 740915 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086978.1 protein_id gnl|my_center|LOCUS_06780 740899 741852 gene locus_tag LOCUS_06790 740899 741852 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_06790 741849 742745 gene locus_tag LOCUS_06800 741849 742745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 742832 743590 gene locus_tag LOCUS_06810 742832 743590 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224031.1 protein_id gnl|my_center|LOCUS_06810 743820 744797 gene locus_tag LOCUS_06820 743820 744797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 745666 744794 gene locus_tag LOCUS_06830 745666 744794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 746949 745666 gene locus_tag LOCUS_06840 746949 745666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 747251 746952 gene locus_tag LOCUS_06850 747251 746952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 747368 747754 gene locus_tag LOCUS_06860 747368 747754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 747875 748186 gene locus_tag LOCUS_06870 747875 748186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 749076 748195 gene locus_tag LOCUS_06880 749076 748195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 749601 749131 gene locus_tag LOCUS_06890 749601 749131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 752254 749606 gene locus_tag LOCUS_06900 752254 749606 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_06900 752201 752425 gene locus_tag LOCUS_06910 752201 752425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 752550 752717 gene locus_tag LOCUS_06920 752550 752717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 752895 753431 gene locus_tag LOCUS_06930 752895 753431 CDS product methylamine utilization protein MauE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229879.1 protein_id gnl|my_center|LOCUS_06930 753451 753993 gene locus_tag LOCUS_06940 753451 753993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 754026 755963 gene locus_tag LOCUS_06950 754026 755963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851158.1 protein_id gnl|my_center|LOCUS_06950 755917 756312 gene locus_tag LOCUS_06960 755917 756312 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229876.1 protein_id gnl|my_center|LOCUS_06960 757210 756320 gene locus_tag LOCUS_06970 757210 756320 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229112.1 protein_id gnl|my_center|LOCUS_06970 757308 758318 gene locus_tag LOCUS_06980 757308 758318 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_06980 758873 758325 gene locus_tag LOCUS_06990 758873 758325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 759556 758870 gene locus_tag LOCUS_07000 759556 758870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230582.1 protein_id gnl|my_center|LOCUS_07000 761361 759553 gene locus_tag LOCUS_07010 761361 759553 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230581.1 protein_id gnl|my_center|LOCUS_07010 762665 761376 gene locus_tag LOCUS_07020 762665 761376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230580.1 protein_id gnl|my_center|LOCUS_07020 763858 762662 gene locus_tag LOCUS_07030 763858 762662 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230579.1 protein_id gnl|my_center|LOCUS_07030 764850 763855 gene locus_tag LOCUS_07040 764850 763855 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285517.1 protein_id gnl|my_center|LOCUS_07040 765818 764859 gene locus_tag LOCUS_07050 765818 764859 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228049.1 protein_id gnl|my_center|LOCUS_07050 766043 766594 gene locus_tag LOCUS_07060 766043 766594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230577.1 protein_id gnl|my_center|LOCUS_07060 766591 767631 gene locus_tag LOCUS_07070 766591 767631 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230576.1 protein_id gnl|my_center|LOCUS_07070 767635 768642 gene locus_tag LOCUS_07080 767635 768642 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230574.1 protein_id gnl|my_center|LOCUS_07080 768834 769331 gene locus_tag LOCUS_07090 768834 769331 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226860.1 protein_id gnl|my_center|LOCUS_07090 769347 769559 gene locus_tag LOCUS_07100 gene mbtH 769347 769559 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_07100 769595 779656 gene locus_tag LOCUS_07110 769595 779656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 779653 793047 gene locus_tag LOCUS_07120 779653 793047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 793044 799169 gene locus_tag LOCUS_07130 793044 799169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07130 799166 801157 gene locus_tag LOCUS_07140 799166 801157 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228163.1 protein_id gnl|my_center|LOCUS_07140 801993 801247 gene locus_tag LOCUS_07150 801993 801247 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223219.1 protein_id gnl|my_center|LOCUS_07150 802135 803181 gene locus_tag LOCUS_07160 802135 803181 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_07160 803178 804236 gene locus_tag LOCUS_07170 803178 804236 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_07170 804233 805108 gene locus_tag LOCUS_07180 804233 805108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_07180 805105 806061 gene locus_tag LOCUS_07190 805105 806061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 806255 807031 gene locus_tag LOCUS_07200 806255 807031 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_07200 807064 808182 gene locus_tag LOCUS_07210 gene dhbC 807064 808182 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_07210 808182 809777 gene locus_tag LOCUS_07220 808182 809777 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_07220 809774 810430 gene locus_tag LOCUS_07230 809774 810430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 810427 810645 gene locus_tag LOCUS_07240 810427 810645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 812486 810657 gene locus_tag LOCUS_07250 812486 810657 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_07250 812729 813964 gene locus_tag LOCUS_07260 812729 813964 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_07260 814083 814520 gene locus_tag LOCUS_07270 814083 814520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 815519 814533 gene locus_tag LOCUS_07280 815519 814533 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_07280 815667 819455 gene locus_tag LOCUS_07290 815667 819455 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_07290 820043 819489 gene locus_tag LOCUS_07300 820043 819489 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_07300 820110 820580 gene locus_tag LOCUS_07310 820110 820580 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_07310 821598 820756 gene locus_tag LOCUS_07320 821598 820756 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_07320 821662 822264 gene locus_tag LOCUS_07330 821662 822264 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978436.1 protein_id gnl|my_center|LOCUS_07330 822349 822918 gene locus_tag LOCUS_07340 822349 822918 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227926.1 protein_id gnl|my_center|LOCUS_07340 823442 824047 gene locus_tag LOCUS_07350 823442 824047 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095452.1 protein_id gnl|my_center|LOCUS_07350 826016 824076 gene locus_tag LOCUS_07360 826016 824076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 827620 826085 gene locus_tag LOCUS_07370 827620 826085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 828600 827635 gene locus_tag LOCUS_07380 828600 827635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 829831 828590 gene locus_tag LOCUS_07390 829831 828590 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_07390 830883 829828 gene locus_tag LOCUS_07400 830883 829828 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222163.1 protein_id gnl|my_center|LOCUS_07400 832276 830873 gene locus_tag LOCUS_07410 832276 830873 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222162.1 protein_id gnl|my_center|LOCUS_07410 832515 832273 gene locus_tag LOCUS_07420 832515 832273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 833381 832542 gene locus_tag LOCUS_07430 833381 832542 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 protein_id gnl|my_center|LOCUS_07430 833518 835008 gene locus_tag LOCUS_07440 gene argH 833518 835008 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227830.1 protein_id gnl|my_center|LOCUS_07440 835016 835894 gene locus_tag LOCUS_07450 835016 835894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 835896 836282 gene locus_tag LOCUS_07460 835896 836282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 836279 837583 gene locus_tag LOCUS_07470 836279 837583 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521514.1 protein_id gnl|my_center|LOCUS_07470 837625 838836 gene locus_tag LOCUS_07480 837625 838836 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880715.1 protein_id gnl|my_center|LOCUS_07480 838842 839789 gene locus_tag LOCUS_07490 838842 839789 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_07490 839895 841076 gene locus_tag LOCUS_07500 839895 841076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 841109 842089 gene locus_tag LOCUS_07510 841109 842089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 842151 843326 gene locus_tag LOCUS_07520 842151 843326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 843316 844098 gene locus_tag LOCUS_07530 843316 844098 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113539.1 protein_id gnl|my_center|LOCUS_07530 844708 844100 gene locus_tag LOCUS_07540 844708 844100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 845256 844780 gene locus_tag LOCUS_07550 845256 844780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 846294 845266 gene locus_tag LOCUS_07560 846294 845266 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 protein_id gnl|my_center|LOCUS_07560 847484 846291 gene locus_tag LOCUS_07570 847484 846291 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_07570 847604 848983 gene locus_tag LOCUS_07580 847604 848983 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047122783.1 protein_id gnl|my_center|LOCUS_07580 848983 850170 gene locus_tag LOCUS_07590 848983 850170 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_07590 850313 850855 gene locus_tag LOCUS_07600 gene kstR2 850313 850855 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_07600 850971 852038 gene locus_tag LOCUS_07610 850971 852038 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_07610 852035 852952 gene locus_tag LOCUS_07620 852035 852952 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_07620 852963 853826 gene locus_tag LOCUS_07630 gene htdY 852963 853826 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_07630 853971 855149 gene locus_tag LOCUS_07640 853971 855149 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415515.1 protein_id gnl|my_center|LOCUS_07640 855178 855978 gene locus_tag LOCUS_07650 855178 855978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 856049 856885 gene locus_tag LOCUS_07660 856049 856885 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_07660 856882 858087 gene locus_tag LOCUS_07670 856882 858087 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419340.1 protein_id gnl|my_center|LOCUS_07670 858084 859106 gene locus_tag LOCUS_07680 858084 859106 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_07680 859103 860638 gene locus_tag LOCUS_07690 gene fadD4 859103 860638 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_07690 860635 861030 gene locus_tag LOCUS_07700 860635 861030 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929743.1 protein_id gnl|my_center|LOCUS_07700 861027 862181 gene locus_tag LOCUS_07710 861027 862181 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_07710 862670 862185 gene locus_tag LOCUS_07720 862670 862185 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036448818.1 protein_id gnl|my_center|LOCUS_07720 863938 862667 gene locus_tag LOCUS_07730 863938 862667 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_07730 864120 865007 gene locus_tag LOCUS_07740 864120 865007 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_07740 865042 865938 gene locus_tag LOCUS_07750 865042 865938 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888751.1 protein_id gnl|my_center|LOCUS_07750 865935 866756 gene locus_tag LOCUS_07760 865935 866756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_07760 866686 867405 gene locus_tag LOCUS_07770 866686 867405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970053.1 protein_id gnl|my_center|LOCUS_07770 867429 868352 gene locus_tag LOCUS_07780 867429 868352 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_07780 868345 869514 gene locus_tag LOCUS_07790 868345 869514 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_07790 869514 870314 gene locus_tag LOCUS_07800 869514 870314 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_07800 870328 871497 gene locus_tag LOCUS_07810 870328 871497 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061151682.1 protein_id gnl|my_center|LOCUS_07810 871500 872468 gene locus_tag LOCUS_07820 871500 872468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 872465 874024 gene locus_tag LOCUS_07830 872465 874024 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_07830 874021 874905 gene locus_tag LOCUS_07840 874021 874905 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_07840 875662 874922 gene locus_tag LOCUS_07850 875662 874922 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085532.1 protein_id gnl|my_center|LOCUS_07850 875790 877499 gene locus_tag LOCUS_07860 875790 877499 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153412267.1 protein_id gnl|my_center|LOCUS_07860 877539 880460 gene locus_tag LOCUS_07870 877539 880460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 880551 881411 gene locus_tag LOCUS_07880 880551 881411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 881423 881752 gene locus_tag LOCUS_07890 881423 881752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 881749 882249 gene locus_tag LOCUS_07900 881749 882249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 882449 882931 gene locus_tag LOCUS_07910 882449 882931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 882953 883234 gene locus_tag LOCUS_07920 882953 883234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 883558 883247 gene locus_tag LOCUS_07930 gene sugE 883558 883247 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228124.1 protein_id gnl|my_center|LOCUS_07930 884298 883558 gene locus_tag LOCUS_07940 884298 883558 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975316.1 protein_id gnl|my_center|LOCUS_07940 884383 884928 gene locus_tag LOCUS_07950 884383 884928 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226699.1 protein_id gnl|my_center|LOCUS_07950 885335 885087 gene locus_tag LOCUS_07960 885335 885087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 885232 885639 gene locus_tag LOCUS_07970 885232 885639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 885627 886196 gene locus_tag LOCUS_07980 885627 886196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 886341 886925 gene locus_tag LOCUS_07990 886341 886925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 886922 888985 gene locus_tag LOCUS_08000 886922 888985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 888985 890079 gene locus_tag LOCUS_08010 888985 890079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 891550 890093 gene locus_tag LOCUS_08020 891550 890093 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 protein_id gnl|my_center|LOCUS_08020 891651 892238 gene locus_tag LOCUS_08030 891651 892238 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 protein_id gnl|my_center|LOCUS_08030 892964 892245 gene locus_tag LOCUS_08040 892964 892245 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_08040 893143 893577 gene locus_tag LOCUS_08050 893143 893577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 895783 893651 gene locus_tag LOCUS_08060 895783 893651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 896598 895867 gene locus_tag LOCUS_08070 896598 895867 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 protein_id gnl|my_center|LOCUS_08070 896736 898850 gene locus_tag LOCUS_08080 896736 898850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_08080 898915 899781 gene locus_tag LOCUS_08090 898915 899781 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723841.1 protein_id gnl|my_center|LOCUS_08090 899782 900729 gene locus_tag LOCUS_08100 899782 900729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_08100 900761 902308 gene locus_tag LOCUS_08110 900761 902308 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064865.1 protein_id gnl|my_center|LOCUS_08110 902370 903302 gene locus_tag LOCUS_08120 902370 903302 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_08120 903302 904759 gene locus_tag LOCUS_08130 903302 904759 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_08130 904799 906778 gene locus_tag LOCUS_08140 904799 906778 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031005.1 protein_id gnl|my_center|LOCUS_08140 906793 910506 gene locus_tag LOCUS_08150 906793 910506 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027062.1 protein_id gnl|my_center|LOCUS_08150 910608 912629 gene locus_tag LOCUS_08160 910608 912629 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_08160 913355 912711 gene locus_tag LOCUS_08170 913355 912711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 913534 914538 gene locus_tag LOCUS_08180 913534 914538 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026991.1 protein_id gnl|my_center|LOCUS_08180 914684 916510 gene locus_tag LOCUS_08190 914684 916510 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_08190 916604 917794 gene locus_tag LOCUS_08200 916604 917794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139542.1 protein_id gnl|my_center|LOCUS_08200 918441 917866 gene locus_tag LOCUS_08210 918441 917866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 918695 920743 gene locus_tag LOCUS_08220 918695 920743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 922677 921529 gene locus_tag LOCUS_08230 922677 921529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 923711 922677 gene locus_tag LOCUS_08240 923711 922677 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_08240 924225 923704 gene locus_tag LOCUS_08250 924225 923704 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_08250 925286 924219 gene locus_tag LOCUS_08260 925286 924219 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_08260 925292 926164 gene locus_tag LOCUS_08270 925292 926164 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_08270 926947 926291 gene locus_tag LOCUS_08280 926947 926291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 928087 927206 gene locus_tag LOCUS_08290 928087 927206 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_08290 928143 929114 gene locus_tag LOCUS_08300 928143 929114 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 protein_id gnl|my_center|LOCUS_08300 930412 929495 gene locus_tag LOCUS_08310 930412 929495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 931299 930424 gene locus_tag LOCUS_08320 931299 930424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 931737 932843 gene locus_tag LOCUS_08330 931737 932843 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225151.1 protein_id gnl|my_center|LOCUS_08330 932937 933689 gene locus_tag LOCUS_08340 932937 933689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 934309 933761 gene locus_tag LOCUS_08350 934309 933761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 937630 934388 gene locus_tag LOCUS_08360 937630 934388 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_08360 937929 938132 gene locus_tag LOCUS_08370 937929 938132 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_08370 938309 938713 gene locus_tag LOCUS_08380 938309 938713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 939634 938765 gene locus_tag LOCUS_08390 939634 938765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_08390 939694 940272 gene locus_tag LOCUS_08400 939694 940272 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_08400 940778 940284 gene locus_tag LOCUS_08410 940778 940284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 942115 940892 gene locus_tag LOCUS_08420 942115 940892 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_08420 942441 942106 gene locus_tag LOCUS_08430 942441 942106 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_08430 942536 943879 gene locus_tag LOCUS_08440 942536 943879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 943994 945199 gene locus_tag LOCUS_08450 943994 945199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 945693 945277 gene locus_tag LOCUS_08460 945693 945277 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229490.1 protein_id gnl|my_center|LOCUS_08460 946532 945690 gene locus_tag LOCUS_08470 946532 945690 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_08470 946626 947090 gene locus_tag LOCUS_08480 946626 947090 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229488.1 protein_id gnl|my_center|LOCUS_08480 947488 947111 gene locus_tag LOCUS_08490 947488 947111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_08490 947898 947491 gene locus_tag LOCUS_08500 947898 947491 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226479.1 protein_id gnl|my_center|LOCUS_08500 948001 948633 gene locus_tag LOCUS_08510 948001 948633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 952979 948723 gene locus_tag LOCUS_08520 952979 948723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 956758 952991 gene locus_tag LOCUS_08530 956758 952991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 957117 958319 gene locus_tag LOCUS_08540 957117 958319 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225331.1 protein_id gnl|my_center|LOCUS_08540 960659 958410 gene locus_tag LOCUS_08550 960659 958410 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224904.1 protein_id gnl|my_center|LOCUS_08550 961633 960656 gene locus_tag LOCUS_08560 961633 960656 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224905.1 protein_id gnl|my_center|LOCUS_08560 962238 961633 gene locus_tag LOCUS_08570 962238 961633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 962366 963691 gene locus_tag LOCUS_08580 962366 963691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033263369.1 protein_id gnl|my_center|LOCUS_08580 963688 964080 gene locus_tag LOCUS_08590 963688 964080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 964134 965141 gene locus_tag LOCUS_08600 964134 965141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093157.1 protein_id gnl|my_center|LOCUS_08600 965138 965686 gene locus_tag LOCUS_08610 965138 965686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222339.1 protein_id gnl|my_center|LOCUS_08610 965653 966798 gene locus_tag LOCUS_08620 965653 966798 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027952.1 protein_id gnl|my_center|LOCUS_08620 966795 967463 gene locus_tag LOCUS_08630 966795 967463 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_08630 968051 967485 gene locus_tag LOCUS_08640 968051 967485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 968953 968237 gene locus_tag LOCUS_08650 968953 968237 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839199.1 protein_id gnl|my_center|LOCUS_08650 969059 969991 gene locus_tag LOCUS_08660 969059 969991 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_08660 972132 970003 gene locus_tag LOCUS_08670 972132 970003 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204072091.1 protein_id gnl|my_center|LOCUS_08670 973164 972166 gene locus_tag LOCUS_08680 973164 972166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 973768 975144 gene locus_tag LOCUS_08690 973768 975144 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_08690 975571 975212 gene locus_tag LOCUS_08700 975571 975212 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 protein_id gnl|my_center|LOCUS_08700 976137 975571 gene locus_tag LOCUS_08710 976137 975571 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227460.1 protein_id gnl|my_center|LOCUS_08710 976224 976610 gene locus_tag LOCUS_08720 976224 976610 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532394.1 protein_id gnl|my_center|LOCUS_08720 976619 977461 gene locus_tag LOCUS_08730 976619 977461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 978068 977514 gene locus_tag LOCUS_08740 978068 977514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 978263 979069 gene locus_tag LOCUS_08750 978263 979069 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227930.1 protein_id gnl|my_center|LOCUS_08750 980399 979185 gene locus_tag LOCUS_08760 980399 979185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_08760 980780 982702 gene locus_tag LOCUS_08770 980780 982702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 982842 982618 gene locus_tag LOCUS_08780 982842 982618 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184788.1 protein_id gnl|my_center|LOCUS_08780 983572 982871 gene locus_tag LOCUS_08790 983572 982871 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972430.1 protein_id gnl|my_center|LOCUS_08790 983884 988398 gene locus_tag LOCUS_08800 983884 988398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 988398 991955 gene locus_tag LOCUS_08810 988398 991955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 991965 994391 gene locus_tag LOCUS_08820 991965 994391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 994415 995650 gene locus_tag LOCUS_08830 994415 995650 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_08830 995647 1001715 gene locus_tag LOCUS_08840 995647 1001715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1001709 1003115 gene locus_tag LOCUS_08850 1001709 1003115 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247976.1 protein_id gnl|my_center|LOCUS_08850 1003112 1003849 gene locus_tag LOCUS_08860 1003112 1003849 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226595.1 protein_id gnl|my_center|LOCUS_08860 1004121 1004594 gene locus_tag LOCUS_08870 1004121 1004594 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225987.1 protein_id gnl|my_center|LOCUS_08870 1004611 1004943 gene locus_tag LOCUS_08880 1004611 1004943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225988.1 protein_id gnl|my_center|LOCUS_08880 1004943 1006082 gene locus_tag LOCUS_08890 1004943 1006082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225989.1 protein_id gnl|my_center|LOCUS_08890 1006013 1006732 gene locus_tag LOCUS_08900 1006013 1006732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225990.1 protein_id gnl|my_center|LOCUS_08900 1007892 1006756 gene locus_tag LOCUS_08910 1007892 1006756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225901.1 protein_id gnl|my_center|LOCUS_08910 1008545 1007889 gene locus_tag LOCUS_08920 1008545 1007889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_08920 1008660 1009844 gene locus_tag LOCUS_08930 1008660 1009844 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225903.1 protein_id gnl|my_center|LOCUS_08930 1010706 1009831 gene locus_tag LOCUS_08940 1010706 1009831 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_08940 1010781 1011404 gene locus_tag LOCUS_08950 1010781 1011404 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225583.1 protein_id gnl|my_center|LOCUS_08950 1011425 1012039 gene locus_tag LOCUS_08960 1011425 1012039 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705143.1 protein_id gnl|my_center|LOCUS_08960 1012261 1013934 gene locus_tag LOCUS_08970 1012261 1013934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1014199 1017066 gene locus_tag LOCUS_08980 1014199 1017066 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_08980 1017122 1017262 gene locus_tag LOCUS_08990 1017122 1017262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1017331 1021062 gene locus_tag LOCUS_09000 1017331 1021062 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_09000 1021126 1025085 gene locus_tag LOCUS_09010 1021126 1025085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1025976 1025152 gene locus_tag LOCUS_09020 1025976 1025152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1026881 1025973 gene locus_tag LOCUS_09030 1026881 1025973 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_09030 1027013 1028197 gene locus_tag LOCUS_09040 1027013 1028197 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950377.1 protein_id gnl|my_center|LOCUS_09040 1028194 1028853 gene locus_tag LOCUS_09050 1028194 1028853 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 protein_id gnl|my_center|LOCUS_09050 1028891 1029679 gene locus_tag LOCUS_09060 1028891 1029679 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225798.1 protein_id gnl|my_center|LOCUS_09060 1030738 1029698 gene locus_tag LOCUS_09070 1030738 1029698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1031074 1031649 gene locus_tag LOCUS_09080 1031074 1031649 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898165.1 protein_id gnl|my_center|LOCUS_09080 1033549 1031684 gene locus_tag LOCUS_09090 1033549 1031684 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_09090 1033746 1033555 gene locus_tag LOCUS_09100 1033746 1033555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1033930 1033757 gene locus_tag LOCUS_09110 1033930 1033757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1034131 1034253 gene locus_tag LOCUS_09120 1034131 1034253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1034250 1035386 gene locus_tag LOCUS_09130 1034250 1035386 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_09130 1035383 1036729 gene locus_tag LOCUS_09140 1035383 1036729 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728200.1 protein_id gnl|my_center|LOCUS_09140 1036763 1036930 gene locus_tag LOCUS_09150 1036763 1036930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1037867 1036932 gene locus_tag LOCUS_09160 1037867 1036932 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_09160 1037945 1038514 gene locus_tag LOCUS_09170 1037945 1038514 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729526.1 protein_id gnl|my_center|LOCUS_09170 1039914 1038643 gene locus_tag LOCUS_09180 1039914 1038643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1041312 1040113 gene locus_tag LOCUS_09190 1041312 1040113 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225801.1 protein_id gnl|my_center|LOCUS_09190 1042136 1041315 gene locus_tag LOCUS_09200 1042136 1041315 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139631769.1 protein_id gnl|my_center|LOCUS_09200 1043053 1042136 gene locus_tag LOCUS_09210 1043053 1042136 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091310187.1 protein_id gnl|my_center|LOCUS_09210 1044337 1043057 gene locus_tag LOCUS_09220 1044337 1043057 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225804.1 protein_id gnl|my_center|LOCUS_09220 1046646 1044322 gene locus_tag LOCUS_09230 1046646 1044322 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225154.1 protein_id gnl|my_center|LOCUS_09230 1048364 1046673 gene locus_tag LOCUS_09240 1048364 1046673 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_09240 1051189 1048361 gene locus_tag LOCUS_09250 1051189 1048361 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_09250 1054656 1051201 gene locus_tag LOCUS_09260 1054656 1051201 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_09260 1055199 1056479 gene locus_tag LOCUS_09270 1055199 1056479 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638993.1 protein_id gnl|my_center|LOCUS_09270 1056499 1057458 gene locus_tag LOCUS_09280 1056499 1057458 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_09280 1057895 1059202 gene locus_tag LOCUS_09290 1057895 1059202 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225835.1 protein_id gnl|my_center|LOCUS_09290 1059226 1060692 gene locus_tag LOCUS_09300 1059226 1060692 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639946.1 protein_id gnl|my_center|LOCUS_09300 1061216 1060848 gene locus_tag LOCUS_09310 1061216 1060848 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227684.1 protein_id gnl|my_center|LOCUS_09310 1061274 1062506 gene locus_tag LOCUS_09320 1061274 1062506 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227683.1 protein_id gnl|my_center|LOCUS_09320 1062770 1063288 gene locus_tag LOCUS_09330 1062770 1063288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1063294 1064274 gene locus_tag LOCUS_09340 1063294 1064274 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029165.1 protein_id gnl|my_center|LOCUS_09340 1064310 1064675 gene locus_tag LOCUS_09350 1064310 1064675 CDS product gas vesicle structural protein GvpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030969.1 protein_id gnl|my_center|LOCUS_09350 1064672 1065424 gene locus_tag LOCUS_09360 1064672 1065424 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_09360 1065428 1065667 gene locus_tag LOCUS_09370 1065428 1065667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1065664 1065951 gene locus_tag LOCUS_09380 1065664 1065951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1065951 1066280 gene locus_tag LOCUS_09390 1065951 1066280 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972473.1 protein_id gnl|my_center|LOCUS_09390 1066298 1067053 gene locus_tag LOCUS_09400 1066298 1067053 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030972.1 protein_id gnl|my_center|LOCUS_09400 1067050 1067247 gene locus_tag LOCUS_09410 1067050 1067247 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897166.1 protein_id gnl|my_center|LOCUS_09410 1067244 1067537 gene locus_tag LOCUS_09420 1067244 1067537 CDS product gas vesicle protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972470.1 protein_id gnl|my_center|LOCUS_09420 1068157 1067819 gene locus_tag LOCUS_09430 1068157 1067819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1069235 1068183 gene locus_tag LOCUS_09440 1069235 1068183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1071030 1069276 gene locus_tag LOCUS_09450 1071030 1069276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_09450 1072856 1071036 gene locus_tag LOCUS_09460 1072856 1071036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_09460 1073839 1072853 gene locus_tag LOCUS_09470 1073839 1072853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1074175 1079619 gene locus_tag LOCUS_09480 1074175 1079619 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189716469.1 protein_id gnl|my_center|LOCUS_09480 1079694 1085087 gene locus_tag LOCUS_09490 1079694 1085087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09490 1085074 1085295 gene locus_tag LOCUS_09500 1085074 1085295 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726914.1 protein_id gnl|my_center|LOCUS_09500 1085301 1086509 gene locus_tag LOCUS_09510 1085301 1086509 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973236.1 protein_id gnl|my_center|LOCUS_09510 1086506 1086736 gene locus_tag LOCUS_09520 1086506 1086736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1086733 1088403 gene locus_tag LOCUS_09530 1086733 1088403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1088396 1089895 gene locus_tag LOCUS_09540 1088396 1089895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1089897 1092623 gene locus_tag LOCUS_09550 1089897 1092623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 1092616 1095798 gene locus_tag LOCUS_09560 1092616 1095798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09560 1095782 1098097 gene locus_tag LOCUS_09570 1095782 1098097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09570 1098084 1101878 gene locus_tag LOCUS_09580 1098084 1101878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1101875 1102855 gene locus_tag LOCUS_09590 1101875 1102855 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085023.1 protein_id gnl|my_center|LOCUS_09590 1102852 1107720 gene locus_tag LOCUS_09600 1102852 1107720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09600 1107717 1109027 gene locus_tag LOCUS_09610 1107717 1109027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1109771 1109031 gene locus_tag LOCUS_09620 1109771 1109031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09620 1112813 1109775 gene locus_tag LOCUS_09630 1112813 1109775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09630 1117537 1112810 gene locus_tag LOCUS_09640 1117537 1112810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1117914 1117534 gene locus_tag LOCUS_09650 1117914 1117534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1118049 1119083 gene locus_tag LOCUS_09660 1118049 1119083 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_09660 1120373 1119126 gene locus_tag LOCUS_09670 1120373 1119126 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_09670 1121295 1120387 gene locus_tag LOCUS_09680 1121295 1120387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1122419 1121292 gene locus_tag LOCUS_09690 1122419 1121292 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222819.1 protein_id gnl|my_center|LOCUS_09690 1123197 1122484 gene locus_tag LOCUS_09700 1123197 1122484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1123334 1124713 gene locus_tag LOCUS_09710 1123334 1124713 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_09710 1124710 1125696 gene locus_tag LOCUS_09720 1124710 1125696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1125693 1126802 gene locus_tag LOCUS_09730 1125693 1126802 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 protein_id gnl|my_center|LOCUS_09730 1127469 1126861 gene locus_tag LOCUS_09740 1127469 1126861 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_09740 1128751 1127543 gene locus_tag LOCUS_09750 1128751 1127543 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083700.1 protein_id gnl|my_center|LOCUS_09750 1129767 1128748 gene locus_tag LOCUS_09760 1129767 1128748 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence02 113 847 gene locus_tag LOCUS_09770 113 847 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222233.1 protein_id gnl|my_center|LOCUS_09770 870 1712 gene locus_tag LOCUS_09780 870 1712 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114349.1 protein_id gnl|my_center|LOCUS_09780 1741 2484 gene locus_tag LOCUS_09790 1741 2484 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_09790 2488 5469 gene locus_tag LOCUS_09800 2488 5469 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466641.1 protein_id gnl|my_center|LOCUS_09800 5490 5912 gene locus_tag LOCUS_09810 5490 5912 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030744.1 protein_id gnl|my_center|LOCUS_09810 6295 5909 gene locus_tag LOCUS_09820 6295 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 6389 6937 gene locus_tag LOCUS_09830 6389 6937 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226517.1 protein_id gnl|my_center|LOCUS_09830 8460 7036 gene locus_tag LOCUS_09840 gene glnA 8460 7036 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223133.1 protein_id gnl|my_center|LOCUS_09840 8654 9112 gene locus_tag LOCUS_09850 8654 9112 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223134.1 protein_id gnl|my_center|LOCUS_09850 9871 9131 gene locus_tag LOCUS_09860 9871 9131 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223136.1 protein_id gnl|my_center|LOCUS_09860 9964 12054 gene locus_tag LOCUS_09870 9964 12054 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742114.1 protein_id gnl|my_center|LOCUS_09870 12185 12421 gene locus_tag LOCUS_09880 12185 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 12542 12925 gene locus_tag LOCUS_09890 12542 12925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 12922 13149 gene locus_tag LOCUS_09900 12922 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 13389 13153 gene locus_tag LOCUS_09910 13389 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 13997 14878 gene locus_tag LOCUS_09920 13997 14878 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466643.1 protein_id gnl|my_center|LOCUS_09920 16777 16322 gene locus_tag LOCUS_09930 16777 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 17676 16765 gene locus_tag LOCUS_09940 17676 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223143.1 protein_id gnl|my_center|LOCUS_09940 19063 17759 gene locus_tag LOCUS_09950 19063 17759 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223144.1 protein_id gnl|my_center|LOCUS_09950 20178 19069 gene locus_tag LOCUS_09960 20178 19069 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223145.1 protein_id gnl|my_center|LOCUS_09960 20293 20832 gene locus_tag LOCUS_09970 20293 20832 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223146.1 protein_id gnl|my_center|LOCUS_09970 22197 20878 gene locus_tag LOCUS_09980 22197 20878 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466645.1 protein_id gnl|my_center|LOCUS_09980 22269 23375 gene locus_tag LOCUS_09990 22269 23375 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324693.1 protein_id gnl|my_center|LOCUS_09990 23930 23376 gene locus_tag LOCUS_10000 23930 23376 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223149.1 protein_id gnl|my_center|LOCUS_10000 24064 27018 gene locus_tag LOCUS_10010 24064 27018 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630643.1 protein_id gnl|my_center|LOCUS_10010 27698 27279 gene locus_tag LOCUS_10020 27698 27279 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_10020 28200 28124 gene locus_tag LOCUS_t00070 28200 28124 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29202 29702 gene locus_tag LOCUS_10030 29202 29702 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223153.1 protein_id gnl|my_center|LOCUS_10030 29750 30862 gene locus_tag LOCUS_10040 gene prfB 29750 30862 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728139.1 protein_id gnl|my_center|LOCUS_10040 30979 31668 gene locus_tag LOCUS_10050 gene ftsE 30979 31668 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_10050 31732 32634 gene locus_tag LOCUS_10060 gene ftsX 31732 32634 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223155.1 protein_id gnl|my_center|LOCUS_10060 32665 33144 gene locus_tag LOCUS_10070 gene smpB 32665 33144 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_10070 33148 34068 gene locus_tag LOCUS_10080 33148 34068 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223157.1 protein_id gnl|my_center|LOCUS_10080 34105 36474 gene locus_tag LOCUS_10090 gene lon 34105 36474 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222513.1 protein_id gnl|my_center|LOCUS_10090 36572 38812 gene locus_tag LOCUS_10100 36572 38812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 39453 38809 gene locus_tag LOCUS_10110 39453 38809 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_10110 40679 39441 gene locus_tag LOCUS_10120 40679 39441 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223162.1 protein_id gnl|my_center|LOCUS_10120 41371 40676 gene locus_tag LOCUS_10130 41371 40676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 41550 41922 gene locus_tag LOCUS_tm00010 41550 41922 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 43207 42242 gene locus_tag LOCUS_10140 43207 42242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 43898 43503 gene locus_tag LOCUS_10150 43898 43503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 44656 44012 gene locus_tag LOCUS_10160 44656 44012 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_10160 44717 45367 gene locus_tag LOCUS_10170 44717 45367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 45364 45846 gene locus_tag LOCUS_10180 45364 45846 CDS product DUF4274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014990.1 protein_id gnl|my_center|LOCUS_10180 45862 46266 gene locus_tag LOCUS_10190 45862 46266 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113222.1 protein_id gnl|my_center|LOCUS_10190 46266 46757 gene locus_tag LOCUS_10200 46266 46757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 46889 47275 gene locus_tag LOCUS_10210 46889 47275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 47353 48138 gene locus_tag LOCUS_10220 47353 48138 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_10220 48170 49435 gene locus_tag LOCUS_10230 48170 49435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 49449 50594 gene locus_tag LOCUS_10240 49449 50594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 50917 51363 gene locus_tag LOCUS_10250 50917 51363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 51504 51986 gene locus_tag LOCUS_10260 51504 51986 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_10260 51988 52809 gene locus_tag LOCUS_10270 51988 52809 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223189.1 protein_id gnl|my_center|LOCUS_10270 54132 52810 gene locus_tag LOCUS_10280 54132 52810 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_10280 54235 54308 gene locus_tag LOCUS_t00080 54235 54308 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55264 55650 gene locus_tag LOCUS_10290 55264 55650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 56122 56358 gene locus_tag LOCUS_10300 56122 56358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 56569 57396 gene locus_tag LOCUS_10310 56569 57396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 57559 57993 gene locus_tag LOCUS_10320 57559 57993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 58586 59011 gene locus_tag LOCUS_10330 58586 59011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 59466 59927 gene locus_tag LOCUS_10340 59466 59927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 61132 59912 gene locus_tag LOCUS_10350 61132 59912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 62047 61190 gene locus_tag LOCUS_10360 62047 61190 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 protein_id gnl|my_center|LOCUS_10360 62961 62044 gene locus_tag LOCUS_10370 62961 62044 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804968.1 protein_id gnl|my_center|LOCUS_10370 64564 62963 gene locus_tag LOCUS_10380 64564 62963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_10380 65637 64564 gene locus_tag LOCUS_10390 65637 64564 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973687.1 protein_id gnl|my_center|LOCUS_10390 65823 67460 gene locus_tag LOCUS_10400 65823 67460 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179748936.1 protein_id gnl|my_center|LOCUS_10400 67492 68307 gene locus_tag LOCUS_10410 67492 68307 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_10410 68368 70509 gene locus_tag LOCUS_10420 68368 70509 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850081.1 protein_id gnl|my_center|LOCUS_10420 70619 72925 gene locus_tag LOCUS_10430 70619 72925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 73725 72949 gene locus_tag LOCUS_10440 73725 72949 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 protein_id gnl|my_center|LOCUS_10440 73888 74229 gene locus_tag LOCUS_10450 73888 74229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 75881 74202 gene locus_tag LOCUS_10460 75881 74202 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224721.1 protein_id gnl|my_center|LOCUS_10460 76152 77657 gene locus_tag LOCUS_10470 76152 77657 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027644.1 protein_id gnl|my_center|LOCUS_10470 77739 78518 gene locus_tag LOCUS_10480 77739 78518 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086127.1 protein_id gnl|my_center|LOCUS_10480 78571 80121 gene locus_tag LOCUS_10490 78571 80121 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_10490 80570 83308 gene locus_tag LOCUS_10500 80570 83308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 86207 83310 gene locus_tag LOCUS_10510 86207 83310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 87471 86326 gene locus_tag LOCUS_10520 87471 86326 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 protein_id gnl|my_center|LOCUS_10520 88731 87574 gene locus_tag LOCUS_10530 88731 87574 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026891.1 protein_id gnl|my_center|LOCUS_10530 90126 88828 gene locus_tag LOCUS_10540 gene nhaA 90126 88828 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_10540 90572 90237 gene locus_tag LOCUS_10550 90572 90237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 91277 90588 gene locus_tag LOCUS_10560 91277 90588 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228176.1 protein_id gnl|my_center|LOCUS_10560 91391 91741 gene locus_tag LOCUS_10570 91391 91741 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_10570 92029 92430 gene locus_tag LOCUS_10580 92029 92430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 93687 92479 gene locus_tag LOCUS_10590 93687 92479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 94600 94172 gene locus_tag LOCUS_10600 94600 94172 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230086.1 protein_id gnl|my_center|LOCUS_10600 94686 95282 gene locus_tag LOCUS_10610 94686 95282 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111807.1 protein_id gnl|my_center|LOCUS_10610 95329 95591 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq accagccccgctcgcgcggggacgac 98907 95944 gene locus_tag LOCUS_10620 98907 95944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 99546 99223 gene locus_tag LOCUS_10630 99546 99223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 100008 99601 gene locus_tag LOCUS_10640 100008 99601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10640 100412 100047 gene locus_tag LOCUS_10650 100412 100047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 101065 100361 gene locus_tag LOCUS_10660 101065 100361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 101232 102080 gene locus_tag LOCUS_10670 101232 102080 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_10670 102088 102315 gene locus_tag LOCUS_10680 102088 102315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 102465 103169 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaccacccccgctcgcgcggggacgac 103420 106056 gene locus_tag LOCUS_10690 gene cas3 103420 106056 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_10690 106238 106449 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtccccgcgcacgcggggctggtcc 106750 108372 gene locus_tag LOCUS_10700 gene casA 106750 108372 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_10700 108374 109003 gene locus_tag LOCUS_10710 108374 109003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 109000 110124 gene locus_tag LOCUS_10720 gene cas7e 109000 110124 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_10720 110121 110825 gene locus_tag LOCUS_10730 gene cas5e 110121 110825 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227611.1 protein_id gnl|my_center|LOCUS_10730 110825 111478 gene locus_tag LOCUS_10740 gene cas6e 110825 111478 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_10740 111478 112170 gene locus_tag LOCUS_10750 111478 112170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 112157 112417 gene locus_tag LOCUS_10760 112157 112417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 113239 112802 gene locus_tag LOCUS_10770 113239 112802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_10770 113290 114207 gene locus_tag LOCUS_10780 113290 114207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 115107 114211 gene locus_tag LOCUS_10790 115107 114211 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031550.1 protein_id gnl|my_center|LOCUS_10790 115874 115239 gene locus_tag LOCUS_10800 115874 115239 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222835.1 protein_id gnl|my_center|LOCUS_10800 116269 115877 gene locus_tag LOCUS_10810 116269 115877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 116410 117117 gene locus_tag LOCUS_10820 116410 117117 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225398.1 protein_id gnl|my_center|LOCUS_10820 117101 119008 gene locus_tag LOCUS_10830 117101 119008 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 protein_id gnl|my_center|LOCUS_10830 120056 118965 gene locus_tag LOCUS_10840 120056 118965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 120385 120053 gene locus_tag LOCUS_10850 120385 120053 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_10850 120505 121656 gene locus_tag LOCUS_10860 120505 121656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 121781 125434 gene locus_tag LOCUS_10870 121781 125434 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_10870 125094 125163 gene locus_tag LOCUS_t00090 125094 125163 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 126296 125478 gene locus_tag LOCUS_10880 126296 125478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 126451 126951 gene locus_tag LOCUS_10890 126451 126951 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_10890 126948 128060 gene locus_tag LOCUS_10900 126948 128060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 128063 131635 gene locus_tag LOCUS_10910 128063 131635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 131664 132314 gene locus_tag LOCUS_10920 131664 132314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 133505 132315 gene locus_tag LOCUS_10930 133505 132315 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_10930 133606 136725 gene locus_tag LOCUS_10940 133606 136725 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_10940 135535 135632 gene locus_tag LOCUS_t00100 135535 135632 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 137452 136700 gene locus_tag LOCUS_10950 137452 136700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221978.1 protein_id gnl|my_center|LOCUS_10950 138390 137449 gene locus_tag LOCUS_10960 138390 137449 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_10960 138623 139597 gene locus_tag LOCUS_10970 138623 139597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 139749 140990 gene locus_tag LOCUS_10980 139749 140990 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224340.1 protein_id gnl|my_center|LOCUS_10980 141092 141907 gene locus_tag LOCUS_10990 141092 141907 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_10990 143110 141917 gene locus_tag LOCUS_11000 143110 141917 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_11000 143209 143826 gene locus_tag LOCUS_11010 143209 143826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 143916 145142 gene locus_tag LOCUS_11020 143916 145142 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224708.1 protein_id gnl|my_center|LOCUS_11020 145139 145792 gene locus_tag LOCUS_11030 145139 145792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224709.1 protein_id gnl|my_center|LOCUS_11030 145827 146564 gene locus_tag LOCUS_11040 145827 146564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_11040 146567 148378 gene locus_tag LOCUS_11050 146567 148378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 148541 148350 gene locus_tag LOCUS_11060 148541 148350 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418993.1 protein_id gnl|my_center|LOCUS_11060 148668 149645 gene locus_tag LOCUS_11070 148668 149645 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_11070 149872 149600 gene locus_tag LOCUS_11080 149872 149600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 149760 150503 gene locus_tag LOCUS_11090 149760 150503 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_11090 151749 150583 gene locus_tag LOCUS_11100 151749 150583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674804.1 protein_id gnl|my_center|LOCUS_11100 152788 151781 gene locus_tag LOCUS_11110 152788 151781 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674803.1 protein_id gnl|my_center|LOCUS_11110 153836 152844 gene locus_tag LOCUS_11120 153836 152844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 154694 153918 gene locus_tag LOCUS_11130 154694 153918 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939553.1 protein_id gnl|my_center|LOCUS_11130 155029 154775 gene locus_tag LOCUS_11140 155029 154775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 155276 156550 gene locus_tag LOCUS_11150 155276 156550 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_11150 156547 157674 gene locus_tag LOCUS_11160 156547 157674 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045945562.1 protein_id gnl|my_center|LOCUS_11160 157671 158528 gene locus_tag LOCUS_11170 157671 158528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 158525 159307 gene locus_tag LOCUS_11180 158525 159307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 159300 160295 gene locus_tag LOCUS_11190 159300 160295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 160292 161356 gene locus_tag LOCUS_11200 160292 161356 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225892.1 protein_id gnl|my_center|LOCUS_11200 161368 161625 gene locus_tag LOCUS_11210 161368 161625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 161622 162020 gene locus_tag LOCUS_11220 161622 162020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 162014 162502 gene locus_tag LOCUS_11230 gene fabZ 162014 162502 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_11230 162527 163279 gene locus_tag LOCUS_11240 gene fabG 162527 163279 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_11240 163299 164018 gene locus_tag LOCUS_11250 163299 164018 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_11250 164053 165729 gene locus_tag LOCUS_11260 164053 165729 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225878.1 protein_id gnl|my_center|LOCUS_11260 165726 166757 gene locus_tag LOCUS_11270 165726 166757 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225892.1 protein_id gnl|my_center|LOCUS_11270 166754 170119 gene locus_tag LOCUS_11280 166754 170119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 170116 171147 gene locus_tag LOCUS_11290 gene sbnB 170116 171147 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225889.1 protein_id gnl|my_center|LOCUS_11290 171149 172138 gene locus_tag LOCUS_11300 gene sbnA 171149 172138 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225888.1 protein_id gnl|my_center|LOCUS_11300 172140 173279 gene locus_tag LOCUS_11310 172140 173279 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_11310 173305 173688 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggaccagccccgctcgcgc 175064 173853 gene locus_tag LOCUS_11320 175064 173853 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_11320 175582 175061 gene locus_tag LOCUS_11330 175582 175061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 175782 185009 gene locus_tag LOCUS_11340 175782 185009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 185006 200107 gene locus_tag LOCUS_11350 185006 200107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 200107 212829 gene locus_tag LOCUS_11360 200107 212829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11360 212826 213041 gene locus_tag LOCUS_11370 212826 213041 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_11370 214292 213102 gene locus_tag LOCUS_11380 214292 213102 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_11380 214645 215967 gene locus_tag LOCUS_11390 214645 215967 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 protein_id gnl|my_center|LOCUS_11390 216036 216410 gene locus_tag LOCUS_11400 216036 216410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 216586 218562 gene locus_tag LOCUS_11410 216586 218562 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224706.1 protein_id gnl|my_center|LOCUS_11410 218552 218806 gene locus_tag LOCUS_11420 218552 218806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 218897 219694 gene locus_tag LOCUS_11430 218897 219694 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_11430 219723 220583 gene locus_tag LOCUS_11440 219723 220583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 223348 220637 gene locus_tag LOCUS_11450 223348 220637 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843344.1 protein_id gnl|my_center|LOCUS_11450 223723 223481 gene locus_tag LOCUS_11460 223723 223481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 223831 224658 gene locus_tag LOCUS_11470 223831 224658 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222148.1 protein_id gnl|my_center|LOCUS_11470 224661 224834 gene locus_tag LOCUS_11480 224661 224834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 224909 225727 gene locus_tag LOCUS_11490 224909 225727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 225805 226992 gene locus_tag LOCUS_11500 225805 226992 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_11500 228223 227045 gene locus_tag LOCUS_11510 228223 227045 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_11510 228657 228232 gene locus_tag LOCUS_11520 gene nsrR 228657 228232 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_11520 228699 230036 gene locus_tag LOCUS_11530 228699 230036 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_11530 230271 230068 gene locus_tag LOCUS_11540 230271 230068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11540 230832 230416 gene locus_tag LOCUS_11550 230832 230416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 230895 231479 gene locus_tag LOCUS_11560 230895 231479 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_11560 231476 231823 gene locus_tag LOCUS_11570 231476 231823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 231913 232512 gene locus_tag LOCUS_11580 231913 232512 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223204.1 protein_id gnl|my_center|LOCUS_11580 232711 237111 gene locus_tag LOCUS_11590 232711 237111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 237190 237858 gene locus_tag LOCUS_11600 237190 237858 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775873.1 protein_id gnl|my_center|LOCUS_11600 239144 237873 gene locus_tag LOCUS_11610 239144 237873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 239259 239528 gene locus_tag LOCUS_11620 239259 239528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 239559 239864 gene locus_tag LOCUS_11630 239559 239864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 240584 239901 gene locus_tag LOCUS_11640 240584 239901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 245145 240541 gene locus_tag LOCUS_11650 245145 240541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 245328 246002 gene locus_tag LOCUS_11660 245328 246002 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227538.1 protein_id gnl|my_center|LOCUS_11660 246014 246331 gene locus_tag LOCUS_11670 246014 246331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 247353 246328 gene locus_tag LOCUS_11680 247353 246328 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_11680 248237 247353 gene locus_tag LOCUS_11690 248237 247353 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384270.1 protein_id gnl|my_center|LOCUS_11690 249445 248267 gene locus_tag LOCUS_11700 249445 248267 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384268.1 protein_id gnl|my_center|LOCUS_11700 250338 249457 gene locus_tag LOCUS_11710 250338 249457 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537722.1 protein_id gnl|my_center|LOCUS_11710 251306 250335 gene locus_tag LOCUS_11720 251306 250335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537721.1 protein_id gnl|my_center|LOCUS_11720 252942 251323 gene locus_tag LOCUS_11730 252942 251323 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384265.1 protein_id gnl|my_center|LOCUS_11730 254150 252942 gene locus_tag LOCUS_11740 254150 252942 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_11740 254329 255327 gene locus_tag LOCUS_11750 254329 255327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731054.1 protein_id gnl|my_center|LOCUS_11750 255311 256315 gene locus_tag LOCUS_11760 255311 256315 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_11760 257030 256326 gene locus_tag LOCUS_11770 257030 256326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 257539 257027 gene locus_tag LOCUS_11780 257539 257027 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_11780 258156 257527 gene locus_tag LOCUS_11790 258156 257527 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 protein_id gnl|my_center|LOCUS_11790 260019 258181 gene locus_tag LOCUS_11800 260019 258181 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_11800 261309 260020 gene locus_tag LOCUS_11810 261309 260020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 263556 261322 gene locus_tag LOCUS_11820 263556 261322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 263691 265109 gene locus_tag LOCUS_11830 263691 265109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 265106 266611 gene locus_tag LOCUS_11840 265106 266611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 266608 268182 gene locus_tag LOCUS_11850 266608 268182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 268198 268908 gene locus_tag LOCUS_11860 268198 268908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 268905 269873 gene locus_tag LOCUS_11870 268905 269873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 270051 269875 gene locus_tag LOCUS_11880 270051 269875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 270452 270048 gene locus_tag LOCUS_11890 270452 270048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 270627 271571 gene locus_tag LOCUS_11900 270627 271571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228171.1 protein_id gnl|my_center|LOCUS_11900 271656 274346 gene locus_tag LOCUS_11910 271656 274346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 274336 275793 gene locus_tag LOCUS_11920 274336 275793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 275825 278596 gene locus_tag LOCUS_11930 275825 278596 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_11930 278679 280994 gene locus_tag LOCUS_11940 278679 280994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 280991 281227 gene locus_tag LOCUS_11950 280991 281227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 281302 282024 gene locus_tag LOCUS_11960 281302 282024 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404735.1 protein_id gnl|my_center|LOCUS_11960 284171 282732 gene locus_tag LOCUS_11970 284171 282732 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 protein_id gnl|my_center|LOCUS_11970 284274 285023 gene locus_tag LOCUS_11980 284274 285023 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_11980 285037 285714 gene locus_tag LOCUS_11990 285037 285714 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_11990 285737 286588 gene locus_tag LOCUS_12000 285737 286588 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_12000 286585 288417 gene locus_tag LOCUS_12010 286585 288417 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_12010 288431 289045 gene locus_tag LOCUS_12020 288431 289045 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_12020 289799 288990 gene locus_tag LOCUS_12030 289799 288990 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775992.1 protein_id gnl|my_center|LOCUS_12030 289933 290718 gene locus_tag LOCUS_12040 289933 290718 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_12040 290954 290706 gene locus_tag LOCUS_12050 290954 290706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 291352 292191 gene locus_tag LOCUS_12060 291352 292191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 292188 292499 gene locus_tag LOCUS_12070 292188 292499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 292510 293592 gene locus_tag LOCUS_12080 292510 293592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 293592 294296 gene locus_tag LOCUS_12090 293592 294296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 294407 294736 gene locus_tag LOCUS_12100 294407 294736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 295380 294733 gene locus_tag LOCUS_12110 295380 294733 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_12110 295817 296512 gene locus_tag LOCUS_12120 295817 296512 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_12120 296528 299017 gene locus_tag LOCUS_12130 296528 299017 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_12130 299032 299799 gene locus_tag LOCUS_12140 299032 299799 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_12140 299845 301032 gene locus_tag LOCUS_12150 299845 301032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence03 <1 716 gene locus_tag LOCUS_12160 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176742098.1:DEAD/DEAH box helicase 1440 718 gene locus_tag LOCUS_12170 1440 718 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_12170 2251 1481 gene locus_tag LOCUS_12180 2251 1481 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224206.1 protein_id gnl|my_center|LOCUS_12180 2670 2248 gene locus_tag LOCUS_12190 2670 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2900 3421 gene locus_tag LOCUS_12200 2900 3421 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224204.1 protein_id gnl|my_center|LOCUS_12200 3418 3993 gene locus_tag LOCUS_12210 3418 3993 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_12210 5650 3998 gene locus_tag LOCUS_12220 5650 3998 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742099.1 protein_id gnl|my_center|LOCUS_12220 5717 6379 gene locus_tag LOCUS_12230 gene lppM 5717 6379 CDS product lipoprotein LppM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411238.1 protein_id gnl|my_center|LOCUS_12230 7269 6376 gene locus_tag LOCUS_12240 7269 6376 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224200.1 protein_id gnl|my_center|LOCUS_12240 7375 8481 gene locus_tag LOCUS_12250 7375 8481 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_12250 8484 10007 gene locus_tag LOCUS_12260 gene crtI 8484 10007 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224197.1 protein_id gnl|my_center|LOCUS_12260 10113 11492 gene locus_tag LOCUS_12270 10113 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 11465 12415 gene locus_tag LOCUS_12280 11465 12415 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_12280 12704 12384 gene locus_tag LOCUS_12290 12704 12384 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_12290 12902 15058 gene locus_tag LOCUS_12300 gene pknB 12902 15058 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_12300 15148 16509 gene locus_tag LOCUS_12310 15148 16509 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449604.1 protein_id gnl|my_center|LOCUS_12310 17902 16511 gene locus_tag LOCUS_12320 17902 16511 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_12320 18953 17928 gene locus_tag LOCUS_12330 18953 17928 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224333.1 protein_id gnl|my_center|LOCUS_12330 19554 19051 gene locus_tag LOCUS_12340 19554 19051 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_12340 20340 19576 gene locus_tag LOCUS_12350 20340 19576 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224330.1 protein_id gnl|my_center|LOCUS_12350 20532 21071 gene locus_tag LOCUS_12360 20532 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224328.1 protein_id gnl|my_center|LOCUS_12360 22034 21084 gene locus_tag LOCUS_12370 22034 21084 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_12370 22438 22031 gene locus_tag LOCUS_12380 22438 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 23613 22435 gene locus_tag LOCUS_12390 23613 22435 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224322.1 protein_id gnl|my_center|LOCUS_12390 24061 23624 gene locus_tag LOCUS_12400 24061 23624 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224321.1 protein_id gnl|my_center|LOCUS_12400 24876 24088 gene locus_tag LOCUS_12410 24876 24088 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224320.1 protein_id gnl|my_center|LOCUS_12410 25255 24887 gene locus_tag LOCUS_12420 25255 24887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224319.1 protein_id gnl|my_center|LOCUS_12420 25314 26441 gene locus_tag LOCUS_12430 25314 26441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 26518 26769 gene locus_tag LOCUS_12440 26518 26769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 26766 27077 gene locus_tag LOCUS_12450 26766 27077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 27471 27028 gene locus_tag LOCUS_12460 27471 27028 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082660.1 protein_id gnl|my_center|LOCUS_12460 28656 27511 gene locus_tag LOCUS_12470 28656 27511 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742100.1 protein_id gnl|my_center|LOCUS_12470 30006 28666 gene locus_tag LOCUS_12480 30006 28666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110481.1 protein_id gnl|my_center|LOCUS_12480 31016 30084 gene locus_tag LOCUS_12490 31016 30084 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227670.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12490 31776 31591 gene locus_tag LOCUS_12500 31776 31591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 33277 31928 gene locus_tag LOCUS_12510 33277 31928 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224086.1 protein_id gnl|my_center|LOCUS_12510 33365 35071 gene locus_tag LOCUS_12520 33365 35071 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_12520 35068 36018 gene locus_tag LOCUS_12530 gene iolC 35068 36018 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_12530 36008 36895 gene locus_tag LOCUS_12540 36008 36895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224910.1 protein_id gnl|my_center|LOCUS_12540 36910 37767 gene locus_tag LOCUS_12550 gene iolB 36910 37767 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_12550 38630 37752 gene locus_tag LOCUS_12560 38630 37752 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229870.1 protein_id gnl|my_center|LOCUS_12560 40288 38627 gene locus_tag LOCUS_12570 40288 38627 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184859936.1 protein_id gnl|my_center|LOCUS_12570 41421 40285 gene locus_tag LOCUS_12580 41421 40285 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224082.1 protein_id gnl|my_center|LOCUS_12580 42173 41418 gene locus_tag LOCUS_12590 42173 41418 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224081.1 protein_id gnl|my_center|LOCUS_12590 42850 42281 gene locus_tag LOCUS_12600 42850 42281 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 protein_id gnl|my_center|LOCUS_12600 43053 43460 gene locus_tag LOCUS_12610 43053 43460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224078.1 protein_id gnl|my_center|LOCUS_12610 43469 44548 gene locus_tag LOCUS_12620 gene trpD 43469 44548 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_12620 45023 44622 gene locus_tag LOCUS_12630 45023 44622 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224074.1 protein_id gnl|my_center|LOCUS_12630 46023 45055 gene locus_tag LOCUS_12640 46023 45055 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466782.1 protein_id gnl|my_center|LOCUS_12640 46242 48095 gene locus_tag LOCUS_12650 gene asnB 46242 48095 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224072.1 protein_id gnl|my_center|LOCUS_12650 48932 48096 gene locus_tag LOCUS_12660 48932 48096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466844.1 protein_id gnl|my_center|LOCUS_12660 49989 48970 gene locus_tag LOCUS_12670 49989 48970 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224071.1 protein_id gnl|my_center|LOCUS_12670 50044 50208 gene locus_tag LOCUS_12680 50044 50208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 50620 50261 gene locus_tag LOCUS_12690 50620 50261 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224070.1 protein_id gnl|my_center|LOCUS_12690 51839 50706 gene locus_tag LOCUS_12700 51839 50706 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085331.1 protein_id gnl|my_center|LOCUS_12700 51878 52525 gene locus_tag LOCUS_12710 51878 52525 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224069.1 protein_id gnl|my_center|LOCUS_12710 52522 53325 gene locus_tag LOCUS_12720 52522 53325 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_12720 53413 54396 gene locus_tag LOCUS_12730 53413 54396 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_12730 54691 54413 gene locus_tag LOCUS_12740 54691 54413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 54617 55141 gene locus_tag LOCUS_12750 54617 55141 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856625.1 protein_id gnl|my_center|LOCUS_12750 55193 56242 gene locus_tag LOCUS_12760 gene cobT 55193 56242 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224062.1 protein_id gnl|my_center|LOCUS_12760 56247 56993 gene locus_tag LOCUS_12770 56247 56993 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110464.1 protein_id gnl|my_center|LOCUS_12770 58141 57041 gene locus_tag LOCUS_12780 58141 57041 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_12780 59261 58212 gene locus_tag LOCUS_12790 59261 58212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 59377 60864 gene locus_tag LOCUS_12800 59377 60864 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224057.1 protein_id gnl|my_center|LOCUS_12800 62914 60881 gene locus_tag LOCUS_12810 62914 60881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 63331 63002 gene locus_tag LOCUS_12820 63331 63002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_12820 63484 64854 gene locus_tag LOCUS_12830 gene lpdA 63484 64854 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_12830 64885 66219 gene locus_tag LOCUS_12840 64885 66219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12840 66222 67109 gene locus_tag LOCUS_12850 66222 67109 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 protein_id gnl|my_center|LOCUS_12850 67199 67903 gene locus_tag LOCUS_12860 gene lipB 67199 67903 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_12860 68601 67936 gene locus_tag LOCUS_12870 68601 67936 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223922.1 protein_id gnl|my_center|LOCUS_12870 69226 68633 gene locus_tag LOCUS_12880 69226 68633 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_12880 72112 69461 gene locus_tag LOCUS_12890 72112 69461 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117302210.1 protein_id gnl|my_center|LOCUS_12890 72254 73258 gene locus_tag LOCUS_12900 gene lipA 72254 73258 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466774.1 protein_id gnl|my_center|LOCUS_12900 73368 74048 gene locus_tag LOCUS_12910 73368 74048 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224042.1 protein_id gnl|my_center|LOCUS_12910 74294 74112 gene locus_tag LOCUS_12920 74294 74112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 74339 75619 gene locus_tag LOCUS_12930 gene serS 74339 75619 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884187.1 protein_id gnl|my_center|LOCUS_12930 76525 75635 gene locus_tag LOCUS_12940 76525 75635 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225561.1 protein_id gnl|my_center|LOCUS_12940 76626 77573 gene locus_tag LOCUS_12950 76626 77573 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030927.1 protein_id gnl|my_center|LOCUS_12950 77661 80612 gene locus_tag LOCUS_12960 77661 80612 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_12960 81158 80664 gene locus_tag LOCUS_12970 81158 80664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 81046 83346 gene locus_tag LOCUS_12980 81046 83346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 83324 84559 gene locus_tag LOCUS_12990 83324 84559 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230385.1 protein_id gnl|my_center|LOCUS_12990 84569 85798 gene locus_tag LOCUS_13000 84569 85798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 85798 88299 gene locus_tag LOCUS_13010 85798 88299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 89903 88653 gene locus_tag LOCUS_13020 89903 88653 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224736.1 protein_id gnl|my_center|LOCUS_13020 90616 89900 gene locus_tag LOCUS_13030 90616 89900 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224817.1 protein_id gnl|my_center|LOCUS_13030 91884 90613 gene locus_tag LOCUS_13040 91884 90613 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224816.1 protein_id gnl|my_center|LOCUS_13040 91974 93239 gene locus_tag LOCUS_13050 91974 93239 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224815.1 protein_id gnl|my_center|LOCUS_13050 93224 94012 gene locus_tag LOCUS_13060 93224 94012 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742172.1 protein_id gnl|my_center|LOCUS_13060 94100 94028 gene locus_tag LOCUS_t00110 94100 94028 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 94603 94139 gene locus_tag LOCUS_13070 94603 94139 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_13070 95103 94672 gene locus_tag LOCUS_13080 95103 94672 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_13080 95361 98132 gene locus_tag LOCUS_13090 gene aceE 95361 98132 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223999.1 protein_id gnl|my_center|LOCUS_13090 99272 100438 gene locus_tag LOCUS_13100 99272 100438 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223990.1 protein_id gnl|my_center|LOCUS_13100 100574 101506 gene locus_tag LOCUS_13110 gene fabD 100574 101506 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411559.1 protein_id gnl|my_center|LOCUS_13110 101503 102477 gene locus_tag LOCUS_13120 101503 102477 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223987.1 protein_id gnl|my_center|LOCUS_13120 102524 102781 gene locus_tag LOCUS_13130 102524 102781 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559006.1 protein_id gnl|my_center|LOCUS_13130 102830 104077 gene locus_tag LOCUS_13140 102830 104077 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_13140 104943 104332 gene locus_tag LOCUS_13150 104943 104332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223985.1 protein_id gnl|my_center|LOCUS_13150 105434 104943 gene locus_tag LOCUS_13160 105434 104943 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223984.1 protein_id gnl|my_center|LOCUS_13160 105635 106930 gene locus_tag LOCUS_13170 105635 106930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 107039 107377 gene locus_tag LOCUS_13180 107039 107377 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_13180 108246 107374 gene locus_tag LOCUS_13190 108246 107374 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_13190 109796 108243 gene locus_tag LOCUS_13200 109796 108243 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_13200 111194 109809 gene locus_tag LOCUS_13210 111194 109809 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229625.1 protein_id gnl|my_center|LOCUS_13210 112296 111244 gene locus_tag LOCUS_13220 112296 111244 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043078326.1 protein_id gnl|my_center|LOCUS_13220 112482 113294 gene locus_tag LOCUS_13230 112482 113294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 113836 113291 gene locus_tag LOCUS_13240 113836 113291 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_13240 113939 114382 gene locus_tag LOCUS_13250 113939 114382 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230879.1 protein_id gnl|my_center|LOCUS_13250 115293 114385 gene locus_tag LOCUS_13260 115293 114385 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466733.1 protein_id gnl|my_center|LOCUS_13260 115376 115783 gene locus_tag LOCUS_13270 115376 115783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 117254 115755 gene locus_tag LOCUS_13280 117254 115755 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_13280 117822 117328 gene locus_tag LOCUS_13290 117822 117328 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_13290 117966 118997 gene locus_tag LOCUS_13300 117966 118997 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_13300 123090 119041 gene locus_tag LOCUS_13310 123090 119041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 126146 123234 gene locus_tag LOCUS_13320 126146 123234 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_13320 127903 126296 gene locus_tag LOCUS_13330 127903 126296 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_13330 128457 127903 gene locus_tag LOCUS_13340 128457 127903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 128560 130959 gene locus_tag LOCUS_13350 128560 130959 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_13350 130981 131577 gene locus_tag LOCUS_13360 130981 131577 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_13360 131624 132046 gene locus_tag LOCUS_13370 131624 132046 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082410.1 protein_id gnl|my_center|LOCUS_13370 132065 133051 gene locus_tag LOCUS_13380 132065 133051 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230778.1 protein_id gnl|my_center|LOCUS_13380 133861 133079 gene locus_tag LOCUS_13390 133861 133079 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_13390 133978 134640 gene locus_tag LOCUS_13400 133978 134640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 136258 134630 gene locus_tag LOCUS_13410 gene cimA 136258 134630 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223593.1 protein_id gnl|my_center|LOCUS_13410 137595 136546 gene locus_tag LOCUS_13420 137595 136546 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223592.1 protein_id gnl|my_center|LOCUS_13420 139299 137704 gene locus_tag LOCUS_13430 gene serA 139299 137704 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223590.1 protein_id gnl|my_center|LOCUS_13430 139749 139444 gene locus_tag LOCUS_13440 139749 139444 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223584.1 protein_id gnl|my_center|LOCUS_13440 140844 139831 gene locus_tag LOCUS_13450 gene ilvC 140844 139831 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_13450 141386 140880 gene locus_tag LOCUS_13460 gene ilvN 141386 140880 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003080760.1 protein_id gnl|my_center|LOCUS_13460 143075 141393 gene locus_tag LOCUS_13470 143075 141393 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_13470 143481 143975 gene locus_tag LOCUS_13480 143481 143975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 143988 145832 gene locus_tag LOCUS_13490 gene ilvD 143988 145832 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_13490 147174 145840 gene locus_tag LOCUS_13500 147174 145840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 148151 147171 gene locus_tag LOCUS_13510 148151 147171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 148531 148154 gene locus_tag LOCUS_13520 148531 148154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 148665 149846 gene locus_tag LOCUS_13530 148665 149846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 149839 150948 gene locus_tag LOCUS_13540 149839 150948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 150930 151586 gene locus_tag LOCUS_13550 150930 151586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 152176 153855 gene locus_tag LOCUS_13560 152176 153855 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228431.1 protein_id gnl|my_center|LOCUS_13560 153852 154022 gene locus_tag LOCUS_13570 153852 154022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_13570 154019 154723 gene locus_tag LOCUS_13580 154019 154723 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228433.1 protein_id gnl|my_center|LOCUS_13580 154768 155646 gene locus_tag LOCUS_13590 gene cysD 154768 155646 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228434.1 protein_id gnl|my_center|LOCUS_13590 155646 156926 gene locus_tag LOCUS_13600 155646 156926 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228435.1 protein_id gnl|my_center|LOCUS_13600 156927 157679 gene locus_tag LOCUS_13610 156927 157679 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_13610 157798 158427 gene locus_tag LOCUS_13620 157798 158427 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228439.1 protein_id gnl|my_center|LOCUS_13620 158435 159328 gene locus_tag LOCUS_13630 158435 159328 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975986.1 protein_id gnl|my_center|LOCUS_13630 160377 159325 gene locus_tag LOCUS_13640 160377 159325 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_13640 160435 161226 gene locus_tag LOCUS_13650 160435 161226 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_13650 161477 161196 gene locus_tag LOCUS_13660 161477 161196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 161872 161477 gene locus_tag LOCUS_13670 161872 161477 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228443.1 protein_id gnl|my_center|LOCUS_13670 162169 161891 gene locus_tag LOCUS_13680 162169 161891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 162238 163203 gene locus_tag LOCUS_13690 162238 163203 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_13690 163210 163647 gene locus_tag LOCUS_13700 163210 163647 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_13700 164280 163699 gene locus_tag LOCUS_13710 164280 163699 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228455.1 protein_id gnl|my_center|LOCUS_13710 166205 164361 gene locus_tag LOCUS_13720 gene lepA 166205 164361 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228456.1 protein_id gnl|my_center|LOCUS_13720 167064 166279 gene locus_tag LOCUS_13730 167064 166279 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_13730 168137 167079 gene locus_tag LOCUS_13740 168137 167079 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_13740 169141 168134 gene locus_tag LOCUS_13750 169141 168134 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 protein_id gnl|my_center|LOCUS_13750 169812 169138 gene locus_tag LOCUS_13760 169812 169138 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 protein_id gnl|my_center|LOCUS_13760 169881 170684 gene locus_tag LOCUS_13770 169881 170684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 170738 172588 gene locus_tag LOCUS_13780 170738 172588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 173425 172550 gene locus_tag LOCUS_13790 173425 172550 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729144.1 protein_id gnl|my_center|LOCUS_13790 174000 173422 gene locus_tag LOCUS_13800 174000 173422 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408271.1 protein_id gnl|my_center|LOCUS_13800 174863 174231 gene locus_tag LOCUS_13810 174863 174231 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018162528.1 protein_id gnl|my_center|LOCUS_13810 175368 175108 gene locus_tag LOCUS_13820 175368 175108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 175931 175446 gene locus_tag LOCUS_13830 175931 175446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 177439 176606 gene locus_tag LOCUS_13840 177439 176606 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_13840 177546 178466 gene locus_tag LOCUS_13850 177546 178466 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_13850 178474 178698 gene locus_tag LOCUS_13860 178474 178698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 178996 179256 gene locus_tag LOCUS_13870 gene rpsT 178996 179256 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228460.1 protein_id gnl|my_center|LOCUS_13870 179457 180434 gene locus_tag LOCUS_13880 gene holA 179457 180434 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 protein_id gnl|my_center|LOCUS_13880 184471 180569 gene locus_tag LOCUS_13890 184471 180569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 185133 184468 gene locus_tag LOCUS_13900 185133 184468 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228465.1 protein_id gnl|my_center|LOCUS_13900 186960 186103 gene locus_tag LOCUS_13910 186960 186103 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228466.1 protein_id gnl|my_center|LOCUS_13910 187689 186967 gene locus_tag LOCUS_13920 187689 186967 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228467.1 protein_id gnl|my_center|LOCUS_13920 188329 187715 gene locus_tag LOCUS_13930 188329 187715 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228468.1 protein_id gnl|my_center|LOCUS_13930 188727 188326 gene locus_tag LOCUS_13940 gene rsfS 188727 188326 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067112.1 protein_id gnl|my_center|LOCUS_13940 189362 188790 gene locus_tag LOCUS_13950 gene nadD 189362 188790 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_13950 189493 191610 gene locus_tag LOCUS_13960 189493 191610 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_13960 192750 191674 gene locus_tag LOCUS_13970 gene proB 192750 191674 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228477.1 protein_id gnl|my_center|LOCUS_13970 194309 192801 gene locus_tag LOCUS_13980 gene obgE 194309 192801 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228478.1 protein_id gnl|my_center|LOCUS_13980 194655 194398 gene locus_tag LOCUS_13990 gene rpmA 194655 194398 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_13990 194980 194669 gene locus_tag LOCUS_14000 gene rplU 194980 194669 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067132.1 protein_id gnl|my_center|LOCUS_14000 198210 195148 gene locus_tag LOCUS_14010 198210 195148 CDS product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228480.1 protein_id gnl|my_center|LOCUS_14010 199153 198419 gene locus_tag LOCUS_14020 199153 198419 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_14020 199418 200893 gene locus_tag LOCUS_14030 199418 200893 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285809.1 protein_id gnl|my_center|LOCUS_14030 202829 200901 gene locus_tag LOCUS_14040 202829 200901 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_14040 203703 202864 gene locus_tag LOCUS_14050 203703 202864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_14050 204479 203700 gene locus_tag LOCUS_14060 204479 203700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228483.1 protein_id gnl|my_center|LOCUS_14060 204975 204556 gene locus_tag LOCUS_14070 204975 204556 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_14070 205217 204972 gene locus_tag LOCUS_14080 205217 204972 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_14080 206185 205256 gene locus_tag LOCUS_14090 206185 205256 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_14090 206593 206225 gene locus_tag LOCUS_14100 gene ndk 206593 206225 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_14100 206474 206806 gene locus_tag LOCUS_14110 206474 206806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 206803 207174 gene locus_tag LOCUS_14120 206803 207174 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_14120 207575 207171 gene locus_tag LOCUS_14130 207575 207171 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228490.1 protein_id gnl|my_center|LOCUS_14130 208942 207572 gene locus_tag LOCUS_14140 208942 207572 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228491.1 protein_id gnl|my_center|LOCUS_14140 211481 208935 gene locus_tag LOCUS_14150 211481 208935 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228497.1 protein_id gnl|my_center|LOCUS_14150 211540 211689 gene locus_tag LOCUS_14160 211540 211689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 211728 212708 gene locus_tag LOCUS_14170 211728 212708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 212809 213060 gene locus_tag LOCUS_14180 212809 213060 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_14180 214600 213038 gene locus_tag LOCUS_14190 214600 213038 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_14190 214775 214602 gene locus_tag LOCUS_14200 214775 214602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 215422 214847 gene locus_tag LOCUS_14210 215422 214847 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_14210 216073 215468 gene locus_tag LOCUS_14220 216073 215468 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887590.1 protein_id gnl|my_center|LOCUS_14220 217391 216090 gene locus_tag LOCUS_14230 gene clpX 217391 216090 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562779.1 protein_id gnl|my_center|LOCUS_14230 218273 217641 gene locus_tag LOCUS_14240 218273 217641 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228511.1 protein_id gnl|my_center|LOCUS_14240 218914 218297 gene locus_tag LOCUS_14250 218914 218297 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228512.1 protein_id gnl|my_center|LOCUS_14250 220406 219042 gene locus_tag LOCUS_14260 gene tig 220406 219042 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228513.1 protein_id gnl|my_center|LOCUS_14260 220601 220525 gene locus_tag LOCUS_t00120 220601 220525 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 220686 220759 gene locus_tag LOCUS_t00130 220686 220759 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 221280 220858 gene locus_tag LOCUS_14270 gene vapC26 221280 220858 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_14270 222316 221954 gene locus_tag LOCUS_14280 222316 221954 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_14280 222954 222577 gene locus_tag LOCUS_14290 222954 222577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 223540 227397 gene locus_tag LOCUS_14300 223540 227397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 228660 227458 gene locus_tag LOCUS_14310 228660 227458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_14310 229760 228828 gene locus_tag LOCUS_14320 229760 228828 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_14320 230428 229757 gene locus_tag LOCUS_14330 gene wrbA 230428 229757 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_14330 231130 230459 gene locus_tag LOCUS_14340 gene upp 231130 230459 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254935.1 protein_id gnl|my_center|LOCUS_14340 231825 231136 gene locus_tag LOCUS_14350 231825 231136 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428832.1 protein_id gnl|my_center|LOCUS_14350 232564 231878 gene locus_tag LOCUS_14360 232564 231878 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193030647.1 protein_id gnl|my_center|LOCUS_14360 233386 232634 gene locus_tag LOCUS_14370 233386 232634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 233681 233457 gene locus_tag LOCUS_14380 233681 233457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 233871 234266 gene locus_tag LOCUS_14390 233871 234266 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_14390 234787 234263 gene locus_tag LOCUS_14400 234787 234263 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223648.1 protein_id gnl|my_center|LOCUS_14400 235154 235071 gene locus_tag LOCUS_t00140 235154 235071 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 236430 235684 gene locus_tag LOCUS_14410 236430 235684 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228583.1 protein_id gnl|my_center|LOCUS_14410 237227 236445 gene locus_tag LOCUS_14420 237227 236445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 237265 237735 gene locus_tag LOCUS_14430 237265 237735 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_14430 237737 238543 gene locus_tag LOCUS_14440 237737 238543 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_14440 239786 238584 gene locus_tag LOCUS_14450 239786 238584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 241298 239859 gene locus_tag LOCUS_14460 241298 239859 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_14460 242054 241419 gene locus_tag LOCUS_14470 242054 241419 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_14470 242203 244770 gene locus_tag LOCUS_14480 gene pepN 242203 244770 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_14480 245377 244868 gene locus_tag LOCUS_14490 245377 244868 CDS product DUF5130 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228587.1 protein_id gnl|my_center|LOCUS_14490 245657 245364 gene locus_tag LOCUS_14500 245657 245364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228588.1 protein_id gnl|my_center|LOCUS_14500 246149 245874 gene locus_tag LOCUS_14510 246149 245874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 246661 246161 gene locus_tag LOCUS_14520 246661 246161 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840499.1 protein_id gnl|my_center|LOCUS_14520 246946 247917 gene locus_tag LOCUS_14530 246946 247917 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_14530 247940 248329 gene locus_tag LOCUS_14540 247940 248329 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742154.1 protein_id gnl|my_center|LOCUS_14540 248377 249945 gene locus_tag LOCUS_14550 248377 249945 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228593.1 protein_id gnl|my_center|LOCUS_14550 250670 250356 gene locus_tag LOCUS_14560 250670 250356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 251373 250738 gene locus_tag LOCUS_14570 251373 250738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228595.1 protein_id gnl|my_center|LOCUS_14570 251758 251366 gene locus_tag LOCUS_14580 251758 251366 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228596.1 protein_id gnl|my_center|LOCUS_14580 256808 251838 gene locus_tag LOCUS_14590 256808 251838 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228597.1 protein_id gnl|my_center|LOCUS_14590 257617 256925 gene locus_tag LOCUS_14600 257617 256925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 257913 257614 gene locus_tag LOCUS_14610 257913 257614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 259137 260357 gene locus_tag LOCUS_14620 259137 260357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 260595 260954 gene locus_tag LOCUS_14630 260595 260954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence04 975 181 gene locus_tag LOCUS_14640 975 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1193 2218 gene locus_tag LOCUS_14650 gene hrcA 1193 2218 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228404.1 protein_id gnl|my_center|LOCUS_14650 2297 3442 gene locus_tag LOCUS_14660 gene dnaJ 2297 3442 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228403.1 protein_id gnl|my_center|LOCUS_14660 3439 4176 gene locus_tag LOCUS_14670 3439 4176 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228402.1 protein_id gnl|my_center|LOCUS_14670 4384 5367 gene locus_tag LOCUS_14680 gene ligD 4384 5367 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_14680 5378 5731 gene locus_tag LOCUS_14690 5378 5731 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228401.1 protein_id gnl|my_center|LOCUS_14690 5837 6928 gene locus_tag LOCUS_14700 5837 6928 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_14700 7008 7574 gene locus_tag LOCUS_14710 gene ybeY 7008 7574 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228399.1 protein_id gnl|my_center|LOCUS_14710 7589 8902 gene locus_tag LOCUS_14720 7589 8902 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_14720 8895 9218 gene locus_tag LOCUS_14730 8895 9218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228397.1 protein_id gnl|my_center|LOCUS_14730 9239 10147 gene locus_tag LOCUS_14740 gene era 9239 10147 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_14740 10148 10957 gene locus_tag LOCUS_14750 10148 10957 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_14750 10954 11703 gene locus_tag LOCUS_14760 gene recO 10954 11703 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_14760 11724 12575 gene locus_tag LOCUS_14770 11724 12575 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_14770 12572 12997 gene locus_tag LOCUS_14780 12572 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228388.1 protein_id gnl|my_center|LOCUS_14780 12994 13989 gene locus_tag LOCUS_14790 12994 13989 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285799.1 protein_id gnl|my_center|LOCUS_14790 13986 15377 gene locus_tag LOCUS_14800 13986 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 16415 15387 gene locus_tag LOCUS_14810 16415 15387 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086675089.1 protein_id gnl|my_center|LOCUS_14810 16592 17869 gene locus_tag LOCUS_14820 16592 17869 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_14820 17869 18882 gene locus_tag LOCUS_14830 17869 18882 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_14830 18879 19745 gene locus_tag LOCUS_14840 18879 19745 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_14840 19748 21148 gene locus_tag LOCUS_14850 19748 21148 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286145.1 protein_id gnl|my_center|LOCUS_14850 22097 22485 gene locus_tag LOCUS_tm00020 22097 22485 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 23175 22903 gene locus_tag LOCUS_14860 23175 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 23363 24748 gene locus_tag LOCUS_14870 23363 24748 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228379.1 protein_id gnl|my_center|LOCUS_14870 25670 26794 gene locus_tag LOCUS_14880 gene aspS 25670 26794 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193209104.1 protein_id gnl|my_center|LOCUS_14880 27746 26796 gene locus_tag LOCUS_14890 27746 26796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228047.1 protein_id gnl|my_center|LOCUS_14890 27939 28604 gene locus_tag LOCUS_14900 27939 28604 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228374.1 protein_id gnl|my_center|LOCUS_14900 28614 29906 gene locus_tag LOCUS_14910 28614 29906 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228373.1 protein_id gnl|my_center|LOCUS_14910 29946 31052 gene locus_tag LOCUS_14920 29946 31052 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228372.1 protein_id gnl|my_center|LOCUS_14920 31119 31715 gene locus_tag LOCUS_14930 31119 31715 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228365.1 protein_id gnl|my_center|LOCUS_14930 32634 31696 gene locus_tag LOCUS_14940 32634 31696 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228363.1 protein_id gnl|my_center|LOCUS_14940 32717 34624 gene locus_tag LOCUS_14950 gene dnaG 32717 34624 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_14950 34621 35145 gene locus_tag LOCUS_14960 34621 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467493.1 protein_id gnl|my_center|LOCUS_14960 35179 35943 gene locus_tag LOCUS_14970 35179 35943 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228360.1 protein_id gnl|my_center|LOCUS_14970 38165 36012 gene locus_tag LOCUS_14980 38165 36012 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 protein_id gnl|my_center|LOCUS_14980 38293 38844 gene locus_tag LOCUS_14990 38293 38844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 38935 39834 gene locus_tag LOCUS_15000 38935 39834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 40838 39807 gene locus_tag LOCUS_15010 40838 39807 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_15010 41061 40813 gene locus_tag LOCUS_15020 41061 40813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 41196 41269 gene locus_tag LOCUS_t00150 41196 41269 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 41309 42139 gene locus_tag LOCUS_15030 41309 42139 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028933.1 protein_id gnl|my_center|LOCUS_15030 42891 42133 gene locus_tag LOCUS_15040 42891 42133 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_15040 43004 43789 gene locus_tag LOCUS_15050 43004 43789 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_15050 43651 43726 gene locus_tag LOCUS_t00160 43651 43726 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45000 43786 gene locus_tag LOCUS_15060 45000 43786 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804231.1 protein_id gnl|my_center|LOCUS_15060 45769 45032 gene locus_tag LOCUS_15070 45769 45032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 46449 45766 gene locus_tag LOCUS_15080 46449 45766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 46559 47662 gene locus_tag LOCUS_15090 46559 47662 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_15090 47659 48354 gene locus_tag LOCUS_15100 47659 48354 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_15100 48469 50127 gene locus_tag LOCUS_15110 48469 50127 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184448.1 protein_id gnl|my_center|LOCUS_15110 50722 50135 gene locus_tag LOCUS_15120 50722 50135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 50810 51058 gene locus_tag LOCUS_15130 50810 51058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 51156 51230 gene locus_tag LOCUS_t00170 51156 51230 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 51443 51895 gene locus_tag LOCUS_15140 51443 51895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224277.1 protein_id gnl|my_center|LOCUS_15140 52310 51900 gene locus_tag LOCUS_15150 52310 51900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 52391 52930 gene locus_tag LOCUS_15160 52391 52930 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_15160 53830 52970 gene locus_tag LOCUS_15170 53830 52970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223352.1 protein_id gnl|my_center|LOCUS_15170 54350 53817 gene locus_tag LOCUS_15180 54350 53817 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_15180 54501 55199 gene locus_tag LOCUS_15190 54501 55199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_15190 55196 57688 gene locus_tag LOCUS_15200 55196 57688 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207316850.1 protein_id gnl|my_center|LOCUS_15200 57691 58908 gene locus_tag LOCUS_15210 57691 58908 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223289.1 protein_id gnl|my_center|LOCUS_15210 58896 59540 gene locus_tag LOCUS_15220 58896 59540 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726958.1 protein_id gnl|my_center|LOCUS_15220 59581 60393 gene locus_tag LOCUS_15230 59581 60393 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229949.1 protein_id gnl|my_center|LOCUS_15230 60434 60784 gene locus_tag LOCUS_15240 60434 60784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 61089 60832 gene locus_tag LOCUS_15250 61089 60832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 62462 61092 gene locus_tag LOCUS_15260 62462 61092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 63285 62518 gene locus_tag LOCUS_15270 63285 62518 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_15270 63310 64677 gene locus_tag LOCUS_15280 63310 64677 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223712.1 protein_id gnl|my_center|LOCUS_15280 65879 64701 gene locus_tag LOCUS_15290 65879 64701 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_15290 66339 67178 gene locus_tag LOCUS_15300 66339 67178 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284413.1 protein_id gnl|my_center|LOCUS_15300 67235 67307 gene locus_tag LOCUS_t00180 67235 67307 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 67350 67423 gene locus_tag LOCUS_t00190 67350 67423 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67837 67451 gene locus_tag LOCUS_15310 67837 67451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 67836 67973 gene locus_tag LOCUS_15320 67836 67973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 68022 68303 gene locus_tag LOCUS_15330 68022 68303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 68414 68581 gene locus_tag LOCUS_15340 68414 68581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 68623 72537 gene locus_tag LOCUS_15350 68623 72537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 72824 73132 gene locus_tag LOCUS_15360 72824 73132 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230177.1 protein_id gnl|my_center|LOCUS_15360 73172 73540 gene locus_tag LOCUS_15370 73172 73540 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_15370 73537 75264 gene locus_tag LOCUS_15380 73537 75264 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230175.1 protein_id gnl|my_center|LOCUS_15380 75264 75959 gene locus_tag LOCUS_15390 75264 75959 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230174.1 protein_id gnl|my_center|LOCUS_15390 75949 76659 gene locus_tag LOCUS_15400 gene ureG 75949 76659 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_15400 76663 77406 gene locus_tag LOCUS_15410 76663 77406 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230172.1 protein_id gnl|my_center|LOCUS_15410 78397 77399 gene locus_tag LOCUS_15420 78397 77399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 78655 79851 gene locus_tag LOCUS_15430 78655 79851 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468241.1 protein_id gnl|my_center|LOCUS_15430 79863 80381 gene locus_tag LOCUS_15440 79863 80381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 81432 80395 gene locus_tag LOCUS_15450 81432 80395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 82272 81442 gene locus_tag LOCUS_15460 82272 81442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 83010 82369 gene locus_tag LOCUS_15470 83010 82369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 84077 82992 gene locus_tag LOCUS_15480 84077 82992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 85188 84070 gene locus_tag LOCUS_15490 85188 84070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 85248 86513 gene locus_tag LOCUS_15500 85248 86513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226646.1 protein_id gnl|my_center|LOCUS_15500 86513 87148 gene locus_tag LOCUS_15510 86513 87148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 87247 87471 gene locus_tag LOCUS_15520 87247 87471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 88495 87473 gene locus_tag LOCUS_15530 88495 87473 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_15530 88386 88619 gene locus_tag LOCUS_15540 88386 88619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 90963 88594 gene locus_tag LOCUS_15550 gene atsD 90963 88594 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_15550 93686 91065 gene locus_tag LOCUS_15560 93686 91065 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850600.1 protein_id gnl|my_center|LOCUS_15560 96352 93692 gene locus_tag LOCUS_15570 96352 93692 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850600.1 protein_id gnl|my_center|LOCUS_15570 97997 96465 gene locus_tag LOCUS_15580 97997 96465 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_15580 98179 98054 gene locus_tag LOCUS_15590 98179 98054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 98349 99989 gene locus_tag LOCUS_15600 98349 99989 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086257.1 protein_id gnl|my_center|LOCUS_15600 100676 100002 gene locus_tag LOCUS_15610 100676 100002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 100778 101269 gene locus_tag LOCUS_15620 100778 101269 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022604.1 protein_id gnl|my_center|LOCUS_15620 101755 101273 gene locus_tag LOCUS_15630 101755 101273 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225759.1 protein_id gnl|my_center|LOCUS_15630 101952 102596 gene locus_tag LOCUS_15640 101952 102596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 102968 102627 gene locus_tag LOCUS_15650 102968 102627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 103702 103040 gene locus_tag LOCUS_15660 103702 103040 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560682.1 protein_id gnl|my_center|LOCUS_15660 103827 105263 gene locus_tag LOCUS_15670 gene leuC 103827 105263 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_15670 105277 105876 gene locus_tag LOCUS_15680 gene leuD 105277 105876 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223620.1 protein_id gnl|my_center|LOCUS_15680 106029 106700 gene locus_tag LOCUS_15690 106029 106700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 107679 106750 gene locus_tag LOCUS_15700 107679 106750 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_15700 109899 107683 gene locus_tag LOCUS_15710 109899 107683 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742242.1 protein_id gnl|my_center|LOCUS_15710 110559 109933 gene locus_tag LOCUS_15720 gene cofC 110559 109933 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_15720 110664 111380 gene locus_tag LOCUS_15730 110664 111380 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223626.1 protein_id gnl|my_center|LOCUS_15730 111384 112385 gene locus_tag LOCUS_15740 111384 112385 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223627.1 protein_id gnl|my_center|LOCUS_15740 112558 113004 gene locus_tag LOCUS_15750 112558 113004 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223628.1 protein_id gnl|my_center|LOCUS_15750 113657 112974 gene locus_tag LOCUS_15760 113657 112974 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223636.1 protein_id gnl|my_center|LOCUS_15760 113728 115149 gene locus_tag LOCUS_15770 113728 115149 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223637.1 protein_id gnl|my_center|LOCUS_15770 115174 116271 gene locus_tag LOCUS_15780 115174 116271 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223638.1 protein_id gnl|my_center|LOCUS_15780 116274 116906 gene locus_tag LOCUS_15790 116274 116906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975445.1 protein_id gnl|my_center|LOCUS_15790 117513 116911 gene locus_tag LOCUS_15800 117513 116911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 117767 117534 gene locus_tag LOCUS_15810 117767 117534 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_15810 117871 118833 gene locus_tag LOCUS_15820 117871 118833 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223640.1 protein_id gnl|my_center|LOCUS_15820 118881 119369 gene locus_tag LOCUS_15830 118881 119369 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_15830 119351 119872 gene locus_tag LOCUS_15840 119351 119872 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_15840 119896 120573 gene locus_tag LOCUS_15850 119896 120573 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_15850 121089 120850 gene locus_tag LOCUS_15860 gene rpmB 121089 120850 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_15860 121205 122845 gene locus_tag LOCUS_15870 121205 122845 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223646.1 protein_id gnl|my_center|LOCUS_15870 123434 122886 gene locus_tag LOCUS_15880 123434 122886 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222272.1 protein_id gnl|my_center|LOCUS_15880 123516 125705 gene locus_tag LOCUS_15890 gene recG 123516 125705 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223647.1 protein_id gnl|my_center|LOCUS_15890 127370 125763 gene locus_tag LOCUS_15900 127370 125763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 129611 127482 gene locus_tag LOCUS_15910 129611 127482 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_15910 129902 131068 gene locus_tag LOCUS_15920 129902 131068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 131178 134564 gene locus_tag LOCUS_15930 131178 134564 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027194.1 protein_id gnl|my_center|LOCUS_15930 135106 134561 gene locus_tag LOCUS_15940 135106 134561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 135218 135817 gene locus_tag LOCUS_15950 135218 135817 CDS product ABATE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530137.1 protein_id gnl|my_center|LOCUS_15950 135953 139636 gene locus_tag LOCUS_15960 135953 139636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 141773 139659 gene locus_tag LOCUS_15970 141773 139659 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223681.1 protein_id gnl|my_center|LOCUS_15970 141966 142442 gene locus_tag LOCUS_15980 gene rsmD 141966 142442 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_15980 142519 142989 gene locus_tag LOCUS_15990 gene coaD 142519 142989 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223683.1 protein_id gnl|my_center|LOCUS_15990 143431 142964 gene locus_tag LOCUS_16000 143431 142964 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_16000 143519 144262 gene locus_tag LOCUS_16010 143519 144262 CDS product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223684.1 protein_id gnl|my_center|LOCUS_16010 144356 145096 gene locus_tag LOCUS_16020 144356 145096 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223687.1 protein_id gnl|my_center|LOCUS_16020 145124 145738 gene locus_tag LOCUS_16030 145124 145738 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284376.1 protein_id gnl|my_center|LOCUS_16030 145782 145964 gene locus_tag LOCUS_16040 gene rpmF 145782 145964 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 protein_id gnl|my_center|LOCUS_16040 145987 146739 gene locus_tag LOCUS_16050 gene rnc 145987 146739 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742189.1 protein_id gnl|my_center|LOCUS_16050 146732 147580 gene locus_tag LOCUS_16060 gene mutM 146732 147580 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_16060 148319 147585 gene locus_tag LOCUS_16070 148319 147585 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222789.1 protein_id gnl|my_center|LOCUS_16070 148478 151012 gene locus_tag LOCUS_16080 148478 151012 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223788.1 protein_id gnl|my_center|LOCUS_16080 151009 151689 gene locus_tag LOCUS_16090 gene kdpE 151009 151689 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405305.1 protein_id gnl|my_center|LOCUS_16090 152396 151695 gene locus_tag LOCUS_16100 152396 151695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 153118 152441 gene locus_tag LOCUS_16110 153118 152441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 153190 153483 gene locus_tag LOCUS_16120 153190 153483 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728332.1 protein_id gnl|my_center|LOCUS_16120 153578 154096 gene locus_tag LOCUS_16130 153578 154096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_16130 154093 154869 gene locus_tag LOCUS_16140 154093 154869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 154976 158737 gene locus_tag LOCUS_16150 gene smc 154976 158737 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223795.1 protein_id gnl|my_center|LOCUS_16150 158820 159728 gene locus_tag LOCUS_16160 158820 159728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 161337 159709 gene locus_tag LOCUS_16170 161337 159709 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223797.1 protein_id gnl|my_center|LOCUS_16170 162540 161341 gene locus_tag LOCUS_16180 162540 161341 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223798.1 protein_id gnl|my_center|LOCUS_16180 162746 164170 gene locus_tag LOCUS_16190 gene ngcE 162746 164170 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_16190 164275 165171 gene locus_tag LOCUS_16200 164275 165171 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_16200 165168 166094 gene locus_tag LOCUS_16210 165168 166094 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_16210 166135 167115 gene locus_tag LOCUS_16220 166135 167115 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_16220 168105 167119 gene locus_tag LOCUS_16230 168105 167119 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978446.1 protein_id gnl|my_center|LOCUS_16230 168239 169543 gene locus_tag LOCUS_16240 gene ftsY 168239 169543 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223799.1 protein_id gnl|my_center|LOCUS_16240 169554 170141 gene locus_tag LOCUS_16250 169554 170141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 170162 171739 gene locus_tag LOCUS_16260 gene aceB 170162 171739 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223803.1 protein_id gnl|my_center|LOCUS_16260 171743 172978 gene locus_tag LOCUS_16270 171743 172978 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_16270 172975 174288 gene locus_tag LOCUS_16280 gene allB 172975 174288 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_16280 174285 175370 gene locus_tag LOCUS_16290 gene alc 174285 175370 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223823.1 protein_id gnl|my_center|LOCUS_16290 175413 176903 gene locus_tag LOCUS_16300 175413 176903 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226721.1 protein_id gnl|my_center|LOCUS_16300 177415 176882 gene locus_tag LOCUS_16310 177415 176882 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223830.1 protein_id gnl|my_center|LOCUS_16310 177705 179042 gene locus_tag LOCUS_16320 177705 179042 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_16320 179039 179377 gene locus_tag LOCUS_16330 gene glnB 179039 179377 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_16330 179377 181746 gene locus_tag LOCUS_16340 179377 181746 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223834.1 protein_id gnl|my_center|LOCUS_16340 181949 183520 gene locus_tag LOCUS_16350 gene ffh 181949 183520 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223845.1 protein_id gnl|my_center|LOCUS_16350 183527 184588 gene locus_tag LOCUS_16360 183527 184588 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223846.1 protein_id gnl|my_center|LOCUS_16360 184662 185417 gene locus_tag LOCUS_16370 184662 185417 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223848.1 protein_id gnl|my_center|LOCUS_16370 185567 186022 gene locus_tag LOCUS_16380 gene rpsP 185567 186022 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223849.1 protein_id gnl|my_center|LOCUS_16380 186019 186258 gene locus_tag LOCUS_16390 186019 186258 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103110.1 protein_id gnl|my_center|LOCUS_16390 186259 186777 gene locus_tag LOCUS_16400 gene rimM 186259 186777 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223850.1 protein_id gnl|my_center|LOCUS_16400 186778 187554 gene locus_tag LOCUS_16410 gene trmD 186778 187554 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223852.1 protein_id gnl|my_center|LOCUS_16410 187685 188044 gene locus_tag LOCUS_16420 gene rplS 187685 188044 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_16420 188104 189090 gene locus_tag LOCUS_16430 gene lepB 188104 189090 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223854.1 protein_id gnl|my_center|LOCUS_16430 189206 190102 gene locus_tag LOCUS_16440 gene lepB 189206 190102 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223854.1 protein_id gnl|my_center|LOCUS_16440 190099 190881 gene locus_tag LOCUS_16450 190099 190881 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223855.1 protein_id gnl|my_center|LOCUS_16450 190878 191201 gene locus_tag LOCUS_16460 190878 191201 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_16460 191321 191701 gene locus_tag LOCUS_16470 191321 191701 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223856.1 protein_id gnl|my_center|LOCUS_16470 191787 193301 gene locus_tag LOCUS_16480 191787 193301 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189256709.1 protein_id gnl|my_center|LOCUS_16480 193298 194857 gene locus_tag LOCUS_16490 193298 194857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 194934 196040 gene locus_tag LOCUS_16500 194934 196040 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223859.1 protein_id gnl|my_center|LOCUS_16500 196012 196935 gene locus_tag LOCUS_16510 196012 196935 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223860.1 protein_id gnl|my_center|LOCUS_16510 197848 197060 gene locus_tag LOCUS_16520 197848 197060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 198196 199047 gene locus_tag LOCUS_16530 gene rpsB 198196 199047 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223862.1 protein_id gnl|my_center|LOCUS_16530 199078 199908 gene locus_tag LOCUS_16540 gene tsf 199078 199908 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223863.1 protein_id gnl|my_center|LOCUS_16540 200005 200736 gene locus_tag LOCUS_16550 gene pyrH 200005 200736 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223864.1 protein_id gnl|my_center|LOCUS_16550 200771 201328 gene locus_tag LOCUS_16560 gene frr 200771 201328 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466739.1 protein_id gnl|my_center|LOCUS_16560 201837 201628 gene locus_tag LOCUS_16570 201837 201628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 201728 202477 gene locus_tag LOCUS_16580 201728 202477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 202506 203252 gene locus_tag LOCUS_16590 202506 203252 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_16590 203853 203281 gene locus_tag LOCUS_16600 203853 203281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 204763 204011 gene locus_tag LOCUS_16610 204763 204011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 205455 204937 gene locus_tag LOCUS_16620 205455 204937 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_16620 205577 206683 gene locus_tag LOCUS_16630 gene rlmN 205577 206683 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223876.1 protein_id gnl|my_center|LOCUS_16630 207764 206718 gene locus_tag LOCUS_16640 207764 206718 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_16640 207872 208477 gene locus_tag LOCUS_16650 207872 208477 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227638.1 protein_id gnl|my_center|LOCUS_16650 209559 208453 gene locus_tag LOCUS_16660 209559 208453 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227639.1 protein_id gnl|my_center|LOCUS_16660 210290 209556 gene locus_tag LOCUS_16670 210290 209556 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227640.1 protein_id gnl|my_center|LOCUS_16670 211673 210405 gene locus_tag LOCUS_16680 211673 210405 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084531.1 protein_id gnl|my_center|LOCUS_16680 212074 211796 gene locus_tag LOCUS_16690 212074 211796 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223923.1 protein_id gnl|my_center|LOCUS_16690 212163 213404 gene locus_tag LOCUS_16700 gene dxr 212163 213404 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284246.1 protein_id gnl|my_center|LOCUS_16700 213411 214619 gene locus_tag LOCUS_16710 213411 214619 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 protein_id gnl|my_center|LOCUS_16710 214660 215817 gene locus_tag LOCUS_16720 gene ispG 214660 215817 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_16720 215946 216755 gene locus_tag LOCUS_16730 215946 216755 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466751.1 protein_id gnl|my_center|LOCUS_16730 216778 218595 gene locus_tag LOCUS_16740 216778 218595 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_16740 218752 218579 gene locus_tag LOCUS_16750 218752 218579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 218924 218745 gene locus_tag LOCUS_16760 218924 218745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 219096 218917 gene locus_tag LOCUS_16770 219096 218917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 219961 219098 gene locus_tag LOCUS_16780 219961 219098 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_16780 220081 220326 gene locus_tag LOCUS_16790 220081 220326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 220370 221227 gene locus_tag LOCUS_16800 gene map 220370 221227 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223934.1 protein_id gnl|my_center|LOCUS_16800 221987 221214 gene locus_tag LOCUS_16810 221987 221214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 222887 224377 gene locus_tag LOCUS_16820 222887 224377 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_16820 225716 224328 gene locus_tag LOCUS_16830 225716 224328 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_16830 226297 225761 gene locus_tag LOCUS_16840 226297 225761 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230876.1 protein_id gnl|my_center|LOCUS_16840 226412 227485 gene locus_tag LOCUS_16850 226412 227485 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224099.1 protein_id gnl|my_center|LOCUS_16850 228075 227482 gene locus_tag LOCUS_16860 228075 227482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 228593 228072 gene locus_tag LOCUS_16870 228593 228072 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_16870 228662 229291 gene locus_tag LOCUS_16880 228662 229291 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728450.1 protein_id gnl|my_center|LOCUS_16880 229395 230168 gene locus_tag LOCUS_16890 229395 230168 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_16890 230181 230633 gene locus_tag LOCUS_16900 230181 230633 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_16900 231801 230596 gene locus_tag LOCUS_16910 231801 230596 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223945.1 protein_id gnl|my_center|LOCUS_16910 231938 232753 gene locus_tag LOCUS_16920 231938 232753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967028.1 protein_id gnl|my_center|LOCUS_16920 232741 233517 gene locus_tag LOCUS_16930 232741 233517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_16930 233514 235340 gene locus_tag LOCUS_16940 233514 235340 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930188.1 protein_id gnl|my_center|LOCUS_16940 235337 236233 gene locus_tag LOCUS_16950 235337 236233 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_16950 236233 237339 gene locus_tag LOCUS_16960 236233 237339 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_16960 237358 238638 gene locus_tag LOCUS_16970 237358 238638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228794.1 protein_id gnl|my_center|LOCUS_16970 238710 239954 gene locus_tag LOCUS_16980 238710 239954 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_16980 240269 241006 gene locus_tag LOCUS_16990 240269 241006 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_16990 241614 241063 gene locus_tag LOCUS_17000 241614 241063 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_17000 241615 242886 gene locus_tag LOCUS_17010 gene cobA 241615 242886 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226827.1 protein_id gnl|my_center|LOCUS_17010 244821 242944 gene locus_tag LOCUS_17020 244821 242944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 246061 245048 gene locus_tag LOCUS_17030 246061 245048 CDS product RIO kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223947.1 protein_id gnl|my_center|LOCUS_17030 246634 246284 gene locus_tag LOCUS_17040 246634 246284 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 protein_id gnl|my_center|LOCUS_17040 246674 247657 gene locus_tag LOCUS_17050 gene mtnA 246674 247657 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228779.1 protein_id gnl|my_center|LOCUS_17050 247724 249472 gene locus_tag LOCUS_17060 247724 249472 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_17060 250059 249469 gene locus_tag LOCUS_17070 250059 249469 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_17070 250127 251323 gene locus_tag LOCUS_17080 250127 251323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112960.1 protein_id gnl|my_center|LOCUS_17080 251944 251249 gene locus_tag LOCUS_17090 251944 251249 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223969.1 protein_id gnl|my_center|LOCUS_17090 252057 253109 gene locus_tag LOCUS_17100 252057 253109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742186.1 protein_id gnl|my_center|LOCUS_17100 253517 253098 gene locus_tag LOCUS_17110 253517 253098 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_17110 253532 254560 gene locus_tag LOCUS_17120 253532 254560 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_17120 254752 255363 gene locus_tag LOCUS_17130 254752 255363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033262539.1 protein_id gnl|my_center|LOCUS_17130 255832 255368 gene locus_tag LOCUS_17140 255832 255368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 256311 255829 gene locus_tag LOCUS_17150 256311 255829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 256423 257001 gene locus_tag LOCUS_17160 gene rimP 256423 257001 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_17160 256998 258056 gene locus_tag LOCUS_17170 gene nusA 256998 258056 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228123.1 protein_id gnl|my_center|LOCUS_17170 258175 258462 gene locus_tag LOCUS_17180 258175 258462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17180 >Feature sequence05 125 907 gene locus_tag LOCUS_17190 125 907 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_17190 904 1785 gene locus_tag LOCUS_17200 904 1785 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226420.1 protein_id gnl|my_center|LOCUS_17200 1788 3503 gene locus_tag LOCUS_17210 gene gcl 1788 3503 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_17210 3683 5089 gene locus_tag LOCUS_17220 3683 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6041 5094 gene locus_tag LOCUS_17230 6041 5094 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228718.1 protein_id gnl|my_center|LOCUS_17230 6850 6032 gene locus_tag LOCUS_17240 6850 6032 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227428.1 protein_id gnl|my_center|LOCUS_17240 6920 7639 gene locus_tag LOCUS_17250 6920 7639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_17250 9298 7688 gene locus_tag LOCUS_17260 9298 7688 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228685.1 protein_id gnl|my_center|LOCUS_17260 10196 9303 gene locus_tag LOCUS_17270 10196 9303 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228684.1 protein_id gnl|my_center|LOCUS_17270 11136 10198 gene locus_tag LOCUS_17280 11136 10198 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_17280 12570 11197 gene locus_tag LOCUS_17290 12570 11197 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_17290 14207 13185 gene locus_tag LOCUS_17300 14207 13185 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_17300 14805 14218 gene locus_tag LOCUS_17310 14805 14218 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_17310 14701 14991 gene locus_tag LOCUS_17320 14701 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 14982 15239 gene locus_tag LOCUS_17330 14982 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 15314 16267 gene locus_tag LOCUS_17340 15314 16267 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286213.1 protein_id gnl|my_center|LOCUS_17340 17688 16891 gene locus_tag LOCUS_17350 17688 16891 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 protein_id gnl|my_center|LOCUS_17350 18113 17685 gene locus_tag LOCUS_17360 gene rsbW 18113 17685 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893193.1 protein_id gnl|my_center|LOCUS_17360 18278 18571 gene locus_tag LOCUS_17370 18278 18571 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223741.1 protein_id gnl|my_center|LOCUS_17370 18928 18599 gene locus_tag LOCUS_17380 18928 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227035.1 protein_id gnl|my_center|LOCUS_17380 20305 18983 gene locus_tag LOCUS_17390 20305 18983 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286026.1 protein_id gnl|my_center|LOCUS_17390 20601 21041 gene locus_tag LOCUS_17400 20601 21041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 21263 21045 gene locus_tag LOCUS_17410 21263 21045 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224868.1 protein_id gnl|my_center|LOCUS_17410 21970 21317 gene locus_tag LOCUS_17420 21970 21317 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030189071.1 protein_id gnl|my_center|LOCUS_17420 23133 21958 gene locus_tag LOCUS_17430 23133 21958 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_17430 23217 23957 gene locus_tag LOCUS_17440 23217 23957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_17440 23954 26431 gene locus_tag LOCUS_17450 23954 26431 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167338154.1 protein_id gnl|my_center|LOCUS_17450 26516 27733 gene locus_tag LOCUS_17460 26516 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 27924 27718 gene locus_tag LOCUS_17470 27924 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 28791 28027 gene locus_tag LOCUS_17480 28791 28027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 29558 28788 gene locus_tag LOCUS_17490 29558 28788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748363.1 protein_id gnl|my_center|LOCUS_17490 30336 29551 gene locus_tag LOCUS_17500 30336 29551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_17500 30974 30333 gene locus_tag LOCUS_17510 30974 30333 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984067.1 protein_id gnl|my_center|LOCUS_17510 31950 30985 gene locus_tag LOCUS_17520 31950 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 32123 32797 gene locus_tag LOCUS_17530 32123 32797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 32797 33624 gene locus_tag LOCUS_17540 32797 33624 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_17540 33617 35932 gene locus_tag LOCUS_17550 33617 35932 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_17550 34513 34427 gene locus_tag LOCUS_t00200 34513 34427 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35929 36393 gene locus_tag LOCUS_17560 gene cutC 35929 36393 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_17560 36390 37124 gene locus_tag LOCUS_17570 36390 37124 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577540.1 protein_id gnl|my_center|LOCUS_17570 37121 38557 gene locus_tag LOCUS_17580 37121 38557 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_17580 38570 39343 gene locus_tag LOCUS_17590 38570 39343 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_17590 39340 39993 gene locus_tag LOCUS_17600 39340 39993 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_17600 39977 41152 gene locus_tag LOCUS_17610 39977 41152 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087567.1 protein_id gnl|my_center|LOCUS_17610 41696 41157 gene locus_tag LOCUS_17620 41696 41157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229278.1 protein_id gnl|my_center|LOCUS_17620 41751 42161 gene locus_tag LOCUS_17630 41751 42161 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_17630 42388 43758 gene locus_tag LOCUS_17640 42388 43758 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_17640 43755 44759 gene locus_tag LOCUS_17650 43755 44759 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_17650 46460 44922 gene locus_tag LOCUS_17660 46460 44922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225000.1 protein_id gnl|my_center|LOCUS_17660 46929 46489 gene locus_tag LOCUS_17670 46929 46489 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_17670 48334 46901 gene locus_tag LOCUS_17680 48334 46901 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530004.1 protein_id gnl|my_center|LOCUS_17680 49077 48397 gene locus_tag LOCUS_17690 49077 48397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 49748 49092 gene locus_tag LOCUS_17700 49748 49092 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084494.1 protein_id gnl|my_center|LOCUS_17700 50416 49748 gene locus_tag LOCUS_17710 50416 49748 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766150.1 protein_id gnl|my_center|LOCUS_17710 51320 50421 gene locus_tag LOCUS_17720 51320 50421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 52072 51335 gene locus_tag LOCUS_17730 52072 51335 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_17730 53289 52069 gene locus_tag LOCUS_17740 53289 52069 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223912.1 protein_id gnl|my_center|LOCUS_17740 55917 53353 gene locus_tag LOCUS_17750 55917 53353 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_17750 56235 56888 gene locus_tag LOCUS_17760 56235 56888 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_17760 57508 56927 gene locus_tag LOCUS_17770 57508 56927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 58310 57534 gene locus_tag LOCUS_17780 58310 57534 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223219.1 protein_id gnl|my_center|LOCUS_17780 60577 58310 gene locus_tag LOCUS_17790 60577 58310 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_17790 60638 61429 gene locus_tag LOCUS_17800 60638 61429 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223221.1 protein_id gnl|my_center|LOCUS_17800 62096 61380 gene locus_tag LOCUS_17810 62096 61380 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_17810 62252 62443 gene locus_tag LOCUS_17820 62252 62443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 62498 64021 gene locus_tag LOCUS_17830 62498 64021 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230541.1 protein_id gnl|my_center|LOCUS_17830 64194 65132 gene locus_tag LOCUS_17840 64194 65132 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_17840 66145 65135 gene locus_tag LOCUS_17850 66145 65135 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226390.1 protein_id gnl|my_center|LOCUS_17850 66738 66172 gene locus_tag LOCUS_17860 66738 66172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 67604 66735 gene locus_tag LOCUS_17870 67604 66735 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226393.1 protein_id gnl|my_center|LOCUS_17870 67898 69643 gene locus_tag LOCUS_17880 67898 69643 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_17880 70678 69710 gene locus_tag LOCUS_17890 70678 69710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 70823 72913 gene locus_tag LOCUS_17900 70823 72913 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203995958.1 protein_id gnl|my_center|LOCUS_17900 73571 72957 gene locus_tag LOCUS_17910 73571 72957 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226988.1 protein_id gnl|my_center|LOCUS_17910 73838 73581 gene locus_tag LOCUS_17920 73838 73581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 74696 73866 gene locus_tag LOCUS_17930 74696 73866 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_17930 75472 74822 gene locus_tag LOCUS_17940 gene phoU 75472 74822 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_17940 75849 75604 gene locus_tag LOCUS_17950 75849 75604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 76503 75931 gene locus_tag LOCUS_17960 76503 75931 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229223.1 protein_id gnl|my_center|LOCUS_17960 77789 76806 gene locus_tag LOCUS_17970 77789 76806 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_17970 78040 81057 gene locus_tag LOCUS_17980 78040 81057 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_17980 81433 81020 gene locus_tag LOCUS_17990 gene crcB 81433 81020 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_17990 81888 81430 gene locus_tag LOCUS_18000 81888 81430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 82373 82008 gene locus_tag LOCUS_18010 82373 82008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 83237 82422 gene locus_tag LOCUS_18020 83237 82422 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_18020 83827 83234 gene locus_tag LOCUS_18030 83827 83234 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 protein_id gnl|my_center|LOCUS_18030 84294 83860 gene locus_tag LOCUS_18040 84294 83860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 84462 85688 gene locus_tag LOCUS_18050 84462 85688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143229435.1 protein_id gnl|my_center|LOCUS_18050 85830 87530 gene locus_tag LOCUS_18060 gene aspT 85830 87530 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_18060 87565 89265 gene locus_tag LOCUS_18070 gene aspD 87565 89265 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948813.1 protein_id gnl|my_center|LOCUS_18070 89270 90949 gene locus_tag LOCUS_18080 gene aspT 89270 90949 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068377.1 protein_id gnl|my_center|LOCUS_18080 90960 92267 gene locus_tag LOCUS_18090 90960 92267 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072408.1 protein_id gnl|my_center|LOCUS_18090 92333 92962 gene locus_tag LOCUS_18100 92333 92962 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_18100 93067 93570 gene locus_tag LOCUS_18110 93067 93570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 93668 94723 gene locus_tag LOCUS_18120 93668 94723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 97859 94878 gene locus_tag LOCUS_18130 97859 94878 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223918.1 protein_id gnl|my_center|LOCUS_18130 98793 98098 gene locus_tag LOCUS_18140 98793 98098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 98955 98881 gene locus_tag LOCUS_t00210 98955 98881 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 98929 100683 gene locus_tag LOCUS_18150 98929 100683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_18150 100744 101655 gene locus_tag LOCUS_18160 100744 101655 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229548.1 protein_id gnl|my_center|LOCUS_18160 102357 101656 gene locus_tag LOCUS_18170 102357 101656 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_18170 103238 102354 gene locus_tag LOCUS_18180 103238 102354 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 protein_id gnl|my_center|LOCUS_18180 103787 103374 gene locus_tag LOCUS_18190 103787 103374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 103897 104163 gene locus_tag LOCUS_18200 103897 104163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 104160 105824 gene locus_tag LOCUS_18210 gene argS 104160 105824 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229544.1 protein_id gnl|my_center|LOCUS_18210 105829 107265 gene locus_tag LOCUS_18220 gene lysA 105829 107265 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229543.1 protein_id gnl|my_center|LOCUS_18220 107262 108548 gene locus_tag LOCUS_18230 107262 108548 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_18230 108545 109621 gene locus_tag LOCUS_18240 gene thrC 108545 109621 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229541.1 protein_id gnl|my_center|LOCUS_18240 109618 110532 gene locus_tag LOCUS_18250 gene thrB 109618 110532 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229540.1 protein_id gnl|my_center|LOCUS_18250 110918 112954 gene locus_tag LOCUS_18260 110918 112954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 113325 112960 gene locus_tag LOCUS_18270 113325 112960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 113603 113821 gene locus_tag LOCUS_18280 gene rpmE 113603 113821 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229538.1 protein_id gnl|my_center|LOCUS_18280 113917 114990 gene locus_tag LOCUS_18290 gene prfA 113917 114990 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229537.1 protein_id gnl|my_center|LOCUS_18290 114992 115885 gene locus_tag LOCUS_18300 gene prmC 114992 115885 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 protein_id gnl|my_center|LOCUS_18300 116454 115891 gene locus_tag LOCUS_18310 116454 115891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094004567.1 protein_id gnl|my_center|LOCUS_18310 116339 116623 gene locus_tag LOCUS_18320 116339 116623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 116599 117420 gene locus_tag LOCUS_18330 116599 117420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 117432 118082 gene locus_tag LOCUS_18340 117432 118082 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229531.1 protein_id gnl|my_center|LOCUS_18340 118082 118522 gene locus_tag LOCUS_18350 118082 118522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 118605 119894 gene locus_tag LOCUS_18360 118605 119894 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_18360 119891 121036 gene locus_tag LOCUS_18370 119891 121036 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229530.1 protein_id gnl|my_center|LOCUS_18370 121033 121515 gene locus_tag LOCUS_18380 121033 121515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229529.1 protein_id gnl|my_center|LOCUS_18380 121758 122540 gene locus_tag LOCUS_18390 gene atpB 121758 122540 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229528.1 protein_id gnl|my_center|LOCUS_18390 122627 122875 gene locus_tag LOCUS_18400 122627 122875 CDS product F-type H+-transporting ATPase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229527.1 protein_id gnl|my_center|LOCUS_18400 122904 123452 gene locus_tag LOCUS_18410 122904 123452 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_18410 123462 124358 gene locus_tag LOCUS_18420 123462 124358 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229525.1 protein_id gnl|my_center|LOCUS_18420 124412 126049 gene locus_tag LOCUS_18430 gene atpA 124412 126049 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229524.1 protein_id gnl|my_center|LOCUS_18430 126066 127019 gene locus_tag LOCUS_18440 126066 127019 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_18440 127019 128443 gene locus_tag LOCUS_18450 gene atpD 127019 128443 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229522.1 protein_id gnl|my_center|LOCUS_18450 129831 128512 gene locus_tag LOCUS_18460 129831 128512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 130339 129818 gene locus_tag LOCUS_18470 130339 129818 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_18470 130459 130821 gene locus_tag LOCUS_18480 130459 130821 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_18480 130841 131284 gene locus_tag LOCUS_18490 130841 131284 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229520.1 protein_id gnl|my_center|LOCUS_18490 131888 131298 gene locus_tag LOCUS_18500 131888 131298 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229518.1 protein_id gnl|my_center|LOCUS_18500 133891 132935 gene locus_tag LOCUS_18510 133891 132935 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_18510 134078 135295 gene locus_tag LOCUS_18520 gene murA 134078 135295 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229517.1 protein_id gnl|my_center|LOCUS_18520 135394 137235 gene locus_tag LOCUS_18530 gene ggt 135394 137235 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_18530 137904 137239 gene locus_tag LOCUS_18540 137904 137239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 138068 139225 gene locus_tag LOCUS_18550 138068 139225 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976445.1 protein_id gnl|my_center|LOCUS_18550 139216 139860 gene locus_tag LOCUS_18560 139216 139860 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326115.1 protein_id gnl|my_center|LOCUS_18560 140481 139882 gene locus_tag LOCUS_18570 140481 139882 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_18570 140865 140581 gene locus_tag LOCUS_18580 140865 140581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 140962 142974 gene locus_tag LOCUS_18590 140962 142974 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840716.1 protein_id gnl|my_center|LOCUS_18590 143447 144343 gene locus_tag LOCUS_18600 gene ehuB 143447 144343 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975972.1 protein_id gnl|my_center|LOCUS_18600 144356 145138 gene locus_tag LOCUS_18610 gene ehuC 144356 145138 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525889.1 protein_id gnl|my_center|LOCUS_18610 145135 145794 gene locus_tag LOCUS_18620 gene ehuD 145135 145794 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530329.1 protein_id gnl|my_center|LOCUS_18620 145796 146560 gene locus_tag LOCUS_18630 gene ehuA 145796 146560 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896768.1 protein_id gnl|my_center|LOCUS_18630 146579 147346 gene locus_tag LOCUS_18640 146579 147346 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229505.1 protein_id gnl|my_center|LOCUS_18640 147378 148037 gene locus_tag LOCUS_18650 gene nucS 147378 148037 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467679.1 protein_id gnl|my_center|LOCUS_18650 148668 148042 gene locus_tag LOCUS_18660 148668 148042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 148779 149759 gene locus_tag LOCUS_18670 148779 149759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 149858 151636 gene locus_tag LOCUS_18680 149858 151636 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229492.1 protein_id gnl|my_center|LOCUS_18680 151914 151672 gene locus_tag LOCUS_18690 151914 151672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 151929 152237 gene locus_tag LOCUS_18700 151929 152237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229480.1 protein_id gnl|my_center|LOCUS_18700 152380 152673 gene locus_tag LOCUS_18710 152380 152673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 153755 152703 gene locus_tag LOCUS_18720 gene hisC 153755 152703 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222222.1 protein_id gnl|my_center|LOCUS_18720 153793 154548 gene locus_tag LOCUS_18730 153793 154548 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229478.1 protein_id gnl|my_center|LOCUS_18730 154575 155027 gene locus_tag LOCUS_18740 154575 155027 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284441.1 protein_id gnl|my_center|LOCUS_18740 155150 156133 gene locus_tag LOCUS_18750 155150 156133 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223470.1 protein_id gnl|my_center|LOCUS_18750 156152 156595 gene locus_tag LOCUS_18760 156152 156595 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224765.1 protein_id gnl|my_center|LOCUS_18760 158492 157428 gene locus_tag LOCUS_18770 158492 157428 CDS product chromosome segregation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306094.1 protein_id gnl|my_center|LOCUS_18770 159880 158549 gene locus_tag LOCUS_18780 gene ccrA 159880 158549 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_18780 160020 160406 gene locus_tag LOCUS_18790 160020 160406 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831581.1 protein_id gnl|my_center|LOCUS_18790 160521 161132 gene locus_tag LOCUS_18800 160521 161132 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223475.1 protein_id gnl|my_center|LOCUS_18800 162116 161673 gene locus_tag LOCUS_18810 gene mce 162116 161673 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_18810 162242 163414 gene locus_tag LOCUS_18820 162242 163414 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223477.1 protein_id gnl|my_center|LOCUS_18820 163407 164360 gene locus_tag LOCUS_18830 gene meaB 163407 164360 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223478.1 protein_id gnl|my_center|LOCUS_18830 164846 165325 gene locus_tag LOCUS_18840 164846 165325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 166539 165517 gene locus_tag LOCUS_18850 166539 165517 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_18850 167603 166536 gene locus_tag LOCUS_18860 167603 166536 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223494.1 protein_id gnl|my_center|LOCUS_18860 168708 167725 gene locus_tag LOCUS_18870 gene pip 168708 167725 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_18870 168773 169660 gene locus_tag LOCUS_18880 168773 169660 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_18880 169657 170703 gene locus_tag LOCUS_18890 169657 170703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 171253 170750 gene locus_tag LOCUS_18900 171253 170750 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223498.1 protein_id gnl|my_center|LOCUS_18900 171450 171265 gene locus_tag LOCUS_18910 171450 171265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 171413 171628 gene locus_tag LOCUS_18920 171413 171628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 171688 172632 gene locus_tag LOCUS_18930 171688 172632 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_18930 174111 172657 gene locus_tag LOCUS_18940 174111 172657 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_18940 173999 174265 gene locus_tag LOCUS_18950 173999 174265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 175602 174199 gene locus_tag LOCUS_18960 175602 174199 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284439.1 protein_id gnl|my_center|LOCUS_18960 177855 175663 gene locus_tag LOCUS_18970 gene glgB 177855 175663 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_18970 178766 178359 gene locus_tag LOCUS_18980 178766 178359 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_18980 179020 178730 gene locus_tag LOCUS_18990 179020 178730 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864957.1 protein_id gnl|my_center|LOCUS_18990 179497 179060 gene locus_tag LOCUS_19000 179497 179060 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_19000 180878 179565 gene locus_tag LOCUS_19010 180878 179565 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_19010 182758 180875 gene locus_tag LOCUS_19020 gene treS 182758 180875 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224468.1 protein_id gnl|my_center|LOCUS_19020 183856 182918 gene locus_tag LOCUS_19030 183856 182918 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_19030 186405 184438 gene locus_tag LOCUS_19040 186405 184438 CDS product DUF3416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224467.1 protein_id gnl|my_center|LOCUS_19040 186556 189102 gene locus_tag LOCUS_19050 gene glgP 186556 189102 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223503.1 protein_id gnl|my_center|LOCUS_19050 191227 189119 gene locus_tag LOCUS_19060 gene glgX 191227 189119 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224466.1 protein_id gnl|my_center|LOCUS_19060 191312 192130 gene locus_tag LOCUS_19070 191312 192130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_19070 192173 192952 gene locus_tag LOCUS_19080 192173 192952 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_19080 192972 193922 gene locus_tag LOCUS_19090 192972 193922 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223513.1 protein_id gnl|my_center|LOCUS_19090 193826 195082 gene locus_tag LOCUS_19100 193826 195082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223514.1 protein_id gnl|my_center|LOCUS_19100 196038 195079 gene locus_tag LOCUS_19110 196038 195079 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223529.1 protein_id gnl|my_center|LOCUS_19110 196117 196863 gene locus_tag LOCUS_19120 196117 196863 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223530.1 protein_id gnl|my_center|LOCUS_19120 196873 197472 gene locus_tag LOCUS_19130 196873 197472 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_19130 197465 198178 gene locus_tag LOCUS_19140 197465 198178 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_19140 198175 198480 gene locus_tag LOCUS_19150 198175 198480 CDS product DUF6510 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729807.1 protein_id gnl|my_center|LOCUS_19150 198755 198450 gene locus_tag LOCUS_19160 198755 198450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 200125 198860 gene locus_tag LOCUS_19170 200125 198860 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223543.1 protein_id gnl|my_center|LOCUS_19170 201627 200122 gene locus_tag LOCUS_19180 201627 200122 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223546.1 protein_id gnl|my_center|LOCUS_19180 202391 201624 gene locus_tag LOCUS_19190 202391 201624 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466697.1 protein_id gnl|my_center|LOCUS_19190 203262 202423 gene locus_tag LOCUS_19200 203262 202423 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223549.1 protein_id gnl|my_center|LOCUS_19200 203476 204261 gene locus_tag LOCUS_19210 203476 204261 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_19210 204276 205241 gene locus_tag LOCUS_19220 204276 205241 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_19220 205305 206084 gene locus_tag LOCUS_19230 205305 206084 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223552.1 protein_id gnl|my_center|LOCUS_19230 206081 206956 gene locus_tag LOCUS_19240 206081 206956 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223553.1 protein_id gnl|my_center|LOCUS_19240 207083 208309 gene locus_tag LOCUS_19250 207083 208309 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_19250 208404 209492 gene locus_tag LOCUS_19260 gene mnmA 208404 209492 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223558.1 protein_id gnl|my_center|LOCUS_19260 209659 210324 gene locus_tag LOCUS_19270 209659 210324 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413441.1 protein_id gnl|my_center|LOCUS_19270 210321 210812 gene locus_tag LOCUS_19280 210321 210812 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_19280 210809 211228 gene locus_tag LOCUS_19290 210809 211228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 211225 212115 gene locus_tag LOCUS_19300 211225 212115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 212130 212555 gene locus_tag LOCUS_19310 212130 212555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 212580 214136 gene locus_tag LOCUS_19320 212580 214136 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_19320 214375 215697 gene locus_tag LOCUS_19330 214375 215697 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027286.1 protein_id gnl|my_center|LOCUS_19330 216783 215761 gene locus_tag LOCUS_19340 216783 215761 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 protein_id gnl|my_center|LOCUS_19340 217466 216780 gene locus_tag LOCUS_19350 217466 216780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_19350 217613 218779 gene locus_tag LOCUS_19360 217613 218779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 218772 219404 gene locus_tag LOCUS_19370 218772 219404 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_19370 220242 219319 gene locus_tag LOCUS_19380 220242 219319 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_19380 219637 219557 gene locus_tag LOCUS_t00220 219637 219557 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 220439 221329 gene locus_tag LOCUS_19390 220439 221329 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160805.1 protein_id gnl|my_center|LOCUS_19390 222245 221340 gene locus_tag LOCUS_19400 222245 221340 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_19400 222278 223540 gene locus_tag LOCUS_19410 222278 223540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730421.1 protein_id gnl|my_center|LOCUS_19410 223610 223996 gene locus_tag LOCUS_19420 223610 223996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 223999 225069 gene locus_tag LOCUS_19430 223999 225069 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284403.1 protein_id gnl|my_center|LOCUS_19430 225123 225809 gene locus_tag LOCUS_19440 225123 225809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223565.1 protein_id gnl|my_center|LOCUS_19440 225819 227942 gene locus_tag LOCUS_19450 gene ligA 225819 227942 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223566.1 protein_id gnl|my_center|LOCUS_19450 227935 228429 gene locus_tag LOCUS_19460 227935 228429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_19460 228498 229283 gene locus_tag LOCUS_19470 228498 229283 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223919.1 protein_id gnl|my_center|LOCUS_19470 229294 232476 gene locus_tag LOCUS_19480 229294 232476 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225961.1 protein_id gnl|my_center|LOCUS_19480 233224 232451 gene locus_tag LOCUS_19490 233224 232451 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_19490 233874 233221 gene locus_tag LOCUS_19500 233874 233221 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284416.1 protein_id gnl|my_center|LOCUS_19500 234073 234372 gene locus_tag LOCUS_19510 gene gatC 234073 234372 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_19510 234369 235886 gene locus_tag LOCUS_19520 gene gatA 234369 235886 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223570.1 protein_id gnl|my_center|LOCUS_19520 235883 237391 gene locus_tag LOCUS_19530 gene gatB 235883 237391 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223571.1 protein_id gnl|my_center|LOCUS_19530 237419 240421 gene locus_tag LOCUS_19540 237419 240421 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229747.1 protein_id gnl|my_center|LOCUS_19540 240941 240414 gene locus_tag LOCUS_19550 240941 240414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 242272 241112 gene locus_tag LOCUS_19560 242272 241112 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223577.1 protein_id gnl|my_center|LOCUS_19560 242349 243251 gene locus_tag LOCUS_19570 242349 243251 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466703.1 protein_id gnl|my_center|LOCUS_19570 243214 244020 gene locus_tag LOCUS_19580 243214 244020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 244043 245275 gene locus_tag LOCUS_19590 gene hemW 244043 245275 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_19590 245946 246347 gene locus_tag LOCUS_19600 245946 246347 CDS product PGPGW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223206.1 protein_id gnl|my_center|LOCUS_19600 247136 246921 gene locus_tag LOCUS_19610 247136 246921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 248419 247142 gene locus_tag LOCUS_19620 gene hisS 248419 247142 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence06 <1 735 gene locus_tag LOCUS_19630 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230631.1:DNA polymerase III subunit gamma and tau 1395 760 gene locus_tag LOCUS_19640 1395 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1277 1957 gene locus_tag LOCUS_19650 1277 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1962 2558 gene locus_tag LOCUS_19660 gene recR 1962 2558 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230626.1 protein_id gnl|my_center|LOCUS_19660 2555 3097 gene locus_tag LOCUS_19670 2555 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3191 4870 gene locus_tag LOCUS_19680 3191 4870 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_19680 4893 5912 gene locus_tag LOCUS_19690 4893 5912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_19690 5909 6835 gene locus_tag LOCUS_19700 5909 6835 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_19700 6842 7852 gene locus_tag LOCUS_19710 6842 7852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_19710 7849 8958 gene locus_tag LOCUS_19720 7849 8958 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_19720 11022 9217 gene locus_tag LOCUS_19730 gene leuA 11022 9217 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_19730 11247 11567 gene locus_tag LOCUS_19740 11247 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11599 13089 gene locus_tag LOCUS_19750 11599 13089 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225243.1 protein_id gnl|my_center|LOCUS_19750 13672 13070 gene locus_tag LOCUS_19760 13672 13070 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_19760 13717 14862 gene locus_tag LOCUS_19770 13717 14862 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_19770 14859 15509 gene locus_tag LOCUS_19780 14859 15509 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_19780 15506 16330 gene locus_tag LOCUS_19790 15506 16330 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 protein_id gnl|my_center|LOCUS_19790 17220 16636 gene locus_tag LOCUS_19800 17220 16636 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086849840.1 protein_id gnl|my_center|LOCUS_19800 18461 17226 gene locus_tag LOCUS_19810 18461 17226 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_19810 18603 19868 gene locus_tag LOCUS_19820 18603 19868 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_19820 19868 20929 gene locus_tag LOCUS_19830 19868 20929 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_19830 21071 21144 gene locus_tag LOCUS_t00230 21071 21144 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22221 21748 gene locus_tag LOCUS_19840 22221 21748 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_19840 22304 22774 gene locus_tag LOCUS_19850 22304 22774 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094660.1 protein_id gnl|my_center|LOCUS_19850 23998 22814 gene locus_tag LOCUS_19860 23998 22814 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230592.1 protein_id gnl|my_center|LOCUS_19860 25174 24077 gene locus_tag LOCUS_19870 25174 24077 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230588.1 protein_id gnl|my_center|LOCUS_19870 25638 25222 gene locus_tag LOCUS_19880 25638 25222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 25707 26264 gene locus_tag LOCUS_19890 25707 26264 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_19890 26292 26768 gene locus_tag LOCUS_19900 26292 26768 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230585.1 protein_id gnl|my_center|LOCUS_19900 28649 26808 gene locus_tag LOCUS_19910 28649 26808 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230572.1 protein_id gnl|my_center|LOCUS_19910 29215 28646 gene locus_tag LOCUS_19920 29215 28646 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_19920 29261 30253 gene locus_tag LOCUS_19930 29261 30253 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023559.1 protein_id gnl|my_center|LOCUS_19930 30601 30897 gene locus_tag LOCUS_19940 30601 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 31057 31347 gene locus_tag LOCUS_19950 31057 31347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 31674 32121 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccccgcgctcgcggggacgac 32527 33723 gene locus_tag LOCUS_19960 32527 33723 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_19960 34057 34656 gene locus_tag LOCUS_19970 34057 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 34638 34967 gene locus_tag LOCUS_19980 34638 34967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19980 35150 35074 gene locus_tag LOCUS_t00240 35150 35074 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36123 35167 gene locus_tag LOCUS_19990 36123 35167 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467832.1 protein_id gnl|my_center|LOCUS_19990 36190 36660 gene locus_tag LOCUS_20000 36190 36660 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_20000 39229 36722 gene locus_tag LOCUS_20010 39229 36722 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319019.1 protein_id gnl|my_center|LOCUS_20010 39494 39799 gene locus_tag LOCUS_20020 39494 39799 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230567.1 protein_id gnl|my_center|LOCUS_20020 40968 39844 gene locus_tag LOCUS_20030 40968 39844 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_20030 41990 40965 gene locus_tag LOCUS_20040 41990 40965 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230565.1 protein_id gnl|my_center|LOCUS_20040 42359 42015 gene locus_tag LOCUS_20050 42359 42015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 42310 42465 gene locus_tag LOCUS_20060 42310 42465 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003068074.1 protein_id gnl|my_center|LOCUS_20060 42470 42925 gene locus_tag LOCUS_20070 42470 42925 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_20070 42950 43567 gene locus_tag LOCUS_20080 42950 43567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230562.1 protein_id gnl|my_center|LOCUS_20080 43658 45742 gene locus_tag LOCUS_20090 43658 45742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 46649 45759 gene locus_tag LOCUS_20100 46649 45759 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230738.1 protein_id gnl|my_center|LOCUS_20100 46698 47555 gene locus_tag LOCUS_20110 46698 47555 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_20110 47552 48325 gene locus_tag LOCUS_20120 47552 48325 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230559.1 protein_id gnl|my_center|LOCUS_20120 49435 48329 gene locus_tag LOCUS_20130 49435 48329 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230553.1 protein_id gnl|my_center|LOCUS_20130 50752 49475 gene locus_tag LOCUS_20140 50752 49475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230552.1 protein_id gnl|my_center|LOCUS_20140 51739 51065 gene locus_tag LOCUS_20150 51739 51065 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081747.1 protein_id gnl|my_center|LOCUS_20150 52163 51885 gene locus_tag LOCUS_20160 52163 51885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230551.1 protein_id gnl|my_center|LOCUS_20160 52322 53065 gene locus_tag LOCUS_20170 gene nth 52322 53065 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_20170 53062 53649 gene locus_tag LOCUS_20180 53062 53649 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230549.1 protein_id gnl|my_center|LOCUS_20180 53646 54341 gene locus_tag LOCUS_20190 53646 54341 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230548.1 protein_id gnl|my_center|LOCUS_20190 54338 55522 gene locus_tag LOCUS_20200 54338 55522 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_20200 56600 55659 gene locus_tag LOCUS_20210 56600 55659 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230544.1 protein_id gnl|my_center|LOCUS_20210 57155 56628 gene locus_tag LOCUS_20220 57155 56628 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230543.1 protein_id gnl|my_center|LOCUS_20220 57921 57211 gene locus_tag LOCUS_20230 57921 57211 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 protein_id gnl|my_center|LOCUS_20230 59927 57942 gene locus_tag LOCUS_20240 gene acs 59927 57942 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230537.1 protein_id gnl|my_center|LOCUS_20240 60075 60809 gene locus_tag LOCUS_20250 60075 60809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_20250 61014 61832 gene locus_tag LOCUS_20260 61014 61832 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_20260 63059 62133 gene locus_tag LOCUS_20270 63059 62133 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230532.1 protein_id gnl|my_center|LOCUS_20270 63999 63082 gene locus_tag LOCUS_20280 63999 63082 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_20280 65958 64177 gene locus_tag LOCUS_20290 65958 64177 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230530.1 protein_id gnl|my_center|LOCUS_20290 67240 65975 gene locus_tag LOCUS_20300 67240 65975 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_20300 69009 67243 gene locus_tag LOCUS_20310 69009 67243 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230528.1 protein_id gnl|my_center|LOCUS_20310 68912 69124 gene locus_tag LOCUS_20320 68912 69124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 70557 69697 gene locus_tag LOCUS_20330 70557 69697 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731091.1 protein_id gnl|my_center|LOCUS_20330 70966 72060 gene locus_tag LOCUS_20340 70966 72060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230526.1 protein_id gnl|my_center|LOCUS_20340 72057 73124 gene locus_tag LOCUS_20350 72057 73124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20350 73121 73993 gene locus_tag LOCUS_20360 73121 73993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 74092 74436 gene locus_tag LOCUS_20370 74092 74436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 74756 75121 gene locus_tag LOCUS_20380 74756 75121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 75250 77118 gene locus_tag LOCUS_20390 75250 77118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 77392 77607 gene locus_tag LOCUS_20400 77392 77607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 77600 77857 gene locus_tag LOCUS_20410 77600 77857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 78099 78386 gene locus_tag LOCUS_20420 78099 78386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 78526 78990 gene locus_tag LOCUS_20430 78526 78990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 78881 80563 gene locus_tag LOCUS_20440 78881 80563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 80596 80946 gene locus_tag LOCUS_20450 80596 80946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 81050 84112 gene locus_tag LOCUS_20460 81050 84112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 84155 84502 gene locus_tag LOCUS_20470 84155 84502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 84506 84826 gene locus_tag LOCUS_20480 84506 84826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 84839 85456 gene locus_tag LOCUS_20490 84839 85456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 85444 85866 gene locus_tag LOCUS_20500 85444 85866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 85868 86275 gene locus_tag LOCUS_20510 85868 86275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 86288 86629 gene locus_tag LOCUS_20520 86288 86629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 86598 86798 gene locus_tag LOCUS_20530 86598 86798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 86795 87208 gene locus_tag LOCUS_20540 86795 87208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 87205 87429 gene locus_tag LOCUS_20550 87205 87429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 87433 88479 gene locus_tag LOCUS_20560 87433 88479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 88476 91355 gene locus_tag LOCUS_20570 88476 91355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 91365 91826 gene locus_tag LOCUS_20580 91365 91826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 92179 91823 gene locus_tag LOCUS_20590 92179 91823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 92332 93087 gene locus_tag LOCUS_20600 92332 93087 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_20600 93302 93129 gene locus_tag LOCUS_20610 93302 93129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 93565 93299 gene locus_tag LOCUS_20620 93565 93299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 93750 94247 gene locus_tag LOCUS_20630 93750 94247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 94244 95929 gene locus_tag LOCUS_20640 94244 95929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 96095 95868 gene locus_tag LOCUS_20650 96095 95868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 96066 96233 gene locus_tag LOCUS_20660 96066 96233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 96227 97270 gene locus_tag LOCUS_20670 96227 97270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 97325 98017 gene locus_tag LOCUS_20680 97325 98017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 98028 98219 gene locus_tag LOCUS_20690 98028 98219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 98219 98575 gene locus_tag LOCUS_20700 98219 98575 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230521.1 protein_id gnl|my_center|LOCUS_20700 99457 100044 gene locus_tag LOCUS_20710 99457 100044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 100266 100898 gene locus_tag LOCUS_20720 100266 100898 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230520.1 protein_id gnl|my_center|LOCUS_20720 103081 101630 gene locus_tag LOCUS_20730 103081 101630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20730 103037 103414 gene locus_tag LOCUS_20740 103037 103414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 105823 103529 gene locus_tag LOCUS_20750 105823 103529 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113919.1 protein_id gnl|my_center|LOCUS_20750 106124 108418 gene locus_tag LOCUS_20760 106124 108418 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449634.1 protein_id gnl|my_center|LOCUS_20760 108441 109025 gene locus_tag LOCUS_20770 108441 109025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 109118 111403 gene locus_tag LOCUS_20780 109118 111403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 111455 112045 gene locus_tag LOCUS_20790 111455 112045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230516.1 protein_id gnl|my_center|LOCUS_20790 112242 114965 gene locus_tag LOCUS_20800 gene topA 112242 114965 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742226.1 protein_id gnl|my_center|LOCUS_20800 115003 115749 gene locus_tag LOCUS_20810 115003 115749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 115776 117002 gene locus_tag LOCUS_20820 115776 117002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224795.1 protein_id gnl|my_center|LOCUS_20820 117018 117611 gene locus_tag LOCUS_20830 117018 117611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 117719 119812 gene locus_tag LOCUS_20840 117719 119812 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230508.1 protein_id gnl|my_center|LOCUS_20840 120775 120428 gene locus_tag LOCUS_20850 120775 120428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 120666 121592 gene locus_tag LOCUS_20860 120666 121592 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_20860 122140 122382 gene locus_tag LOCUS_20870 122140 122382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 124816 122612 gene locus_tag LOCUS_20880 124816 122612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742225.1 protein_id gnl|my_center|LOCUS_20880 124912 124988 gene locus_tag LOCUS_t00250 124912 124988 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 125191 126048 gene locus_tag LOCUS_20890 125191 126048 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225079.1 protein_id gnl|my_center|LOCUS_20890 126224 127282 gene locus_tag LOCUS_20900 126224 127282 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_20900 128040 127273 gene locus_tag LOCUS_20910 128040 127273 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_20910 128089 128535 gene locus_tag LOCUS_20920 128089 128535 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136699628.1 protein_id gnl|my_center|LOCUS_20920 128581 129834 gene locus_tag LOCUS_20930 128581 129834 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_20930 132017 130452 gene locus_tag LOCUS_20940 132017 130452 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_20940 132197 132757 gene locus_tag LOCUS_20950 132197 132757 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_20950 132758 134365 gene locus_tag LOCUS_20960 132758 134365 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_20960 134922 134425 gene locus_tag LOCUS_20970 134922 134425 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_20970 135000 137648 gene locus_tag LOCUS_20980 135000 137648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 137705 138784 gene locus_tag LOCUS_20990 137705 138784 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230475.1 protein_id gnl|my_center|LOCUS_20990 138781 139713 gene locus_tag LOCUS_21000 gene tilS 138781 139713 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230474.1 protein_id gnl|my_center|LOCUS_21000 139730 140284 gene locus_tag LOCUS_21010 gene hpt 139730 140284 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230473.1 protein_id gnl|my_center|LOCUS_21010 140391 140762 gene locus_tag LOCUS_21020 140391 140762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 140759 141331 gene locus_tag LOCUS_21030 140759 141331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 141351 142724 gene locus_tag LOCUS_21040 141351 142724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 142714 143454 gene locus_tag LOCUS_21050 142714 143454 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230470.1 protein_id gnl|my_center|LOCUS_21050 143663 146023 gene locus_tag LOCUS_21060 gene ftsH 143663 146023 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230468.1 protein_id gnl|my_center|LOCUS_21060 146039 147196 gene locus_tag LOCUS_21070 146039 147196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 147202 148053 gene locus_tag LOCUS_21080 gene folP 147202 148053 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467816.1 protein_id gnl|my_center|LOCUS_21080 148050 148433 gene locus_tag LOCUS_21090 gene folB 148050 148433 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_21090 148430 148927 gene locus_tag LOCUS_21100 gene folK 148430 148927 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230464.1 protein_id gnl|my_center|LOCUS_21100 149456 149935 gene locus_tag LOCUS_21110 149456 149935 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230462.1 protein_id gnl|my_center|LOCUS_21110 149985 152303 gene locus_tag LOCUS_21120 149985 152303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 152382 153539 gene locus_tag LOCUS_21130 152382 153539 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_21130 153619 154521 gene locus_tag LOCUS_21140 153619 154521 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230459.1 protein_id gnl|my_center|LOCUS_21140 154518 155405 gene locus_tag LOCUS_21150 gene panC 154518 155405 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230458.1 protein_id gnl|my_center|LOCUS_21150 155416 155916 gene locus_tag LOCUS_21160 155416 155916 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_21160 155923 156699 gene locus_tag LOCUS_21170 155923 156699 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230456.1 protein_id gnl|my_center|LOCUS_21170 157439 156696 gene locus_tag LOCUS_21180 157439 156696 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831617.1 protein_id gnl|my_center|LOCUS_21180 157617 157781 gene locus_tag LOCUS_21190 157617 157781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 158390 158737 gene locus_tag LOCUS_21200 158390 158737 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_21200 160026 158827 gene locus_tag LOCUS_21210 160026 158827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230812.1 protein_id gnl|my_center|LOCUS_21210 160093 161064 gene locus_tag LOCUS_21220 160093 161064 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_21220 161890 161102 gene locus_tag LOCUS_21230 161890 161102 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230450.1 protein_id gnl|my_center|LOCUS_21230 162278 164767 gene locus_tag LOCUS_21240 162278 164767 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284160.1 protein_id gnl|my_center|LOCUS_21240 164890 165096 gene locus_tag LOCUS_21250 164890 165096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350508.1 protein_id gnl|my_center|LOCUS_21250 165089 166081 gene locus_tag LOCUS_21260 165089 166081 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_21260 167549 166086 gene locus_tag LOCUS_21270 167549 166086 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315510.1 protein_id gnl|my_center|LOCUS_21270 167640 168419 gene locus_tag LOCUS_21280 167640 168419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230426.1 protein_id gnl|my_center|LOCUS_21280 168912 168409 gene locus_tag LOCUS_21290 168912 168409 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730399.1 protein_id gnl|my_center|LOCUS_21290 169995 168985 gene locus_tag LOCUS_21300 169995 168985 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199431534.1 protein_id gnl|my_center|LOCUS_21300 170995 170120 gene locus_tag LOCUS_21310 170995 170120 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230424.1 protein_id gnl|my_center|LOCUS_21310 171504 171013 gene locus_tag LOCUS_21320 171504 171013 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230422.1 protein_id gnl|my_center|LOCUS_21320 173178 172030 gene locus_tag LOCUS_21330 173178 172030 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_21330 173347 174291 gene locus_tag LOCUS_21340 173347 174291 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230420.1 protein_id gnl|my_center|LOCUS_21340 174288 175130 gene locus_tag LOCUS_21350 174288 175130 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_21350 175131 176009 gene locus_tag LOCUS_21360 175131 176009 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230418.1 protein_id gnl|my_center|LOCUS_21360 177171 175972 gene locus_tag LOCUS_21370 177171 175972 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230416.1 protein_id gnl|my_center|LOCUS_21370 177337 180234 gene locus_tag LOCUS_21380 177337 180234 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_21380 180336 180470 gene locus_tag LOCUS_21390 180336 180470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 180491 184417 gene locus_tag LOCUS_21400 180491 184417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 186699 184474 gene locus_tag LOCUS_21410 186699 184474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 187409 186696 gene locus_tag LOCUS_21420 187409 186696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 190768 187610 gene locus_tag LOCUS_21430 190768 187610 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_21430 191022 191837 gene locus_tag LOCUS_21440 191022 191837 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228572.1 protein_id gnl|my_center|LOCUS_21440 191839 192153 gene locus_tag LOCUS_21450 191839 192153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 192620 192228 gene locus_tag LOCUS_21460 192620 192228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 194308 192875 gene locus_tag LOCUS_21470 194308 192875 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230408.1 protein_id gnl|my_center|LOCUS_21470 195354 194398 gene locus_tag LOCUS_21480 gene rlmB 195354 194398 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_21480 196747 195356 gene locus_tag LOCUS_21490 gene cysS 196747 195356 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284151.1 protein_id gnl|my_center|LOCUS_21490 197270 196797 gene locus_tag LOCUS_21500 gene ispF 197270 196797 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230402.1 protein_id gnl|my_center|LOCUS_21500 197809 197267 gene locus_tag LOCUS_21510 197809 197267 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230401.1 protein_id gnl|my_center|LOCUS_21510 198399 197908 gene locus_tag LOCUS_21520 198399 197908 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_21520 198702 199421 gene locus_tag LOCUS_21530 198702 199421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 199457 200836 gene locus_tag LOCUS_21540 gene radA 199457 200836 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230399.1 protein_id gnl|my_center|LOCUS_21540 202299 200833 gene locus_tag LOCUS_21550 202299 200833 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230392.1 protein_id gnl|my_center|LOCUS_21550 203829 202396 gene locus_tag LOCUS_21560 203829 202396 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230391.1 protein_id gnl|my_center|LOCUS_21560 203968 204041 gene locus_tag LOCUS_t00260 203968 204041 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 204821 204117 gene locus_tag LOCUS_21570 204821 204117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 205050 205949 gene locus_tag LOCUS_21580 205050 205949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 206439 206053 gene locus_tag LOCUS_21590 206439 206053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 206642 207010 gene locus_tag LOCUS_21600 206642 207010 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228644.1 protein_id gnl|my_center|LOCUS_21600 207011 208273 gene locus_tag LOCUS_21610 207011 208273 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_21610 208366 209628 gene locus_tag LOCUS_21620 208366 209628 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 protein_id gnl|my_center|LOCUS_21620 210224 209850 gene locus_tag LOCUS_21630 210224 209850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224711.1 protein_id gnl|my_center|LOCUS_21630 210240 210599 gene locus_tag LOCUS_21640 210240 210599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 211767 210607 gene locus_tag LOCUS_21650 211767 210607 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227809.1 protein_id gnl|my_center|LOCUS_21650 211974 214502 gene locus_tag LOCUS_21660 gene otsB 211974 214502 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230393.1 protein_id gnl|my_center|LOCUS_21660 214864 214499 gene locus_tag LOCUS_21670 214864 214499 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence07 1565 3745 gene locus_tag LOCUS_21680 1565 3745 CDS product germacradienol/geosmin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630266.1 protein_id gnl|my_center|LOCUS_21680 3790 4818 gene locus_tag LOCUS_21690 3790 4818 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226051.1 protein_id gnl|my_center|LOCUS_21690 6883 4829 gene locus_tag LOCUS_21700 6883 4829 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_21700 6919 8361 gene locus_tag LOCUS_21710 6919 8361 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_21710 9077 8403 gene locus_tag LOCUS_21720 9077 8403 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223293.1 protein_id gnl|my_center|LOCUS_21720 9325 9951 gene locus_tag LOCUS_21730 9325 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 10450 10710 gene locus_tag LOCUS_21740 10450 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 10880 10967 gene locus_tag LOCUS_t00270 10880 10967 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11532 11032 gene locus_tag LOCUS_21750 11532 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 11854 11941 gene locus_tag LOCUS_t00280 11854 11941 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12571 13296 gene locus_tag LOCUS_21760 12571 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 13293 13727 gene locus_tag LOCUS_21770 13293 13727 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190733.1 protein_id gnl|my_center|LOCUS_21770 14278 13760 gene locus_tag LOCUS_21780 14278 13760 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_21780 15613 14444 gene locus_tag LOCUS_21790 15613 14444 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_21790 16035 15751 gene locus_tag LOCUS_21800 16035 15751 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477090.1 protein_id gnl|my_center|LOCUS_21800 17342 16032 gene locus_tag LOCUS_21810 17342 16032 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091506663.1 protein_id gnl|my_center|LOCUS_21810 17881 17339 gene locus_tag LOCUS_21820 17881 17339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 20305 18128 gene locus_tag LOCUS_21830 20305 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 21361 20309 gene locus_tag LOCUS_21840 21361 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 21591 21361 gene locus_tag LOCUS_21850 21591 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 21788 21588 gene locus_tag LOCUS_21860 21788 21588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 22228 21788 gene locus_tag LOCUS_21870 22228 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 22352 22705 gene locus_tag LOCUS_21880 22352 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 22911 22708 gene locus_tag LOCUS_21890 22911 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 23190 23453 gene locus_tag LOCUS_21900 23190 23453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 23460 24086 gene locus_tag LOCUS_21910 23460 24086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 24074 25273 gene locus_tag LOCUS_21920 24074 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 26618 25233 gene locus_tag LOCUS_21930 26618 25233 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748495.1 protein_id gnl|my_center|LOCUS_21930 26860 26651 gene locus_tag LOCUS_21940 26860 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 26951 28261 gene locus_tag LOCUS_21950 26951 28261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 29372 28500 gene locus_tag LOCUS_21960 29372 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 29343 29654 gene locus_tag LOCUS_21970 29343 29654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 29651 29977 gene locus_tag LOCUS_21980 29651 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 30686 30243 gene locus_tag LOCUS_21990 30686 30243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 31448 31744 gene locus_tag LOCUS_22000 31448 31744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 31741 32865 gene locus_tag LOCUS_22010 31741 32865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 32871 33194 gene locus_tag LOCUS_22020 32871 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 33429 38657 gene locus_tag LOCUS_22030 33429 38657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 38857 39411 gene locus_tag LOCUS_22040 38857 39411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 40245 39466 gene locus_tag LOCUS_22050 40245 39466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 40665 40288 gene locus_tag LOCUS_22060 40665 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 41165 40707 gene locus_tag LOCUS_22070 41165 40707 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 protein_id gnl|my_center|LOCUS_22070 41659 41162 gene locus_tag LOCUS_22080 41659 41162 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199198884.1 protein_id gnl|my_center|LOCUS_22080 41765 42994 gene locus_tag LOCUS_22090 41765 42994 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_22090 43033 44013 gene locus_tag LOCUS_22100 43033 44013 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222259.1 protein_id gnl|my_center|LOCUS_22100 44980 44396 gene locus_tag LOCUS_22110 44980 44396 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878619.1 protein_id gnl|my_center|LOCUS_22110 46186 45047 gene locus_tag LOCUS_22120 46186 45047 CDS product thioester domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316091.1 protein_id gnl|my_center|LOCUS_22120 46671 46441 gene locus_tag LOCUS_22130 46671 46441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 46568 47254 gene locus_tag LOCUS_22140 46568 47254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 48878 47241 gene locus_tag LOCUS_22150 48878 47241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 49379 48888 gene locus_tag LOCUS_22160 49379 48888 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_22160 49492 50397 gene locus_tag LOCUS_22170 49492 50397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 protein_id gnl|my_center|LOCUS_22170 50394 52046 gene locus_tag LOCUS_22180 50394 52046 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_22180 52253 53434 gene locus_tag LOCUS_22190 52253 53434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081138.1 protein_id gnl|my_center|LOCUS_22190 53446 54225 gene locus_tag LOCUS_22200 53446 54225 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_22200 54215 55327 gene locus_tag LOCUS_22210 54215 55327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 55478 57259 gene locus_tag LOCUS_22220 55478 57259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 57256 57510 gene locus_tag LOCUS_22230 57256 57510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 57507 57947 gene locus_tag LOCUS_22240 57507 57947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 57985 58125 gene locus_tag LOCUS_22250 57985 58125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 58266 59108 gene locus_tag LOCUS_22260 58266 59108 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226448.1 protein_id gnl|my_center|LOCUS_22260 59132 59638 gene locus_tag LOCUS_22270 59132 59638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 60979 59708 gene locus_tag LOCUS_22280 60979 59708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 61934 61074 gene locus_tag LOCUS_22290 61934 61074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 62814 61948 gene locus_tag LOCUS_22300 62814 61948 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226278.1 protein_id gnl|my_center|LOCUS_22300 63887 62805 gene locus_tag LOCUS_22310 63887 62805 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223573.1 protein_id gnl|my_center|LOCUS_22310 66216 63889 gene locus_tag LOCUS_22320 66216 63889 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026995.1 protein_id gnl|my_center|LOCUS_22320 66447 67757 gene locus_tag LOCUS_22330 66447 67757 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_22330 67757 68701 gene locus_tag LOCUS_22340 67757 68701 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_22340 68698 69543 gene locus_tag LOCUS_22350 68698 69543 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972114.1 protein_id gnl|my_center|LOCUS_22350 69722 70729 gene locus_tag LOCUS_22360 69722 70729 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_22360 70983 71933 gene locus_tag LOCUS_22370 70983 71933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 72092 75031 gene locus_tag LOCUS_22380 72092 75031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133852608.1 protein_id gnl|my_center|LOCUS_22380 75456 75283 gene locus_tag LOCUS_22390 75456 75283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 77046 75781 gene locus_tag LOCUS_22400 77046 75781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 77753 77241 gene locus_tag LOCUS_22410 77753 77241 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229502.1 protein_id gnl|my_center|LOCUS_22410 77881 78579 gene locus_tag LOCUS_22420 77881 78579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 78742 83034 gene locus_tag LOCUS_22430 78742 83034 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390206.1 protein_id gnl|my_center|LOCUS_22430 83133 84779 gene locus_tag LOCUS_22440 83133 84779 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_22440 85237 84857 gene locus_tag LOCUS_22450 gene trxA 85237 84857 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_22450 86121 85291 gene locus_tag LOCUS_22460 86121 85291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 86196 86579 gene locus_tag LOCUS_22470 86196 86579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 86572 87186 gene locus_tag LOCUS_22480 86572 87186 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316316.1 protein_id gnl|my_center|LOCUS_22480 87186 88391 gene locus_tag LOCUS_22490 87186 88391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 88393 89151 gene locus_tag LOCUS_22500 88393 89151 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231008.1 protein_id gnl|my_center|LOCUS_22500 89958 89179 gene locus_tag LOCUS_22510 89958 89179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 90843 90004 gene locus_tag LOCUS_22520 90843 90004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 91202 90843 gene locus_tag LOCUS_22530 91202 90843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 91643 91221 gene locus_tag LOCUS_22540 91643 91221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 92441 91692 gene locus_tag LOCUS_22550 92441 91692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 93393 92542 gene locus_tag LOCUS_22560 93393 92542 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224285.1 protein_id gnl|my_center|LOCUS_22560 93590 95860 gene locus_tag LOCUS_22570 93590 95860 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_22570 95880 96659 gene locus_tag LOCUS_22580 95880 96659 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_22580 97632 96673 gene locus_tag LOCUS_22590 97632 96673 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_22590 97666 99072 gene locus_tag LOCUS_22600 97666 99072 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_22600 99149 99814 gene locus_tag LOCUS_22610 99149 99814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 100891 99926 gene locus_tag LOCUS_22620 100891 99926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 101437 101673 gene locus_tag LOCUS_22630 101437 101673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 103155 101875 gene locus_tag LOCUS_22640 103155 101875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_22640 103623 103874 gene locus_tag LOCUS_22650 103623 103874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 103894 104499 gene locus_tag LOCUS_22660 103894 104499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 104508 104762 gene locus_tag LOCUS_22670 104508 104762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 104759 105187 gene locus_tag LOCUS_22680 104759 105187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 105825 106826 gene locus_tag LOCUS_22690 105825 106826 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861113.1 protein_id gnl|my_center|LOCUS_22690 107755 106835 gene locus_tag LOCUS_22700 107755 106835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 109075 108410 gene locus_tag LOCUS_22710 109075 108410 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224281.1 protein_id gnl|my_center|LOCUS_22710 109622 109089 gene locus_tag LOCUS_22720 109622 109089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 109894 109819 gene locus_tag LOCUS_t00290 109894 109819 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 110014 109925 gene locus_tag LOCUS_t00300 110014 109925 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 112014 110068 gene locus_tag LOCUS_22730 112014 110068 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222224.1 protein_id gnl|my_center|LOCUS_22730 112810 112055 gene locus_tag LOCUS_22740 112810 112055 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_22740 113900 112803 gene locus_tag LOCUS_22750 113900 112803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 114358 113897 gene locus_tag LOCUS_22760 114358 113897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 115153 114470 gene locus_tag LOCUS_22770 115153 114470 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222223.1 protein_id gnl|my_center|LOCUS_22770 115902 115150 gene locus_tag LOCUS_22780 115902 115150 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_22780 116279 115899 gene locus_tag LOCUS_22790 116279 115899 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028745.1 protein_id gnl|my_center|LOCUS_22790 117709 116333 gene locus_tag LOCUS_22800 117709 116333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 118437 117706 gene locus_tag LOCUS_22810 118437 117706 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_22810 118501 119484 gene locus_tag LOCUS_22820 gene pseB 118501 119484 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867763.1 protein_id gnl|my_center|LOCUS_22820 119477 120610 gene locus_tag LOCUS_22830 gene pseC 119477 120610 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_22830 120607 121341 gene locus_tag LOCUS_22840 120607 121341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 121702 123072 gene locus_tag LOCUS_22850 121702 123072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 123642 123433 gene locus_tag LOCUS_22860 123642 123433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 124817 123768 gene locus_tag LOCUS_22870 gene pseI 124817 123768 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_22870 125054 124833 gene locus_tag LOCUS_22880 125054 124833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 125696 125208 gene locus_tag LOCUS_22890 125696 125208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 126391 125732 gene locus_tag LOCUS_22900 126391 125732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 126524 127447 gene locus_tag LOCUS_22910 126524 127447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284954.1 protein_id gnl|my_center|LOCUS_22910 127464 128282 gene locus_tag LOCUS_22920 127464 128282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222189.1 protein_id gnl|my_center|LOCUS_22920 128282 129187 gene locus_tag LOCUS_22930 128282 129187 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466521.1 protein_id gnl|my_center|LOCUS_22930 129346 130422 gene locus_tag LOCUS_22940 129346 130422 CDS product thioester domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316091.1 protein_id gnl|my_center|LOCUS_22940 130484 130753 gene locus_tag LOCUS_22950 130484 130753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222183.1 protein_id gnl|my_center|LOCUS_22950 131362 130772 gene locus_tag LOCUS_22960 131362 130772 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_22960 131432 132031 gene locus_tag LOCUS_22970 131432 132031 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_22970 132517 132104 gene locus_tag LOCUS_22980 132517 132104 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284971.1 protein_id gnl|my_center|LOCUS_22980 132632 133924 gene locus_tag LOCUS_22990 132632 133924 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222180.1 protein_id gnl|my_center|LOCUS_22990 133921 134676 gene locus_tag LOCUS_23000 133921 134676 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222179.1 protein_id gnl|my_center|LOCUS_23000 135338 134673 gene locus_tag LOCUS_23010 135338 134673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 135611 135399 gene locus_tag LOCUS_23020 135611 135399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 135716 136615 gene locus_tag LOCUS_23030 135716 136615 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_23030 136615 136935 gene locus_tag LOCUS_23040 136615 136935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 138029 137115 gene locus_tag LOCUS_23050 138029 137115 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222176.1 protein_id gnl|my_center|LOCUS_23050 138601 138026 gene locus_tag LOCUS_23060 138601 138026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 139815 138601 gene locus_tag LOCUS_23070 gene glf 139815 138601 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222174.1 protein_id gnl|my_center|LOCUS_23070 140522 139830 gene locus_tag LOCUS_23080 140522 139830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804164.1 protein_id gnl|my_center|LOCUS_23080 141501 140632 gene locus_tag LOCUS_23090 141501 140632 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222172.1 protein_id gnl|my_center|LOCUS_23090 142114 141533 gene locus_tag LOCUS_23100 142114 141533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 142166 142984 gene locus_tag LOCUS_23110 142166 142984 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222171.1 protein_id gnl|my_center|LOCUS_23110 143007 143492 gene locus_tag LOCUS_23120 143007 143492 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_23120 143884 143537 gene locus_tag LOCUS_23130 143884 143537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230128.1 protein_id gnl|my_center|LOCUS_23130 144039 144317 gene locus_tag LOCUS_23140 144039 144317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 146291 144387 gene locus_tag LOCUS_23150 146291 144387 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731265.1 protein_id gnl|my_center|LOCUS_23150 146953 146336 gene locus_tag LOCUS_23160 146953 146336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 147129 148076 gene locus_tag LOCUS_23170 147129 148076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 150099 148138 gene locus_tag LOCUS_23180 150099 148138 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222182.1 protein_id gnl|my_center|LOCUS_23180 152773 150263 gene locus_tag LOCUS_23190 152773 150263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 155071 152789 gene locus_tag LOCUS_23200 155071 152789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 155198 155064 gene locus_tag LOCUS_23210 155198 155064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 157486 155195 gene locus_tag LOCUS_23220 157486 155195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 160303 157505 gene locus_tag LOCUS_23230 160303 157505 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230650.1 protein_id gnl|my_center|LOCUS_23230 160559 162547 gene locus_tag LOCUS_23240 160559 162547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 protein_id gnl|my_center|LOCUS_23240 163448 162558 gene locus_tag LOCUS_23250 163448 162558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 163807 163445 gene locus_tag LOCUS_23260 163807 163445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 164582 163800 gene locus_tag LOCUS_23270 164582 163800 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_23270 166045 164594 gene locus_tag LOCUS_23280 166045 164594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230622.1 protein_id gnl|my_center|LOCUS_23280 166796 166539 gene locus_tag LOCUS_23290 166796 166539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 167512 166952 gene locus_tag LOCUS_23300 167512 166952 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_23300 167595 168455 gene locus_tag LOCUS_23310 167595 168455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029935.1 protein_id gnl|my_center|LOCUS_23310 168476 169657 gene locus_tag LOCUS_23320 gene lhgO 168476 169657 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222145.1 protein_id gnl|my_center|LOCUS_23320 170522 169650 gene locus_tag LOCUS_23330 170522 169650 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224202.1 protein_id gnl|my_center|LOCUS_23330 171605 170727 gene locus_tag LOCUS_23340 171605 170727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 172204 171770 gene locus_tag LOCUS_23350 172204 171770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 173380 174327 gene locus_tag LOCUS_23360 173380 174327 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222137.1 protein_id gnl|my_center|LOCUS_23360 174332 174682 gene locus_tag LOCUS_23370 174332 174682 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_23370 174736 175341 gene locus_tag LOCUS_23380 174736 175341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 175338 177941 gene locus_tag LOCUS_23390 175338 177941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 179198 178020 gene locus_tag LOCUS_23400 179198 178020 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_23400 180116 179220 gene locus_tag LOCUS_23410 180116 179220 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227084.1 protein_id gnl|my_center|LOCUS_23410 180919 180161 gene locus_tag LOCUS_23420 180919 180161 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224587.1 protein_id gnl|my_center|LOCUS_23420 180997 182199 gene locus_tag LOCUS_23430 180997 182199 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 protein_id gnl|my_center|LOCUS_23430 182354 182980 gene locus_tag LOCUS_23440 182354 182980 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_23440 183885 183445 gene locus_tag LOCUS_23450 183885 183445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 184244 184002 gene locus_tag LOCUS_23460 184244 184002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 184439 186085 gene locus_tag LOCUS_23470 184439 186085 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092626645.1 protein_id gnl|my_center|LOCUS_23470 186082 186747 gene locus_tag LOCUS_23480 186082 186747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_23480 187372 186731 gene locus_tag LOCUS_23490 187372 186731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 187939 187508 gene locus_tag LOCUS_23500 187939 187508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 188230 189063 gene locus_tag LOCUS_23510 188230 189063 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_23510 189779 188979 gene locus_tag LOCUS_23520 189779 188979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_23520 190756 189776 gene locus_tag LOCUS_23530 190756 189776 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_23530 190893 191354 gene locus_tag LOCUS_23540 190893 191354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 192281 191355 gene locus_tag LOCUS_23550 gene pheA 192281 191355 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222131.1 protein_id gnl|my_center|LOCUS_23550 192402 192989 gene locus_tag LOCUS_23560 192402 192989 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222130.1 protein_id gnl|my_center|LOCUS_23560 193209 194144 gene locus_tag LOCUS_23570 gene coaA 193209 194144 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222129.1 protein_id gnl|my_center|LOCUS_23570 194157 194891 gene locus_tag LOCUS_23580 194157 194891 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031612.1 protein_id gnl|my_center|LOCUS_23580 194901 195536 gene locus_tag LOCUS_23590 194901 195536 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222118.1 protein_id gnl|my_center|LOCUS_23590 198315 195802 gene locus_tag LOCUS_23600 198315 195802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230858.1 protein_id gnl|my_center|LOCUS_23600 199070 198315 gene locus_tag LOCUS_23610 199070 198315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284384.1 protein_id gnl|my_center|LOCUS_23610 200302 199166 gene locus_tag LOCUS_23620 200302 199166 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839508.1 protein_id gnl|my_center|LOCUS_23620 <201024 200314 gene locus_tag LOCUS_23630 <201024 200314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222116.1:thiol reductant ABC exporter subunit CydC >Feature sequence08 1556 123 gene locus_tag LOCUS_23640 1556 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2410 1553 gene locus_tag LOCUS_23650 2410 1553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139527.1 protein_id gnl|my_center|LOCUS_23650 2976 2407 gene locus_tag LOCUS_23660 2976 2407 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031930.1 protein_id gnl|my_center|LOCUS_23660 4085 3120 gene locus_tag LOCUS_23670 4085 3120 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228220.1 protein_id gnl|my_center|LOCUS_23670 4176 4745 gene locus_tag LOCUS_23680 4176 4745 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228221.1 protein_id gnl|my_center|LOCUS_23680 4906 5925 gene locus_tag LOCUS_23690 4906 5925 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729474.1 protein_id gnl|my_center|LOCUS_23690 5939 7216 gene locus_tag LOCUS_23700 5939 7216 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729475.1 protein_id gnl|my_center|LOCUS_23700 8778 7213 gene locus_tag LOCUS_23710 8778 7213 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095244.1 protein_id gnl|my_center|LOCUS_23710 9906 8782 gene locus_tag LOCUS_23720 9906 8782 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162184663.1 protein_id gnl|my_center|LOCUS_23720 10850 9939 gene locus_tag LOCUS_23730 10850 9939 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466703.1 protein_id gnl|my_center|LOCUS_23730 11615 10863 gene locus_tag LOCUS_23740 11615 10863 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_23740 13067 11625 gene locus_tag LOCUS_23750 13067 11625 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727459.1 protein_id gnl|my_center|LOCUS_23750 14054 13086 gene locus_tag LOCUS_23760 14054 13086 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_23760 14491 14051 gene locus_tag LOCUS_23770 14491 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 15297 14488 gene locus_tag LOCUS_23780 15297 14488 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_23780 16324 15311 gene locus_tag LOCUS_23790 16324 15311 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729469.1 protein_id gnl|my_center|LOCUS_23790 17202 16330 gene locus_tag LOCUS_23800 17202 16330 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_23800 18048 17230 gene locus_tag LOCUS_23810 18048 17230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_23810 18710 18054 gene locus_tag LOCUS_23820 18710 18054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_23820 19891 18848 gene locus_tag LOCUS_23830 19891 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 22037 19893 gene locus_tag LOCUS_23840 22037 19893 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_23840 22854 22081 gene locus_tag LOCUS_23850 22854 22081 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_23850 23760 22858 gene locus_tag LOCUS_23860 23760 22858 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727457.1 protein_id gnl|my_center|LOCUS_23860 24539 23757 gene locus_tag LOCUS_23870 24539 23757 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727456.1 protein_id gnl|my_center|LOCUS_23870 25690 24536 gene locus_tag LOCUS_23880 25690 24536 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727455.1 protein_id gnl|my_center|LOCUS_23880 27060 25687 gene locus_tag LOCUS_23890 27060 25687 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_23890 27778 27164 gene locus_tag LOCUS_23900 27778 27164 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727452.1 protein_id gnl|my_center|LOCUS_23900 28448 28176 gene locus_tag LOCUS_23910 28448 28176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 28771 28475 gene locus_tag LOCUS_23920 28771 28475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 29139 28828 gene locus_tag LOCUS_23930 29139 28828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 29512 29177 gene locus_tag LOCUS_23940 29512 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 33002 29547 gene locus_tag LOCUS_23950 33002 29547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 34478 33393 gene locus_tag LOCUS_23960 34478 33393 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_23960 35619 34492 gene locus_tag LOCUS_23970 35619 34492 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226589.1 protein_id gnl|my_center|LOCUS_23970 35893 35612 gene locus_tag LOCUS_23980 35893 35612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 36741 35899 gene locus_tag LOCUS_23990 36741 35899 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225910.1 protein_id gnl|my_center|LOCUS_23990 37430 36768 gene locus_tag LOCUS_24000 37430 36768 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_24000 38922 37480 gene locus_tag LOCUS_24010 38922 37480 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_24010 43936 38915 gene locus_tag LOCUS_24020 43936 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 58092 43933 gene locus_tag LOCUS_24030 58092 43933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24030 69472 59303 gene locus_tag LOCUS_24040 69472 59303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24040 81893 69489 gene locus_tag LOCUS_24050 81893 69489 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030787.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24050 83131 81923 gene locus_tag LOCUS_24060 83131 81923 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 protein_id gnl|my_center|LOCUS_24060 84584 83301 gene locus_tag LOCUS_24070 84584 83301 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730842.1 protein_id gnl|my_center|LOCUS_24070 85166 86542 gene locus_tag LOCUS_24080 85166 86542 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_24080 87122 86673 gene locus_tag LOCUS_24090 87122 86673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 87419 87724 gene locus_tag LOCUS_24100 87419 87724 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223697.1 protein_id gnl|my_center|LOCUS_24100 87721 88476 gene locus_tag LOCUS_24110 87721 88476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 89499 88666 gene locus_tag LOCUS_24120 89499 88666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 protein_id gnl|my_center|LOCUS_24120 90470 89496 gene locus_tag LOCUS_24130 90470 89496 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 protein_id gnl|my_center|LOCUS_24130 90571 91290 gene locus_tag LOCUS_24140 90571 91290 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224251.1 protein_id gnl|my_center|LOCUS_24140 91890 91414 gene locus_tag LOCUS_24150 91890 91414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 93773 92439 gene locus_tag LOCUS_24160 93773 92439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 95109 93856 gene locus_tag LOCUS_24170 95109 93856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 95861 95115 gene locus_tag LOCUS_24180 95861 95115 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_24180 97216 95861 gene locus_tag LOCUS_24190 97216 95861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 98508 97246 gene locus_tag LOCUS_24200 98508 97246 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_24200 99518 98505 gene locus_tag LOCUS_24210 99518 98505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 100236 99496 gene locus_tag LOCUS_24220 100236 99496 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229957.1 protein_id gnl|my_center|LOCUS_24220 102776 100233 gene locus_tag LOCUS_24230 102776 100233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 103996 102791 gene locus_tag LOCUS_24240 gene phzC 103996 102791 CDS product phenazine biosynthesis protein PhzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093621.1 protein_id gnl|my_center|LOCUS_24240 105459 103996 gene locus_tag LOCUS_24250 105459 103996 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403486.1 protein_id gnl|my_center|LOCUS_24250 106459 105449 gene locus_tag LOCUS_24260 106459 105449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 106749 106456 gene locus_tag LOCUS_24270 106749 106456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 107171 106746 gene locus_tag LOCUS_24280 107171 106746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 108856 107180 gene locus_tag LOCUS_24290 108856 107180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 110160 108850 gene locus_tag LOCUS_24300 110160 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 111418 110171 gene locus_tag LOCUS_24310 111418 110171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 111746 112765 gene locus_tag LOCUS_24320 111746 112765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 112792 113700 gene locus_tag LOCUS_24330 112792 113700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 113697 113885 gene locus_tag LOCUS_24340 113697 113885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 117059 113865 gene locus_tag LOCUS_24350 117059 113865 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_24350 117361 117942 gene locus_tag LOCUS_24360 117361 117942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 118459 121422 gene locus_tag LOCUS_24370 118459 121422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 121873 121430 gene locus_tag LOCUS_24380 121873 121430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 122099 122296 gene locus_tag LOCUS_24390 122099 122296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 122649 122479 gene locus_tag LOCUS_24400 122649 122479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 123714 122851 gene locus_tag LOCUS_24410 123714 122851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 124523 123903 gene locus_tag LOCUS_24420 124523 123903 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_24420 125701 124520 gene locus_tag LOCUS_24430 125701 124520 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_24430 125877 126032 gene locus_tag LOCUS_24440 125877 126032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 126063 126626 gene locus_tag LOCUS_24450 126063 126626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 126640 126813 gene locus_tag LOCUS_24460 126640 126813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 127624 127070 gene locus_tag LOCUS_24470 127624 127070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 128268 127804 gene locus_tag LOCUS_24480 128268 127804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 128683 128447 gene locus_tag LOCUS_24490 128683 128447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 130541 128676 gene locus_tag LOCUS_24500 130541 128676 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_24500 133109 130554 gene locus_tag LOCUS_24510 133109 130554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 133345 133106 gene locus_tag LOCUS_24520 133345 133106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 134730 133342 gene locus_tag LOCUS_24530 134730 133342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_24530 140881 134756 gene locus_tag LOCUS_24540 140881 134756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 141094 140894 gene locus_tag LOCUS_24550 141094 140894 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192056.1 protein_id gnl|my_center|LOCUS_24550 144114 141091 gene locus_tag LOCUS_24560 144114 141091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 147299 144111 gene locus_tag LOCUS_24570 147299 144111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24570 149152 147296 gene locus_tag LOCUS_24580 149152 147296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 151214 149274 gene locus_tag LOCUS_24590 151214 149274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 151464 151871 gene locus_tag LOCUS_24600 151464 151871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 152034 151858 gene locus_tag LOCUS_24610 152034 151858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 152264 152656 gene locus_tag LOCUS_24620 152264 152656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 152848 152609 gene locus_tag LOCUS_24630 152848 152609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 152777 152998 gene locus_tag LOCUS_24640 152777 152998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 155060 152991 gene locus_tag LOCUS_24650 155060 152991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 155289 155750 gene locus_tag LOCUS_24660 155289 155750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 156175 155765 gene locus_tag LOCUS_24670 156175 155765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 157054 156449 gene locus_tag LOCUS_24680 157054 156449 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_24680 158202 157069 gene locus_tag LOCUS_24690 158202 157069 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388861.1 protein_id gnl|my_center|LOCUS_24690 159173 158199 gene locus_tag LOCUS_24700 159173 158199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 160165 159176 gene locus_tag LOCUS_24710 160165 159176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 160402 163581 gene locus_tag LOCUS_24720 160402 163581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 163568 164509 gene locus_tag LOCUS_24730 163568 164509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 165199 164762 gene locus_tag LOCUS_24740 165199 164762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 165527 165886 gene locus_tag LOCUS_24750 165527 165886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 166641 165850 gene locus_tag LOCUS_24760 166641 165850 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_24760 168105 168344 gene locus_tag LOCUS_24770 168105 168344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 168396 169583 gene locus_tag LOCUS_24780 168396 169583 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_24780 170388 169588 gene locus_tag LOCUS_24790 170388 169588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 171344 170385 gene locus_tag LOCUS_24800 171344 170385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 172189 171341 gene locus_tag LOCUS_24810 172189 171341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 173193 172186 gene locus_tag LOCUS_24820 173193 172186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 protein_id gnl|my_center|LOCUS_24820 174806 173190 gene locus_tag LOCUS_24830 174806 173190 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804465.1 protein_id gnl|my_center|LOCUS_24830 174988 175770 gene locus_tag LOCUS_24840 gene xynR 174988 175770 CDS product DNA-binding transcriptional repressor XynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095377.1 protein_id gnl|my_center|LOCUS_24840 176806 175787 gene locus_tag LOCUS_24850 176806 175787 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_24850 178298 176799 gene locus_tag LOCUS_24860 178298 176799 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_24860 179383 178298 gene locus_tag LOCUS_24870 gene thrC 179383 178298 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_24870 180173 179418 gene locus_tag LOCUS_24880 gene fabG 180173 179418 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_24880 181003 180170 gene locus_tag LOCUS_24890 181003 180170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 181356 181000 gene locus_tag LOCUS_24900 181356 181000 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528752.1 protein_id gnl|my_center|LOCUS_24900 182625 181366 gene locus_tag LOCUS_24910 gene hemL 182625 181366 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_24910 182548 182820 gene locus_tag LOCUS_24920 182548 182820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 183129 182887 gene locus_tag LOCUS_24930 183129 182887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 183162 183647 gene locus_tag LOCUS_24940 183162 183647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 184053 183829 gene locus_tag LOCUS_24950 184053 183829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 184790 185230 gene locus_tag LOCUS_24960 184790 185230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 185247 186344 gene locus_tag LOCUS_24970 185247 186344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 187616 186450 gene locus_tag LOCUS_24980 187616 186450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 188719 187613 gene locus_tag LOCUS_24990 188719 187613 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364967.1 protein_id gnl|my_center|LOCUS_24990 189030 190448 gene locus_tag LOCUS_25000 189030 190448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 190601 191590 gene locus_tag LOCUS_25010 190601 191590 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_25010 191778 192347 gene locus_tag LOCUS_25020 191778 192347 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227281.1 protein_id gnl|my_center|LOCUS_25020 192492 193139 gene locus_tag LOCUS_25030 192492 193139 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077716.1 protein_id gnl|my_center|LOCUS_25030 194836 193166 gene locus_tag LOCUS_25040 194836 193166 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878257.1 protein_id gnl|my_center|LOCUS_25040 195386 194979 gene locus_tag LOCUS_25050 195386 194979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 195279 196010 gene locus_tag LOCUS_25060 195279 196010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 196351 195968 gene locus_tag LOCUS_25070 196351 195968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence09 854 1645 gene locus_tag LOCUS_25080 854 1645 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742120.1 protein_id gnl|my_center|LOCUS_25080 1749 2675 gene locus_tag LOCUS_25090 1749 2675 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_25090 2733 3578 gene locus_tag LOCUS_25100 2733 3578 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222400.1 protein_id gnl|my_center|LOCUS_25100 3628 4464 gene locus_tag LOCUS_25110 gene proC 3628 4464 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222401.1 protein_id gnl|my_center|LOCUS_25110 4534 4815 gene locus_tag LOCUS_25120 4534 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 4917 5072 gene locus_tag LOCUS_25130 4917 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 5248 6156 gene locus_tag LOCUS_25140 5248 6156 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222403.1 protein_id gnl|my_center|LOCUS_25140 6149 7072 gene locus_tag LOCUS_25150 6149 7072 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222404.1 protein_id gnl|my_center|LOCUS_25150 8047 7097 gene locus_tag LOCUS_25160 8047 7097 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_25160 9408 8134 gene locus_tag LOCUS_25170 9408 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 10190 9507 gene locus_tag LOCUS_25180 10190 9507 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_25180 10321 11838 gene locus_tag LOCUS_25190 10321 11838 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222411.1 protein_id gnl|my_center|LOCUS_25190 11839 12066 gene locus_tag LOCUS_25200 11839 12066 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_25200 12117 13634 gene locus_tag LOCUS_25210 12117 13634 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_25210 13755 14576 gene locus_tag LOCUS_25220 13755 14576 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222414.1 protein_id gnl|my_center|LOCUS_25220 14664 15989 gene locus_tag LOCUS_25230 14664 15989 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222415.1 protein_id gnl|my_center|LOCUS_25230 15986 16951 gene locus_tag LOCUS_25240 gene hemC 15986 16951 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222416.1 protein_id gnl|my_center|LOCUS_25240 16995 18587 gene locus_tag LOCUS_25250 16995 18587 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222417.1 protein_id gnl|my_center|LOCUS_25250 18597 19568 gene locus_tag LOCUS_25260 gene hemB 18597 19568 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831526.1 protein_id gnl|my_center|LOCUS_25260 19598 20203 gene locus_tag LOCUS_25270 19598 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222421.1 protein_id gnl|my_center|LOCUS_25270 20200 20658 gene locus_tag LOCUS_25280 20200 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222422.1 protein_id gnl|my_center|LOCUS_25280 20726 21247 gene locus_tag LOCUS_25290 20726 21247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225070.1 protein_id gnl|my_center|LOCUS_25290 21269 21622 gene locus_tag LOCUS_25300 21269 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222423.1 protein_id gnl|my_center|LOCUS_25300 21624 22913 gene locus_tag LOCUS_25310 gene hemL 21624 22913 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_25310 22910 23542 gene locus_tag LOCUS_25320 22910 23542 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_25320 23539 24114 gene locus_tag LOCUS_25330 23539 24114 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222431.1 protein_id gnl|my_center|LOCUS_25330 24193 24984 gene locus_tag LOCUS_25340 24193 24984 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222432.1 protein_id gnl|my_center|LOCUS_25340 24981 26567 gene locus_tag LOCUS_25350 24981 26567 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222433.1 protein_id gnl|my_center|LOCUS_25350 26572 27540 gene locus_tag LOCUS_25360 gene ccsB 26572 27540 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222434.1 protein_id gnl|my_center|LOCUS_25360 27641 28357 gene locus_tag LOCUS_25370 27641 28357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 28522 30033 gene locus_tag LOCUS_25380 28522 30033 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222435.1 protein_id gnl|my_center|LOCUS_25380 30287 30048 gene locus_tag LOCUS_25390 30287 30048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222436.1 protein_id gnl|my_center|LOCUS_25390 30582 30367 gene locus_tag LOCUS_25400 30582 30367 CDS product BldC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081896.1 protein_id gnl|my_center|LOCUS_25400 30730 31194 gene locus_tag LOCUS_25410 30730 31194 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466559.1 protein_id gnl|my_center|LOCUS_25410 31184 31462 gene locus_tag LOCUS_25420 31184 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 31465 32559 gene locus_tag LOCUS_25430 31465 32559 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_25430 33418 32552 gene locus_tag LOCUS_25440 33418 32552 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466560.1 protein_id gnl|my_center|LOCUS_25440 34076 33504 gene locus_tag LOCUS_25450 34076 33504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 34221 35450 gene locus_tag LOCUS_25460 34221 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 35475 35678 gene locus_tag LOCUS_25470 35475 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 35852 36142 gene locus_tag LOCUS_25480 35852 36142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 37216 36113 gene locus_tag LOCUS_25490 gene menE 37216 36113 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742122.1 protein_id gnl|my_center|LOCUS_25490 37379 37233 gene locus_tag LOCUS_25500 37379 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 38319 37396 gene locus_tag LOCUS_25510 38319 37396 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222442.1 protein_id gnl|my_center|LOCUS_25510 38392 39747 gene locus_tag LOCUS_25520 38392 39747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 39744 41423 gene locus_tag LOCUS_25530 gene menD 39744 41423 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_25530 43866 41476 gene locus_tag LOCUS_25540 43866 41476 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_25540 43998 44501 gene locus_tag LOCUS_25550 43998 44501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 44532 45476 gene locus_tag LOCUS_25560 gene paaA 44532 45476 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_25560 45473 45751 gene locus_tag LOCUS_25570 gene paaB 45473 45751 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_25570 45822 46718 gene locus_tag LOCUS_25580 gene paaC 45822 46718 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223465.1 protein_id gnl|my_center|LOCUS_25580 46712 47203 gene locus_tag LOCUS_25590 gene paaJ 46712 47203 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_25590 47204 48271 gene locus_tag LOCUS_25600 gene paaK 47204 48271 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971667.1 protein_id gnl|my_center|LOCUS_25600 48655 48281 gene locus_tag LOCUS_25610 48655 48281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 48747 49310 gene locus_tag LOCUS_25620 48747 49310 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028219.1 protein_id gnl|my_center|LOCUS_25620 49421 50542 gene locus_tag LOCUS_25630 49421 50542 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_25630 50602 51282 gene locus_tag LOCUS_25640 50602 51282 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222451.1 protein_id gnl|my_center|LOCUS_25640 51519 51283 gene locus_tag LOCUS_25650 51519 51283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 52089 51547 gene locus_tag LOCUS_25660 52089 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 52239 53534 gene locus_tag LOCUS_25670 52239 53534 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_25670 53874 53665 gene locus_tag LOCUS_25680 53874 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 54722 53871 gene locus_tag LOCUS_25690 54722 53871 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_25690 55094 55273 gene locus_tag LOCUS_25700 55094 55273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 55315 55542 gene locus_tag LOCUS_25710 55315 55542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 56252 55605 gene locus_tag LOCUS_25720 56252 55605 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_25720 56334 57050 gene locus_tag LOCUS_25730 56334 57050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 58263 57043 gene locus_tag LOCUS_25740 58263 57043 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_25740 59127 58300 gene locus_tag LOCUS_25750 59127 58300 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730433.1 protein_id gnl|my_center|LOCUS_25750 59355 60731 gene locus_tag LOCUS_25760 59355 60731 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229841.1 protein_id gnl|my_center|LOCUS_25760 60832 62049 gene locus_tag LOCUS_25770 60832 62049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 62160 63314 gene locus_tag LOCUS_25780 62160 63314 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_25780 63826 63353 gene locus_tag LOCUS_25790 63826 63353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 63762 64655 gene locus_tag LOCUS_25800 63762 64655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969623.1 protein_id gnl|my_center|LOCUS_25800 65918 64719 gene locus_tag LOCUS_25810 gene hppD 65918 64719 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229829.1 protein_id gnl|my_center|LOCUS_25810 66054 66548 gene locus_tag LOCUS_25820 66054 66548 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229828.1 protein_id gnl|my_center|LOCUS_25820 67070 66582 gene locus_tag LOCUS_25830 gene greA 67070 66582 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229826.1 protein_id gnl|my_center|LOCUS_25830 67711 67256 gene locus_tag LOCUS_25840 67711 67256 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229825.1 protein_id gnl|my_center|LOCUS_25840 67854 68735 gene locus_tag LOCUS_25850 gene mca 67854 68735 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229824.1 protein_id gnl|my_center|LOCUS_25850 68732 69076 gene locus_tag LOCUS_25860 68732 69076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229823.1 protein_id gnl|my_center|LOCUS_25860 69205 70140 gene locus_tag LOCUS_25870 69205 70140 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389439.1 protein_id gnl|my_center|LOCUS_25870 70202 72211 gene locus_tag LOCUS_25880 70202 72211 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284173.1 protein_id gnl|my_center|LOCUS_25880 72747 72935 gene locus_tag LOCUS_25890 72747 72935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 72982 73614 gene locus_tag LOCUS_25900 72982 73614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_25900 74112 73624 gene locus_tag LOCUS_25910 74112 73624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 74169 74600 gene locus_tag LOCUS_25920 74169 74600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 74597 75061 gene locus_tag LOCUS_25930 74597 75061 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728622.1 protein_id gnl|my_center|LOCUS_25930 75503 75243 gene locus_tag LOCUS_25940 75503 75243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 76018 75503 gene locus_tag LOCUS_25950 76018 75503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 75971 76189 gene locus_tag LOCUS_25960 75971 76189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 76296 76847 gene locus_tag LOCUS_25970 76296 76847 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227701.1 protein_id gnl|my_center|LOCUS_25970 77307 76897 gene locus_tag LOCUS_25980 77307 76897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270067.1 protein_id gnl|my_center|LOCUS_25980 77997 77326 gene locus_tag LOCUS_25990 77997 77326 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_25990 78460 78044 gene locus_tag LOCUS_26000 78460 78044 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078677.1 protein_id gnl|my_center|LOCUS_26000 78499 79290 gene locus_tag LOCUS_26010 78499 79290 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_26010 79575 80912 gene locus_tag LOCUS_26020 79575 80912 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229808.1 protein_id gnl|my_center|LOCUS_26020 80995 81687 gene locus_tag LOCUS_26030 80995 81687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 83244 81670 gene locus_tag LOCUS_26040 83244 81670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 84728 83289 gene locus_tag LOCUS_26050 84728 83289 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229805.1 protein_id gnl|my_center|LOCUS_26050 86272 84740 gene locus_tag LOCUS_26060 86272 84740 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_26060 86664 86317 gene locus_tag LOCUS_26070 86664 86317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 87020 86661 gene locus_tag LOCUS_26080 87020 86661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 87226 88293 gene locus_tag LOCUS_26090 87226 88293 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971615.1 protein_id gnl|my_center|LOCUS_26090 89647 88271 gene locus_tag LOCUS_26100 89647 88271 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027697.1 protein_id gnl|my_center|LOCUS_26100 89694 90632 gene locus_tag LOCUS_26110 89694 90632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 92213 90855 gene locus_tag LOCUS_26120 92213 90855 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229796.1 protein_id gnl|my_center|LOCUS_26120 92335 93318 gene locus_tag LOCUS_26130 92335 93318 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284007.1 protein_id gnl|my_center|LOCUS_26130 94446 93853 gene locus_tag LOCUS_26140 94446 93853 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230651.1 protein_id gnl|my_center|LOCUS_26140 95592 94537 gene locus_tag LOCUS_26150 gene glpX 95592 94537 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_26150 95666 96292 gene locus_tag LOCUS_26160 95666 96292 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730406.1 protein_id gnl|my_center|LOCUS_26160 96848 96285 gene locus_tag LOCUS_26170 96848 96285 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222967.1 protein_id gnl|my_center|LOCUS_26170 97153 96845 gene locus_tag LOCUS_26180 97153 96845 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222965.1 protein_id gnl|my_center|LOCUS_26180 98120 97191 gene locus_tag LOCUS_26190 98120 97191 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831595.1 protein_id gnl|my_center|LOCUS_26190 98989 98120 gene locus_tag LOCUS_26200 gene folP 98989 98120 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296421.1 protein_id gnl|my_center|LOCUS_26200 99853 99074 gene locus_tag LOCUS_26210 99853 99074 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_26210 101023 99923 gene locus_tag LOCUS_26220 gene dapE 101023 99923 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222942.1 protein_id gnl|my_center|LOCUS_26220 101061 101552 gene locus_tag LOCUS_26230 101061 101552 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_26230 101572 102381 gene locus_tag LOCUS_26240 101572 102381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 102401 103375 gene locus_tag LOCUS_26250 gene dapD 102401 103375 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_26250 103417 104346 gene locus_tag LOCUS_26260 103417 104346 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222939.1 protein_id gnl|my_center|LOCUS_26260 105431 104343 gene locus_tag LOCUS_26270 gene dapC 105431 104343 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_26270 105754 105428 gene locus_tag LOCUS_26280 105754 105428 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083029.1 protein_id gnl|my_center|LOCUS_26280 106251 105844 gene locus_tag LOCUS_26290 106251 105844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229757.1 protein_id gnl|my_center|LOCUS_26290 107096 106251 gene locus_tag LOCUS_26300 gene mshB 107096 106251 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229758.1 protein_id gnl|my_center|LOCUS_26300 107618 107127 gene locus_tag LOCUS_26310 107618 107127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26310 108187 107528 gene locus_tag LOCUS_26320 108187 107528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26320 109257 108184 gene locus_tag LOCUS_26330 109257 108184 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_26330 110248 109271 gene locus_tag LOCUS_26340 gene gsiD 110248 109271 CDS product glutathione ABC transporter permease GsiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065130.1 protein_id gnl|my_center|LOCUS_26340 111191 110259 gene locus_tag LOCUS_26350 111191 110259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_26350 112993 111269 gene locus_tag LOCUS_26360 112993 111269 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_26360 115117 113438 gene locus_tag LOCUS_26370 115117 113438 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229764.1 protein_id gnl|my_center|LOCUS_26370 117123 115219 gene locus_tag LOCUS_26380 gene typA 117123 115219 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229765.1 protein_id gnl|my_center|LOCUS_26380 117391 118371 gene locus_tag LOCUS_26390 gene trpS 117391 118371 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229767.1 protein_id gnl|my_center|LOCUS_26390 119069 118368 gene locus_tag LOCUS_26400 119069 118368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 120406 119066 gene locus_tag LOCUS_26410 120406 119066 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229769.1 protein_id gnl|my_center|LOCUS_26410 119320 119224 gene locus_tag LOCUS_t00310 119320 119224 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 121155 120427 gene locus_tag LOCUS_26420 121155 120427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283998.1 protein_id gnl|my_center|LOCUS_26420 121300 122397 gene locus_tag LOCUS_26430 121300 122397 CDS product sigma-E factor regulatory protein RseB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229771.1 protein_id gnl|my_center|LOCUS_26430 122394 123515 gene locus_tag LOCUS_26440 122394 123515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_26440 123512 124354 gene locus_tag LOCUS_26450 123512 124354 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229773.1 protein_id gnl|my_center|LOCUS_26450 125414 124386 gene locus_tag LOCUS_26460 125414 124386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_26460 127012 125414 gene locus_tag LOCUS_26470 127012 125414 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125313541.1 protein_id gnl|my_center|LOCUS_26470 128040 126988 gene locus_tag LOCUS_26480 128040 126988 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_26480 128159 128521 gene locus_tag LOCUS_26490 128159 128521 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229777.1 protein_id gnl|my_center|LOCUS_26490 130147 128549 gene locus_tag LOCUS_26500 130147 128549 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_26500 130575 130147 gene locus_tag LOCUS_26510 130575 130147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 130683 132665 gene locus_tag LOCUS_26520 130683 132665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 132732 133436 gene locus_tag LOCUS_26530 132732 133436 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532405.1 protein_id gnl|my_center|LOCUS_26530 133494 133727 gene locus_tag LOCUS_26540 133494 133727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 133928 134149 gene locus_tag LOCUS_26550 133928 134149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 134854 134105 gene locus_tag LOCUS_26560 134854 134105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 135881 134844 gene locus_tag LOCUS_26570 135881 134844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 136706 135936 gene locus_tag LOCUS_26580 gene map 136706 135936 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084151.1 protein_id gnl|my_center|LOCUS_26580 136762 137031 gene locus_tag LOCUS_26590 136762 137031 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_26590 138260 137013 gene locus_tag LOCUS_26600 138260 137013 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533371.1 protein_id gnl|my_center|LOCUS_26600 138544 138257 gene locus_tag LOCUS_26610 138544 138257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 139031 138603 gene locus_tag LOCUS_26620 139031 138603 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776784.1 protein_id gnl|my_center|LOCUS_26620 140110 139028 gene locus_tag LOCUS_26630 gene ychF 140110 139028 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229781.1 protein_id gnl|my_center|LOCUS_26630 140375 143581 gene locus_tag LOCUS_26640 140375 143581 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228544.1 protein_id gnl|my_center|LOCUS_26640 143675 145117 gene locus_tag LOCUS_26650 143675 145117 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229782.1 protein_id gnl|my_center|LOCUS_26650 145583 145155 gene locus_tag LOCUS_26660 145583 145155 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_26660 146717 145746 gene locus_tag LOCUS_26670 146717 145746 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230847.1 protein_id gnl|my_center|LOCUS_26670 146834 147688 gene locus_tag LOCUS_26680 146834 147688 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230843.1 protein_id gnl|my_center|LOCUS_26680 147685 148308 gene locus_tag LOCUS_26690 147685 148308 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_26690 151265 148326 gene locus_tag LOCUS_26700 151265 148326 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_26700 152443 151262 gene locus_tag LOCUS_26710 152443 151262 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_26710 152745 152449 gene locus_tag LOCUS_26720 152745 152449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 152629 153579 gene locus_tag LOCUS_26730 152629 153579 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229786.1 protein_id gnl|my_center|LOCUS_26730 153915 154643 gene locus_tag LOCUS_26740 153915 154643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26740 155643 154651 gene locus_tag LOCUS_26750 155643 154651 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_26750 155686 156303 gene locus_tag LOCUS_26760 155686 156303 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229789.1 protein_id gnl|my_center|LOCUS_26760 156296 157564 gene locus_tag LOCUS_26770 gene xseA 156296 157564 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229790.1 protein_id gnl|my_center|LOCUS_26770 157545 157982 gene locus_tag LOCUS_26780 157545 157982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229791.1 protein_id gnl|my_center|LOCUS_26780 157979 158179 gene locus_tag LOCUS_26790 157979 158179 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229792.1 protein_id gnl|my_center|LOCUS_26790 158962 158183 gene locus_tag LOCUS_26800 158962 158183 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_26800 159782 158982 gene locus_tag LOCUS_26810 gene paaX 159782 158982 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041177.1 protein_id gnl|my_center|LOCUS_26810 159966 160133 gene locus_tag LOCUS_26820 159966 160133 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_26820 160183 161781 gene locus_tag LOCUS_26830 160183 161781 CDS product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222970.1 protein_id gnl|my_center|LOCUS_26830 163374 162217 gene locus_tag LOCUS_26840 gene glgA 163374 162217 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 protein_id gnl|my_center|LOCUS_26840 163421 164638 gene locus_tag LOCUS_26850 gene glgC 163421 164638 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406249.1 protein_id gnl|my_center|LOCUS_26850 164676 164975 gene locus_tag LOCUS_26860 164676 164975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 165624 165007 gene locus_tag LOCUS_26870 165624 165007 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_26870 165903 166499 gene locus_tag LOCUS_26880 gene sigE 165903 166499 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314132.1 protein_id gnl|my_center|LOCUS_26880 166496 167089 gene locus_tag LOCUS_26890 166496 167089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222976.1 protein_id gnl|my_center|LOCUS_26890 167233 168639 gene locus_tag LOCUS_26900 167233 168639 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286309.1 protein_id gnl|my_center|LOCUS_26900 168691 169101 gene locus_tag LOCUS_26910 gene tatB 168691 169101 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222978.1 protein_id gnl|my_center|LOCUS_26910 170331 169186 gene locus_tag LOCUS_26920 170331 169186 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286318.1 protein_id gnl|my_center|LOCUS_26920 170439 170879 gene locus_tag LOCUS_26930 170439 170879 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227819.1 protein_id gnl|my_center|LOCUS_26930 171414 170884 gene locus_tag LOCUS_26940 171414 170884 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222980.1 protein_id gnl|my_center|LOCUS_26940 172702 171407 gene locus_tag LOCUS_26950 172702 171407 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222981.1 protein_id gnl|my_center|LOCUS_26950 173602 172751 gene locus_tag LOCUS_26960 173602 172751 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222982.1 protein_id gnl|my_center|LOCUS_26960 173702 174760 gene locus_tag LOCUS_26970 173702 174760 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222030.1 protein_id gnl|my_center|LOCUS_26970 174775 175611 gene locus_tag LOCUS_26980 174775 175611 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_26980 175665 176459 gene locus_tag LOCUS_26990 175665 176459 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222983.1 protein_id gnl|my_center|LOCUS_26990 176579 176758 gene locus_tag LOCUS_27000 176579 176758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 176840 178036 gene locus_tag LOCUS_27010 176840 178036 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222986.1 protein_id gnl|my_center|LOCUS_27010 178142 178939 gene locus_tag LOCUS_27020 178142 178939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 178996 179517 gene locus_tag LOCUS_27030 178996 179517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286307.1 protein_id gnl|my_center|LOCUS_27030 179697 181019 gene locus_tag LOCUS_27040 179697 181019 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222988.1 protein_id gnl|my_center|LOCUS_27040 181016 181936 gene locus_tag LOCUS_27050 181016 181936 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222989.1 protein_id gnl|my_center|LOCUS_27050 181936 182778 gene locus_tag LOCUS_27060 181936 182778 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222990.1 protein_id gnl|my_center|LOCUS_27060 182784 183971 gene locus_tag LOCUS_27070 gene ugpC 182784 183971 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_27070 185746 183959 gene locus_tag LOCUS_27080 185746 183959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 186755 185856 gene locus_tag LOCUS_27090 186755 185856 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191091.1 protein_id gnl|my_center|LOCUS_27090 187504 186755 gene locus_tag LOCUS_27100 187504 186755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 187992 187597 gene locus_tag LOCUS_27110 187992 187597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 188945 188100 gene locus_tag LOCUS_27120 188945 188100 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223001.1 protein_id gnl|my_center|LOCUS_27120 189606 188935 gene locus_tag LOCUS_27130 189606 188935 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_27130 189752 190885 gene locus_tag LOCUS_27140 189752 190885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 190906 192669 gene locus_tag LOCUS_27150 190906 192669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 192666 193463 gene locus_tag LOCUS_27160 192666 193463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence10 2433 1720 gene locus_tag LOCUS_27170 2433 1720 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536888.1 protein_id gnl|my_center|LOCUS_27170 3344 2505 gene locus_tag LOCUS_27180 gene tauC 3344 2505 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206507.1 protein_id gnl|my_center|LOCUS_27180 4162 3341 gene locus_tag LOCUS_27190 4162 3341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_27190 4389 5732 gene locus_tag LOCUS_27200 4389 5732 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931176.1 protein_id gnl|my_center|LOCUS_27200 7268 5787 gene locus_tag LOCUS_27210 7268 5787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_27210 8224 7328 gene locus_tag LOCUS_27220 8224 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 8401 9984 gene locus_tag LOCUS_27230 8401 9984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268117.1 protein_id gnl|my_center|LOCUS_27230 9981 10955 gene locus_tag LOCUS_27240 9981 10955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400748.1 protein_id gnl|my_center|LOCUS_27240 10948 11811 gene locus_tag LOCUS_27250 10948 11811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400747.1 protein_id gnl|my_center|LOCUS_27250 11808 13403 gene locus_tag LOCUS_27260 11808 13403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537751.1 protein_id gnl|my_center|LOCUS_27260 13880 13404 gene locus_tag LOCUS_27270 13880 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 14323 13964 gene locus_tag LOCUS_27280 14323 13964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 15413 14346 gene locus_tag LOCUS_27290 15413 14346 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224744.1 protein_id gnl|my_center|LOCUS_27290 18187 15440 gene locus_tag LOCUS_27300 18187 15440 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224745.1 protein_id gnl|my_center|LOCUS_27300 19619 18987 gene locus_tag LOCUS_27310 19619 18987 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223787.1 protein_id gnl|my_center|LOCUS_27310 21706 19622 gene locus_tag LOCUS_27320 gene kdpB 21706 19622 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223786.1 protein_id gnl|my_center|LOCUS_27320 23352 21703 gene locus_tag LOCUS_27330 gene kdpA 23352 21703 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223785.1 protein_id gnl|my_center|LOCUS_27330 25600 24302 gene locus_tag LOCUS_27340 25600 24302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 25689 29273 gene locus_tag LOCUS_27350 25689 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_27350 29325 29720 gene locus_tag LOCUS_27360 29325 29720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 29946 29770 gene locus_tag LOCUS_27370 29946 29770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 30300 29950 gene locus_tag LOCUS_27380 30300 29950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 30520 30317 gene locus_tag LOCUS_27390 30520 30317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 30615 32162 gene locus_tag LOCUS_27400 30615 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 32959 32168 gene locus_tag LOCUS_27410 32959 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 34864 33026 gene locus_tag LOCUS_27420 34864 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 35040 35792 gene locus_tag LOCUS_27430 35040 35792 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029033.1 protein_id gnl|my_center|LOCUS_27430 35917 36852 gene locus_tag LOCUS_27440 35917 36852 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_27440 37127 37196 gene locus_tag LOCUS_t00320 37127 37196 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 37350 37422 gene locus_tag LOCUS_t00330 37350 37422 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37436 37512 gene locus_tag LOCUS_t00340 37436 37512 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 37545 37619 gene locus_tag LOCUS_t00350 37545 37619 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 37725 38039 gene locus_tag LOCUS_27450 37725 38039 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815632.1 protein_id gnl|my_center|LOCUS_27450 40056 38119 gene locus_tag LOCUS_27460 40056 38119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 41259 40831 gene locus_tag LOCUS_27470 41259 40831 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973660.1 protein_id gnl|my_center|LOCUS_27470 41373 41627 gene locus_tag LOCUS_27480 41373 41627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 42108 41608 gene locus_tag LOCUS_27490 42108 41608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 42343 43437 gene locus_tag LOCUS_27500 42343 43437 CDS product DUF3103 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707631.1 protein_id gnl|my_center|LOCUS_27500 44381 43482 gene locus_tag LOCUS_27510 44381 43482 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_27510 45535 44378 gene locus_tag LOCUS_27520 45535 44378 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_27520 45729 46166 gene locus_tag LOCUS_27530 45729 46166 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226581.1 protein_id gnl|my_center|LOCUS_27530 46163 47455 gene locus_tag LOCUS_27540 46163 47455 CDS product methylaspartate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226582.1 protein_id gnl|my_center|LOCUS_27540 47455 48447 gene locus_tag LOCUS_27550 47455 48447 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226583.1 protein_id gnl|my_center|LOCUS_27550 48444 49703 gene locus_tag LOCUS_27560 48444 49703 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226584.1 protein_id gnl|my_center|LOCUS_27560 49953 49672 gene locus_tag LOCUS_27570 49953 49672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 49841 50932 gene locus_tag LOCUS_27580 49841 50932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_27580 50925 52349 gene locus_tag LOCUS_27590 50925 52349 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223125.1 protein_id gnl|my_center|LOCUS_27590 52386 52595 gene locus_tag LOCUS_27600 52386 52595 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978376.1 protein_id gnl|my_center|LOCUS_27600 52654 66591 gene locus_tag LOCUS_27610 52654 66591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27610 66588 76520 gene locus_tag LOCUS_27620 66588 76520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27620 76517 76885 gene locus_tag LOCUS_27630 76517 76885 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226586.1 protein_id gnl|my_center|LOCUS_27630 76915 77970 gene locus_tag LOCUS_27640 76915 77970 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226587.1 protein_id gnl|my_center|LOCUS_27640 78389 77979 gene locus_tag LOCUS_27650 78389 77979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 79652 78402 gene locus_tag LOCUS_27660 79652 78402 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226590.1 protein_id gnl|my_center|LOCUS_27660 79868 80038 gene locus_tag LOCUS_27670 79868 80038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 83054 80043 gene locus_tag LOCUS_27680 83054 80043 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_27680 83240 83674 gene locus_tag LOCUS_27690 83240 83674 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226640.1 protein_id gnl|my_center|LOCUS_27690 84830 83607 gene locus_tag LOCUS_27700 84830 83607 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_27700 85396 84830 gene locus_tag LOCUS_27710 85396 84830 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227534.1 protein_id gnl|my_center|LOCUS_27710 86967 85705 gene locus_tag LOCUS_27720 86967 85705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 87157 89346 gene locus_tag LOCUS_27730 87157 89346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 89475 90332 gene locus_tag LOCUS_27740 89475 90332 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027634.1 protein_id gnl|my_center|LOCUS_27740 90334 95175 gene locus_tag LOCUS_27750 90334 95175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484681.1 protein_id gnl|my_center|LOCUS_27750 95172 96323 gene locus_tag LOCUS_27760 95172 96323 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_27760 96331 99729 gene locus_tag LOCUS_27770 96331 99729 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031106.1 protein_id gnl|my_center|LOCUS_27770 99726 101465 gene locus_tag LOCUS_27780 99726 101465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027637.1 protein_id gnl|my_center|LOCUS_27780 102123 101488 gene locus_tag LOCUS_27790 102123 101488 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_27790 103332 102187 gene locus_tag LOCUS_27800 103332 102187 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227234.1 protein_id gnl|my_center|LOCUS_27800 103643 104620 gene locus_tag LOCUS_27810 103643 104620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 105297 104632 gene locus_tag LOCUS_27820 105297 104632 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_27820 105615 107252 gene locus_tag LOCUS_27830 105615 107252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 107919 107305 gene locus_tag LOCUS_27840 107919 107305 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_27840 108280 107900 gene locus_tag LOCUS_27850 108280 107900 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_27850 108735 108277 gene locus_tag LOCUS_27860 108735 108277 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_27860 111161 108732 gene locus_tag LOCUS_27870 111161 108732 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229429.1 protein_id gnl|my_center|LOCUS_27870 113045 111435 gene locus_tag LOCUS_27880 113045 111435 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903329.1 protein_id gnl|my_center|LOCUS_27880 113136 113726 gene locus_tag LOCUS_27890 113136 113726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_27890 113802 114758 gene locus_tag LOCUS_27900 113802 114758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 114943 115203 gene locus_tag LOCUS_27910 114943 115203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 115308 116291 gene locus_tag LOCUS_27920 115308 116291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 116302 118692 gene locus_tag LOCUS_27930 116302 118692 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228489.1 protein_id gnl|my_center|LOCUS_27930 118828 119787 gene locus_tag LOCUS_27940 118828 119787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 119872 120693 gene locus_tag LOCUS_27950 119872 120693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 121616 120798 gene locus_tag LOCUS_27960 121616 120798 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878779.1 protein_id gnl|my_center|LOCUS_27960 122648 121632 gene locus_tag LOCUS_27970 122648 121632 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731581.1 protein_id gnl|my_center|LOCUS_27970 123980 122688 gene locus_tag LOCUS_27980 123980 122688 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_27980 124498 123977 gene locus_tag LOCUS_27990 124498 123977 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731582.1 protein_id gnl|my_center|LOCUS_27990 125640 124495 gene locus_tag LOCUS_28000 125640 124495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_28000 125769 126707 gene locus_tag LOCUS_28010 125769 126707 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897528.1 protein_id gnl|my_center|LOCUS_28010 128066 126894 gene locus_tag LOCUS_28020 128066 126894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 128490 128257 gene locus_tag LOCUS_28030 128490 128257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 129141 128509 gene locus_tag LOCUS_28040 129141 128509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903230.1 protein_id gnl|my_center|LOCUS_28040 129252 130583 gene locus_tag LOCUS_28050 129252 130583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 protein_id gnl|my_center|LOCUS_28050 130662 131849 gene locus_tag LOCUS_28060 130662 131849 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_28060 131846 133054 gene locus_tag LOCUS_28070 131846 133054 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_28070 133071 133448 gene locus_tag LOCUS_28080 133071 133448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 133563 134378 gene locus_tag LOCUS_28090 133563 134378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 134466 134774 gene locus_tag LOCUS_28100 134466 134774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 134782 136119 gene locus_tag LOCUS_28110 134782 136119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 136116 136610 gene locus_tag LOCUS_28120 136116 136610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224118.1 protein_id gnl|my_center|LOCUS_28120 136607 136888 gene locus_tag LOCUS_28130 136607 136888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 138152 136896 gene locus_tag LOCUS_28140 138152 136896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 138477 138175 gene locus_tag LOCUS_28150 138477 138175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 139938 138493 gene locus_tag LOCUS_28160 139938 138493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 140264 139935 gene locus_tag LOCUS_28170 140264 139935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 140662 140261 gene locus_tag LOCUS_28180 140662 140261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 141395 140652 gene locus_tag LOCUS_28190 141395 140652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 141736 141392 gene locus_tag LOCUS_28200 141736 141392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 142829 141723 gene locus_tag LOCUS_28210 142829 141723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 145137 142921 gene locus_tag LOCUS_28220 145137 142921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 147023 145224 gene locus_tag LOCUS_28230 147023 145224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 147586 148350 gene locus_tag LOCUS_28240 147586 148350 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065256.1 protein_id gnl|my_center|LOCUS_28240 148347 149612 gene locus_tag LOCUS_28250 148347 149612 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_28250 149657 150928 gene locus_tag LOCUS_28260 149657 150928 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227575.1 protein_id gnl|my_center|LOCUS_28260 150994 151806 gene locus_tag LOCUS_28270 150994 151806 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_28270 151803 152636 gene locus_tag LOCUS_28280 151803 152636 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 protein_id gnl|my_center|LOCUS_28280 152640 155429 gene locus_tag LOCUS_28290 152640 155429 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_28290 155436 157016 gene locus_tag LOCUS_28300 155436 157016 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_28300 157016 158488 gene locus_tag LOCUS_28310 157016 158488 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_28310 158485 158790 gene locus_tag LOCUS_28320 158485 158790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 159398 158946 gene locus_tag LOCUS_28330 159398 158946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 159610 159855 gene locus_tag LOCUS_28340 159610 159855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 159880 161505 gene locus_tag LOCUS_28350 159880 161505 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850187.1 protein_id gnl|my_center|LOCUS_28350 161502 162554 gene locus_tag LOCUS_28360 161502 162554 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 protein_id gnl|my_center|LOCUS_28360 162632 163303 gene locus_tag LOCUS_28370 162632 163303 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084755.1 protein_id gnl|my_center|LOCUS_28370 163316 164506 gene locus_tag LOCUS_28380 163316 164506 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_28380 165271 164561 gene locus_tag LOCUS_28390 165271 164561 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_28390 166535 165264 gene locus_tag LOCUS_28400 166535 165264 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_28400 166423 166701 gene locus_tag LOCUS_28410 166423 166701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 168365 166755 gene locus_tag LOCUS_28420 168365 166755 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_28420 <168913 168362 gene locus_tag LOCUS_28430 <168913 168362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222248.1:ABC transporter ATP-binding protein >Feature sequence11 <1 6579 gene locus_tag LOCUS_28440 <1 6579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030787.1:type I polyketide synthase 6602 9244 gene locus_tag LOCUS_28450 6602 9244 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156089687.1 protein_id gnl|my_center|LOCUS_28450 10004 9252 gene locus_tag LOCUS_28460 10004 9252 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_28460 10754 10038 gene locus_tag LOCUS_28470 10754 10038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_28470 11688 10756 gene locus_tag LOCUS_28480 11688 10756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_28480 12245 15067 gene locus_tag LOCUS_28490 12245 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 15073 17892 gene locus_tag LOCUS_28500 15073 17892 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156089687.1 protein_id gnl|my_center|LOCUS_28500 18114 21089 gene locus_tag LOCUS_28510 18114 21089 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223082.1 protein_id gnl|my_center|LOCUS_28510 21564 22190 gene locus_tag LOCUS_28520 21564 22190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 22315 24042 gene locus_tag LOCUS_28530 22315 24042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_28530 24039 25904 gene locus_tag LOCUS_28540 24039 25904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776837.1 protein_id gnl|my_center|LOCUS_28540 27367 26069 gene locus_tag LOCUS_28550 27367 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 28089 27424 gene locus_tag LOCUS_28560 28089 27424 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_28560 28307 29179 gene locus_tag LOCUS_28570 28307 29179 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_28570 29176 30174 gene locus_tag LOCUS_28580 29176 30174 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047667.1 protein_id gnl|my_center|LOCUS_28580 30459 30178 gene locus_tag LOCUS_28590 30459 30178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229080.1 protein_id gnl|my_center|LOCUS_28590 31662 30574 gene locus_tag LOCUS_28600 31662 30574 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027220.1 protein_id gnl|my_center|LOCUS_28600 33838 31829 gene locus_tag LOCUS_28610 33838 31829 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486780.1 protein_id gnl|my_center|LOCUS_28610 33952 34317 gene locus_tag LOCUS_28620 33952 34317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 34296 34700 gene locus_tag LOCUS_28630 34296 34700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 34766 36247 gene locus_tag LOCUS_28640 34766 36247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 36901 36221 gene locus_tag LOCUS_28650 36901 36221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 37061 37507 gene locus_tag LOCUS_28660 37061 37507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 37997 37647 gene locus_tag LOCUS_28670 37997 37647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 38524 38162 gene locus_tag LOCUS_28680 38524 38162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 39229 38624 gene locus_tag LOCUS_28690 39229 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 39356 39583 gene locus_tag LOCUS_28700 39356 39583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 40113 39478 gene locus_tag LOCUS_28710 40113 39478 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808122.1 protein_id gnl|my_center|LOCUS_28710 41156 40110 gene locus_tag LOCUS_28720 41156 40110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 41694 41161 gene locus_tag LOCUS_28730 41694 41161 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031802.1 protein_id gnl|my_center|LOCUS_28730 42925 41933 gene locus_tag LOCUS_28740 42925 41933 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_28740 43019 43426 gene locus_tag LOCUS_28750 43019 43426 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_28750 44414 43431 gene locus_tag LOCUS_28760 44414 43431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 44862 44536 gene locus_tag LOCUS_28770 44862 44536 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_28770 45005 45424 gene locus_tag LOCUS_28780 45005 45424 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_28780 46818 45664 gene locus_tag LOCUS_28790 46818 45664 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_28790 47036 47536 gene locus_tag LOCUS_28800 47036 47536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 47661 48620 gene locus_tag LOCUS_28810 47661 48620 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_28810 48681 51011 gene locus_tag LOCUS_28820 48681 51011 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_28820 51433 51143 gene locus_tag LOCUS_28830 51433 51143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 52155 51547 gene locus_tag LOCUS_28840 52155 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 53277 52168 gene locus_tag LOCUS_28850 53277 52168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 53475 55865 gene locus_tag LOCUS_28860 53475 55865 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_28860 55935 56360 gene locus_tag LOCUS_28870 55935 56360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 57372 56419 gene locus_tag LOCUS_28880 57372 56419 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_28880 57397 58104 gene locus_tag LOCUS_28890 57397 58104 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244058.1 protein_id gnl|my_center|LOCUS_28890 58298 60484 gene locus_tag LOCUS_28900 58298 60484 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224095.1 protein_id gnl|my_center|LOCUS_28900 61853 60489 gene locus_tag LOCUS_28910 61853 60489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228261.1 protein_id gnl|my_center|LOCUS_28910 62889 61924 gene locus_tag LOCUS_28920 62889 61924 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_28920 62937 63722 gene locus_tag LOCUS_28930 gene hisN 62937 63722 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_28930 63762 66149 gene locus_tag LOCUS_28940 63762 66149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 67531 66140 gene locus_tag LOCUS_28950 67531 66140 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_28950 68208 67528 gene locus_tag LOCUS_28960 68208 67528 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 protein_id gnl|my_center|LOCUS_28960 69006 68251 gene locus_tag LOCUS_28970 69006 68251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225024.1 protein_id gnl|my_center|LOCUS_28970 69944 69003 gene locus_tag LOCUS_28980 69944 69003 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_28980 71090 70188 gene locus_tag LOCUS_28990 71090 70188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28990 71751 71083 gene locus_tag LOCUS_29000 71751 71083 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_29000 71867 72790 gene locus_tag LOCUS_29010 71867 72790 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027675.1 protein_id gnl|my_center|LOCUS_29010 72787 74175 gene locus_tag LOCUS_29020 72787 74175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_29020 74172 74756 gene locus_tag LOCUS_29030 74172 74756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 75706 74855 gene locus_tag LOCUS_29040 75706 74855 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466665.1 protein_id gnl|my_center|LOCUS_29040 75805 76095 gene locus_tag LOCUS_29050 75805 76095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 78329 76140 gene locus_tag LOCUS_29060 78329 76140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 78521 79051 gene locus_tag LOCUS_29070 78521 79051 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_29070 79044 79814 gene locus_tag LOCUS_29080 79044 79814 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229219.1 protein_id gnl|my_center|LOCUS_29080 80170 80547 gene locus_tag LOCUS_29090 80170 80547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 80563 81009 gene locus_tag LOCUS_29100 80563 81009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 81679 80933 gene locus_tag LOCUS_29110 81679 80933 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227159.1 protein_id gnl|my_center|LOCUS_29110 82575 81676 gene locus_tag LOCUS_29120 82575 81676 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974694.1 protein_id gnl|my_center|LOCUS_29120 83722 82577 gene locus_tag LOCUS_29130 83722 82577 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969230.1 protein_id gnl|my_center|LOCUS_29130 86910 83719 gene locus_tag LOCUS_29140 86910 83719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 87010 87804 gene locus_tag LOCUS_29150 87010 87804 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257233.1 protein_id gnl|my_center|LOCUS_29150 87801 88703 gene locus_tag LOCUS_29160 87801 88703 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 protein_id gnl|my_center|LOCUS_29160 88700 89605 gene locus_tag LOCUS_29170 88700 89605 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_29170 89633 90907 gene locus_tag LOCUS_29180 89633 90907 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975589.1 protein_id gnl|my_center|LOCUS_29180 90927 91739 gene locus_tag LOCUS_29190 90927 91739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 93494 91740 gene locus_tag LOCUS_29200 93494 91740 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_29200 93504 94715 gene locus_tag LOCUS_29210 93504 94715 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_29210 94723 95466 gene locus_tag LOCUS_29220 94723 95466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 96864 95395 gene locus_tag LOCUS_29230 96864 95395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_29230 100021 97019 gene locus_tag LOCUS_29240 100021 97019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 100894 100154 gene locus_tag LOCUS_29250 100894 100154 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_29250 101360 102259 gene locus_tag LOCUS_29260 101360 102259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 102271 102930 gene locus_tag LOCUS_29270 102271 102930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 104160 102976 gene locus_tag LOCUS_29280 104160 102976 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_29280 104329 105417 gene locus_tag LOCUS_29290 104329 105417 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_29290 105414 106907 gene locus_tag LOCUS_29300 105414 106907 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_29300 106904 107917 gene locus_tag LOCUS_29310 106904 107917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523473.1 protein_id gnl|my_center|LOCUS_29310 107914 108945 gene locus_tag LOCUS_29320 107914 108945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707231.1 protein_id gnl|my_center|LOCUS_29320 108969 110147 gene locus_tag LOCUS_29330 108969 110147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 110171 110995 gene locus_tag LOCUS_29340 110171 110995 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_29340 111058 115833 gene locus_tag LOCUS_29350 111058 115833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 117450 115987 gene locus_tag LOCUS_29360 117450 115987 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230071.1 protein_id gnl|my_center|LOCUS_29360 117614 118951 gene locus_tag LOCUS_29370 117614 118951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 119131 120270 gene locus_tag LOCUS_29380 119131 120270 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391455.1 protein_id gnl|my_center|LOCUS_29380 120260 121519 gene locus_tag LOCUS_29390 120260 121519 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_29390 121522 122442 gene locus_tag LOCUS_29400 121522 122442 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731057.1 protein_id gnl|my_center|LOCUS_29400 123504 122659 gene locus_tag LOCUS_29410 123504 122659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 124058 123501 gene locus_tag LOCUS_29420 124058 123501 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296687.1 protein_id gnl|my_center|LOCUS_29420 124113 124478 gene locus_tag LOCUS_29430 124113 124478 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859631.1 protein_id gnl|my_center|LOCUS_29430 125646 124468 gene locus_tag LOCUS_29440 125646 124468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 125756 126805 gene locus_tag LOCUS_29450 125756 126805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 127395 126796 gene locus_tag LOCUS_29460 127395 126796 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839715.1 protein_id gnl|my_center|LOCUS_29460 128243 127392 gene locus_tag LOCUS_29470 128243 127392 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_29470 129332 128271 gene locus_tag LOCUS_29480 129332 128271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 130135 129347 gene locus_tag LOCUS_29490 130135 129347 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_29490 131526 130132 gene locus_tag LOCUS_29500 131526 130132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_29500 132437 131526 gene locus_tag LOCUS_29510 132437 131526 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_29510 132569 133525 gene locus_tag LOCUS_29520 132569 133525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 133522 134178 gene locus_tag LOCUS_29530 133522 134178 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_29530 135270 134149 gene locus_tag LOCUS_29540 135270 134149 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_29540 136051 135365 gene locus_tag LOCUS_29550 136051 135365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 136256 136993 gene locus_tag LOCUS_29560 136256 136993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 137031 137717 gene locus_tag LOCUS_29570 137031 137717 CDS product DUF6529 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226053.1 protein_id gnl|my_center|LOCUS_29570 137732 138529 gene locus_tag LOCUS_29580 137732 138529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 139874 138855 gene locus_tag LOCUS_29590 139874 138855 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_29590 139976 140392 gene locus_tag LOCUS_29600 139976 140392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 141797 140418 gene locus_tag LOCUS_29610 141797 140418 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_29610 141990 142823 gene locus_tag LOCUS_29620 141990 142823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_29620 144336 142912 gene locus_tag LOCUS_29630 144336 142912 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742083.1 protein_id gnl|my_center|LOCUS_29630 144411 145454 gene locus_tag LOCUS_29640 gene kdd 144411 145454 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_29640 145451 146887 gene locus_tag LOCUS_29650 145451 146887 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226567.1 protein_id gnl|my_center|LOCUS_29650 146888 148585 gene locus_tag LOCUS_29660 146888 148585 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_29660 148582 149316 gene locus_tag LOCUS_29670 148582 149316 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_29670 149313 149702 gene locus_tag LOCUS_29680 149313 149702 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_29680 149791 151848 gene locus_tag LOCUS_29690 149791 151848 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 protein_id gnl|my_center|LOCUS_29690 152198 151845 gene locus_tag LOCUS_29700 152198 151845 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_29700 152641 152192 gene locus_tag LOCUS_29710 152641 152192 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225292.1 protein_id gnl|my_center|LOCUS_29710 152685 153086 gene locus_tag LOCUS_29720 152685 153086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 154051 153062 gene locus_tag LOCUS_29730 154051 153062 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226128.1 protein_id gnl|my_center|LOCUS_29730 154675 154055 gene locus_tag LOCUS_29740 154675 154055 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_29740 155231 155398 gene locus_tag LOCUS_29750 155231 155398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 155627 157255 gene locus_tag LOCUS_29760 gene lnt 155627 157255 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_29760 157301 158059 gene locus_tag LOCUS_29770 157301 158059 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_29770 158474 158130 gene locus_tag LOCUS_29780 158474 158130 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081521.1 protein_id gnl|my_center|LOCUS_29780 159461 158718 gene locus_tag LOCUS_29790 159461 158718 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285024.1 protein_id gnl|my_center|LOCUS_29790 160903 159476 gene locus_tag LOCUS_29800 160903 159476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226560.1 protein_id gnl|my_center|LOCUS_29800 161063 161689 gene locus_tag LOCUS_29810 161063 161689 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226559.1 protein_id gnl|my_center|LOCUS_29810 162382 161705 gene locus_tag LOCUS_29820 162382 161705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 162425 163042 gene locus_tag LOCUS_29830 gene rpoE 162425 163042 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_29830 163035 163754 gene locus_tag LOCUS_29840 163035 163754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 164545 163751 gene locus_tag LOCUS_29850 164545 163751 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226558.1 protein_id gnl|my_center|LOCUS_29850 164614 164976 gene locus_tag LOCUS_29860 164614 164976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226557.1 protein_id gnl|my_center|LOCUS_29860 165038 166741 gene locus_tag LOCUS_29870 165038 166741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 166804 167049 gene locus_tag LOCUS_29880 166804 167049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence12 142 1035 gene locus_tag LOCUS_29890 gene miaA 142 1035 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_29890 1046 1855 gene locus_tag LOCUS_29900 gene dapF 1046 1855 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_29900 1933 3396 gene locus_tag LOCUS_29910 gene hflX 1933 3396 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224262.1 protein_id gnl|my_center|LOCUS_29910 3441 4499 gene locus_tag LOCUS_29920 3441 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224263.1 protein_id gnl|my_center|LOCUS_29920 5280 4504 gene locus_tag LOCUS_29930 gene lexA 5280 4504 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091617684.1 protein_id gnl|my_center|LOCUS_29930 5511 5981 gene locus_tag LOCUS_29940 5511 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 6467 5940 gene locus_tag LOCUS_29950 6467 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 6914 6705 gene locus_tag LOCUS_29960 6914 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 6826 7158 gene locus_tag LOCUS_29970 6826 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 7278 11153 gene locus_tag LOCUS_29980 7278 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 11241 11696 gene locus_tag LOCUS_29990 11241 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 12110 11733 gene locus_tag LOCUS_30000 12110 11733 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 protein_id gnl|my_center|LOCUS_30000 12436 12107 gene locus_tag LOCUS_30010 12436 12107 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226554.1 protein_id gnl|my_center|LOCUS_30010 12882 12433 gene locus_tag LOCUS_30020 12882 12433 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029408.1 protein_id gnl|my_center|LOCUS_30020 13341 12955 gene locus_tag LOCUS_30030 13341 12955 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_30030 13417 14277 gene locus_tag LOCUS_30040 13417 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 16249 14228 gene locus_tag LOCUS_30050 16249 14228 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466817.1 protein_id gnl|my_center|LOCUS_30050 17065 16268 gene locus_tag LOCUS_30060 17065 16268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 18015 17062 gene locus_tag LOCUS_30070 18015 17062 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_30070 19112 18012 gene locus_tag LOCUS_30080 19112 18012 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_30080 21523 19121 gene locus_tag LOCUS_30090 21523 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 22647 21661 gene locus_tag LOCUS_30100 22647 21661 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_30100 22821 23621 gene locus_tag LOCUS_30110 22821 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 25567 24392 gene locus_tag LOCUS_30120 25567 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 25595 26548 gene locus_tag LOCUS_30130 25595 26548 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086670594.1 protein_id gnl|my_center|LOCUS_30130 26570 27391 gene locus_tag LOCUS_30140 26570 27391 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257385.1 protein_id gnl|my_center|LOCUS_30140 31059 28129 gene locus_tag LOCUS_30150 31059 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 32262 31618 gene locus_tag LOCUS_30160 32262 31618 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228115.1 protein_id gnl|my_center|LOCUS_30160 32377 33102 gene locus_tag LOCUS_30170 32377 33102 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191067.1 protein_id gnl|my_center|LOCUS_30170 33323 33745 gene locus_tag LOCUS_30180 33323 33745 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222738.1 protein_id gnl|my_center|LOCUS_30180 34900 33866 gene locus_tag LOCUS_30190 gene add 34900 33866 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_30190 35134 36177 gene locus_tag LOCUS_30200 35134 36177 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111537.1 protein_id gnl|my_center|LOCUS_30200 37179 36217 gene locus_tag LOCUS_30210 gene galE 37179 36217 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_30210 38456 37236 gene locus_tag LOCUS_30220 gene galK 38456 37236 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224288.1 protein_id gnl|my_center|LOCUS_30220 39219 38524 gene locus_tag LOCUS_30230 39219 38524 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224289.1 protein_id gnl|my_center|LOCUS_30230 39549 40343 gene locus_tag LOCUS_30240 39549 40343 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_30240 40533 41708 gene locus_tag LOCUS_30250 40533 41708 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_30250 41719 45039 gene locus_tag LOCUS_30260 41719 45039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 45092 45562 gene locus_tag LOCUS_30270 45092 45562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224436.1 protein_id gnl|my_center|LOCUS_30270 45663 46244 gene locus_tag LOCUS_30280 45663 46244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 48001 46256 gene locus_tag LOCUS_30290 48001 46256 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224438.1 protein_id gnl|my_center|LOCUS_30290 49201 48230 gene locus_tag LOCUS_30300 49201 48230 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224439.1 protein_id gnl|my_center|LOCUS_30300 52317 49561 gene locus_tag LOCUS_30310 52317 49561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 54083 52314 gene locus_tag LOCUS_30320 54083 52314 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027769.1 protein_id gnl|my_center|LOCUS_30320 54646 54212 gene locus_tag LOCUS_30330 gene dtd 54646 54212 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224440.1 protein_id gnl|my_center|LOCUS_30330 55402 54662 gene locus_tag LOCUS_30340 55402 54662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 55504 55815 gene locus_tag LOCUS_30350 55504 55815 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224443.1 protein_id gnl|my_center|LOCUS_30350 56687 55812 gene locus_tag LOCUS_30360 56687 55812 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_30360 56735 57547 gene locus_tag LOCUS_30370 56735 57547 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_30370 57540 58334 gene locus_tag LOCUS_30380 57540 58334 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804599.1 protein_id gnl|my_center|LOCUS_30380 58331 59290 gene locus_tag LOCUS_30390 58331 59290 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_30390 60210 59275 gene locus_tag LOCUS_30400 60210 59275 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224445.1 protein_id gnl|my_center|LOCUS_30400 61079 60273 gene locus_tag LOCUS_30410 61079 60273 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224447.1 protein_id gnl|my_center|LOCUS_30410 61138 61380 gene locus_tag LOCUS_30420 61138 61380 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284335.1 protein_id gnl|my_center|LOCUS_30420 62580 61384 gene locus_tag LOCUS_30430 62580 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 62818 64551 gene locus_tag LOCUS_30440 62818 64551 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224452.1 protein_id gnl|my_center|LOCUS_30440 64729 65859 gene locus_tag LOCUS_30450 64729 65859 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224453.1 protein_id gnl|my_center|LOCUS_30450 65930 66703 gene locus_tag LOCUS_30460 65930 66703 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_30460 66724 68157 gene locus_tag LOCUS_30470 66724 68157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224455.1 protein_id gnl|my_center|LOCUS_30470 68190 69377 gene locus_tag LOCUS_30480 68190 69377 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_30480 69657 69472 gene locus_tag LOCUS_30490 69657 69472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224457.1 protein_id gnl|my_center|LOCUS_30490 69927 70721 gene locus_tag LOCUS_30500 69927 70721 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224458.1 protein_id gnl|my_center|LOCUS_30500 72011 70755 gene locus_tag LOCUS_30510 72011 70755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 73129 72368 gene locus_tag LOCUS_30520 73129 72368 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_30520 73252 74001 gene locus_tag LOCUS_30530 73252 74001 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_30530 74729 74022 gene locus_tag LOCUS_30540 gene cei 74729 74022 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224475.1 protein_id gnl|my_center|LOCUS_30540 75260 75568 gene locus_tag LOCUS_30550 75260 75568 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224476.1 protein_id gnl|my_center|LOCUS_30550 76050 75574 gene locus_tag LOCUS_30560 76050 75574 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224477.1 protein_id gnl|my_center|LOCUS_30560 76129 76587 gene locus_tag LOCUS_30570 gene dut 76129 76587 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_30570 76593 77306 gene locus_tag LOCUS_30580 76593 77306 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224479.1 protein_id gnl|my_center|LOCUS_30580 77314 77934 gene locus_tag LOCUS_30590 77314 77934 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479837.1 protein_id gnl|my_center|LOCUS_30590 78149 77931 gene locus_tag LOCUS_30600 78149 77931 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974619.1 protein_id gnl|my_center|LOCUS_30600 78700 78149 gene locus_tag LOCUS_30610 78700 78149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 79443 78754 gene locus_tag LOCUS_30620 79443 78754 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224480.1 protein_id gnl|my_center|LOCUS_30620 79593 79973 gene locus_tag LOCUS_30630 79593 79973 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224481.1 protein_id gnl|my_center|LOCUS_30630 79970 80692 gene locus_tag LOCUS_30640 79970 80692 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_30640 81324 80701 gene locus_tag LOCUS_30650 81324 80701 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_30650 81400 82320 gene locus_tag LOCUS_30660 81400 82320 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_30660 82980 82324 gene locus_tag LOCUS_30670 82980 82324 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003067924.1 protein_id gnl|my_center|LOCUS_30670 83646 82981 gene locus_tag LOCUS_30680 83646 82981 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851807.1 protein_id gnl|my_center|LOCUS_30680 83743 85764 gene locus_tag LOCUS_30690 83743 85764 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742167.1 protein_id gnl|my_center|LOCUS_30690 85761 86948 gene locus_tag LOCUS_30700 85761 86948 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224485.1 protein_id gnl|my_center|LOCUS_30700 88669 88917 gene locus_tag LOCUS_30710 88669 88917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 93871 89450 gene locus_tag LOCUS_30720 93871 89450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 93969 95912 gene locus_tag LOCUS_30730 gene dxs 93969 95912 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224488.1 protein_id gnl|my_center|LOCUS_30730 95939 96613 gene locus_tag LOCUS_30740 95939 96613 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 protein_id gnl|my_center|LOCUS_30740 96610 97737 gene locus_tag LOCUS_30750 96610 97737 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224496.1 protein_id gnl|my_center|LOCUS_30750 98575 97769 gene locus_tag LOCUS_30760 98575 97769 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_30760 99081 98581 gene locus_tag LOCUS_30770 99081 98581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 101032 99116 gene locus_tag LOCUS_30780 101032 99116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 101875 101051 gene locus_tag LOCUS_30790 101875 101051 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230275.1 protein_id gnl|my_center|LOCUS_30790 103135 101882 gene locus_tag LOCUS_30800 103135 101882 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224510.1 protein_id gnl|my_center|LOCUS_30800 103995 103279 gene locus_tag LOCUS_30810 103995 103279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 104250 105404 gene locus_tag LOCUS_30820 104250 105404 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_30820 105877 105392 gene locus_tag LOCUS_30830 105877 105392 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284339.1 protein_id gnl|my_center|LOCUS_30830 106081 107139 gene locus_tag LOCUS_30840 gene hemE 106081 107139 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224512.1 protein_id gnl|my_center|LOCUS_30840 107181 108602 gene locus_tag LOCUS_30850 gene hemG 107181 108602 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_30850 108618 109307 gene locus_tag LOCUS_30860 108618 109307 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_30860 112584 109330 gene locus_tag LOCUS_30870 112584 109330 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_30870 112944 116936 gene locus_tag LOCUS_30880 112944 116936 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 protein_id gnl|my_center|LOCUS_30880 117903 117169 gene locus_tag LOCUS_30890 117903 117169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 118738 120672 gene locus_tag LOCUS_30900 118738 120672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 120923 120669 gene locus_tag LOCUS_30910 120923 120669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 120820 122691 gene locus_tag LOCUS_30920 120820 122691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 123458 122688 gene locus_tag LOCUS_30930 123458 122688 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284974.1 protein_id gnl|my_center|LOCUS_30930 123648 125714 gene locus_tag LOCUS_30940 123648 125714 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_30940 128554 125705 gene locus_tag LOCUS_30950 128554 125705 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223918.1 protein_id gnl|my_center|LOCUS_30950 128688 129824 gene locus_tag LOCUS_30960 128688 129824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 129826 130296 gene locus_tag LOCUS_30970 129826 130296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 131048 130293 gene locus_tag LOCUS_30980 131048 130293 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_30980 131235 134303 gene locus_tag LOCUS_30990 131235 134303 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441479.1 protein_id gnl|my_center|LOCUS_30990 134363 135211 gene locus_tag LOCUS_31000 134363 135211 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_31000 135378 135226 gene locus_tag LOCUS_31010 135378 135226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 136136 135687 gene locus_tag LOCUS_31020 136136 135687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 137140 136292 gene locus_tag LOCUS_31030 137140 136292 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028631.1 protein_id gnl|my_center|LOCUS_31030 137491 137198 gene locus_tag LOCUS_31040 137491 137198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 137975 137622 gene locus_tag LOCUS_31050 137975 137622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 137892 138374 gene locus_tag LOCUS_31060 137892 138374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 138371 138688 gene locus_tag LOCUS_31070 138371 138688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 139130 138714 gene locus_tag LOCUS_31080 139130 138714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 140122 139247 gene locus_tag LOCUS_31090 140122 139247 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_31090 141184 140171 gene locus_tag LOCUS_31100 141184 140171 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226641.1 protein_id gnl|my_center|LOCUS_31100 141807 141184 gene locus_tag LOCUS_31110 141807 141184 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742149.1 protein_id gnl|my_center|LOCUS_31110 142639 141869 gene locus_tag LOCUS_31120 142639 141869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 142961 142746 gene locus_tag LOCUS_31130 142961 142746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 144560 142965 gene locus_tag LOCUS_31140 144560 142965 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727486.1 protein_id gnl|my_center|LOCUS_31140 145963 144983 gene locus_tag LOCUS_31150 145963 144983 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230423.1 protein_id gnl|my_center|LOCUS_31150 146255 145980 gene locus_tag LOCUS_31160 146255 145980 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229582.1 protein_id gnl|my_center|LOCUS_31160 146874 146293 gene locus_tag LOCUS_31170 146874 146293 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_31170 147229 146855 gene locus_tag LOCUS_31180 147229 146855 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_31180 147651 147226 gene locus_tag LOCUS_31190 147651 147226 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_31190 149978 147684 gene locus_tag LOCUS_31200 149978 147684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229429.1 protein_id gnl|my_center|LOCUS_31200 147883 147979 gene locus_tag LOCUS_t00360 147883 147979 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 150334 150143 gene locus_tag LOCUS_31210 150334 150143 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_31210 150987 150331 gene locus_tag LOCUS_31220 150987 150331 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896256.1 protein_id gnl|my_center|LOCUS_31220 152198 150981 gene locus_tag LOCUS_31230 152198 150981 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467629.1 protein_id gnl|my_center|LOCUS_31230 154489 152297 gene locus_tag LOCUS_31240 154489 152297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 154944 154486 gene locus_tag LOCUS_31250 154944 154486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 155272 157641 gene locus_tag LOCUS_31260 155272 157641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 157670 160477 gene locus_tag LOCUS_31270 157670 160477 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_31270 160504 162204 gene locus_tag LOCUS_31280 160504 162204 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_31280 163620 162220 gene locus_tag LOCUS_31290 163620 162220 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_31290 163706 164464 gene locus_tag LOCUS_31300 163706 164464 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229990.1 protein_id gnl|my_center|LOCUS_31300 164476 164952 gene locus_tag LOCUS_31310 gene rnhA 164476 164952 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227882.1 protein_id gnl|my_center|LOCUS_31310 165045 165395 gene locus_tag LOCUS_31320 165045 165395 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223907.1 protein_id gnl|my_center|LOCUS_31320 165397 166683 gene locus_tag LOCUS_31330 165397 166683 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 protein_id gnl|my_center|LOCUS_31330 167198 168580 gene locus_tag LOCUS_31340 167198 168580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 169520 168633 gene locus_tag LOCUS_31350 169520 168633 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831427.1 protein_id gnl|my_center|LOCUS_31350 169694 171571 gene locus_tag LOCUS_31360 169694 171571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 171616 172089 gene locus_tag LOCUS_31370 171616 172089 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897922.1 protein_id gnl|my_center|LOCUS_31370 172147 172788 gene locus_tag LOCUS_31380 172147 172788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 172790 173566 gene locus_tag LOCUS_31390 172790 173566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_31390 174428 173592 gene locus_tag LOCUS_31400 174428 173592 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_31400 174639 175202 gene locus_tag LOCUS_31410 gene wrbA 174639 175202 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_31410 175232 176344 gene locus_tag LOCUS_31420 175232 176344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 176361 176684 gene locus_tag LOCUS_31430 176361 176684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 176681 177868 gene locus_tag LOCUS_31440 176681 177868 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_31440 177850 178572 gene locus_tag LOCUS_31450 177850 178572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 178569 179411 gene locus_tag LOCUS_31460 178569 179411 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227244.1 protein_id gnl|my_center|LOCUS_31460 179408 180343 gene locus_tag LOCUS_31470 179408 180343 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_31470 180359 180793 gene locus_tag LOCUS_31480 180359 180793 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_31480 180790 182061 gene locus_tag LOCUS_31490 180790 182061 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973654.1 protein_id gnl|my_center|LOCUS_31490 182058 183269 gene locus_tag LOCUS_31500 182058 183269 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030171.1 protein_id gnl|my_center|LOCUS_31500 183310 183549 gene locus_tag LOCUS_31510 183310 183549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 183551 184003 gene locus_tag LOCUS_31520 183551 184003 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_31520 184000 185172 gene locus_tag LOCUS_31530 184000 185172 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223791.1 protein_id gnl|my_center|LOCUS_31530 185188 186360 gene locus_tag LOCUS_31540 185188 186360 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223791.1 protein_id gnl|my_center|LOCUS_31540 186380 186703 gene locus_tag LOCUS_31550 186380 186703 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 protein_id gnl|my_center|LOCUS_31550 186714 187727 gene locus_tag LOCUS_31560 186714 187727 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_31560 188577 187804 gene locus_tag LOCUS_31570 188577 187804 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_31570 188661 189278 gene locus_tag LOCUS_31580 gene wrbA 188661 189278 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228078.1 protein_id gnl|my_center|LOCUS_31580 189275 190639 gene locus_tag LOCUS_31590 189275 190639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531249.1 protein_id gnl|my_center|LOCUS_31590 190758 191255 gene locus_tag LOCUS_31600 190758 191255 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528223.1 protein_id gnl|my_center|LOCUS_31600 191616 193298 gene locus_tag LOCUS_31610 191616 193298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 193295 193741 gene locus_tag LOCUS_31620 193295 193741 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390187.1 protein_id gnl|my_center|LOCUS_31620 193758 195110 gene locus_tag LOCUS_31630 gene accC 193758 195110 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_31630 195149 195763 gene locus_tag LOCUS_31640 195149 195763 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_31640 196983 195895 gene locus_tag LOCUS_31650 196983 195895 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_31650 198608 197091 gene locus_tag LOCUS_31660 198608 197091 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967515.1 protein_id gnl|my_center|LOCUS_31660 199437 198817 gene locus_tag LOCUS_31670 199437 198817 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_31670 200246 199509 gene locus_tag LOCUS_31680 200246 199509 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_31680 200973 200254 gene locus_tag LOCUS_31690 200973 200254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 201099 202469 gene locus_tag LOCUS_31700 201099 202469 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225907.1 protein_id gnl|my_center|LOCUS_31700 202549 202857 gene locus_tag LOCUS_31710 202549 202857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 202859 204256 gene locus_tag LOCUS_31720 202859 204256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 204253 205053 gene locus_tag LOCUS_31730 204253 205053 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231008.1 protein_id gnl|my_center|LOCUS_31730 205523 205092 gene locus_tag LOCUS_31740 205523 205092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 206625 205528 gene locus_tag LOCUS_31750 206625 205528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_31750 208019 206856 gene locus_tag LOCUS_31760 208019 206856 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328620.1 protein_id gnl|my_center|LOCUS_31760 208150 208800 gene locus_tag LOCUS_31770 208150 208800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 208910 210163 gene locus_tag LOCUS_31780 208910 210163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 210176 210688 gene locus_tag LOCUS_31790 210176 210688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 210803 215323 gene locus_tag LOCUS_31800 210803 215323 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223320.1 protein_id gnl|my_center|LOCUS_31800 215320 215712 gene locus_tag LOCUS_31810 215320 215712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 215840 215989 gene locus_tag LOCUS_31820 215840 215989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 215996 217714 gene locus_tag LOCUS_31830 215996 217714 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_31830 217708 218499 gene locus_tag LOCUS_31840 217708 218499 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228687.1 protein_id gnl|my_center|LOCUS_31840 219101 218496 gene locus_tag LOCUS_31850 219101 218496 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892887.1 protein_id gnl|my_center|LOCUS_31850 220576 219098 gene locus_tag LOCUS_31860 220576 219098 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727704.1 protein_id gnl|my_center|LOCUS_31860 220865 220671 gene locus_tag LOCUS_31870 220865 220671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 221322 222668 gene locus_tag LOCUS_31880 221322 222668 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393312.1 protein_id gnl|my_center|LOCUS_31880 222762 223955 gene locus_tag LOCUS_31890 222762 223955 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228689.1 protein_id gnl|my_center|LOCUS_31890 223999 224202 gene locus_tag LOCUS_31900 223999 224202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 224463 226940 gene locus_tag LOCUS_31910 224463 226940 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223788.1 protein_id gnl|my_center|LOCUS_31910 228258 226912 gene locus_tag LOCUS_31920 228258 226912 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226755.1 protein_id gnl|my_center|LOCUS_31920 228509 228255 gene locus_tag LOCUS_31930 228509 228255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 228619 229557 gene locus_tag LOCUS_31940 228619 229557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 231922 229544 gene locus_tag LOCUS_31950 231922 229544 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 protein_id gnl|my_center|LOCUS_31950 233141 231975 gene locus_tag LOCUS_31960 233141 231975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 233813 233217 gene locus_tag LOCUS_31970 233813 233217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 234837 233839 gene locus_tag LOCUS_31980 234837 233839 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898118.1 protein_id gnl|my_center|LOCUS_31980 235496 234855 gene locus_tag LOCUS_31990 235496 234855 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074680.1 protein_id gnl|my_center|LOCUS_31990 235870 237621 gene locus_tag LOCUS_32000 235870 237621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 237816 238778 gene locus_tag LOCUS_32010 237816 238778 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_32010 239194 238706 gene locus_tag LOCUS_32020 239194 238706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 239212 239658 gene locus_tag LOCUS_32030 239212 239658 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_32030 239704 241332 gene locus_tag LOCUS_32040 239704 241332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 243464 241338 gene locus_tag LOCUS_32050 243464 241338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 244639 243461 gene locus_tag LOCUS_32060 244639 243461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 245630 244644 gene locus_tag LOCUS_32070 245630 244644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 247597 245627 gene locus_tag LOCUS_32080 247597 245627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 248670 247828 gene locus_tag LOCUS_32090 248670 247828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 253122 248692 gene locus_tag LOCUS_32100 253122 248692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 253476 253186 gene locus_tag LOCUS_32110 253476 253186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 254493 253507 gene locus_tag LOCUS_32120 254493 253507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 254781 254521 gene locus_tag LOCUS_32130 254781 254521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 254952 256463 gene locus_tag LOCUS_32140 254952 256463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 256782 256507 gene locus_tag LOCUS_32150 256782 256507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 256958 257413 gene locus_tag LOCUS_32160 256958 257413 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_32160 257511 257311 gene locus_tag LOCUS_32170 257511 257311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 258196 257648 gene locus_tag LOCUS_32180 258196 257648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 258313 258663 gene locus_tag LOCUS_32190 258313 258663 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226526.1 protein_id gnl|my_center|LOCUS_32190 258660 259103 gene locus_tag LOCUS_32200 258660 259103 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_32200 259248 259784 gene locus_tag LOCUS_32210 gene sigK 259248 259784 CDS product ECF RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466900.1 protein_id gnl|my_center|LOCUS_32210 259781 260515 gene locus_tag LOCUS_32220 259781 260515 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_32220 260652 261311 gene locus_tag LOCUS_32230 gene mpt83 260652 261311 CDS product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 protein_id gnl|my_center|LOCUS_32230 261403 262935 gene locus_tag LOCUS_32240 261403 262935 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 protein_id gnl|my_center|LOCUS_32240 263310 262936 gene locus_tag LOCUS_32250 263310 262936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 264235 263432 gene locus_tag LOCUS_32260 264235 263432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225294.1 protein_id gnl|my_center|LOCUS_32260 265195 264668 gene locus_tag LOCUS_32270 265195 264668 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975339.1 protein_id gnl|my_center|LOCUS_32270 265255 266190 gene locus_tag LOCUS_32280 265255 266190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029113.1 protein_id gnl|my_center|LOCUS_32280 266268 266465 gene locus_tag LOCUS_32290 266268 266465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 267388 266552 gene locus_tag LOCUS_32300 267388 266552 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_32300 267480 268388 gene locus_tag LOCUS_32310 267480 268388 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_32310 268652 268449 gene locus_tag LOCUS_32320 268652 268449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 268926 271178 gene locus_tag LOCUS_32330 268926 271178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 272309 273211 gene locus_tag LOCUS_32340 272309 273211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227343.1 protein_id gnl|my_center|LOCUS_32340 273983 273222 gene locus_tag LOCUS_32350 273983 273222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 274589 274176 gene locus_tag LOCUS_32360 gene msrB 274589 274176 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894168.1 protein_id gnl|my_center|LOCUS_32360 274925 274605 gene locus_tag LOCUS_32370 274925 274605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284340.1 protein_id gnl|my_center|LOCUS_32370 274983 276038 gene locus_tag LOCUS_32380 gene ligD 274983 276038 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_32380 276194 276400 gene locus_tag LOCUS_32390 276194 276400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223159.1 protein_id gnl|my_center|LOCUS_32390 277922 276405 gene locus_tag LOCUS_32400 277922 276405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224537.1 protein_id gnl|my_center|LOCUS_32400 278071 279099 gene locus_tag LOCUS_32410 278071 279099 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005121850.1 protein_id gnl|my_center|LOCUS_32410 279104 279799 gene locus_tag LOCUS_32420 279104 279799 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_32420 280419 279733 gene locus_tag LOCUS_32430 280419 279733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 280652 280416 gene locus_tag LOCUS_32440 280652 280416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 280720 282345 gene locus_tag LOCUS_32450 280720 282345 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_32450 283666 282464 gene locus_tag LOCUS_32460 gene rocD 283666 282464 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224552.1 protein_id gnl|my_center|LOCUS_32460 284800 283808 gene locus_tag LOCUS_32470 284800 283808 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228421.1 protein_id gnl|my_center|LOCUS_32470 286199 284814 gene locus_tag LOCUS_32480 gene hydA 286199 284814 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228420.1 protein_id gnl|my_center|LOCUS_32480 287047 286205 gene locus_tag LOCUS_32490 287047 286205 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_32490 288624 287047 gene locus_tag LOCUS_32500 288624 287047 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228418.1 protein_id gnl|my_center|LOCUS_32500 289611 288772 gene locus_tag LOCUS_32510 289611 288772 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224326.1 protein_id gnl|my_center|LOCUS_32510 291224 289608 gene locus_tag LOCUS_32520 291224 289608 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_32520 291331 292590 gene locus_tag LOCUS_32530 291331 292590 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_32530 292590 294083 gene locus_tag LOCUS_32540 292590 294083 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_32540 294147 294305 gene locus_tag LOCUS_32550 294147 294305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 294312 296879 gene locus_tag LOCUS_32560 294312 296879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 296884 297633 gene locus_tag LOCUS_32570 296884 297633 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226798.1 protein_id gnl|my_center|LOCUS_32570 297806 298582 gene locus_tag LOCUS_32580 297806 298582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 298744 298511 gene locus_tag LOCUS_32590 298744 298511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 299105 298725 gene locus_tag LOCUS_32600 299105 298725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 299136 301244 gene locus_tag LOCUS_32610 299136 301244 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224556.1 protein_id gnl|my_center|LOCUS_32610 301241 302194 gene locus_tag LOCUS_32620 301241 302194 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224557.1 protein_id gnl|my_center|LOCUS_32620 302246 303619 gene locus_tag LOCUS_32630 302246 303619 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224561.1 protein_id gnl|my_center|LOCUS_32630 303616 304911 gene locus_tag LOCUS_32640 303616 304911 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224562.1 protein_id gnl|my_center|LOCUS_32640 304908 306641 gene locus_tag LOCUS_32650 304908 306641 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224563.1 protein_id gnl|my_center|LOCUS_32650 306638 307930 gene locus_tag LOCUS_32660 306638 307930 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224564.1 protein_id gnl|my_center|LOCUS_32660 308016 308813 gene locus_tag LOCUS_32670 308016 308813 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_32670 308810 310468 gene locus_tag LOCUS_32680 308810 310468 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224751.1 protein_id gnl|my_center|LOCUS_32680 310465 311613 gene locus_tag LOCUS_32690 310465 311613 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224752.1 protein_id gnl|my_center|LOCUS_32690 311610 313208 gene locus_tag LOCUS_32700 311610 313208 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_32700 312570 312486 gene locus_tag LOCUS_t00370 312570 312486 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 313214 315184 gene locus_tag LOCUS_32710 313214 315184 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 protein_id gnl|my_center|LOCUS_32710 315184 316344 gene locus_tag LOCUS_32720 315184 316344 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224755.1 protein_id gnl|my_center|LOCUS_32720 316356 316970 gene locus_tag LOCUS_32730 316356 316970 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_32730 317062 319281 gene locus_tag LOCUS_32740 gene helR 317062 319281 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_32740 319760 319320 gene locus_tag LOCUS_32750 319760 319320 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_32750 320209 319766 gene locus_tag LOCUS_32760 320209 319766 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 protein_id gnl|my_center|LOCUS_32760 320426 322801 gene locus_tag LOCUS_32770 320426 322801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 326771 322851 gene locus_tag LOCUS_32780 326771 322851 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031493.1 protein_id gnl|my_center|LOCUS_32780 326903 327892 gene locus_tag LOCUS_32790 326903 327892 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_32790 329318 327903 gene locus_tag LOCUS_32800 329318 327903 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_32800 330533 329328 gene locus_tag LOCUS_32810 330533 329328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_32810 330747 331961 gene locus_tag LOCUS_32820 330747 331961 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404423.1 protein_id gnl|my_center|LOCUS_32820 332001 334166 gene locus_tag LOCUS_32830 332001 334166 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_32830 334215 334418 gene locus_tag LOCUS_32840 334215 334418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 334745 334476 gene locus_tag LOCUS_32850 334745 334476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 335120 334770 gene locus_tag LOCUS_32860 335120 334770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 335392 336786 gene locus_tag LOCUS_32870 335392 336786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 338239 336779 gene locus_tag LOCUS_32880 338239 336779 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227862.1 protein_id gnl|my_center|LOCUS_32880 339076 338243 gene locus_tag LOCUS_32890 339076 338243 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227861.1 protein_id gnl|my_center|LOCUS_32890 340011 339073 gene locus_tag LOCUS_32900 340011 339073 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742190.1 protein_id gnl|my_center|LOCUS_32900 341311 340022 gene locus_tag LOCUS_32910 341311 340022 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227859.1 protein_id gnl|my_center|LOCUS_32910 342021 341395 gene locus_tag LOCUS_32920 342021 341395 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_32920 343326 342040 gene locus_tag LOCUS_32930 343326 342040 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227855.1 protein_id gnl|my_center|LOCUS_32930 343433 344392 gene locus_tag LOCUS_32940 343433 344392 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227854.1 protein_id gnl|my_center|LOCUS_32940 344389 345168 gene locus_tag LOCUS_32950 344389 345168 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227853.1 protein_id gnl|my_center|LOCUS_32950 345165 345545 gene locus_tag LOCUS_32960 345165 345545 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031872.1 protein_id gnl|my_center|LOCUS_32960 347850 345595 gene locus_tag LOCUS_32970 347850 345595 CDS product cellulase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027340.1 protein_id gnl|my_center|LOCUS_32970 348065 349306 gene locus_tag LOCUS_32980 348065 349306 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_32980 349329 349826 gene locus_tag LOCUS_32990 gene uraD 349329 349826 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_32990 349823 350140 gene locus_tag LOCUS_33000 gene uraH 349823 350140 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223819.1 protein_id gnl|my_center|LOCUS_33000 350142 351011 gene locus_tag LOCUS_33010 gene pucL 350142 351011 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223818.1 protein_id gnl|my_center|LOCUS_33010 351016 351870 gene locus_tag LOCUS_33020 351016 351870 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226422.1 protein_id gnl|my_center|LOCUS_33020 351874 352341 gene locus_tag LOCUS_33030 351874 352341 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223812.1 protein_id gnl|my_center|LOCUS_33030 352338 353687 gene locus_tag LOCUS_33040 352338 353687 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223813.1 protein_id gnl|my_center|LOCUS_33040 353684 355972 gene locus_tag LOCUS_33050 gene pucD 353684 355972 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223814.1 protein_id gnl|my_center|LOCUS_33050 356354 358324 gene locus_tag LOCUS_33060 356354 358324 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226197.1 protein_id gnl|my_center|LOCUS_33060 358555 359739 gene locus_tag LOCUS_33070 gene tuf 358555 359739 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226063.1 protein_id gnl|my_center|LOCUS_33070 359823 360230 gene locus_tag LOCUS_33080 359823 360230 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228458.1 protein_id gnl|my_center|LOCUS_33080 360451 360236 gene locus_tag LOCUS_33090 360451 360236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 361136 360711 gene locus_tag LOCUS_33100 361136 360711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 361798 361157 gene locus_tag LOCUS_33110 361798 361157 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090854.1 protein_id gnl|my_center|LOCUS_33110 363368 361842 gene locus_tag LOCUS_33120 363368 361842 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_33120 365169 363382 gene locus_tag LOCUS_33130 365169 363382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 366411 365332 gene locus_tag LOCUS_33140 366411 365332 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_33140 368213 366447 gene locus_tag LOCUS_33150 368213 366447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726610.1 protein_id gnl|my_center|LOCUS_33150 369898 368210 gene locus_tag LOCUS_33160 369898 368210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891342.1 protein_id gnl|my_center|LOCUS_33160 369985 370695 gene locus_tag LOCUS_33170 369985 370695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 371147 370692 gene locus_tag LOCUS_33180 371147 370692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 371240 371935 gene locus_tag LOCUS_33190 371240 371935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_33190 371942 373210 gene locus_tag LOCUS_33200 371942 373210 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_33200 373286 373822 gene locus_tag LOCUS_33210 373286 373822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 373850 374389 gene locus_tag LOCUS_33220 373850 374389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 374906 374373 gene locus_tag LOCUS_33230 374906 374373 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466773.1 protein_id gnl|my_center|LOCUS_33230 374924 375436 gene locus_tag LOCUS_33240 374924 375436 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224025.1 protein_id gnl|my_center|LOCUS_33240 375465 376310 gene locus_tag LOCUS_33250 375465 376310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 376827 376417 gene locus_tag LOCUS_33260 376827 376417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 377231 376824 gene locus_tag LOCUS_33270 377231 376824 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_33270 377277 378041 gene locus_tag LOCUS_33280 377277 378041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 378102 379295 gene locus_tag LOCUS_33290 gene dinB 378102 379295 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226402.1 protein_id gnl|my_center|LOCUS_33290 379419 381122 gene locus_tag LOCUS_33300 379419 381122 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_33300 381132 381368 gene locus_tag LOCUS_33310 381132 381368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229497.1 protein_id gnl|my_center|LOCUS_33310 381984 381553 gene locus_tag LOCUS_33320 381984 381553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 382093 383166 gene locus_tag LOCUS_33330 382093 383166 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_33330 383623 383390 gene locus_tag LOCUS_33340 383623 383390 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_33340 385361 383637 gene locus_tag LOCUS_33350 gene treZ 385361 383637 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224465.1 protein_id gnl|my_center|LOCUS_33350 387607 385358 gene locus_tag LOCUS_33360 gene treY 387607 385358 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224464.1 protein_id gnl|my_center|LOCUS_33360 389757 387604 gene locus_tag LOCUS_33370 gene glgX 389757 387604 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224925.1 protein_id gnl|my_center|LOCUS_33370 391806 389851 gene locus_tag LOCUS_33380 gene malQ 391806 389851 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224462.1 protein_id gnl|my_center|LOCUS_33380 392177 391818 gene locus_tag LOCUS_33390 392177 391818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 393202 392399 gene locus_tag LOCUS_33400 393202 392399 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_33400 393375 394430 gene locus_tag LOCUS_33410 393375 394430 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226146.1 protein_id gnl|my_center|LOCUS_33410 394721 394449 gene locus_tag LOCUS_33420 394721 394449 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222199.1 protein_id gnl|my_center|LOCUS_33420 394863 397448 gene locus_tag LOCUS_33430 gene lanKC 394863 397448 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_33430 397473 397619 gene locus_tag LOCUS_33440 397473 397619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 397809 399404 gene locus_tag LOCUS_33450 397809 399404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33450 399430 401163 gene locus_tag LOCUS_33460 399430 401163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_33460 401813 401169 gene locus_tag LOCUS_33470 401813 401169 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_33470 402311 403990 gene locus_tag LOCUS_33480 402311 403990 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_33480 403999 405144 gene locus_tag LOCUS_33490 403999 405144 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223610.1 protein_id gnl|my_center|LOCUS_33490 405144 407579 gene locus_tag LOCUS_33500 405144 407579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 407590 408537 gene locus_tag LOCUS_33510 407590 408537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223613.1 protein_id gnl|my_center|LOCUS_33510 408600 408884 gene locus_tag LOCUS_33520 408600 408884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 410047 408896 gene locus_tag LOCUS_33530 410047 408896 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228618.1 protein_id gnl|my_center|LOCUS_33530 410272 411873 gene locus_tag LOCUS_33540 gene hutH 410272 411873 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_33540 411903 413249 gene locus_tag LOCUS_33550 411903 413249 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228016.1 protein_id gnl|my_center|LOCUS_33550 413265 414776 gene locus_tag LOCUS_33560 413265 414776 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_33560 414788 415864 gene locus_tag LOCUS_33570 414788 415864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 415861 416301 gene locus_tag LOCUS_33580 415861 416301 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228611.1 protein_id gnl|my_center|LOCUS_33580 417569 416904 gene locus_tag LOCUS_33590 417569 416904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 418192 417734 gene locus_tag LOCUS_33600 418192 417734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 418387 419748 gene locus_tag LOCUS_33610 418387 419748 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_33610 420473 420012 gene locus_tag LOCUS_33620 420473 420012 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_33620 426183 420481 gene locus_tag LOCUS_33630 426183 420481 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831510.1 protein_id gnl|my_center|LOCUS_33630 426547 427572 gene locus_tag LOCUS_33640 426547 427572 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228639.1 protein_id gnl|my_center|LOCUS_33640 427623 428606 gene locus_tag LOCUS_33650 427623 428606 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086861803.1 protein_id gnl|my_center|LOCUS_33650 428603 430573 gene locus_tag LOCUS_33660 428603 430573 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_33660 430582 431622 gene locus_tag LOCUS_33670 430582 431622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_33670 431619 432995 gene locus_tag LOCUS_33680 431619 432995 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 protein_id gnl|my_center|LOCUS_33680 433020 434234 gene locus_tag LOCUS_33690 433020 434234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 434231 435262 gene locus_tag LOCUS_33700 434231 435262 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742109.1 protein_id gnl|my_center|LOCUS_33700 435890 435345 gene locus_tag LOCUS_33710 435890 435345 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_33710 436864 436031 gene locus_tag LOCUS_33720 436864 436031 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_33720 438447 436894 gene locus_tag LOCUS_33730 438447 436894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 438761 440143 gene locus_tag LOCUS_33740 438761 440143 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_33740 440160 440960 gene locus_tag LOCUS_33750 440160 440960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_33750 441152 442909 gene locus_tag LOCUS_33760 441152 442909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 442910 444217 gene locus_tag LOCUS_33770 442910 444217 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_33770 444204 444440 gene locus_tag LOCUS_33780 444204 444440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 444421 445971 gene locus_tag LOCUS_33790 444421 445971 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_33790 446070 446513 gene locus_tag LOCUS_33800 446070 446513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 446529 447812 gene locus_tag LOCUS_33810 446529 447812 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230802.1 protein_id gnl|my_center|LOCUS_33810 447853 448854 gene locus_tag LOCUS_33820 447853 448854 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_33820 448856 450085 gene locus_tag LOCUS_33830 448856 450085 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229724.1 protein_id gnl|my_center|LOCUS_33830 450856 450134 gene locus_tag LOCUS_33840 450856 450134 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228655.1 protein_id gnl|my_center|LOCUS_33840 452445 450883 gene locus_tag LOCUS_33850 452445 450883 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_33850 452753 454060 gene locus_tag LOCUS_33860 452753 454060 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969489.1 protein_id gnl|my_center|LOCUS_33860 454092 454961 gene locus_tag LOCUS_33870 454092 454961 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_33870 454983 455801 gene locus_tag LOCUS_33880 454983 455801 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_33880 456442 455897 gene locus_tag LOCUS_33890 456442 455897 CDS product immunity 21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977534.1 protein_id gnl|my_center|LOCUS_33890 457819 456626 gene locus_tag LOCUS_33900 457819 456626 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_33900 458018 459601 gene locus_tag LOCUS_33910 458018 459601 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_33910 461253 459664 gene locus_tag LOCUS_33920 461253 459664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_33920 461452 462273 gene locus_tag LOCUS_33930 461452 462273 CDS product 27-O-demethylrifamycin SV methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_33930 462270 463160 gene locus_tag LOCUS_33940 462270 463160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 463241 463966 gene locus_tag LOCUS_33950 463241 463966 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230095.1 protein_id gnl|my_center|LOCUS_33950 465334 464024 gene locus_tag LOCUS_33960 465334 464024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_33960 465544 466794 gene locus_tag LOCUS_33970 465544 466794 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083663.1 protein_id gnl|my_center|LOCUS_33970 466853 468247 gene locus_tag LOCUS_33980 466853 468247 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228608.1 protein_id gnl|my_center|LOCUS_33980 468269 468511 gene locus_tag LOCUS_33990 468269 468511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 468516 469898 gene locus_tag LOCUS_34000 468516 469898 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 protein_id gnl|my_center|LOCUS_34000 469892 472978 gene locus_tag LOCUS_34010 469892 472978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 473092 473991 gene locus_tag LOCUS_34020 473092 473991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 474083 474793 gene locus_tag LOCUS_34030 gene trpC 474083 474793 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460912.1 protein_id gnl|my_center|LOCUS_34030 474781 475557 gene locus_tag LOCUS_34040 gene trpA 474781 475557 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103014.1 protein_id gnl|my_center|LOCUS_34040 476713 475622 gene locus_tag LOCUS_34050 gene aroF 476713 475622 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_34050 477172 476759 gene locus_tag LOCUS_34060 gene aroH 477172 476759 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_34060 478007 477210 gene locus_tag LOCUS_34070 478007 477210 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228631.1 protein_id gnl|my_center|LOCUS_34070 478303 478632 gene locus_tag LOCUS_34080 478303 478632 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230891.1 protein_id gnl|my_center|LOCUS_34080 478800 480392 gene locus_tag LOCUS_34090 478800 480392 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538209.1 protein_id gnl|my_center|LOCUS_34090 480396 481697 gene locus_tag LOCUS_34100 480396 481697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 481859 482689 gene locus_tag LOCUS_34110 481859 482689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 482698 483162 gene locus_tag LOCUS_34120 482698 483162 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_34120 483164 483712 gene locus_tag LOCUS_34130 483164 483712 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228628.1 protein_id gnl|my_center|LOCUS_34130 483724 484755 gene locus_tag LOCUS_34140 483724 484755 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228627.1 protein_id gnl|my_center|LOCUS_34140 484804 485520 gene locus_tag LOCUS_34150 484804 485520 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_34150 485851 485510 gene locus_tag LOCUS_34160 485851 485510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 486143 487753 gene locus_tag LOCUS_34170 486143 487753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_34170 487849 488523 gene locus_tag LOCUS_34180 487849 488523 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_34180 488556 490040 gene locus_tag LOCUS_34190 488556 490040 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_34190 490037 490900 gene locus_tag LOCUS_34200 490037 490900 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076519.1 protein_id gnl|my_center|LOCUS_34200 491652 490861 gene locus_tag LOCUS_34210 491652 490861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 491746 492561 gene locus_tag LOCUS_34220 491746 492561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 492623 493354 gene locus_tag LOCUS_34230 492623 493354 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_34230 495866 493356 gene locus_tag LOCUS_34240 495866 493356 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_34240 497269 495869 gene locus_tag LOCUS_34250 497269 495869 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_34250 497400 499451 gene locus_tag LOCUS_34260 497400 499451 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223200.1 protein_id gnl|my_center|LOCUS_34260 499465 501951 gene locus_tag LOCUS_34270 499465 501951 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223199.1 protein_id gnl|my_center|LOCUS_34270 504374 501999 gene locus_tag LOCUS_34280 504374 501999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 505400 504459 gene locus_tag LOCUS_34290 505400 504459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229181.1 protein_id gnl|my_center|LOCUS_34290 505399 506268 gene locus_tag LOCUS_34300 505399 506268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 506344 508365 gene locus_tag LOCUS_34310 506344 508365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 508605 510281 gene locus_tag LOCUS_34320 gene gguA 508605 510281 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_34320 510278 511276 gene locus_tag LOCUS_34330 510278 511276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_34330 511280 512257 gene locus_tag LOCUS_34340 511280 512257 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_34340 512887 512312 gene locus_tag LOCUS_34350 512887 512312 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403355.1 protein_id gnl|my_center|LOCUS_34350 512994 513320 gene locus_tag LOCUS_34360 512994 513320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 513486 514313 gene locus_tag LOCUS_34370 513486 514313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 515156 514374 gene locus_tag LOCUS_34380 515156 514374 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228650.1 protein_id gnl|my_center|LOCUS_34380 515444 516013 gene locus_tag LOCUS_34390 515444 516013 CDS product DUF5987 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228634.1 protein_id gnl|my_center|LOCUS_34390 516010 517638 gene locus_tag LOCUS_34400 516010 517638 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228633.1 protein_id gnl|my_center|LOCUS_34400 517746 518294 gene locus_tag LOCUS_34410 517746 518294 CDS product DUF6423 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228623.1 protein_id gnl|my_center|LOCUS_34410 518291 519598 gene locus_tag LOCUS_34420 518291 519598 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228622.1 protein_id gnl|my_center|LOCUS_34420 519585 520037 gene locus_tag LOCUS_34430 519585 520037 CDS product DUF6187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228621.1 protein_id gnl|my_center|LOCUS_34430 520012 520557 gene locus_tag LOCUS_34440 520012 520557 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228620.1 protein_id gnl|my_center|LOCUS_34440 521508 520705 gene locus_tag LOCUS_34450 521508 520705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 521997 521782 gene locus_tag LOCUS_34460 521997 521782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 522905 521994 gene locus_tag LOCUS_34470 522905 521994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 523845 522916 gene locus_tag LOCUS_34480 523845 522916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 524046 524180 gene locus_tag LOCUS_34490 524046 524180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 527350 524258 gene locus_tag LOCUS_34500 527350 524258 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226639.1 protein_id gnl|my_center|LOCUS_34500 527714 528487 gene locus_tag LOCUS_34510 527714 528487 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228642.1 protein_id gnl|my_center|LOCUS_34510 528551 529144 gene locus_tag LOCUS_34520 528551 529144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_34520 529148 530599 gene locus_tag LOCUS_34530 529148 530599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 531816 530554 gene locus_tag LOCUS_34540 531816 530554 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393312.1 protein_id gnl|my_center|LOCUS_34540 533083 531893 gene locus_tag LOCUS_34550 533083 531893 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393312.1 protein_id gnl|my_center|LOCUS_34550 534361 533204 gene locus_tag LOCUS_34560 534361 533204 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_34560 536535 534358 gene locus_tag LOCUS_34570 536535 534358 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227758.1 protein_id gnl|my_center|LOCUS_34570 537611 536532 gene locus_tag LOCUS_34580 537611 536532 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_34580 538987 537608 gene locus_tag LOCUS_34590 538987 537608 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34590 540276 538984 gene locus_tag LOCUS_34600 540276 538984 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_34600 540468 541454 gene locus_tag LOCUS_34610 540468 541454 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728156.1 protein_id gnl|my_center|LOCUS_34610 541826 543079 gene locus_tag LOCUS_34620 541826 543079 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227093.1 protein_id gnl|my_center|LOCUS_34620 543076 543516 gene locus_tag LOCUS_34630 543076 543516 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227092.1 protein_id gnl|my_center|LOCUS_34630 543513 543932 gene locus_tag LOCUS_34640 543513 543932 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742078.1 protein_id gnl|my_center|LOCUS_34640 543907 544503 gene locus_tag LOCUS_34650 543907 544503 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227090.1 protein_id gnl|my_center|LOCUS_34650 544555 545799 gene locus_tag LOCUS_34660 544555 545799 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227089.1 protein_id gnl|my_center|LOCUS_34660 545966 545724 gene locus_tag LOCUS_34670 545966 545724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 546082 547242 gene locus_tag LOCUS_34680 546082 547242 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_34680 547288 547857 gene locus_tag LOCUS_34690 547288 547857 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 protein_id gnl|my_center|LOCUS_34690 548195 547887 gene locus_tag LOCUS_34700 548195 547887 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228175.1 protein_id gnl|my_center|LOCUS_34700 548307 549206 gene locus_tag LOCUS_34710 548307 549206 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_34710 550257 549256 gene locus_tag LOCUS_34720 550257 549256 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_34720 550673 550257 gene locus_tag LOCUS_34730 550673 550257 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230586.1 protein_id gnl|my_center|LOCUS_34730 550797 551627 gene locus_tag LOCUS_34740 gene cdtA 550797 551627 CDS product siderophore ABC transporter ATP-binding protein CdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971743.1 protein_id gnl|my_center|LOCUS_34740 551653 552624 gene locus_tag LOCUS_34750 gene cdtB 551653 552624 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_34750 552635 554719 gene locus_tag LOCUS_34760 gene cdtC 552635 554719 CDS product siderophore ABC transporter permease CdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031636.1 protein_id gnl|my_center|LOCUS_34760 555257 554688 gene locus_tag LOCUS_34770 555257 554688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 555917 555270 gene locus_tag LOCUS_34780 555917 555270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_34780 557047 555914 gene locus_tag LOCUS_34790 557047 555914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 557202 557708 gene locus_tag LOCUS_34800 557202 557708 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_34800 557847 558809 gene locus_tag LOCUS_34810 557847 558809 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224690.1 protein_id gnl|my_center|LOCUS_34810 558862 559752 gene locus_tag LOCUS_34820 558862 559752 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087636.1 protein_id gnl|my_center|LOCUS_34820 560467 559727 gene locus_tag LOCUS_34830 560467 559727 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_34830 561618 560464 gene locus_tag LOCUS_34840 561618 560464 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_34840 562814 561630 gene locus_tag LOCUS_34850 562814 561630 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728069.1 protein_id gnl|my_center|LOCUS_34850 562926 563657 gene locus_tag LOCUS_34860 562926 563657 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804409.1 protein_id gnl|my_center|LOCUS_34860 564701 563661 gene locus_tag LOCUS_34870 564701 563661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 565263 564709 gene locus_tag LOCUS_34880 565263 564709 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_34880 565927 567432 gene locus_tag LOCUS_34890 565927 567432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 567521 568099 gene locus_tag LOCUS_34900 567521 568099 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224409.1 protein_id gnl|my_center|LOCUS_34900 568138 568320 gene locus_tag LOCUS_34910 568138 568320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 568321 572187 gene locus_tag LOCUS_34920 568321 572187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 573335 572160 gene locus_tag LOCUS_34930 573335 572160 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_34930 574012 573332 gene locus_tag LOCUS_34940 574012 573332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_34940 574586 574065 gene locus_tag LOCUS_34950 574586 574065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227658.1 protein_id gnl|my_center|LOCUS_34950 574962 575585 gene locus_tag LOCUS_34960 574962 575585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 578048 575784 gene locus_tag LOCUS_34970 gene secD 578048 575784 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111870946.1 protein_id gnl|my_center|LOCUS_34970 578531 578097 gene locus_tag LOCUS_34980 578531 578097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 581197 578540 gene locus_tag LOCUS_34990 581197 578540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 581916 581194 gene locus_tag LOCUS_35000 581916 581194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_35000 582491 581913 gene locus_tag LOCUS_35010 582491 581913 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_35010 583239 582538 gene locus_tag LOCUS_35020 583239 582538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 583641 583375 gene locus_tag LOCUS_35030 583641 583375 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_35030 583811 584524 gene locus_tag LOCUS_35040 583811 584524 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230869.1 protein_id gnl|my_center|LOCUS_35040 584524 585171 gene locus_tag LOCUS_35050 584524 585171 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304888.1 protein_id gnl|my_center|LOCUS_35050 585371 586816 gene locus_tag LOCUS_35060 gene gndA 585371 586816 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_35060 587836 586883 gene locus_tag LOCUS_35070 587836 586883 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191003.1 protein_id gnl|my_center|LOCUS_35070 588195 587836 gene locus_tag LOCUS_35080 588195 587836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 589052 588192 gene locus_tag LOCUS_35090 589052 588192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 589848 589045 gene locus_tag LOCUS_35100 589848 589045 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 protein_id gnl|my_center|LOCUS_35100 591044 589845 gene locus_tag LOCUS_35110 591044 589845 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_35110 591860 591060 gene locus_tag LOCUS_35120 591860 591060 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226682.1 protein_id gnl|my_center|LOCUS_35120 591950 593392 gene locus_tag LOCUS_35130 591950 593392 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_35130 593431 594510 gene locus_tag LOCUS_35140 593431 594510 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_35140 595483 594518 gene locus_tag LOCUS_35150 595483 594518 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110075.1 protein_id gnl|my_center|LOCUS_35150 595541 595948 gene locus_tag LOCUS_35160 595541 595948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 596274 595945 gene locus_tag LOCUS_35170 596274 595945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224516.1 protein_id gnl|my_center|LOCUS_35170 597070 596267 gene locus_tag LOCUS_35180 597070 596267 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224517.1 protein_id gnl|my_center|LOCUS_35180 597960 597067 gene locus_tag LOCUS_35190 597960 597067 CDS product TIGR04222 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224518.1 protein_id gnl|my_center|LOCUS_35190 598449 598763 gene locus_tag LOCUS_35200 598449 598763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 598901 600814 gene locus_tag LOCUS_35210 598901 600814 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027129.1 protein_id gnl|my_center|LOCUS_35210 600841 602568 gene locus_tag LOCUS_35220 600841 602568 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_35220 602633 603625 gene locus_tag LOCUS_35230 602633 603625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_35230 603622 604536 gene locus_tag LOCUS_35240 603622 604536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_35240 604536 605483 gene locus_tag LOCUS_35250 604536 605483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080073.1 protein_id gnl|my_center|LOCUS_35250 605483 606412 gene locus_tag LOCUS_35260 605483 606412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_35260 606409 607431 gene locus_tag LOCUS_35270 606409 607431 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 protein_id gnl|my_center|LOCUS_35270 607428 608072 gene locus_tag LOCUS_35280 gene frnE 607428 608072 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_35280 609013 608069 gene locus_tag LOCUS_35290 609013 608069 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225228.1 protein_id gnl|my_center|LOCUS_35290 610222 609077 gene locus_tag LOCUS_35300 610222 609077 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_35300 611044 610289 gene locus_tag LOCUS_35310 611044 610289 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225172.1 protein_id gnl|my_center|LOCUS_35310 611646 611041 gene locus_tag LOCUS_35320 611646 611041 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229223.1 protein_id gnl|my_center|LOCUS_35320 611986 611627 gene locus_tag LOCUS_35330 611986 611627 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229224.1 protein_id gnl|my_center|LOCUS_35330 612399 611983 gene locus_tag LOCUS_35340 612399 611983 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467633.1 protein_id gnl|my_center|LOCUS_35340 614630 612396 gene locus_tag LOCUS_35350 614630 612396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 615587 614817 gene locus_tag LOCUS_35360 615587 614817 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_35360 616331 615843 gene locus_tag LOCUS_35370 616331 615843 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_35370 616757 616335 gene locus_tag LOCUS_35380 616757 616335 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_35380 619039 616754 gene locus_tag LOCUS_35390 619039 616754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 619290 619658 gene locus_tag LOCUS_35400 619290 619658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 619655 621232 gene locus_tag LOCUS_35410 619655 621232 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224361.1 protein_id gnl|my_center|LOCUS_35410 621248 622153 gene locus_tag LOCUS_35420 gene cysD 621248 622153 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_35420 622230 624053 gene locus_tag LOCUS_35430 gene cysN 622230 624053 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_35430 624823 624050 gene locus_tag LOCUS_35440 624823 624050 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897328.1 protein_id gnl|my_center|LOCUS_35440 625962 624820 gene locus_tag LOCUS_35450 625962 624820 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_35450 627038 625959 gene locus_tag LOCUS_35460 627038 625959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 628032 628409 gene locus_tag LOCUS_35470 628032 628409 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_35470 630159 628522 gene locus_tag LOCUS_35480 630159 628522 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226873.1 protein_id gnl|my_center|LOCUS_35480 630437 630156 gene locus_tag LOCUS_35490 630437 630156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 631425 630541 gene locus_tag LOCUS_35500 631425 630541 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285158.1 protein_id gnl|my_center|LOCUS_35500 632306 631446 gene locus_tag LOCUS_35510 632306 631446 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222333.1 protein_id gnl|my_center|LOCUS_35510 633361 632609 gene locus_tag LOCUS_35520 633361 632609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 633539 634267 gene locus_tag LOCUS_35530 633539 634267 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966429.1 protein_id gnl|my_center|LOCUS_35530 634339 635814 gene locus_tag LOCUS_35540 634339 635814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 638529 636106 gene locus_tag LOCUS_35550 gene hrpB 638529 636106 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_35550 639730 638531 gene locus_tag LOCUS_35560 639730 638531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 641633 639777 gene locus_tag LOCUS_35570 gene htpG 641633 639777 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467081.1 protein_id gnl|my_center|LOCUS_35570 641772 643547 gene locus_tag LOCUS_35580 641772 643547 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_35580 644676 643648 gene locus_tag LOCUS_35590 644676 643648 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_35590 645167 644718 gene locus_tag LOCUS_35600 645167 644718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 645986 645186 gene locus_tag LOCUS_35610 645986 645186 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_35610 646036 646629 gene locus_tag LOCUS_35620 646036 646629 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974324.1 protein_id gnl|my_center|LOCUS_35620 646656 647228 gene locus_tag LOCUS_35630 646656 647228 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_35630 648004 647330 gene locus_tag LOCUS_35640 648004 647330 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_35640 648819 648001 gene locus_tag LOCUS_35650 648819 648001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 648958 649650 gene locus_tag LOCUS_35660 648958 649650 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_35660 650135 652456 gene locus_tag LOCUS_35670 650135 652456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 652993 652460 gene locus_tag LOCUS_35680 652993 652460 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225897.1 protein_id gnl|my_center|LOCUS_35680 653412 653065 gene locus_tag LOCUS_35690 653412 653065 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190696.1 protein_id gnl|my_center|LOCUS_35690 654263 653448 gene locus_tag LOCUS_35700 654263 653448 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226194.1 protein_id gnl|my_center|LOCUS_35700 654457 655299 gene locus_tag LOCUS_35710 654457 655299 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227642.1 protein_id gnl|my_center|LOCUS_35710 655477 656529 gene locus_tag LOCUS_35720 655477 656529 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309949.1 protein_id gnl|my_center|LOCUS_35720 656537 658237 gene locus_tag LOCUS_35730 656537 658237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172801.1 protein_id gnl|my_center|LOCUS_35730 658234 659256 gene locus_tag LOCUS_35740 658234 659256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_35740 659253 660164 gene locus_tag LOCUS_35750 659253 660164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530293.1 protein_id gnl|my_center|LOCUS_35750 660161 660892 gene locus_tag LOCUS_35760 660161 660892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 660889 662049 gene locus_tag LOCUS_35770 660889 662049 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_35770 662049 663038 gene locus_tag LOCUS_35780 662049 663038 CDS product s-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679362.1 protein_id gnl|my_center|LOCUS_35780 663035 663745 gene locus_tag LOCUS_35790 gene mtnC 663035 663745 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267285.1 protein_id gnl|my_center|LOCUS_35790 663742 664344 gene locus_tag LOCUS_35800 663742 664344 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 protein_id gnl|my_center|LOCUS_35800 664357 664935 gene locus_tag LOCUS_35810 664357 664935 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167484.1 protein_id gnl|my_center|LOCUS_35810 665202 664939 gene locus_tag LOCUS_35820 665202 664939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 667169 665220 gene locus_tag LOCUS_35830 667169 665220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 667402 668094 gene locus_tag LOCUS_35840 667402 668094 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224977.1 protein_id gnl|my_center|LOCUS_35840 668137 669069 gene locus_tag LOCUS_35850 668137 669069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_35850 669066 669827 gene locus_tag LOCUS_35860 669066 669827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_35860 670031 671713 gene locus_tag LOCUS_35870 670031 671713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 673134 671710 gene locus_tag LOCUS_35880 673134 671710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 674784 673228 gene locus_tag LOCUS_35890 674784 673228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 675278 674970 gene locus_tag LOCUS_35900 675278 674970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 676106 675309 gene locus_tag LOCUS_35910 676106 675309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 676387 676701 gene locus_tag LOCUS_35920 676387 676701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 676728 678008 gene locus_tag LOCUS_35930 676728 678008 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_35930 678069 678602 gene locus_tag LOCUS_35940 gene calD 678069 678602 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_35940 679073 678666 gene locus_tag LOCUS_35950 679073 678666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 679989 679066 gene locus_tag LOCUS_35960 679989 679066 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268972.1 protein_id gnl|my_center|LOCUS_35960 681110 679989 gene locus_tag LOCUS_35970 681110 679989 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064100.1 protein_id gnl|my_center|LOCUS_35970 682399 681107 gene locus_tag LOCUS_35980 682399 681107 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_35980 683247 682396 gene locus_tag LOCUS_35990 683247 682396 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_35990 684289 683240 gene locus_tag LOCUS_36000 684289 683240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 684482 685672 gene locus_tag LOCUS_36010 684482 685672 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948532.1 protein_id gnl|my_center|LOCUS_36010 685669 686823 gene locus_tag LOCUS_36020 685669 686823 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530155.1 protein_id gnl|my_center|LOCUS_36020 686857 687546 gene locus_tag LOCUS_36030 686857 687546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 687543 688478 gene locus_tag LOCUS_36040 687543 688478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 688478 689836 gene locus_tag LOCUS_36050 688478 689836 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_36050 689833 691440 gene locus_tag LOCUS_36060 689833 691440 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_36060 691437 692207 gene locus_tag LOCUS_36070 691437 692207 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878303.1 protein_id gnl|my_center|LOCUS_36070 692240 692959 gene locus_tag LOCUS_36080 692240 692959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence13 9519 4483 gene locus_tag LOCUS_36090 9519 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 19290 9523 gene locus_tag LOCUS_36100 19290 9523 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218130244.1 protein_id gnl|my_center|LOCUS_36100 26783 19287 gene locus_tag LOCUS_36110 26783 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 19677 19600 gene locus_tag LOCUS_t00380 19677 19600 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 28537 26786 gene locus_tag LOCUS_36120 28537 26786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36120 30024 28537 gene locus_tag LOCUS_36130 30024 28537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36130 30861 30052 gene locus_tag LOCUS_36140 30861 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 32183 30858 gene locus_tag LOCUS_36150 32183 30858 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876999.1 protein_id gnl|my_center|LOCUS_36150 33075 32197 gene locus_tag LOCUS_36160 33075 32197 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776014.1 protein_id gnl|my_center|LOCUS_36160 33838 33116 gene locus_tag LOCUS_36170 33838 33116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 34591 33962 gene locus_tag LOCUS_36180 34591 33962 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728500.1 protein_id gnl|my_center|LOCUS_36180 35117 34602 gene locus_tag LOCUS_36190 35117 34602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 36526 35222 gene locus_tag LOCUS_36200 36526 35222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 38042 36552 gene locus_tag LOCUS_36210 38042 36552 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_36210 39610 38057 gene locus_tag LOCUS_36220 39610 38057 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_36220 40505 39621 gene locus_tag LOCUS_36230 40505 39621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 40633 40962 gene locus_tag LOCUS_36240 40633 40962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 40972 41958 gene locus_tag LOCUS_36250 40972 41958 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_36250 42119 42784 gene locus_tag LOCUS_36260 gene fabG 42119 42784 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_36260 42971 43681 gene locus_tag LOCUS_36270 42971 43681 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_36270 43724 44002 gene locus_tag LOCUS_36280 43724 44002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 44015 44839 gene locus_tag LOCUS_36290 44015 44839 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_36290 45549 44884 gene locus_tag LOCUS_36300 45549 44884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 47579 45546 gene locus_tag LOCUS_36310 47579 45546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 50987 47622 gene locus_tag LOCUS_36320 50987 47622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 51237 52412 gene locus_tag LOCUS_36330 51237 52412 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_36330 52417 53646 gene locus_tag LOCUS_36340 gene fabF 52417 53646 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125918.1 protein_id gnl|my_center|LOCUS_36340 53643 54503 gene locus_tag LOCUS_36350 53643 54503 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083571.1 protein_id gnl|my_center|LOCUS_36350 54503 56008 gene locus_tag LOCUS_36360 54503 56008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 56005 56265 gene locus_tag LOCUS_36370 56005 56265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 56270 57301 gene locus_tag LOCUS_36380 gene trpD 56270 57301 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389649.1 protein_id gnl|my_center|LOCUS_36380 57294 58121 gene locus_tag LOCUS_36390 gene trpA 57294 58121 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_36390 58124 58498 gene locus_tag LOCUS_36400 58124 58498 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403190.1 protein_id gnl|my_center|LOCUS_36400 58511 59656 gene locus_tag LOCUS_36410 58511 59656 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_36410 59653 60345 gene locus_tag LOCUS_36420 59653 60345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 60342 61100 gene locus_tag LOCUS_36430 60342 61100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 61097 61828 gene locus_tag LOCUS_36440 61097 61828 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_36440 62648 61833 gene locus_tag LOCUS_36450 62648 61833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 62945 65239 gene locus_tag LOCUS_36460 62945 65239 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_36460 65338 66771 gene locus_tag LOCUS_36470 65338 66771 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228653.1 protein_id gnl|my_center|LOCUS_36470 66865 68112 gene locus_tag LOCUS_36480 66865 68112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 68659 68054 gene locus_tag LOCUS_36490 68659 68054 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228649.1 protein_id gnl|my_center|LOCUS_36490 69223 68900 gene locus_tag LOCUS_36500 69223 68900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 70115 69342 gene locus_tag LOCUS_36510 70115 69342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_36510 71125 70112 gene locus_tag LOCUS_36520 71125 70112 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974571.1 protein_id gnl|my_center|LOCUS_36520 72114 71122 gene locus_tag LOCUS_36530 gene fepD 72114 71122 CDS product Fe(3+)-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817185.1 protein_id gnl|my_center|LOCUS_36530 72907 72101 gene locus_tag LOCUS_36540 72907 72101 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268742.1 protein_id gnl|my_center|LOCUS_36540 73893 72904 gene locus_tag LOCUS_36550 73893 72904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 74007 74792 gene locus_tag LOCUS_36560 74007 74792 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266540.1 protein_id gnl|my_center|LOCUS_36560 74834 75781 gene locus_tag LOCUS_36570 74834 75781 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_36570 76769 75792 gene locus_tag LOCUS_36580 76769 75792 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_36580 77698 76766 gene locus_tag LOCUS_36590 77698 76766 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065472.1 protein_id gnl|my_center|LOCUS_36590 79239 77695 gene locus_tag LOCUS_36600 79239 77695 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 protein_id gnl|my_center|LOCUS_36600 79413 79712 gene locus_tag LOCUS_36610 79413 79712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 79729 81081 gene locus_tag LOCUS_36620 79729 81081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 81085 81585 gene locus_tag LOCUS_36630 81085 81585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 81595 82926 gene locus_tag LOCUS_36640 81595 82926 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090583.1 protein_id gnl|my_center|LOCUS_36640 83291 82902 gene locus_tag LOCUS_36650 83291 82902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 83421 84014 gene locus_tag LOCUS_36660 83421 84014 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949009.1 protein_id gnl|my_center|LOCUS_36660 84689 84297 gene locus_tag LOCUS_36670 84689 84297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 84851 85696 gene locus_tag LOCUS_36680 84851 85696 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028631.1 protein_id gnl|my_center|LOCUS_36680 85706 85906 gene locus_tag LOCUS_36690 85706 85906 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224160.1 protein_id gnl|my_center|LOCUS_36690 86512 85907 gene locus_tag LOCUS_36700 86512 85907 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226338.1 protein_id gnl|my_center|LOCUS_36700 86574 87416 gene locus_tag LOCUS_36710 86574 87416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_36710 87413 87952 gene locus_tag LOCUS_36720 87413 87952 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908916.1 protein_id gnl|my_center|LOCUS_36720 88886 87936 gene locus_tag LOCUS_36730 88886 87936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 89962 89006 gene locus_tag LOCUS_36740 89962 89006 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_36740 90153 90779 gene locus_tag LOCUS_36750 90153 90779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 90794 91600 gene locus_tag LOCUS_36760 90794 91600 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_36760 91606 92778 gene locus_tag LOCUS_36770 91606 92778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_36770 93730 92819 gene locus_tag LOCUS_36780 93730 92819 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067118245.1 protein_id gnl|my_center|LOCUS_36780 95154 93790 gene locus_tag LOCUS_36790 95154 93790 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940001.1 protein_id gnl|my_center|LOCUS_36790 95954 95175 gene locus_tag LOCUS_36800 95954 95175 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_36800 97027 95951 gene locus_tag LOCUS_36810 97027 95951 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892418.1 protein_id gnl|my_center|LOCUS_36810 98685 97024 gene locus_tag LOCUS_36820 98685 97024 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110557.1 protein_id gnl|my_center|LOCUS_36820 99447 98686 gene locus_tag LOCUS_36830 99447 98686 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_36830 100234 99440 gene locus_tag LOCUS_36840 100234 99440 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224750.1 protein_id gnl|my_center|LOCUS_36840 102198 100231 gene locus_tag LOCUS_36850 102198 100231 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726854.1 protein_id gnl|my_center|LOCUS_36850 103798 102203 gene locus_tag LOCUS_36860 103798 102203 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110566.1 protein_id gnl|my_center|LOCUS_36860 105425 103812 gene locus_tag LOCUS_36870 105425 103812 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_36870 105529 105984 gene locus_tag LOCUS_36880 105529 105984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 105995 106399 gene locus_tag LOCUS_36890 105995 106399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36890 107543 106416 gene locus_tag LOCUS_36900 107543 106416 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_36900 108615 107557 gene locus_tag LOCUS_36910 108615 107557 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225001.1 protein_id gnl|my_center|LOCUS_36910 109748 108612 gene locus_tag LOCUS_36920 109748 108612 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466834.1 protein_id gnl|my_center|LOCUS_36920 109926 110465 gene locus_tag LOCUS_36930 109926 110465 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401044.1 protein_id gnl|my_center|LOCUS_36930 111559 110468 gene locus_tag LOCUS_36940 111559 110468 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 protein_id gnl|my_center|LOCUS_36940 112569 111556 gene locus_tag LOCUS_36950 112569 111556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 112714 113580 gene locus_tag LOCUS_36960 112714 113580 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_36960 113583 115358 gene locus_tag LOCUS_36970 113583 115358 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815513.1 protein_id gnl|my_center|LOCUS_36970 115355 116065 gene locus_tag LOCUS_36980 115355 116065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523163.1 protein_id gnl|my_center|LOCUS_36980 116203 116952 gene locus_tag LOCUS_36990 116203 116952 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225721.1 protein_id gnl|my_center|LOCUS_36990 117105 116962 gene locus_tag LOCUS_37000 117105 116962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 118120 117158 gene locus_tag LOCUS_37010 118120 117158 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897028.1 protein_id gnl|my_center|LOCUS_37010 119262 118117 gene locus_tag LOCUS_37020 119262 118117 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897029.1 protein_id gnl|my_center|LOCUS_37020 119798 119268 gene locus_tag LOCUS_37030 119798 119268 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085863.1 protein_id gnl|my_center|LOCUS_37030 120517 119825 gene locus_tag LOCUS_37040 120517 119825 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836211.1 protein_id gnl|my_center|LOCUS_37040 121488 120517 gene locus_tag LOCUS_37050 121488 120517 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_37050 124904 121500 gene locus_tag LOCUS_37060 124904 121500 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_37060 126071 124938 gene locus_tag LOCUS_37070 126071 124938 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226848.1 protein_id gnl|my_center|LOCUS_37070 127075 126068 gene locus_tag LOCUS_37080 127075 126068 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026153082.1 protein_id gnl|my_center|LOCUS_37080 127772 127062 gene locus_tag LOCUS_37090 127772 127062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226850.1 protein_id gnl|my_center|LOCUS_37090 128563 127757 gene locus_tag LOCUS_37100 128563 127757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_37100 129880 128726 gene locus_tag LOCUS_37110 129880 128726 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161630698.1 protein_id gnl|my_center|LOCUS_37110 131473 129962 gene locus_tag LOCUS_37120 131473 129962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_37120 131559 134327 gene locus_tag LOCUS_37130 131559 134327 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222149.1 protein_id gnl|my_center|LOCUS_37130 135124 134324 gene locus_tag LOCUS_37140 135124 134324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_37140 136165 135137 gene locus_tag LOCUS_37150 136165 135137 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_37150 137190 136165 gene locus_tag LOCUS_37160 137190 136165 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_37160 138160 137177 gene locus_tag LOCUS_37170 138160 137177 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 protein_id gnl|my_center|LOCUS_37170 138199 138942 gene locus_tag LOCUS_37180 138199 138942 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_37180 138987 139871 gene locus_tag LOCUS_37190 138987 139871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 139971 140471 gene locus_tag LOCUS_37200 139971 140471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 140682 140404 gene locus_tag LOCUS_37210 140682 140404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 142040 140679 gene locus_tag LOCUS_37220 142040 140679 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227536.1 protein_id gnl|my_center|LOCUS_37220 142775 142059 gene locus_tag LOCUS_37230 142775 142059 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227535.1 protein_id gnl|my_center|LOCUS_37230 142885 143328 gene locus_tag LOCUS_37240 142885 143328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 143325 143726 gene locus_tag LOCUS_37250 143325 143726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 143803 144681 gene locus_tag LOCUS_37260 143803 144681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 144820 145686 gene locus_tag LOCUS_37270 144820 145686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 148751 146028 gene locus_tag LOCUS_37280 148751 146028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 150972 148786 gene locus_tag LOCUS_37290 150972 148786 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204072091.1 protein_id gnl|my_center|LOCUS_37290 151074 151910 gene locus_tag LOCUS_37300 151074 151910 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222914.1 protein_id gnl|my_center|LOCUS_37300 151977 153158 gene locus_tag LOCUS_37310 151977 153158 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413979.1 protein_id gnl|my_center|LOCUS_37310 153514 153161 gene locus_tag LOCUS_37320 153514 153161 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058519.1 protein_id gnl|my_center|LOCUS_37320 153878 153525 gene locus_tag LOCUS_37330 153878 153525 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977520.1 protein_id gnl|my_center|LOCUS_37330 154012 154881 gene locus_tag LOCUS_37340 154012 154881 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_37340 154894 155529 gene locus_tag LOCUS_37350 154894 155529 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_37350 155543 156424 gene locus_tag LOCUS_37360 155543 156424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229446.1 protein_id gnl|my_center|LOCUS_37360 156424 156996 gene locus_tag LOCUS_37370 156424 156996 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975821.1 protein_id gnl|my_center|LOCUS_37370 158525 156963 gene locus_tag LOCUS_37380 158525 156963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 <159275 158522 gene locus_tag LOCUS_37390 <159275 158522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895435.1:CaiB/BaiF CoA-transferase family protein >Feature sequence14 1894 602 gene locus_tag LOCUS_37400 1894 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 2973 1891 gene locus_tag LOCUS_37410 2973 1891 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_37410 3845 2970 gene locus_tag LOCUS_37420 3845 2970 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_37420 3848 4990 gene locus_tag LOCUS_37430 3848 4990 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419340.1 protein_id gnl|my_center|LOCUS_37430 4987 5757 gene locus_tag LOCUS_37440 4987 5757 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_37440 5796 7181 gene locus_tag LOCUS_37450 5796 7181 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229605.1 protein_id gnl|my_center|LOCUS_37450 8214 7153 gene locus_tag LOCUS_37460 8214 7153 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225238.1 protein_id gnl|my_center|LOCUS_37460 8915 8214 gene locus_tag LOCUS_37470 8915 8214 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_37470 9745 8912 gene locus_tag LOCUS_37480 9745 8912 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_37480 10490 9756 gene locus_tag LOCUS_37490 10490 9756 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_37490 11656 10538 gene locus_tag LOCUS_37500 11656 10538 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224421.1 protein_id gnl|my_center|LOCUS_37500 11749 12987 gene locus_tag LOCUS_37510 11749 12987 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466839.1 protein_id gnl|my_center|LOCUS_37510 13451 12981 gene locus_tag LOCUS_37520 13451 12981 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222375.1 protein_id gnl|my_center|LOCUS_37520 13513 14154 gene locus_tag LOCUS_37530 13513 14154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_37530 14622 14155 gene locus_tag LOCUS_37540 14622 14155 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467525.1 protein_id gnl|my_center|LOCUS_37540 15488 14619 gene locus_tag LOCUS_37550 15488 14619 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_37550 16639 15485 gene locus_tag LOCUS_37560 16639 15485 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_37560 17677 16640 gene locus_tag LOCUS_37570 17677 16640 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_37570 18681 17674 gene locus_tag LOCUS_37580 18681 17674 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_37580 18983 18732 gene locus_tag LOCUS_37590 18983 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 19294 19028 gene locus_tag LOCUS_37600 19294 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 19384 20424 gene locus_tag LOCUS_37610 19384 20424 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078017.1 protein_id gnl|my_center|LOCUS_37610 20446 21960 gene locus_tag LOCUS_37620 20446 21960 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_37620 23172 22396 gene locus_tag LOCUS_37630 23172 22396 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_37630 23229 24875 gene locus_tag LOCUS_37640 23229 24875 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_37640 24856 25965 gene locus_tag LOCUS_37650 24856 25965 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_37650 25958 26515 gene locus_tag LOCUS_37660 25958 26515 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 protein_id gnl|my_center|LOCUS_37660 26717 26520 gene locus_tag LOCUS_37670 26717 26520 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228723.1 protein_id gnl|my_center|LOCUS_37670 28365 26722 gene locus_tag LOCUS_37680 28365 26722 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225796.1 protein_id gnl|my_center|LOCUS_37680 29493 28381 gene locus_tag LOCUS_37690 29493 28381 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 protein_id gnl|my_center|LOCUS_37690 30703 29513 gene locus_tag LOCUS_37700 30703 29513 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_37700 30777 31862 gene locus_tag LOCUS_37710 30777 31862 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_37710 31868 32755 gene locus_tag LOCUS_37720 31868 32755 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_37720 32752 34260 gene locus_tag LOCUS_37730 32752 34260 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_37730 34269 35030 gene locus_tag LOCUS_37740 34269 35030 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_37740 35072 35857 gene locus_tag LOCUS_37750 35072 35857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224299.1 protein_id gnl|my_center|LOCUS_37750 35862 36692 gene locus_tag LOCUS_37760 35862 36692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466821.1 protein_id gnl|my_center|LOCUS_37760 36689 37999 gene locus_tag LOCUS_37770 36689 37999 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_37770 37996 39036 gene locus_tag LOCUS_37780 37996 39036 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224302.1 protein_id gnl|my_center|LOCUS_37780 39024 40055 gene locus_tag LOCUS_37790 39024 40055 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284352.1 protein_id gnl|my_center|LOCUS_37790 40052 41239 gene locus_tag LOCUS_37800 40052 41239 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224304.1 protein_id gnl|my_center|LOCUS_37800 41236 42357 gene locus_tag LOCUS_37810 41236 42357 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224305.1 protein_id gnl|my_center|LOCUS_37810 42357 43592 gene locus_tag LOCUS_37820 42357 43592 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 protein_id gnl|my_center|LOCUS_37820 44714 43581 gene locus_tag LOCUS_37830 44714 43581 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_37830 45106 44711 gene locus_tag LOCUS_37840 45106 44711 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 protein_id gnl|my_center|LOCUS_37840 45963 45103 gene locus_tag LOCUS_37850 45963 45103 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_37850 47108 45960 gene locus_tag LOCUS_37860 47108 45960 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466834.1 protein_id gnl|my_center|LOCUS_37860 48122 47112 gene locus_tag LOCUS_37870 48122 47112 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224380.1 protein_id gnl|my_center|LOCUS_37870 50287 48122 gene locus_tag LOCUS_37880 50287 48122 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224373.1 protein_id gnl|my_center|LOCUS_37880 50342 50971 gene locus_tag LOCUS_37890 gene kstR 50342 50971 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224372.1 protein_id gnl|my_center|LOCUS_37890 51028 51645 gene locus_tag LOCUS_37900 51028 51645 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_37900 52274 51666 gene locus_tag LOCUS_37910 52274 51666 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878264.1 protein_id gnl|my_center|LOCUS_37910 52412 53137 gene locus_tag LOCUS_37920 52412 53137 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076158225.1 protein_id gnl|my_center|LOCUS_37920 53174 53881 gene locus_tag LOCUS_37930 53174 53881 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_37930 54537 53878 gene locus_tag LOCUS_37940 54537 53878 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229616.1 protein_id gnl|my_center|LOCUS_37940 55277 54555 gene locus_tag LOCUS_37950 55277 54555 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877404.1 protein_id gnl|my_center|LOCUS_37950 56065 55298 gene locus_tag LOCUS_37960 56065 55298 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071522.1 protein_id gnl|my_center|LOCUS_37960 56575 56078 gene locus_tag LOCUS_37970 56575 56078 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229621.1 protein_id gnl|my_center|LOCUS_37970 56750 57742 gene locus_tag LOCUS_37980 56750 57742 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_37980 57739 59145 gene locus_tag LOCUS_37990 57739 59145 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_37990 59206 60531 gene locus_tag LOCUS_38000 59206 60531 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229644.1 protein_id gnl|my_center|LOCUS_38000 60528 61730 gene locus_tag LOCUS_38010 60528 61730 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229645.1 protein_id gnl|my_center|LOCUS_38010 62013 62531 gene locus_tag LOCUS_38020 62013 62531 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066533.1 protein_id gnl|my_center|LOCUS_38020 63068 62535 gene locus_tag LOCUS_38030 63068 62535 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 protein_id gnl|my_center|LOCUS_38030 63379 63086 gene locus_tag LOCUS_38040 63379 63086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 63444 64043 gene locus_tag LOCUS_38050 63444 64043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 64630 64031 gene locus_tag LOCUS_38060 64630 64031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 65584 64949 gene locus_tag LOCUS_38070 65584 64949 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228507.1 protein_id gnl|my_center|LOCUS_38070 65627 66034 gene locus_tag LOCUS_38080 65627 66034 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_38080 66829 65996 gene locus_tag LOCUS_38090 66829 65996 CDS product APH(3'') family aminoglycoside O-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110890.1 protein_id gnl|my_center|LOCUS_38090 67094 67417 gene locus_tag LOCUS_38100 67094 67417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 67460 68272 gene locus_tag LOCUS_38110 67460 68272 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229627.1 protein_id gnl|my_center|LOCUS_38110 69567 68338 gene locus_tag LOCUS_38120 69567 68338 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_38120 70894 69584 gene locus_tag LOCUS_38130 70894 69584 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_38130 71887 71036 gene locus_tag LOCUS_38140 71887 71036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 73734 71884 gene locus_tag LOCUS_38150 73734 71884 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227893.1 protein_id gnl|my_center|LOCUS_38150 73928 74551 gene locus_tag LOCUS_38160 73928 74551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 75766 74606 gene locus_tag LOCUS_38170 75766 74606 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_38170 77719 75770 gene locus_tag LOCUS_38180 77719 75770 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_38180 79356 77722 gene locus_tag LOCUS_38190 79356 77722 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_38190 80238 79450 gene locus_tag LOCUS_38200 80238 79450 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_38200 80423 81010 gene locus_tag LOCUS_38210 80423 81010 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_38210 81145 81945 gene locus_tag LOCUS_38220 81145 81945 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229628.1 protein_id gnl|my_center|LOCUS_38220 82025 84235 gene locus_tag LOCUS_38230 82025 84235 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226197.1 protein_id gnl|my_center|LOCUS_38230 84271 84786 gene locus_tag LOCUS_38240 84271 84786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229665.1 protein_id gnl|my_center|LOCUS_38240 84871 85776 gene locus_tag LOCUS_38250 84871 85776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 85773 86078 gene locus_tag LOCUS_38260 85773 86078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 86096 89134 gene locus_tag LOCUS_38270 86096 89134 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224805.1 protein_id gnl|my_center|LOCUS_38270 89139 90686 gene locus_tag LOCUS_38280 89139 90686 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229675.1 protein_id gnl|my_center|LOCUS_38280 90817 91932 gene locus_tag LOCUS_38290 gene ald 90817 91932 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_38290 92899 93102 gene locus_tag LOCUS_38300 92899 93102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 93106 93432 gene locus_tag LOCUS_38310 93106 93432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 93481 94968 gene locus_tag LOCUS_38320 93481 94968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 94968 95852 gene locus_tag LOCUS_38330 94968 95852 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229684.1 protein_id gnl|my_center|LOCUS_38330 96014 99991 gene locus_tag LOCUS_38340 96014 99991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_38340 100112 103855 gene locus_tag LOCUS_38350 100112 103855 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467712.1 protein_id gnl|my_center|LOCUS_38350 103859 104035 gene locus_tag LOCUS_38360 103859 104035 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_38360 105090 104074 gene locus_tag LOCUS_38370 105090 104074 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_38370 105114 107114 gene locus_tag LOCUS_38380 105114 107114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 107126 107320 gene locus_tag LOCUS_38390 107126 107320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 107371 107577 gene locus_tag LOCUS_38400 107371 107577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 108730 107585 gene locus_tag LOCUS_38410 gene hutI 108730 107585 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 protein_id gnl|my_center|LOCUS_38410 110034 108724 gene locus_tag LOCUS_38420 110034 108724 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_38420 111224 110031 gene locus_tag LOCUS_38430 111224 110031 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223169.1 protein_id gnl|my_center|LOCUS_38430 112876 111221 gene locus_tag LOCUS_38440 gene hutU 112876 111221 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223168.1 protein_id gnl|my_center|LOCUS_38440 114369 112873 gene locus_tag LOCUS_38450 gene hutH 114369 112873 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223167.1 protein_id gnl|my_center|LOCUS_38450 114447 115220 gene locus_tag LOCUS_38460 114447 115220 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_38460 115250 116272 gene locus_tag LOCUS_38470 115250 116272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486834.1 protein_id gnl|my_center|LOCUS_38470 117263 116349 gene locus_tag LOCUS_38480 117263 116349 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_38480 117967 117275 gene locus_tag LOCUS_38490 117967 117275 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_38490 118632 117964 gene locus_tag LOCUS_38500 118632 117964 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229697.1 protein_id gnl|my_center|LOCUS_38500 119765 118629 gene locus_tag LOCUS_38510 119765 118629 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229698.1 protein_id gnl|my_center|LOCUS_38510 122434 119945 gene locus_tag LOCUS_38520 122434 119945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 123929 122730 gene locus_tag LOCUS_38530 123929 122730 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229700.1 protein_id gnl|my_center|LOCUS_38530 124066 124761 gene locus_tag LOCUS_38540 124066 124761 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_38540 125076 124738 gene locus_tag LOCUS_38550 125076 124738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 125165 125572 gene locus_tag LOCUS_38560 gene sodN 125165 125572 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_38560 126211 125873 gene locus_tag LOCUS_38570 126211 125873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 126105 126347 gene locus_tag LOCUS_38580 126105 126347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 126378 126971 gene locus_tag LOCUS_38590 126378 126971 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_38590 126982 127476 gene locus_tag LOCUS_38600 126982 127476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_38600 127502 127873 gene locus_tag LOCUS_38610 127502 127873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 127916 128257 gene locus_tag LOCUS_38620 127916 128257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 128251 129024 gene locus_tag LOCUS_38630 128251 129024 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469478.1 protein_id gnl|my_center|LOCUS_38630 129081 129350 gene locus_tag LOCUS_38640 129081 129350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 129379 129570 gene locus_tag LOCUS_38650 129379 129570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 130085 129567 gene locus_tag LOCUS_38660 130085 129567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 130726 130085 gene locus_tag LOCUS_38670 130726 130085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 131434 130733 gene locus_tag LOCUS_38680 131434 130733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 131751 131431 gene locus_tag LOCUS_38690 131751 131431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 132162 131770 gene locus_tag LOCUS_38700 132162 131770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 133081 132350 gene locus_tag LOCUS_38710 133081 132350 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222282.1 protein_id gnl|my_center|LOCUS_38710 133622 133194 gene locus_tag LOCUS_38720 133622 133194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056347.1 protein_id gnl|my_center|LOCUS_38720 133681 134661 gene locus_tag LOCUS_38730 133681 134661 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229709.1 protein_id gnl|my_center|LOCUS_38730 134903 135157 gene locus_tag LOCUS_38740 134903 135157 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003059797.1 protein_id gnl|my_center|LOCUS_38740 136779 135274 gene locus_tag LOCUS_38750 136779 135274 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_38750 137196 136927 gene locus_tag LOCUS_38760 137196 136927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 137843 137193 gene locus_tag LOCUS_38770 137843 137193 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_38770 138562 137960 gene locus_tag LOCUS_38780 138562 137960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_38780 139329 138568 gene locus_tag LOCUS_38790 139329 138568 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229715.1 protein_id gnl|my_center|LOCUS_38790 139423 140727 gene locus_tag LOCUS_38800 gene aroA 139423 140727 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727983.1 protein_id gnl|my_center|LOCUS_38800 140724 141749 gene locus_tag LOCUS_38810 gene rsgA 140724 141749 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229716.1 protein_id gnl|my_center|LOCUS_38810 141816 142646 gene locus_tag LOCUS_38820 141816 142646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229718.1 protein_id gnl|my_center|LOCUS_38820 142795 142571 gene locus_tag LOCUS_38830 142795 142571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 142794 143147 gene locus_tag LOCUS_38840 142794 143147 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_38840 143154 144347 gene locus_tag LOCUS_38850 143154 144347 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_38850 144344 144961 gene locus_tag LOCUS_38860 144344 144961 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230676.1 protein_id gnl|my_center|LOCUS_38860 148220 144972 gene locus_tag LOCUS_38870 148220 144972 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_38870 149944 148316 gene locus_tag LOCUS_38880 gene pruA 149944 148316 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_38880 150681 150031 gene locus_tag LOCUS_38890 150681 150031 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 protein_id gnl|my_center|LOCUS_38890 150763 151764 gene locus_tag LOCUS_38900 150763 151764 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226261.1 protein_id gnl|my_center|LOCUS_38900 151850 152452 gene locus_tag LOCUS_38910 151850 152452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 152445 153176 gene locus_tag LOCUS_38920 152445 153176 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_38920 153209 153931 gene locus_tag LOCUS_38930 153209 153931 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_38930 154545 153946 gene locus_tag LOCUS_38940 154545 153946 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 protein_id gnl|my_center|LOCUS_38940 154750 154547 gene locus_tag LOCUS_38950 154750 154547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 155413 154949 gene locus_tag LOCUS_38960 155413 154949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 156041 155535 gene locus_tag LOCUS_38970 156041 155535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229719.1 protein_id gnl|my_center|LOCUS_38970 156122 156844 gene locus_tag LOCUS_38980 156122 156844 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229721.1 protein_id gnl|my_center|LOCUS_38980 >Feature sequence15 968 2263 gene locus_tag LOCUS_38990 968 2263 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_38990 2260 3435 gene locus_tag LOCUS_39000 2260 3435 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231016.1 protein_id gnl|my_center|LOCUS_39000 3432 4130 gene locus_tag LOCUS_39010 3432 4130 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231017.1 protein_id gnl|my_center|LOCUS_39010 4137 4766 gene locus_tag LOCUS_39020 4137 4766 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467889.1 protein_id gnl|my_center|LOCUS_39020 4795 5826 gene locus_tag LOCUS_39030 gene tdh 4795 5826 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_39030 5826 7016 gene locus_tag LOCUS_39040 5826 7016 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_39040 10124 7308 gene locus_tag LOCUS_39050 gene leuS 10124 7308 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231035.1 protein_id gnl|my_center|LOCUS_39050 10302 10751 gene locus_tag LOCUS_39060 10302 10751 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231037.1 protein_id gnl|my_center|LOCUS_39060 11315 10713 gene locus_tag LOCUS_39070 11315 10713 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231038.1 protein_id gnl|my_center|LOCUS_39070 11581 12927 gene locus_tag LOCUS_39080 11581 12927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087403.1 protein_id gnl|my_center|LOCUS_39080 14389 12884 gene locus_tag LOCUS_39090 14389 12884 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231051.1 protein_id gnl|my_center|LOCUS_39090 14493 14936 gene locus_tag LOCUS_39100 14493 14936 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_39100 14943 17156 gene locus_tag LOCUS_39110 14943 17156 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231053.1 protein_id gnl|my_center|LOCUS_39110 17125 18771 gene locus_tag LOCUS_39120 gene murJ 17125 18771 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231054.1 protein_id gnl|my_center|LOCUS_39120 18880 20439 gene locus_tag LOCUS_39130 18880 20439 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231055.1 protein_id gnl|my_center|LOCUS_39130 20452 21132 gene locus_tag LOCUS_39140 gene sigM 20452 21132 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_39140 21129 21935 gene locus_tag LOCUS_39150 21129 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231057.1 protein_id gnl|my_center|LOCUS_39150 22087 23088 gene locus_tag LOCUS_39160 gene trxB 22087 23088 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_39160 23099 23425 gene locus_tag LOCUS_39170 gene trxA 23099 23425 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082899.1 protein_id gnl|my_center|LOCUS_39170 23674 24768 gene locus_tag LOCUS_39180 23674 24768 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231059.1 protein_id gnl|my_center|LOCUS_39180 25470 24835 gene locus_tag LOCUS_39190 25470 24835 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231060.1 protein_id gnl|my_center|LOCUS_39190 25689 26921 gene locus_tag LOCUS_39200 25689 26921 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_39200 26969 27943 gene locus_tag LOCUS_39210 26969 27943 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_39210 28987 27998 gene locus_tag LOCUS_39220 28987 27998 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_39220 29898 28999 gene locus_tag LOCUS_39230 29898 28999 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_39230 30793 30071 gene locus_tag LOCUS_39240 gene rsmG 30793 30071 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231065.1 protein_id gnl|my_center|LOCUS_39240 31488 30841 gene locus_tag LOCUS_39250 31488 30841 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467902.1 protein_id gnl|my_center|LOCUS_39250 32711 31518 gene locus_tag LOCUS_39260 32711 31518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 33192 32716 gene locus_tag LOCUS_39270 33192 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 33637 33176 gene locus_tag LOCUS_39280 33637 33176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 33780 33643 gene locus_tag LOCUS_39290 33780 33643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 34193 33795 gene locus_tag LOCUS_39300 34193 33795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 34280 36139 gene locus_tag LOCUS_39310 34280 36139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 36777 37910 gene locus_tag LOCUS_39320 gene dnaN 36777 37910 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221956.1 protein_id gnl|my_center|LOCUS_39320 37948 38874 gene locus_tag LOCUS_39330 gene gnd 37948 38874 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221957.1 protein_id gnl|my_center|LOCUS_39330 38879 40039 gene locus_tag LOCUS_39340 gene recF 38879 40039 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221958.1 protein_id gnl|my_center|LOCUS_39340 40020 40682 gene locus_tag LOCUS_39350 40020 40682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 40868 42838 gene locus_tag LOCUS_39360 gene gyrB 40868 42838 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_39360 42895 45480 gene locus_tag LOCUS_39370 gene gyrA 42895 45480 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221961.1 protein_id gnl|my_center|LOCUS_39370 45516 47063 gene locus_tag LOCUS_39380 45516 47063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 47156 47231 gene locus_tag LOCUS_t00390 47156 47231 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 47680 47826 gene locus_tag LOCUS_39390 47680 47826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 47927 48001 gene locus_tag LOCUS_t00400 47927 48001 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48125 48715 gene locus_tag LOCUS_39400 48125 48715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 48901 49452 gene locus_tag LOCUS_39410 48901 49452 CDS product DUF2020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742125.1 protein_id gnl|my_center|LOCUS_39410 50160 49507 gene locus_tag LOCUS_39420 50160 49507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 50280 50804 gene locus_tag LOCUS_39430 50280 50804 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878080.1 protein_id gnl|my_center|LOCUS_39430 50805 51734 gene locus_tag LOCUS_39440 50805 51734 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_39440 52181 51762 gene locus_tag LOCUS_39450 52181 51762 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091389441.1 protein_id gnl|my_center|LOCUS_39450 52581 52315 gene locus_tag LOCUS_39460 gene crgA 52581 52315 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221990.1 protein_id gnl|my_center|LOCUS_39460 52708 53643 gene locus_tag LOCUS_39470 52708 53643 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221991.1 protein_id gnl|my_center|LOCUS_39470 53643 53798 gene locus_tag LOCUS_39480 53643 53798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221992.1 protein_id gnl|my_center|LOCUS_39480 53857 54510 gene locus_tag LOCUS_39490 53857 54510 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221999.1 protein_id gnl|my_center|LOCUS_39490 56536 54536 gene locus_tag LOCUS_39500 gene pknB 56536 54536 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_39500 58085 56619 gene locus_tag LOCUS_39510 58085 56619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 59612 58092 gene locus_tag LOCUS_39520 59612 58092 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222005.1 protein_id gnl|my_center|LOCUS_39520 60964 59609 gene locus_tag LOCUS_39530 60964 59609 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222006.1 protein_id gnl|my_center|LOCUS_39530 62475 61054 gene locus_tag LOCUS_39540 62475 61054 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222007.1 protein_id gnl|my_center|LOCUS_39540 62915 62472 gene locus_tag LOCUS_39550 62915 62472 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003079002.1 protein_id gnl|my_center|LOCUS_39550 64184 63012 gene locus_tag LOCUS_39560 64184 63012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 64312 64396 gene locus_tag LOCUS_t00410 64312 64396 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 65531 66226 gene locus_tag LOCUS_39570 65531 66226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222031.1 protein_id gnl|my_center|LOCUS_39570 66227 66874 gene locus_tag LOCUS_39580 66227 66874 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222032.1 protein_id gnl|my_center|LOCUS_39580 68176 66860 gene locus_tag LOCUS_39590 68176 66860 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 protein_id gnl|my_center|LOCUS_39590 68205 69431 gene locus_tag LOCUS_39600 68205 69431 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222035.1 protein_id gnl|my_center|LOCUS_39600 70036 69428 gene locus_tag LOCUS_39610 70036 69428 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_39610 70646 70281 gene locus_tag LOCUS_39620 70646 70281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 70930 70661 gene locus_tag LOCUS_39630 70930 70661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222040.1 protein_id gnl|my_center|LOCUS_39630 71189 72526 gene locus_tag LOCUS_39640 71189 72526 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222041.1 protein_id gnl|my_center|LOCUS_39640 72544 73464 gene locus_tag LOCUS_39650 72544 73464 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_39650 73741 73983 gene locus_tag LOCUS_39660 73741 73983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 75140 74133 gene locus_tag LOCUS_39670 75140 74133 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222043.1 protein_id gnl|my_center|LOCUS_39670 75657 75154 gene locus_tag LOCUS_39680 75657 75154 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284846.1 protein_id gnl|my_center|LOCUS_39680 76448 75687 gene locus_tag LOCUS_39690 76448 75687 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 protein_id gnl|my_center|LOCUS_39690 77087 76521 gene locus_tag LOCUS_39700 77087 76521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222046.1 protein_id gnl|my_center|LOCUS_39700 77153 79942 gene locus_tag LOCUS_39710 77153 79942 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_39710 80395 79919 gene locus_tag LOCUS_39720 80395 79919 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222051.1 protein_id gnl|my_center|LOCUS_39720 80552 82102 gene locus_tag LOCUS_39730 80552 82102 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_39730 82868 82110 gene locus_tag LOCUS_39740 82868 82110 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_39740 83414 82917 gene locus_tag LOCUS_39750 83414 82917 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223801.1 protein_id gnl|my_center|LOCUS_39750 84390 83428 gene locus_tag LOCUS_39760 84390 83428 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_39760 84513 85457 gene locus_tag LOCUS_39770 84513 85457 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_39770 86031 85744 gene locus_tag LOCUS_39780 86031 85744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 88162 86018 gene locus_tag LOCUS_39790 88162 86018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 89432 88203 gene locus_tag LOCUS_39800 89432 88203 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039282280.1 protein_id gnl|my_center|LOCUS_39800 93242 89493 gene locus_tag LOCUS_39810 93242 89493 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091628724.1 protein_id gnl|my_center|LOCUS_39810 94419 93235 gene locus_tag LOCUS_39820 94419 93235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842871.1 protein_id gnl|my_center|LOCUS_39820 95644 94514 gene locus_tag LOCUS_39830 95644 94514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 96939 95662 gene locus_tag LOCUS_39840 96939 95662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222070.1 protein_id gnl|my_center|LOCUS_39840 97759 96992 gene locus_tag LOCUS_39850 97759 96992 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226798.1 protein_id gnl|my_center|LOCUS_39850 98938 97763 gene locus_tag LOCUS_39860 98938 97763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39860 99540 98935 gene locus_tag LOCUS_39870 99540 98935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 99884 99540 gene locus_tag LOCUS_39880 99884 99540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 100944 99982 gene locus_tag LOCUS_39890 100944 99982 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_39890 101641 100937 gene locus_tag LOCUS_39900 101641 100937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 102654 101638 gene locus_tag LOCUS_39910 102654 101638 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_39910 104390 102651 gene locus_tag LOCUS_39920 104390 102651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223891.1 protein_id gnl|my_center|LOCUS_39920 104783 104481 gene locus_tag LOCUS_39930 104783 104481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 104863 105531 gene locus_tag LOCUS_39940 gene msrA 104863 105531 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_39940 105564 105872 gene locus_tag LOCUS_39950 105564 105872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 105877 106395 gene locus_tag LOCUS_39960 105877 106395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 106395 106544 gene locus_tag LOCUS_39970 106395 106544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 106596 106847 gene locus_tag LOCUS_39980 106596 106847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 106851 107117 gene locus_tag LOCUS_39990 106851 107117 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390944.1 protein_id gnl|my_center|LOCUS_39990 107244 107169 gene locus_tag LOCUS_t00420 107244 107169 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 107438 108943 gene locus_tag LOCUS_40000 107438 108943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 109019 109453 gene locus_tag LOCUS_40010 109019 109453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222080.1 protein_id gnl|my_center|LOCUS_40010 109481 110347 gene locus_tag LOCUS_40020 109481 110347 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222081.1 protein_id gnl|my_center|LOCUS_40020 110392 111657 gene locus_tag LOCUS_40030 110392 111657 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222082.1 protein_id gnl|my_center|LOCUS_40030 111744 113717 gene locus_tag LOCUS_40040 111744 113717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 113950 113732 gene locus_tag LOCUS_40050 113950 113732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 114079 114963 gene locus_tag LOCUS_40060 114079 114963 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_40060 115036 115872 gene locus_tag LOCUS_40070 115036 115872 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284934.1 protein_id gnl|my_center|LOCUS_40070 115873 116301 gene locus_tag LOCUS_40080 115873 116301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 116326 118119 gene locus_tag LOCUS_40090 116326 118119 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222087.1 protein_id gnl|my_center|LOCUS_40090 118127 119281 gene locus_tag LOCUS_40100 118127 119281 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223488.1 protein_id gnl|my_center|LOCUS_40100 119278 120048 gene locus_tag LOCUS_40110 119278 120048 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223487.1 protein_id gnl|my_center|LOCUS_40110 120075 120398 gene locus_tag LOCUS_40120 120075 120398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223486.1 protein_id gnl|my_center|LOCUS_40120 120395 122104 gene locus_tag LOCUS_40130 120395 122104 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223485.1 protein_id gnl|my_center|LOCUS_40130 122340 122684 gene locus_tag LOCUS_40140 122340 122684 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223484.1 protein_id gnl|my_center|LOCUS_40140 122681 124300 gene locus_tag LOCUS_40150 122681 124300 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223483.1 protein_id gnl|my_center|LOCUS_40150 124433 124750 gene locus_tag LOCUS_40160 124433 124750 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_40160 124752 125642 gene locus_tag LOCUS_40170 124752 125642 CDS product DUF4328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222089.1 protein_id gnl|my_center|LOCUS_40170 126839 125649 gene locus_tag LOCUS_40180 126839 125649 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 protein_id gnl|my_center|LOCUS_40180 126888 127691 gene locus_tag LOCUS_40190 126888 127691 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084130.1 protein_id gnl|my_center|LOCUS_40190 127703 128644 gene locus_tag LOCUS_40200 127703 128644 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_40200 128641 128988 gene locus_tag LOCUS_40210 128641 128988 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831628.1 protein_id gnl|my_center|LOCUS_40210 130135 128993 gene locus_tag LOCUS_40220 130135 128993 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529942.1 protein_id gnl|my_center|LOCUS_40220 130173 130748 gene locus_tag LOCUS_40230 130173 130748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 131290 130745 gene locus_tag LOCUS_40240 131290 130745 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284940.1 protein_id gnl|my_center|LOCUS_40240 131441 132589 gene locus_tag LOCUS_40250 131441 132589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 133781 132570 gene locus_tag LOCUS_40260 133781 132570 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466510.1 protein_id gnl|my_center|LOCUS_40260 133935 134741 gene locus_tag LOCUS_40270 133935 134741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 134738 134914 gene locus_tag LOCUS_40280 134738 134914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 136167 134968 gene locus_tag LOCUS_40290 136167 134968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 137174 136164 gene locus_tag LOCUS_40300 137174 136164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 137542 137180 gene locus_tag LOCUS_40310 137542 137180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 140045 137637 gene locus_tag LOCUS_40320 gene ligD 140045 137637 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225117.1 protein_id gnl|my_center|LOCUS_40320 140868 140065 gene locus_tag LOCUS_40330 140868 140065 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222100.1 protein_id gnl|my_center|LOCUS_40330 140765 141361 gene locus_tag LOCUS_40340 140765 141361 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222101.1 protein_id gnl|my_center|LOCUS_40340 142131 141358 gene locus_tag LOCUS_40350 142131 141358 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222102.1 protein_id gnl|my_center|LOCUS_40350 144487 142184 gene locus_tag LOCUS_40360 144487 142184 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313782.1 protein_id gnl|my_center|LOCUS_40360 145775 144597 gene locus_tag LOCUS_40370 145775 144597 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222108.1 protein_id gnl|my_center|LOCUS_40370 145951 146721 gene locus_tag LOCUS_40380 145951 146721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222109.1 protein_id gnl|my_center|LOCUS_40380 146718 147914 gene locus_tag LOCUS_40390 gene fahA 146718 147914 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_40390 147917 148612 gene locus_tag LOCUS_40400 147917 148612 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222110.1 protein_id gnl|my_center|LOCUS_40400 148717 150549 gene locus_tag LOCUS_40410 148717 150549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 151835 150951 gene locus_tag LOCUS_40420 151835 150951 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079707.1 protein_id gnl|my_center|LOCUS_40420 151950 153455 gene locus_tag LOCUS_40430 151950 153455 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222114.1 protein_id gnl|my_center|LOCUS_40430 153470 154477 gene locus_tag LOCUS_40440 gene cydB 153470 154477 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222115.1 protein_id gnl|my_center|LOCUS_40440 154914 154988 gene locus_tag LOCUS_t00430 154914 154988 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 2362 197 gene locus_tag LOCUS_40450 2362 197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230975.1 protein_id gnl|my_center|LOCUS_40450 3048 2359 gene locus_tag LOCUS_40460 3048 2359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230976.1 protein_id gnl|my_center|LOCUS_40460 3317 7864 gene locus_tag LOCUS_40470 3317 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 8219 8425 gene locus_tag LOCUS_40480 8219 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 9149 8574 gene locus_tag LOCUS_40490 9149 8574 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226060.1 protein_id gnl|my_center|LOCUS_40490 9223 10161 gene locus_tag LOCUS_40500 9223 10161 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_40500 10367 10158 gene locus_tag LOCUS_40510 10367 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 10853 10419 gene locus_tag LOCUS_40520 10853 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 10843 12630 gene locus_tag LOCUS_40530 10843 12630 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_40530 12641 13624 gene locus_tag LOCUS_40540 12641 13624 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_40540 14040 13621 gene locus_tag LOCUS_40550 14040 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 15040 14189 gene locus_tag LOCUS_40560 gene ligD 15040 14189 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227028.1 protein_id gnl|my_center|LOCUS_40560 16487 15141 gene locus_tag LOCUS_40570 16487 15141 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_40570 17116 16544 gene locus_tag LOCUS_40580 17116 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 17617 17183 gene locus_tag LOCUS_40590 17617 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 17751 18476 gene locus_tag LOCUS_40600 17751 18476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 18541 19524 gene locus_tag LOCUS_40610 18541 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 21092 19521 gene locus_tag LOCUS_40620 21092 19521 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_40620 21283 21843 gene locus_tag LOCUS_40630 21283 21843 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968585.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40630 21840 22925 gene locus_tag LOCUS_40640 21840 22925 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226367.1 protein_id gnl|my_center|LOCUS_40640 22939 23223 gene locus_tag LOCUS_40650 22939 23223 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 protein_id gnl|my_center|LOCUS_40650 23220 23750 gene locus_tag LOCUS_40660 23220 23750 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_40660 23834 24655 gene locus_tag LOCUS_40670 23834 24655 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389774.1 protein_id gnl|my_center|LOCUS_40670 24724 24930 gene locus_tag LOCUS_40680 24724 24930 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_40680 25887 24976 gene locus_tag LOCUS_40690 25887 24976 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226393.1 protein_id gnl|my_center|LOCUS_40690 26059 27768 gene locus_tag LOCUS_40700 26059 27768 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031032.1 protein_id gnl|my_center|LOCUS_40700 29226 27823 gene locus_tag LOCUS_40710 29226 27823 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_40710 30255 29245 gene locus_tag LOCUS_40720 30255 29245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_40720 31202 30252 gene locus_tag LOCUS_40730 31202 30252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_40730 32186 31206 gene locus_tag LOCUS_40740 32186 31206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_40740 33246 32206 gene locus_tag LOCUS_40750 33246 32206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_40750 34910 33246 gene locus_tag LOCUS_40760 34910 33246 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_40760 35129 36355 gene locus_tag LOCUS_40770 35129 36355 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230103.1 protein_id gnl|my_center|LOCUS_40770 36807 37811 gene locus_tag LOCUS_40780 36807 37811 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_40780 37818 38357 gene locus_tag LOCUS_40790 37818 38357 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_40790 40631 38358 gene locus_tag LOCUS_40800 40631 38358 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227076.1 protein_id gnl|my_center|LOCUS_40800 41750 40752 gene locus_tag LOCUS_40810 41750 40752 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_40810 42102 41791 gene locus_tag LOCUS_40820 42102 41791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 42472 42110 gene locus_tag LOCUS_40830 42472 42110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 43311 42469 gene locus_tag LOCUS_40840 43311 42469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 43736 44356 gene locus_tag LOCUS_40850 43736 44356 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_40850 44438 45751 gene locus_tag LOCUS_40860 44438 45751 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086846399.1 protein_id gnl|my_center|LOCUS_40860 46140 45730 gene locus_tag LOCUS_40870 46140 45730 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976576.1 protein_id gnl|my_center|LOCUS_40870 48194 46941 gene locus_tag LOCUS_40880 48194 46941 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_40880 48580 48197 gene locus_tag LOCUS_40890 48580 48197 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_40890 48938 50137 gene locus_tag LOCUS_40900 48938 50137 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_40900 50479 51534 gene locus_tag LOCUS_40910 50479 51534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 protein_id gnl|my_center|LOCUS_40910 51531 52403 gene locus_tag LOCUS_40920 51531 52403 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 protein_id gnl|my_center|LOCUS_40920 52400 53212 gene locus_tag LOCUS_40930 52400 53212 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_40930 53209 53985 gene locus_tag LOCUS_40940 53209 53985 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227771.1 protein_id gnl|my_center|LOCUS_40940 53982 55055 gene locus_tag LOCUS_40950 53982 55055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731583.1 protein_id gnl|my_center|LOCUS_40950 55157 56134 gene locus_tag LOCUS_40960 55157 56134 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_40960 56127 56597 gene locus_tag LOCUS_40970 56127 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 57495 56638 gene locus_tag LOCUS_40980 57495 56638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 57984 57514 gene locus_tag LOCUS_40990 57984 57514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 59678 57981 gene locus_tag LOCUS_41000 59678 57981 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_41000 60857 59769 gene locus_tag LOCUS_41010 gene galT 60857 59769 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_41010 61636 60854 gene locus_tag LOCUS_41020 61636 60854 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_41020 62095 63402 gene locus_tag LOCUS_41030 62095 63402 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_41030 63415 64317 gene locus_tag LOCUS_41040 63415 64317 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_41040 64314 65192 gene locus_tag LOCUS_41050 64314 65192 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445531.1 protein_id gnl|my_center|LOCUS_41050 65189 67300 gene locus_tag LOCUS_41060 65189 67300 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_41060 67297 67896 gene locus_tag LOCUS_41070 67297 67896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 69215 67884 gene locus_tag LOCUS_41080 69215 67884 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103999.1 protein_id gnl|my_center|LOCUS_41080 69333 69638 gene locus_tag LOCUS_41090 69333 69638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 69650 74275 gene locus_tag LOCUS_41100 69650 74275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 74275 75108 gene locus_tag LOCUS_41110 74275 75108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 75781 75119 gene locus_tag LOCUS_41120 75781 75119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_41120 77115 75778 gene locus_tag LOCUS_41130 77115 75778 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_41130 77370 77128 gene locus_tag LOCUS_41140 77370 77128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 77285 78358 gene locus_tag LOCUS_41150 77285 78358 CDS product pectin acetylesterase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878319.1 protein_id gnl|my_center|LOCUS_41150 78396 78701 gene locus_tag LOCUS_41160 78396 78701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 79231 78845 gene locus_tag LOCUS_41170 79231 78845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 79113 79352 gene locus_tag LOCUS_41180 79113 79352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 79647 79339 gene locus_tag LOCUS_41190 79647 79339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 80886 79726 gene locus_tag LOCUS_41200 80886 79726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 81430 81005 gene locus_tag LOCUS_41210 81430 81005 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191984393.1 protein_id gnl|my_center|LOCUS_41210 81596 82357 gene locus_tag LOCUS_41220 81596 82357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 83698 82733 gene locus_tag LOCUS_41230 83698 82733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 83938 84321 gene locus_tag LOCUS_41240 83938 84321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 84296 85540 gene locus_tag LOCUS_41250 84296 85540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 85543 86445 gene locus_tag LOCUS_41260 85543 86445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 86643 86458 gene locus_tag LOCUS_41270 86643 86458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 87512 86640 gene locus_tag LOCUS_41280 87512 86640 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_41280 87700 87930 gene locus_tag LOCUS_41290 87700 87930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 88681 88010 gene locus_tag LOCUS_41300 88681 88010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 90898 88742 gene locus_tag LOCUS_41310 90898 88742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 92034 90937 gene locus_tag LOCUS_41320 92034 90937 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_41320 93042 92131 gene locus_tag LOCUS_41330 93042 92131 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 protein_id gnl|my_center|LOCUS_41330 93980 93042 gene locus_tag LOCUS_41340 93980 93042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 94740 93991 gene locus_tag LOCUS_41350 94740 93991 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_41350 96008 94776 gene locus_tag LOCUS_41360 96008 94776 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_41360 97608 96019 gene locus_tag LOCUS_41370 97608 96019 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_41370 98562 97771 gene locus_tag LOCUS_41380 98562 97771 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928799.1 protein_id gnl|my_center|LOCUS_41380 98751 99602 gene locus_tag LOCUS_41390 98751 99602 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027038.1 protein_id gnl|my_center|LOCUS_41390 99649 100380 gene locus_tag LOCUS_41400 99649 100380 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_41400 100362 101801 gene locus_tag LOCUS_41410 100362 101801 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 protein_id gnl|my_center|LOCUS_41410 101794 102414 gene locus_tag LOCUS_41420 101794 102414 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_41420 102509 103831 gene locus_tag LOCUS_41430 102509 103831 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_41430 103828 104580 gene locus_tag LOCUS_41440 103828 104580 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223729.1 protein_id gnl|my_center|LOCUS_41440 105993 105304 gene locus_tag LOCUS_41450 105993 105304 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_41450 106058 106366 gene locus_tag LOCUS_41460 106058 106366 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803725.1 protein_id gnl|my_center|LOCUS_41460 106363 107322 gene locus_tag LOCUS_41470 106363 107322 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_41470 107799 107671 gene locus_tag LOCUS_41480 107799 107671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 108061 108912 gene locus_tag LOCUS_41490 108061 108912 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_41490 108909 110258 gene locus_tag LOCUS_41500 108909 110258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 110689 110255 gene locus_tag LOCUS_41510 110689 110255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 110831 112300 gene locus_tag LOCUS_41520 110831 112300 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_41520 112469 112969 gene locus_tag LOCUS_41530 112469 112969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 113342 114448 gene locus_tag LOCUS_41540 113342 114448 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_41540 114508 114849 gene locus_tag LOCUS_41550 114508 114849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 114846 115562 gene locus_tag LOCUS_41560 114846 115562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 116221 116611 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgtccccgcgcgagcggggctggtcc 117585 116785 gene locus_tag LOCUS_41570 117585 116785 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728440.1 protein_id gnl|my_center|LOCUS_41570 117650 119245 gene locus_tag LOCUS_41580 117650 119245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 119299 119693 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaccagccccgctcgcgcggggacgac 120063 119746 gene locus_tag LOCUS_41590 120063 119746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 120713 120051 gene locus_tag LOCUS_41600 120713 120051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 120859 122223 gene locus_tag LOCUS_41610 120859 122223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_41610 122224 122772 gene locus_tag LOCUS_41620 122224 122772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 123818 123105 gene locus_tag LOCUS_41630 123818 123105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 124726 123815 gene locus_tag LOCUS_41640 124726 123815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_41640 125592 124723 gene locus_tag LOCUS_41650 125592 124723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182524933.1 protein_id gnl|my_center|LOCUS_41650 126514 125585 gene locus_tag LOCUS_41660 126514 125585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_41660 126611 127480 gene locus_tag LOCUS_41670 126611 127480 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222502.1 protein_id gnl|my_center|LOCUS_41670 127515 128381 gene locus_tag LOCUS_41680 127515 128381 CDS product TIGR03560 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225208.1 protein_id gnl|my_center|LOCUS_41680 129079 128390 gene locus_tag LOCUS_41690 129079 128390 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903123.1 protein_id gnl|my_center|LOCUS_41690 129852 129079 gene locus_tag LOCUS_41700 129852 129079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 129971 131125 gene locus_tag LOCUS_41710 129971 131125 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185067440.1 protein_id gnl|my_center|LOCUS_41710 131137 131910 gene locus_tag LOCUS_41720 131137 131910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 131907 132638 gene locus_tag LOCUS_41730 131907 132638 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_41730 132696 133442 gene locus_tag LOCUS_41740 132696 133442 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_41740 133523 134827 gene locus_tag LOCUS_41750 gene glnA3 133523 134827 CDS product gamma-glutamylpolyamine synthetase GlnA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031340.1 protein_id gnl|my_center|LOCUS_41750 134933 135262 gene locus_tag LOCUS_41760 134933 135262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 135259 135807 gene locus_tag LOCUS_41770 135259 135807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 135809 136921 gene locus_tag LOCUS_41780 135809 136921 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031339.1 protein_id gnl|my_center|LOCUS_41780 137992 136880 gene locus_tag LOCUS_41790 137992 136880 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_41790 139173 137989 gene locus_tag LOCUS_41800 139173 137989 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556451.1 protein_id gnl|my_center|LOCUS_41800 140609 139173 gene locus_tag LOCUS_41810 140609 139173 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031663.1 protein_id gnl|my_center|LOCUS_41810 141385 140606 gene locus_tag LOCUS_41820 141385 140606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_41820 142161 141385 gene locus_tag LOCUS_41830 142161 141385 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226152.1 protein_id gnl|my_center|LOCUS_41830 142922 142158 gene locus_tag LOCUS_41840 142922 142158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_41840 143875 142919 gene locus_tag LOCUS_41850 143875 142919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 144043 144840 gene locus_tag LOCUS_41860 144043 144840 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223750.1 protein_id gnl|my_center|LOCUS_41860 144837 145592 gene locus_tag LOCUS_41870 144837 145592 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_41870 145589 146284 gene locus_tag LOCUS_41880 gene pcaH 145589 146284 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965195.1 protein_id gnl|my_center|LOCUS_41880 146287 146799 gene locus_tag LOCUS_41890 gene pcaG 146287 146799 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223754.1 protein_id gnl|my_center|LOCUS_41890 146813 147595 gene locus_tag LOCUS_41900 146813 147595 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 protein_id gnl|my_center|LOCUS_41900 147894 148673 gene locus_tag LOCUS_41910 147894 148673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 148986 148675 gene locus_tag LOCUS_41920 148986 148675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 <150753 149062 gene locus_tag LOCUS_41930 <150753 149062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966317.1:AAA domain-containing protein >Feature sequence17 <1 631 gene locus_tag LOCUS_41940 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728357.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 628 1476 gene locus_tag LOCUS_41950 628 1476 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893830.1 protein_id gnl|my_center|LOCUS_41950 1473 2108 gene locus_tag LOCUS_41960 1473 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 2105 3181 gene locus_tag LOCUS_41970 2105 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 3260 4249 gene locus_tag LOCUS_41980 3260 4249 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_41980 4249 5748 gene locus_tag LOCUS_41990 4249 5748 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 protein_id gnl|my_center|LOCUS_41990 5745 6488 gene locus_tag LOCUS_42000 5745 6488 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_42000 7067 6495 gene locus_tag LOCUS_42010 7067 6495 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825682.1 protein_id gnl|my_center|LOCUS_42010 7256 8710 gene locus_tag LOCUS_42020 7256 8710 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_42020 8707 9438 gene locus_tag LOCUS_42030 8707 9438 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_42030 9435 10433 gene locus_tag LOCUS_42040 9435 10433 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_42040 10426 11271 gene locus_tag LOCUS_42050 10426 11271 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577540.1 protein_id gnl|my_center|LOCUS_42050 11268 12161 gene locus_tag LOCUS_42060 11268 12161 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807629.1 protein_id gnl|my_center|LOCUS_42060 12139 12639 gene locus_tag LOCUS_42070 12139 12639 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 protein_id gnl|my_center|LOCUS_42070 12644 14950 gene locus_tag LOCUS_42080 12644 14950 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_42080 14962 15588 gene locus_tag LOCUS_42090 14962 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 16874 15597 gene locus_tag LOCUS_42100 16874 15597 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729120.1 protein_id gnl|my_center|LOCUS_42100 17210 17665 gene locus_tag LOCUS_42110 17210 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 18514 17666 gene locus_tag LOCUS_42120 18514 17666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 19348 18677 gene locus_tag LOCUS_42130 19348 18677 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224207.1 protein_id gnl|my_center|LOCUS_42130 19448 19816 gene locus_tag LOCUS_42140 19448 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 20019 21149 gene locus_tag LOCUS_42150 20019 21149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 21174 21578 gene locus_tag LOCUS_42160 21174 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 21649 25428 gene locus_tag LOCUS_42170 21649 25428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_42170 25806 25504 gene locus_tag LOCUS_42180 25806 25504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 25741 26826 gene locus_tag LOCUS_42190 25741 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 27030 28007 gene locus_tag LOCUS_42200 27030 28007 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_42200 29570 28098 gene locus_tag LOCUS_42210 29570 28098 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031609.1 protein_id gnl|my_center|LOCUS_42210 30985 29849 gene locus_tag LOCUS_42220 30985 29849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230596.1 protein_id gnl|my_center|LOCUS_42220 32477 30879 gene locus_tag LOCUS_42230 32477 30879 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230595.1 protein_id gnl|my_center|LOCUS_42230 33156 32506 gene locus_tag LOCUS_42240 33156 32506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 36199 33248 gene locus_tag LOCUS_42250 36199 33248 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_42250 36452 36919 gene locus_tag LOCUS_42260 36452 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 37040 38374 gene locus_tag LOCUS_42270 37040 38374 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899567.1 protein_id gnl|my_center|LOCUS_42270 38414 39076 gene locus_tag LOCUS_42280 38414 39076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 39091 39519 gene locus_tag LOCUS_42290 39091 39519 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466682.1 protein_id gnl|my_center|LOCUS_42290 39746 39516 gene locus_tag LOCUS_42300 39746 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306656.1 protein_id gnl|my_center|LOCUS_42300 39892 41070 gene locus_tag LOCUS_42310 39892 41070 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_42310 41173 42414 gene locus_tag LOCUS_42320 41173 42414 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_42320 42884 42471 gene locus_tag LOCUS_42330 gene tpx 42884 42471 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_42330 43411 43013 gene locus_tag LOCUS_42340 43411 43013 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228612.1 protein_id gnl|my_center|LOCUS_42340 43640 44137 gene locus_tag LOCUS_42350 43640 44137 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228611.1 protein_id gnl|my_center|LOCUS_42350 44134 44616 gene locus_tag LOCUS_42360 44134 44616 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228614.1 protein_id gnl|my_center|LOCUS_42360 44648 45988 gene locus_tag LOCUS_42370 44648 45988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 45998 47338 gene locus_tag LOCUS_42380 45998 47338 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224741.1 protein_id gnl|my_center|LOCUS_42380 48983 47457 gene locus_tag LOCUS_42390 48983 47457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231020.1 protein_id gnl|my_center|LOCUS_42390 49177 50250 gene locus_tag LOCUS_42400 49177 50250 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_42400 50260 50982 gene locus_tag LOCUS_42410 50260 50982 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_42410 52397 51045 gene locus_tag LOCUS_42420 52397 51045 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_42420 52794 54317 gene locus_tag LOCUS_42430 52794 54317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 54307 55944 gene locus_tag LOCUS_42440 54307 55944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 55954 60519 gene locus_tag LOCUS_42450 55954 60519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 60536 61672 gene locus_tag LOCUS_42460 60536 61672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 61669 64797 gene locus_tag LOCUS_42470 61669 64797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 64778 69994 gene locus_tag LOCUS_42480 64778 69994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 69991 71826 gene locus_tag LOCUS_42490 69991 71826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 72568 71831 gene locus_tag LOCUS_42500 72568 71831 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937402.1 protein_id gnl|my_center|LOCUS_42500 72964 74211 gene locus_tag LOCUS_42510 72964 74211 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_42510 74242 74922 gene locus_tag LOCUS_42520 74242 74922 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_42520 74942 75553 gene locus_tag LOCUS_42530 gene idi 74942 75553 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_42530 75553 76575 gene locus_tag LOCUS_42540 75553 76575 CDS product isocyanide synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529712.1 protein_id gnl|my_center|LOCUS_42540 76572 77381 gene locus_tag LOCUS_42550 76572 77381 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205355.1 protein_id gnl|my_center|LOCUS_42550 77433 78332 gene locus_tag LOCUS_42560 77433 78332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 78365 78871 gene locus_tag LOCUS_42570 78365 78871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 79360 79596 gene locus_tag LOCUS_42580 79360 79596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 81147 79663 gene locus_tag LOCUS_42590 81147 79663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 82110 81502 gene locus_tag LOCUS_42600 82110 81502 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191019.1 protein_id gnl|my_center|LOCUS_42600 82919 82110 gene locus_tag LOCUS_42610 82919 82110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222875.1 protein_id gnl|my_center|LOCUS_42610 84281 83001 gene locus_tag LOCUS_42620 84281 83001 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_42620 84455 85303 gene locus_tag LOCUS_42630 84455 85303 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218604714.1 protein_id gnl|my_center|LOCUS_42630 85581 86711 gene locus_tag LOCUS_42640 85581 86711 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_42640 86722 87831 gene locus_tag LOCUS_42650 86722 87831 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_42650 87953 88777 gene locus_tag LOCUS_42660 87953 88777 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228118.1 protein_id gnl|my_center|LOCUS_42660 89091 88846 gene locus_tag LOCUS_42670 89091 88846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 88978 90012 gene locus_tag LOCUS_42680 88978 90012 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42680 90640 92685 gene locus_tag LOCUS_42690 90640 92685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 93630 92689 gene locus_tag LOCUS_42700 93630 92689 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107451924.1 protein_id gnl|my_center|LOCUS_42700 93747 94862 gene locus_tag LOCUS_42710 93747 94862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 95635 94874 gene locus_tag LOCUS_42720 95635 94874 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_42720 96449 95721 gene locus_tag LOCUS_42730 96449 95721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 97291 96389 gene locus_tag LOCUS_42740 97291 96389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 98014 97421 gene locus_tag LOCUS_42750 98014 97421 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 protein_id gnl|my_center|LOCUS_42750 98117 99337 gene locus_tag LOCUS_42760 98117 99337 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_42760 99419 100345 gene locus_tag LOCUS_42770 99419 100345 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_42770 101288 100350 gene locus_tag LOCUS_42780 101288 100350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 101488 101285 gene locus_tag LOCUS_42790 101488 101285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 103852 101546 gene locus_tag LOCUS_42800 103852 101546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 104162 104821 gene locus_tag LOCUS_42810 104162 104821 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223308.1 protein_id gnl|my_center|LOCUS_42810 105301 104897 gene locus_tag LOCUS_42820 105301 104897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 105471 108224 gene locus_tag LOCUS_42830 105471 108224 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_42830 109261 108200 gene locus_tag LOCUS_42840 109261 108200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 110306 109395 gene locus_tag LOCUS_42850 110306 109395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 111751 110303 gene locus_tag LOCUS_42860 111751 110303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 114687 111991 gene locus_tag LOCUS_42870 114687 111991 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487609.1 protein_id gnl|my_center|LOCUS_42870 114806 115447 gene locus_tag LOCUS_42880 114806 115447 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026996.1 protein_id gnl|my_center|LOCUS_42880 115444 116352 gene locus_tag LOCUS_42890 115444 116352 CDS product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029662.1 protein_id gnl|my_center|LOCUS_42890 116349 116738 gene locus_tag LOCUS_42900 116349 116738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 116841 117341 gene locus_tag LOCUS_42910 116841 117341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 117341 118729 gene locus_tag LOCUS_42920 117341 118729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 118726 120075 gene locus_tag LOCUS_42930 118726 120075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 120094 121230 gene locus_tag LOCUS_42940 120094 121230 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_42940 121227 123977 gene locus_tag LOCUS_42950 121227 123977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 125448 123988 gene locus_tag LOCUS_42960 125448 123988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 125977 125534 gene locus_tag LOCUS_42970 125977 125534 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223318.1 protein_id gnl|my_center|LOCUS_42970 126043 126558 gene locus_tag LOCUS_42980 126043 126558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951582.1 protein_id gnl|my_center|LOCUS_42980 126748 129912 gene locus_tag LOCUS_42990 126748 129912 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_42990 131499 129982 gene locus_tag LOCUS_43000 131499 129982 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028977.1 protein_id gnl|my_center|LOCUS_43000 131637 134870 gene locus_tag LOCUS_43010 131637 134870 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_43010 136420 134939 gene locus_tag LOCUS_43020 136420 134939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 136764 137333 gene locus_tag LOCUS_43030 136764 137333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 137342 137554 gene locus_tag LOCUS_43040 137342 137554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 137607 138392 gene locus_tag LOCUS_43050 137607 138392 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384273.1 protein_id gnl|my_center|LOCUS_43050 138541 139125 gene locus_tag LOCUS_43060 138541 139125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 140738 139122 gene locus_tag LOCUS_43070 140738 139122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 143840 140760 gene locus_tag LOCUS_43080 143840 140760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 144986 143931 gene locus_tag LOCUS_43090 144986 143931 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742158.1 protein_id gnl|my_center|LOCUS_43090 145508 145077 gene locus_tag LOCUS_43100 145508 145077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 145607 146971 gene locus_tag LOCUS_43110 145607 146971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893847.1 protein_id gnl|my_center|LOCUS_43110 147054 148394 gene locus_tag LOCUS_43120 147054 148394 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889588.1 protein_id gnl|my_center|LOCUS_43120 >Feature sequence18 675 274 gene locus_tag LOCUS_43130 675 274 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742210.1 protein_id gnl|my_center|LOCUS_43130 788 1057 gene locus_tag LOCUS_43140 788 1057 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971884.1 protein_id gnl|my_center|LOCUS_43140 1471 2031 gene locus_tag LOCUS_43150 1471 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 2052 4007 gene locus_tag LOCUS_43160 2052 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975548.1 protein_id gnl|my_center|LOCUS_43160 4004 8902 gene locus_tag LOCUS_43170 4004 8902 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_43170 9669 8905 gene locus_tag LOCUS_43180 9669 8905 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225666.1 protein_id gnl|my_center|LOCUS_43180 9797 10135 gene locus_tag LOCUS_43190 9797 10135 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 protein_id gnl|my_center|LOCUS_43190 11094 10132 gene locus_tag LOCUS_43200 11094 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 11597 11091 gene locus_tag LOCUS_43210 11597 11091 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226925.1 protein_id gnl|my_center|LOCUS_43210 11837 11625 gene locus_tag LOCUS_43220 11837 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 12290 11856 gene locus_tag LOCUS_43230 12290 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 12378 13199 gene locus_tag LOCUS_43240 12378 13199 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831648.1 protein_id gnl|my_center|LOCUS_43240 13586 14797 gene locus_tag LOCUS_43250 13586 14797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 14896 15507 gene locus_tag LOCUS_43260 14896 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 15592 16266 gene locus_tag LOCUS_43270 15592 16266 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949618.1 protein_id gnl|my_center|LOCUS_43270 17579 16422 gene locus_tag LOCUS_43280 17579 16422 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_43280 17728 18705 gene locus_tag LOCUS_43290 17728 18705 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642937.1 protein_id gnl|my_center|LOCUS_43290 18726 19757 gene locus_tag LOCUS_43300 18726 19757 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_43300 19767 20162 gene locus_tag LOCUS_43310 19767 20162 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002941856.1 protein_id gnl|my_center|LOCUS_43310 20165 21598 gene locus_tag LOCUS_43320 20165 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 21668 22303 gene locus_tag LOCUS_43330 21668 22303 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_43330 22696 22307 gene locus_tag LOCUS_43340 22696 22307 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226479.1 protein_id gnl|my_center|LOCUS_43340 22787 23452 gene locus_tag LOCUS_43350 22787 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 23517 28709 gene locus_tag LOCUS_43360 gene ppsA 23517 28709 CDS product phthiocerol type I polyketide synthase PpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886158.1 protein_id gnl|my_center|LOCUS_43360 28699 30354 gene locus_tag LOCUS_43370 28699 30354 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960113.1 protein_id gnl|my_center|LOCUS_43370 30423 31079 gene locus_tag LOCUS_43380 30423 31079 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_43380 32558 31083 gene locus_tag LOCUS_43390 32558 31083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 32695 34134 gene locus_tag LOCUS_43400 32695 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 34131 34700 gene locus_tag LOCUS_43410 34131 34700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 35603 34743 gene locus_tag LOCUS_43420 35603 34743 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227264.1 protein_id gnl|my_center|LOCUS_43420 35986 35603 gene locus_tag LOCUS_43430 35986 35603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 36761 36009 gene locus_tag LOCUS_43440 36761 36009 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384660.1 protein_id gnl|my_center|LOCUS_43440 37654 36758 gene locus_tag LOCUS_43450 37654 36758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 38290 37805 gene locus_tag LOCUS_43460 38290 37805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 39696 38413 gene locus_tag LOCUS_43470 39696 38413 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 protein_id gnl|my_center|LOCUS_43470 39873 41435 gene locus_tag LOCUS_43480 39873 41435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 41432 42886 gene locus_tag LOCUS_43490 41432 42886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43490 42849 43409 gene locus_tag LOCUS_43500 42849 43409 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_43500 43483 43698 gene locus_tag LOCUS_43510 43483 43698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 43686 44093 gene locus_tag LOCUS_43520 43686 44093 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_43520 44312 44166 gene locus_tag LOCUS_43530 44312 44166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 44286 44675 gene locus_tag LOCUS_43540 44286 44675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 45697 44657 gene locus_tag LOCUS_43550 45697 44657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 45914 46564 gene locus_tag LOCUS_43560 45914 46564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 47551 46592 gene locus_tag LOCUS_43570 47551 46592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 48314 47709 gene locus_tag LOCUS_43580 48314 47709 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932608.1 protein_id gnl|my_center|LOCUS_43580 49171 48311 gene locus_tag LOCUS_43590 49171 48311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 50439 49258 gene locus_tag LOCUS_43600 50439 49258 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222819.1 protein_id gnl|my_center|LOCUS_43600 50794 50441 gene locus_tag LOCUS_43610 50794 50441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 50693 51088 gene locus_tag LOCUS_43620 50693 51088 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_43620 51085 52200 gene locus_tag LOCUS_43630 51085 52200 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_43630 52390 53736 gene locus_tag LOCUS_43640 52390 53736 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_43640 53733 54716 gene locus_tag LOCUS_43650 53733 54716 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_43650 55283 54729 gene locus_tag LOCUS_43660 55283 54729 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027389.1 protein_id gnl|my_center|LOCUS_43660 55424 56764 gene locus_tag LOCUS_43670 gene ccrA 55424 56764 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223473.1 protein_id gnl|my_center|LOCUS_43670 56820 57503 gene locus_tag LOCUS_43680 56820 57503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 57505 58350 gene locus_tag LOCUS_43690 57505 58350 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_43690 58347 59573 gene locus_tag LOCUS_43700 58347 59573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 59576 60967 gene locus_tag LOCUS_43710 59576 60967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 61399 61040 gene locus_tag LOCUS_43720 61399 61040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 62401 61628 gene locus_tag LOCUS_43730 gene fabG 62401 61628 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_43730 63266 62418 gene locus_tag LOCUS_43740 63266 62418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 64566 63283 gene locus_tag LOCUS_43750 64566 63283 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726836.1 protein_id gnl|my_center|LOCUS_43750 65681 64656 gene locus_tag LOCUS_43760 65681 64656 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_43760 67029 65710 gene locus_tag LOCUS_43770 67029 65710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 67082 68290 gene locus_tag LOCUS_43780 67082 68290 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184867305.1 protein_id gnl|my_center|LOCUS_43780 68292 68489 gene locus_tag LOCUS_43790 68292 68489 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228974.1 protein_id gnl|my_center|LOCUS_43790 69810 68590 gene locus_tag LOCUS_43800 69810 68590 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 protein_id gnl|my_center|LOCUS_43800 71174 69981 gene locus_tag LOCUS_43810 71174 69981 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056494.1 protein_id gnl|my_center|LOCUS_43810 71395 72747 gene locus_tag LOCUS_43820 71395 72747 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028355.1 protein_id gnl|my_center|LOCUS_43820 72847 73308 gene locus_tag LOCUS_43830 72847 73308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 75007 73355 gene locus_tag LOCUS_43840 75007 73355 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967515.1 protein_id gnl|my_center|LOCUS_43840 75875 75126 gene locus_tag LOCUS_43850 75875 75126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 76380 75913 gene locus_tag LOCUS_43860 76380 75913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 76937 76380 gene locus_tag LOCUS_43870 76937 76380 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 protein_id gnl|my_center|LOCUS_43870 77045 77896 gene locus_tag LOCUS_43880 77045 77896 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_43880 78116 77904 gene locus_tag LOCUS_43890 78116 77904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 78547 78113 gene locus_tag LOCUS_43900 78547 78113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 79008 78544 gene locus_tag LOCUS_43910 79008 78544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 79111 80274 gene locus_tag LOCUS_43920 79111 80274 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228562.1 protein_id gnl|my_center|LOCUS_43920 80287 80646 gene locus_tag LOCUS_43930 80287 80646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 81332 80835 gene locus_tag LOCUS_43940 81332 80835 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_43940 81298 81573 gene locus_tag LOCUS_43950 81298 81573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 82013 81546 gene locus_tag LOCUS_43960 82013 81546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 82353 82027 gene locus_tag LOCUS_43970 82353 82027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 83582 82350 gene locus_tag LOCUS_43980 83582 82350 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182663097.1 protein_id gnl|my_center|LOCUS_43980 84973 83579 gene locus_tag LOCUS_43990 84973 83579 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 protein_id gnl|my_center|LOCUS_43990 85863 84970 gene locus_tag LOCUS_44000 85863 84970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 86124 85879 gene locus_tag LOCUS_44010 86124 85879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 86455 86138 gene locus_tag LOCUS_44020 86455 86138 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_44020 87711 86653 gene locus_tag LOCUS_44030 87711 86653 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265765.1 protein_id gnl|my_center|LOCUS_44030 87892 88371 gene locus_tag LOCUS_44040 87892 88371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 88371 89282 gene locus_tag LOCUS_44050 88371 89282 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227244.1 protein_id gnl|my_center|LOCUS_44050 89523 90041 gene locus_tag LOCUS_44060 89523 90041 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_44060 90043 91116 gene locus_tag LOCUS_44070 90043 91116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 91136 91528 gene locus_tag LOCUS_44080 91136 91528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 94095 91519 gene locus_tag LOCUS_44090 94095 91519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_44090 94864 94100 gene locus_tag LOCUS_44100 94864 94100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_44100 95388 94864 gene locus_tag LOCUS_44110 95388 94864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244421.1 protein_id gnl|my_center|LOCUS_44110 95867 95412 gene locus_tag LOCUS_44120 95867 95412 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222710.1 protein_id gnl|my_center|LOCUS_44120 96049 97257 gene locus_tag LOCUS_44130 96049 97257 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_44130 97254 97919 gene locus_tag LOCUS_44140 97254 97919 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_44140 98040 98735 gene locus_tag LOCUS_44150 98040 98735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 99471 98806 gene locus_tag LOCUS_44160 99471 98806 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_44160 100198 99455 gene locus_tag LOCUS_44170 100198 99455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 101172 100306 gene locus_tag LOCUS_44180 101172 100306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 102864 101269 gene locus_tag LOCUS_44190 102864 101269 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_44190 104836 102992 gene locus_tag LOCUS_44200 104836 102992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 105239 105358 gene locus_tag LOCUS_44210 105239 105358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 107305 106013 gene locus_tag LOCUS_44220 107305 106013 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225491.1 protein_id gnl|my_center|LOCUS_44220 107673 107302 gene locus_tag LOCUS_44230 107673 107302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 109229 108036 gene locus_tag LOCUS_44240 109229 108036 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_44240 109351 109887 gene locus_tag LOCUS_44250 109351 109887 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200072.1 protein_id gnl|my_center|LOCUS_44250 110426 109884 gene locus_tag LOCUS_44260 110426 109884 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224385.1 protein_id gnl|my_center|LOCUS_44260 110320 110622 gene locus_tag LOCUS_44270 110320 110622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 110856 112088 gene locus_tag LOCUS_44280 110856 112088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222294.1 protein_id gnl|my_center|LOCUS_44280 112368 112060 gene locus_tag LOCUS_44290 112368 112060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 112343 113080 gene locus_tag LOCUS_44300 112343 113080 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222295.1 protein_id gnl|my_center|LOCUS_44300 114590 113829 gene locus_tag LOCUS_44310 114590 113829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 114472 116535 gene locus_tag LOCUS_44320 114472 116535 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_44320 117324 116542 gene locus_tag LOCUS_44330 117324 116542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225558.1 protein_id gnl|my_center|LOCUS_44330 117435 118070 gene locus_tag LOCUS_44340 117435 118070 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225557.1 protein_id gnl|my_center|LOCUS_44340 119293 118088 gene locus_tag LOCUS_44350 119293 118088 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_44350 119890 119306 gene locus_tag LOCUS_44360 119890 119306 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_44360 120059 121156 gene locus_tag LOCUS_44370 120059 121156 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903136.1 protein_id gnl|my_center|LOCUS_44370 121153 121827 gene locus_tag LOCUS_44380 121153 121827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_44380 121824 123032 gene locus_tag LOCUS_44390 121824 123032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_44390 123044 124417 gene locus_tag LOCUS_44400 123044 124417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 124436 125182 gene locus_tag LOCUS_44410 124436 125182 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_44410 126244 125183 gene locus_tag LOCUS_44420 gene ldtMt5 126244 125183 CDS product L,D-transpeptidase LdtMt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402357.1 protein_id gnl|my_center|LOCUS_44420 126763 126966 gene locus_tag LOCUS_44430 126763 126966 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 protein_id gnl|my_center|LOCUS_44430 127388 127053 gene locus_tag LOCUS_44440 127388 127053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 127940 127722 gene locus_tag LOCUS_44450 127940 127722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 128329 128571 gene locus_tag LOCUS_44460 128329 128571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222297.1 protein_id gnl|my_center|LOCUS_44460 128689 128764 gene locus_tag LOCUS_t00440 128689 128764 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 129861 128857 gene locus_tag LOCUS_44470 129861 128857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 130397 129870 gene locus_tag LOCUS_44480 130397 129870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 130726 131175 gene locus_tag LOCUS_44490 130726 131175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 131246 132181 gene locus_tag LOCUS_44500 131246 132181 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_44500 132556 132167 gene locus_tag LOCUS_44510 132556 132167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 133143 132514 gene locus_tag LOCUS_44520 133143 132514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 133209 133850 gene locus_tag LOCUS_44530 133209 133850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 133860 134447 gene locus_tag LOCUS_44540 133860 134447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 135158 134421 gene locus_tag LOCUS_44550 135158 134421 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455878.1 protein_id gnl|my_center|LOCUS_44550 >Feature sequence19 574 2694 gene locus_tag LOCUS_44560 574 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 2688 3830 gene locus_tag LOCUS_44570 2688 3830 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296723.1 protein_id gnl|my_center|LOCUS_44570 3865 4254 gene locus_tag LOCUS_44580 3865 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 4251 4751 gene locus_tag LOCUS_44590 4251 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 4742 5464 gene locus_tag LOCUS_44600 4742 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 5464 6009 gene locus_tag LOCUS_44610 5464 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 6953 5985 gene locus_tag LOCUS_44620 6953 5985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_44620 7726 6950 gene locus_tag LOCUS_44630 7726 6950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_44630 8754 7726 gene locus_tag LOCUS_44640 8754 7726 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_44640 8888 10048 gene locus_tag LOCUS_44650 8888 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 10803 10036 gene locus_tag LOCUS_44660 10803 10036 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529615.1 protein_id gnl|my_center|LOCUS_44660 11708 10782 gene locus_tag LOCUS_44670 11708 10782 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44670 12719 11961 gene locus_tag LOCUS_44680 12719 11961 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228704.1 protein_id gnl|my_center|LOCUS_44680 12808 13971 gene locus_tag LOCUS_44690 12808 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 14521 13961 gene locus_tag LOCUS_44700 14521 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 15306 14518 gene locus_tag LOCUS_44710 15306 14518 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142544.1 protein_id gnl|my_center|LOCUS_44710 17560 15308 gene locus_tag LOCUS_44720 17560 15308 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_44720 17895 17557 gene locus_tag LOCUS_44730 17895 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 19070 17892 gene locus_tag LOCUS_44740 19070 17892 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_44740 19862 19074 gene locus_tag LOCUS_44750 19862 19074 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_44750 19944 21419 gene locus_tag LOCUS_44760 19944 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 21416 21730 gene locus_tag LOCUS_44770 21416 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 protein_id gnl|my_center|LOCUS_44770 21743 23260 gene locus_tag LOCUS_44780 21743 23260 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031160740.1 protein_id gnl|my_center|LOCUS_44780 23257 24360 gene locus_tag LOCUS_44790 23257 24360 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_44790 24464 25243 gene locus_tag LOCUS_44800 24464 25243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803987.1 protein_id gnl|my_center|LOCUS_44800 25240 26124 gene locus_tag LOCUS_44810 25240 26124 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_44810 26141 27187 gene locus_tag LOCUS_44820 26141 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 27203 28330 gene locus_tag LOCUS_44830 27203 28330 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113160.1 protein_id gnl|my_center|LOCUS_44830 28336 29322 gene locus_tag LOCUS_44840 28336 29322 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225246.1 protein_id gnl|my_center|LOCUS_44840 29322 30161 gene locus_tag LOCUS_44850 29322 30161 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_44850 31509 30169 gene locus_tag LOCUS_44860 31509 30169 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228965.1 protein_id gnl|my_center|LOCUS_44860 32678 31506 gene locus_tag LOCUS_44870 32678 31506 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133901847.1 protein_id gnl|my_center|LOCUS_44870 32696 33721 gene locus_tag LOCUS_44880 32696 33721 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026402003.1 protein_id gnl|my_center|LOCUS_44880 33848 34588 gene locus_tag LOCUS_44890 33848 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 34588 35202 gene locus_tag LOCUS_44900 34588 35202 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_44900 35298 36701 gene locus_tag LOCUS_44910 35298 36701 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_44910 36701 38182 gene locus_tag LOCUS_44920 36701 38182 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_44920 38179 39156 gene locus_tag LOCUS_44930 38179 39156 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074634.1 protein_id gnl|my_center|LOCUS_44930 39190 40149 gene locus_tag LOCUS_44940 39190 40149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44940 40166 41566 gene locus_tag LOCUS_44950 40166 41566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 41649 42440 gene locus_tag LOCUS_44960 41649 42440 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066700.1 protein_id gnl|my_center|LOCUS_44960 42551 44029 gene locus_tag LOCUS_44970 gene xylB 42551 44029 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764573.1 protein_id gnl|my_center|LOCUS_44970 44936 44019 gene locus_tag LOCUS_44980 gene sigJ 44936 44019 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_44980 45177 44992 gene locus_tag LOCUS_44990 45177 44992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 45236 46399 gene locus_tag LOCUS_45000 45236 46399 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896840.1 protein_id gnl|my_center|LOCUS_45000 46396 47292 gene locus_tag LOCUS_45010 gene sigJ 46396 47292 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112241.1 protein_id gnl|my_center|LOCUS_45010 47289 47732 gene locus_tag LOCUS_45020 47289 47732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 48138 47647 gene locus_tag LOCUS_45030 48138 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 48485 48135 gene locus_tag LOCUS_45040 48485 48135 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804808.1 protein_id gnl|my_center|LOCUS_45040 49475 48507 gene locus_tag LOCUS_45050 49475 48507 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_45050 49565 50086 gene locus_tag LOCUS_45060 49565 50086 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_45060 50120 50785 gene locus_tag LOCUS_45070 50120 50785 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_45070 52255 50801 gene locus_tag LOCUS_45080 52255 50801 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226093.1 protein_id gnl|my_center|LOCUS_45080 52435 53724 gene locus_tag LOCUS_45090 52435 53724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086853672.1 protein_id gnl|my_center|LOCUS_45090 54574 53729 gene locus_tag LOCUS_45100 gene fdhD 54574 53729 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_45100 54797 54576 gene locus_tag LOCUS_45110 54797 54576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 57616 54794 gene locus_tag LOCUS_45120 gene fdhF 57616 54794 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_45120 59163 57613 gene locus_tag LOCUS_45130 59163 57613 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_45130 59642 59160 gene locus_tag LOCUS_45140 59642 59160 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 protein_id gnl|my_center|LOCUS_45140 59870 61297 gene locus_tag LOCUS_45150 59870 61297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 61294 61872 gene locus_tag LOCUS_45160 61294 61872 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892887.1 protein_id gnl|my_center|LOCUS_45160 61942 63291 gene locus_tag LOCUS_45170 gene gdhA 61942 63291 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_45170 64357 63698 gene locus_tag LOCUS_45180 64357 63698 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_45180 65307 64354 gene locus_tag LOCUS_45190 65307 64354 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666121.1 protein_id gnl|my_center|LOCUS_45190 65201 65524 gene locus_tag LOCUS_45200 65201 65524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 65521 66063 gene locus_tag LOCUS_45210 65521 66063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 66117 66575 gene locus_tag LOCUS_45220 66117 66575 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727240.1 protein_id gnl|my_center|LOCUS_45220 66706 67992 gene locus_tag LOCUS_45230 66706 67992 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727239.1 protein_id gnl|my_center|LOCUS_45230 68111 69235 gene locus_tag LOCUS_45240 68111 69235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 70537 69329 gene locus_tag LOCUS_45250 70537 69329 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029762.1 protein_id gnl|my_center|LOCUS_45250 71196 70537 gene locus_tag LOCUS_45260 71196 70537 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969386.1 protein_id gnl|my_center|LOCUS_45260 71503 71309 gene locus_tag LOCUS_45270 71503 71309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 71970 71500 gene locus_tag LOCUS_45280 71970 71500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 73044 71995 gene locus_tag LOCUS_45290 73044 71995 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467095.1 protein_id gnl|my_center|LOCUS_45290 73929 73060 gene locus_tag LOCUS_45300 73929 73060 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228180.1 protein_id gnl|my_center|LOCUS_45300 74003 74488 gene locus_tag LOCUS_45310 74003 74488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 74557 76275 gene locus_tag LOCUS_45320 74557 76275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 79423 76325 gene locus_tag LOCUS_45330 79423 76325 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_45330 79468 79842 gene locus_tag LOCUS_45340 79468 79842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 79846 80721 gene locus_tag LOCUS_45350 79846 80721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 82172 80679 gene locus_tag LOCUS_45360 82172 80679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 83098 82169 gene locus_tag LOCUS_45370 83098 82169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 83768 83091 gene locus_tag LOCUS_45380 83768 83091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 84026 85201 gene locus_tag LOCUS_45390 84026 85201 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_45390 85282 86478 gene locus_tag LOCUS_45400 85282 86478 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026891.1 protein_id gnl|my_center|LOCUS_45400 86480 87424 gene locus_tag LOCUS_45410 86480 87424 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495068.1 protein_id gnl|my_center|LOCUS_45410 91538 87492 gene locus_tag LOCUS_45420 91538 87492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 91750 92541 gene locus_tag LOCUS_45430 91750 92541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 92538 93065 gene locus_tag LOCUS_45440 92538 93065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 93691 93083 gene locus_tag LOCUS_45450 93691 93083 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_45450 93828 95159 gene locus_tag LOCUS_45460 93828 95159 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_45460 95174 95734 gene locus_tag LOCUS_45470 95174 95734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 95707 96084 gene locus_tag LOCUS_45480 95707 96084 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620749.1 protein_id gnl|my_center|LOCUS_45480 97526 96081 gene locus_tag LOCUS_45490 97526 96081 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 protein_id gnl|my_center|LOCUS_45490 98677 97523 gene locus_tag LOCUS_45500 98677 97523 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776011.1 protein_id gnl|my_center|LOCUS_45500 99471 98674 gene locus_tag LOCUS_45510 99471 98674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225323.1 protein_id gnl|my_center|LOCUS_45510 101357 99468 gene locus_tag LOCUS_45520 101357 99468 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225322.1 protein_id gnl|my_center|LOCUS_45520 102304 101354 gene locus_tag LOCUS_45530 102304 101354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225321.1 protein_id gnl|my_center|LOCUS_45530 103901 102309 gene locus_tag LOCUS_45540 103901 102309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225320.1 protein_id gnl|my_center|LOCUS_45540 105393 103966 gene locus_tag LOCUS_45550 105393 103966 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192785.1 protein_id gnl|my_center|LOCUS_45550 107075 105390 gene locus_tag LOCUS_45560 107075 105390 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808165.1 protein_id gnl|my_center|LOCUS_45560 107206 107913 gene locus_tag LOCUS_45570 107206 107913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 109114 107930 gene locus_tag LOCUS_45580 109114 107930 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_45580 109590 109114 gene locus_tag LOCUS_45590 109590 109114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 110756 109590 gene locus_tag LOCUS_45600 110756 109590 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087687.1 protein_id gnl|my_center|LOCUS_45600 111695 110769 gene locus_tag LOCUS_45610 111695 110769 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_45610 111789 112853 gene locus_tag LOCUS_45620 gene hisC 111789 112853 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_45620 112850 114307 gene locus_tag LOCUS_45630 112850 114307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 114309 115244 gene locus_tag LOCUS_45640 gene hpaI 114309 115244 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144460629.1 protein_id gnl|my_center|LOCUS_45640 115322 116737 gene locus_tag LOCUS_45650 gene hpaE 115322 116737 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173038.1 protein_id gnl|my_center|LOCUS_45650 116734 117741 gene locus_tag LOCUS_45660 gene hpaD 116734 117741 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228330.1 protein_id gnl|my_center|LOCUS_45660 117919 118338 gene locus_tag LOCUS_45670 117919 118338 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081112.1 protein_id gnl|my_center|LOCUS_45670 118739 119302 gene locus_tag LOCUS_45680 118739 119302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 119331 120485 gene locus_tag LOCUS_45690 119331 120485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 120584 121609 gene locus_tag LOCUS_45700 120584 121609 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230685.1 protein_id gnl|my_center|LOCUS_45700 121617 122684 gene locus_tag LOCUS_45710 121617 122684 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_45710 123554 123003 gene locus_tag LOCUS_45720 123554 123003 CDS product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227398.1 protein_id gnl|my_center|LOCUS_45720 124471 123614 gene locus_tag LOCUS_45730 124471 123614 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_45730 124896 124483 gene locus_tag LOCUS_45740 124896 124483 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227887.1 protein_id gnl|my_center|LOCUS_45740 125327 124941 gene locus_tag LOCUS_45750 125327 124941 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031404.1 protein_id gnl|my_center|LOCUS_45750 126076 125324 gene locus_tag LOCUS_45760 126076 125324 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_45760 129066 126073 gene locus_tag LOCUS_45770 129066 126073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 <134612 129079 gene locus_tag LOCUS_45780 <134612 129079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence20 522 238 gene locus_tag LOCUS_45790 522 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 1676 738 gene locus_tag LOCUS_45800 1676 738 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225254.1 protein_id gnl|my_center|LOCUS_45800 1591 1767 gene locus_tag LOCUS_45810 1591 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 1780 3486 gene locus_tag LOCUS_45820 1780 3486 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532968.1 protein_id gnl|my_center|LOCUS_45820 3661 4107 gene locus_tag LOCUS_45830 3661 4107 CDS product DUF6292 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226102.1 protein_id gnl|my_center|LOCUS_45830 4157 5386 gene locus_tag LOCUS_45840 4157 5386 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_45840 5451 6224 gene locus_tag LOCUS_45850 5451 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 6273 7310 gene locus_tag LOCUS_45860 6273 7310 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_45860 8053 7307 gene locus_tag LOCUS_45870 8053 7307 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_45870 8526 8050 gene locus_tag LOCUS_45880 8526 8050 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466685.1 protein_id gnl|my_center|LOCUS_45880 8574 9935 gene locus_tag LOCUS_45890 8574 9935 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223480.1 protein_id gnl|my_center|LOCUS_45890 9954 11462 gene locus_tag LOCUS_45900 9954 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 11536 12717 gene locus_tag LOCUS_45910 11536 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 12714 16778 gene locus_tag LOCUS_45920 12714 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 16947 17918 gene locus_tag LOCUS_45930 16947 17918 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_45930 18031 18603 gene locus_tag LOCUS_45940 18031 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 18727 19833 gene locus_tag LOCUS_45950 18727 19833 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_45950 21197 19884 gene locus_tag LOCUS_45960 21197 19884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 21865 21194 gene locus_tag LOCUS_45970 21865 21194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_45970 22857 21862 gene locus_tag LOCUS_45980 22857 21862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 23034 23969 gene locus_tag LOCUS_45990 23034 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_45990 24124 25044 gene locus_tag LOCUS_46000 24124 25044 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_46000 25592 25041 gene locus_tag LOCUS_46010 25592 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 27308 25674 gene locus_tag LOCUS_46020 gene ptsP 27308 25674 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_46020 27582 27301 gene locus_tag LOCUS_46030 27582 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 28668 27628 gene locus_tag LOCUS_46040 28668 27628 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_46040 29117 28665 gene locus_tag LOCUS_46050 29117 28665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 30567 29110 gene locus_tag LOCUS_46060 30567 29110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46060 31535 30564 gene locus_tag LOCUS_46070 gene pfkB 31535 30564 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_46070 32293 31532 gene locus_tag LOCUS_46080 32293 31532 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226344.1 protein_id gnl|my_center|LOCUS_46080 32393 33613 gene locus_tag LOCUS_46090 32393 33613 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226269.1 protein_id gnl|my_center|LOCUS_46090 33731 35491 gene locus_tag LOCUS_46100 33731 35491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 35505 36593 gene locus_tag LOCUS_46110 35505 36593 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229640.1 protein_id gnl|my_center|LOCUS_46110 36590 40978 gene locus_tag LOCUS_46120 gene fxsT 36590 40978 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320500.1 protein_id gnl|my_center|LOCUS_46120 42788 40971 gene locus_tag LOCUS_46130 42788 40971 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317561.1 protein_id gnl|my_center|LOCUS_46130 43024 42788 gene locus_tag LOCUS_46140 43024 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 43766 43059 gene locus_tag LOCUS_46150 43766 43059 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259246.1 protein_id gnl|my_center|LOCUS_46150 43961 44359 gene locus_tag LOCUS_46160 43961 44359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 45406 44330 gene locus_tag LOCUS_46170 45406 44330 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226538.1 protein_id gnl|my_center|LOCUS_46170 45501 46658 gene locus_tag LOCUS_46180 45501 46658 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226539.1 protein_id gnl|my_center|LOCUS_46180 48869 46713 gene locus_tag LOCUS_46190 48869 46713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 52854 48940 gene locus_tag LOCUS_46200 52854 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 54070 52988 gene locus_tag LOCUS_46210 54070 52988 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 protein_id gnl|my_center|LOCUS_46210 55831 54593 gene locus_tag LOCUS_46220 55831 54593 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_46220 57069 55828 gene locus_tag LOCUS_46230 57069 55828 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223336.1 protein_id gnl|my_center|LOCUS_46230 57674 57066 gene locus_tag LOCUS_46240 57674 57066 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971676.1 protein_id gnl|my_center|LOCUS_46240 58041 57655 gene locus_tag LOCUS_46250 58041 57655 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975928.1 protein_id gnl|my_center|LOCUS_46250 58448 58047 gene locus_tag LOCUS_46260 58448 58047 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078495246.1 protein_id gnl|my_center|LOCUS_46260 60025 58445 gene locus_tag LOCUS_46270 60025 58445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 59722 59818 gene locus_tag LOCUS_t00450 59722 59818 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 60271 62178 gene locus_tag LOCUS_46280 60271 62178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 63077 62184 gene locus_tag LOCUS_46290 63077 62184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 65021 63084 gene locus_tag LOCUS_46300 65021 63084 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_46300 65729 65058 gene locus_tag LOCUS_46310 gene dhaM 65729 65058 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229493.1 protein_id gnl|my_center|LOCUS_46310 66352 65726 gene locus_tag LOCUS_46320 gene dhaL 66352 65726 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229494.1 protein_id gnl|my_center|LOCUS_46320 67482 66352 gene locus_tag LOCUS_46330 gene dhaK 67482 66352 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229495.1 protein_id gnl|my_center|LOCUS_46330 67429 69027 gene locus_tag LOCUS_46340 67429 69027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 71059 69029 gene locus_tag LOCUS_46350 71059 69029 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228686.1 protein_id gnl|my_center|LOCUS_46350 71926 71102 gene locus_tag LOCUS_46360 71926 71102 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_46360 72028 72597 gene locus_tag LOCUS_46370 72028 72597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 72594 73760 gene locus_tag LOCUS_46380 72594 73760 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_46380 74055 75137 gene locus_tag LOCUS_46390 gene rsgA 74055 75137 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_46390 75406 75780 gene locus_tag LOCUS_46400 75406 75780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 78665 75867 gene locus_tag LOCUS_46410 gene afsR 78665 75867 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_46410 78776 79441 gene locus_tag LOCUS_46420 78776 79441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 79657 79445 gene locus_tag LOCUS_46430 79657 79445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 80154 79792 gene locus_tag LOCUS_46440 80154 79792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 81375 80272 gene locus_tag LOCUS_46450 81375 80272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 81454 81774 gene locus_tag LOCUS_46460 81454 81774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 81979 81791 gene locus_tag LOCUS_46470 81979 81791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 82219 85032 gene locus_tag LOCUS_46480 82219 85032 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_46480 85528 88275 gene locus_tag LOCUS_46490 85528 88275 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_46490 88452 90134 gene locus_tag LOCUS_46500 88452 90134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 92205 90124 gene locus_tag LOCUS_46510 92205 90124 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228230.1 protein_id gnl|my_center|LOCUS_46510 92479 92294 gene locus_tag LOCUS_46520 92479 92294 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_46520 93598 92546 gene locus_tag LOCUS_46530 93598 92546 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225012.1 protein_id gnl|my_center|LOCUS_46530 94760 93822 gene locus_tag LOCUS_46540 94760 93822 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 protein_id gnl|my_center|LOCUS_46540 97287 94849 gene locus_tag LOCUS_46550 97287 94849 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467386.1 protein_id gnl|my_center|LOCUS_46550 97854 97375 gene locus_tag LOCUS_46560 97854 97375 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284359.1 protein_id gnl|my_center|LOCUS_46560 100991 97899 gene locus_tag LOCUS_46570 100991 97899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 101011 101208 gene locus_tag LOCUS_46580 101011 101208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 101240 102184 gene locus_tag LOCUS_46590 101240 102184 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282906.1 protein_id gnl|my_center|LOCUS_46590 102259 102471 gene locus_tag LOCUS_46600 102259 102471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 104512 102605 gene locus_tag LOCUS_46610 104512 102605 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_46610 106180 104948 gene locus_tag LOCUS_46620 106180 104948 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_46620 107826 106177 gene locus_tag LOCUS_46630 107826 106177 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_46630 110711 107823 gene locus_tag LOCUS_46640 gene fdhF 110711 107823 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_46640 112559 110760 gene locus_tag LOCUS_46650 112559 110760 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_46650 113374 112577 gene locus_tag LOCUS_46660 113374 112577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 113580 115409 gene locus_tag LOCUS_46670 113580 115409 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225500.1 protein_id gnl|my_center|LOCUS_46670 115502 117010 gene locus_tag LOCUS_46680 115502 117010 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_46680 117445 117077 gene locus_tag LOCUS_46690 117445 117077 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_46690 117819 117457 gene locus_tag LOCUS_46700 117819 117457 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978117.1 protein_id gnl|my_center|LOCUS_46700 117923 121036 gene locus_tag LOCUS_46710 117923 121036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 121809 121012 gene locus_tag LOCUS_46720 121809 121012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 122779 121823 gene locus_tag LOCUS_46730 122779 121823 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226282.1 protein_id gnl|my_center|LOCUS_46730 123166 125454 gene locus_tag LOCUS_46740 123166 125454 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227003.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46740 125469 127289 gene locus_tag LOCUS_46750 125469 127289 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229168.1 protein_id gnl|my_center|LOCUS_46750 127377 128228 gene locus_tag LOCUS_46760 127377 128228 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_46760 129028 128225 gene locus_tag LOCUS_46770 129028 128225 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229622.1 protein_id gnl|my_center|LOCUS_46770 129648 129025 gene locus_tag LOCUS_46780 129648 129025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 130222 130131 gene locus_tag LOCUS_t00460 130222 130131 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 130424 131077 gene locus_tag LOCUS_46790 130424 131077 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229849.1 protein_id gnl|my_center|LOCUS_46790 131416 131111 gene locus_tag LOCUS_46800 131416 131111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 >Feature sequence21 553 1458 gene locus_tag LOCUS_46810 553 1458 CDS product AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224837.1 protein_id gnl|my_center|LOCUS_46810 2393 1467 gene locus_tag LOCUS_46820 2393 1467 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224836.1 protein_id gnl|my_center|LOCUS_46820 3082 2390 gene locus_tag LOCUS_46830 gene lspA 3082 2390 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947675.1 protein_id gnl|my_center|LOCUS_46830 4447 3101 gene locus_tag LOCUS_46840 4447 3101 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_46840 4664 6097 gene locus_tag LOCUS_46850 gene sthA 4664 6097 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900556.1 protein_id gnl|my_center|LOCUS_46850 7592 6105 gene locus_tag LOCUS_46860 7592 6105 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224832.1 protein_id gnl|my_center|LOCUS_46860 7702 8703 gene locus_tag LOCUS_46870 7702 8703 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029747.1 protein_id gnl|my_center|LOCUS_46870 8969 8700 gene locus_tag LOCUS_46880 8969 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 10171 8966 gene locus_tag LOCUS_46890 10171 8966 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_46890 13309 10196 gene locus_tag LOCUS_46900 gene ileS 13309 10196 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224829.1 protein_id gnl|my_center|LOCUS_46900 14183 13539 gene locus_tag LOCUS_46910 14183 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224826.1 protein_id gnl|my_center|LOCUS_46910 15040 14216 gene locus_tag LOCUS_46920 15040 14216 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224825.1 protein_id gnl|my_center|LOCUS_46920 15373 15089 gene locus_tag LOCUS_46930 15373 15089 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224824.1 protein_id gnl|my_center|LOCUS_46930 16080 15394 gene locus_tag LOCUS_46940 gene sepF 16080 15394 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224823.1 protein_id gnl|my_center|LOCUS_46940 16858 16127 gene locus_tag LOCUS_46950 16858 16127 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224822.1 protein_id gnl|my_center|LOCUS_46950 17586 16855 gene locus_tag LOCUS_46960 gene pgeF 17586 16855 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224821.1 protein_id gnl|my_center|LOCUS_46960 18912 17596 gene locus_tag LOCUS_46970 gene ftsZ 18912 17596 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224820.1 protein_id gnl|my_center|LOCUS_46970 19657 19163 gene locus_tag LOCUS_46980 19657 19163 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_46980 20421 19657 gene locus_tag LOCUS_46990 20421 19657 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228035.1 protein_id gnl|my_center|LOCUS_46990 21818 20418 gene locus_tag LOCUS_47000 gene murC 21818 20418 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_47000 21360 21277 gene locus_tag LOCUS_t00470 21360 21277 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22992 21889 gene locus_tag LOCUS_47010 gene murG 22992 21889 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228037.1 protein_id gnl|my_center|LOCUS_47010 24353 22989 gene locus_tag LOCUS_47020 gene ftsW 24353 22989 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228038.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47020 25711 24350 gene locus_tag LOCUS_47030 gene murD 25711 24350 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228039.1 protein_id gnl|my_center|LOCUS_47030 26801 25713 gene locus_tag LOCUS_47040 gene mraY 26801 25713 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228040.1 protein_id gnl|my_center|LOCUS_47040 28255 26798 gene locus_tag LOCUS_47050 28255 26798 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228041.1 protein_id gnl|my_center|LOCUS_47050 29865 28252 gene locus_tag LOCUS_47060 29865 28252 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228042.1 protein_id gnl|my_center|LOCUS_47060 30456 29896 gene locus_tag LOCUS_47070 30456 29896 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_47070 32952 31363 gene locus_tag LOCUS_47080 32952 31363 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_47080 35440 32963 gene locus_tag LOCUS_47090 35440 32963 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467433.1 protein_id gnl|my_center|LOCUS_47090 35940 35440 gene locus_tag LOCUS_47100 35940 35440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 36020 36526 gene locus_tag LOCUS_47110 36020 36526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 37477 36521 gene locus_tag LOCUS_47120 gene rsmH 37477 36521 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228045.1 protein_id gnl|my_center|LOCUS_47120 38142 37702 gene locus_tag LOCUS_47130 gene mraZ 38142 37702 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467434.1 protein_id gnl|my_center|LOCUS_47130 38599 39714 gene locus_tag LOCUS_47140 38599 39714 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_47140 39719 40984 gene locus_tag LOCUS_47150 39719 40984 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_47150 41121 43496 gene locus_tag LOCUS_47160 41121 43496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47160 46035 43501 gene locus_tag LOCUS_47170 46035 43501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 47690 46122 gene locus_tag LOCUS_47180 47690 46122 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067284407.1 protein_id gnl|my_center|LOCUS_47180 48241 47834 gene locus_tag LOCUS_47190 48241 47834 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228055.1 protein_id gnl|my_center|LOCUS_47190 48460 49461 gene locus_tag LOCUS_47200 48460 49461 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_47200 49449 50216 gene locus_tag LOCUS_47210 49449 50216 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_47210 50263 51237 gene locus_tag LOCUS_47220 50263 51237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 52382 51225 gene locus_tag LOCUS_47230 52382 51225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 53700 52432 gene locus_tag LOCUS_47240 gene dinB 53700 52432 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_47240 54356 53742 gene locus_tag LOCUS_47250 54356 53742 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228057.1 protein_id gnl|my_center|LOCUS_47250 54499 55374 gene locus_tag LOCUS_47260 54499 55374 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_47260 56574 55708 gene locus_tag LOCUS_47270 56574 55708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 56617 57645 gene locus_tag LOCUS_47280 56617 57645 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_47280 58505 57642 gene locus_tag LOCUS_47290 58505 57642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 59384 58539 gene locus_tag LOCUS_47300 59384 58539 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228065.1 protein_id gnl|my_center|LOCUS_47300 60130 59675 gene locus_tag LOCUS_47310 60130 59675 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467438.1 protein_id gnl|my_center|LOCUS_47310 60827 60321 gene locus_tag LOCUS_47320 60827 60321 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_47320 61436 60834 gene locus_tag LOCUS_47330 gene pgsA 61436 60834 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228068.1 protein_id gnl|my_center|LOCUS_47330 62920 61433 gene locus_tag LOCUS_47340 gene rimO 62920 61433 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228069.1 protein_id gnl|my_center|LOCUS_47340 63071 63568 gene locus_tag LOCUS_47350 63071 63568 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228070.1 protein_id gnl|my_center|LOCUS_47350 63685 64134 gene locus_tag LOCUS_47360 63685 64134 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228071.1 protein_id gnl|my_center|LOCUS_47360 65308 64187 gene locus_tag LOCUS_47370 65308 64187 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_47370 67591 65363 gene locus_tag LOCUS_47380 67591 65363 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228076.1 protein_id gnl|my_center|LOCUS_47380 67782 68996 gene locus_tag LOCUS_47390 67782 68996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 68993 69976 gene locus_tag LOCUS_47400 68993 69976 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_47400 71661 69973 gene locus_tag LOCUS_47410 71661 69973 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454980.1 protein_id gnl|my_center|LOCUS_47410 72689 71682 gene locus_tag LOCUS_47420 gene dapA 72689 71682 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878175.1 protein_id gnl|my_center|LOCUS_47420 74241 72730 gene locus_tag LOCUS_47430 74241 72730 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228086.1 protein_id gnl|my_center|LOCUS_47430 74947 74321 gene locus_tag LOCUS_47440 74947 74321 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230583.1 protein_id gnl|my_center|LOCUS_47440 76417 74969 gene locus_tag LOCUS_47450 76417 74969 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228086.1 protein_id gnl|my_center|LOCUS_47450 76487 77512 gene locus_tag LOCUS_47460 76487 77512 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227082.1 protein_id gnl|my_center|LOCUS_47460 77925 77524 gene locus_tag LOCUS_47470 77925 77524 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228089.1 protein_id gnl|my_center|LOCUS_47470 78670 77930 gene locus_tag LOCUS_47480 gene thyX 78670 77930 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228090.1 protein_id gnl|my_center|LOCUS_47480 78792 79343 gene locus_tag LOCUS_47490 78792 79343 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228091.1 protein_id gnl|my_center|LOCUS_47490 79349 80254 gene locus_tag LOCUS_47500 79349 80254 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228092.1 protein_id gnl|my_center|LOCUS_47500 81550 80336 gene locus_tag LOCUS_47510 81550 80336 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228093.1 protein_id gnl|my_center|LOCUS_47510 82497 81547 gene locus_tag LOCUS_47520 gene yedA 82497 81547 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_47520 83384 82539 gene locus_tag LOCUS_47530 83384 82539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 83433 83990 gene locus_tag LOCUS_47540 83433 83990 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228094.1 protein_id gnl|my_center|LOCUS_47540 84055 84579 gene locus_tag LOCUS_47550 84055 84579 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228095.1 protein_id gnl|my_center|LOCUS_47550 85409 84600 gene locus_tag LOCUS_47560 85409 84600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 86080 85472 gene locus_tag LOCUS_47570 86080 85472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 86509 86084 gene locus_tag LOCUS_47580 86509 86084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 87574 86810 gene locus_tag LOCUS_47590 gene dapB 87574 86810 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228101.1 protein_id gnl|my_center|LOCUS_47590 88890 87571 gene locus_tag LOCUS_47600 88890 87571 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228102.1 protein_id gnl|my_center|LOCUS_47600 91189 88916 gene locus_tag LOCUS_47610 91189 88916 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228103.1 protein_id gnl|my_center|LOCUS_47610 91706 91437 gene locus_tag LOCUS_47620 gene rpsO 91706 91437 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_47620 92387 91818 gene locus_tag LOCUS_47630 gene thpR 92387 91818 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228104.1 protein_id gnl|my_center|LOCUS_47630 92888 92409 gene locus_tag LOCUS_47640 92888 92409 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228105.1 protein_id gnl|my_center|LOCUS_47640 93957 93022 gene locus_tag LOCUS_47650 93957 93022 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_47650 95520 94009 gene locus_tag LOCUS_47660 95520 94009 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_47660 96456 95575 gene locus_tag LOCUS_47670 gene truB 96456 95575 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_47670 97838 96516 gene locus_tag LOCUS_47680 97838 96516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228110.1 protein_id gnl|my_center|LOCUS_47680 97978 98304 gene locus_tag LOCUS_47690 97978 98304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 99617 98301 gene locus_tag LOCUS_47700 99617 98301 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 protein_id gnl|my_center|LOCUS_47700 100968 99637 gene locus_tag LOCUS_47710 100968 99637 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_47710 102350 101229 gene locus_tag LOCUS_47720 gene ugpC 102350 101229 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 protein_id gnl|my_center|LOCUS_47720 103369 102476 gene locus_tag LOCUS_47730 103369 102476 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_47730 104291 103374 gene locus_tag LOCUS_47740 104291 103374 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_47740 105612 104371 gene locus_tag LOCUS_47750 105612 104371 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_47750 106788 105727 gene locus_tag LOCUS_47760 106788 105727 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 protein_id gnl|my_center|LOCUS_47760 107517 106828 gene locus_tag LOCUS_47770 107517 106828 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228118.1 protein_id gnl|my_center|LOCUS_47770 107833 108273 gene locus_tag LOCUS_47780 107833 108273 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394231.1 protein_id gnl|my_center|LOCUS_47780 108784 108335 gene locus_tag LOCUS_47790 gene rbfA 108784 108335 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228119.1 protein_id gnl|my_center|LOCUS_47790 109121 108825 gene locus_tag LOCUS_47800 109121 108825 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_47800 111042 109198 gene locus_tag LOCUS_47810 111042 109198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 >Feature sequence22 24211 11381 gene locus_tag LOCUS_47820 24211 11381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47820 24527 26389 gene locus_tag LOCUS_47830 24527 26389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 26556 27767 gene locus_tag LOCUS_47840 26556 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 27746 28132 gene locus_tag LOCUS_47850 27746 28132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 28319 28936 gene locus_tag LOCUS_47860 28319 28936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 28964 30154 gene locus_tag LOCUS_47870 28964 30154 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222788.1 protein_id gnl|my_center|LOCUS_47870 37020 30220 gene locus_tag LOCUS_47880 37020 30220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 42614 37053 gene locus_tag LOCUS_47890 42614 37053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 63135 42634 gene locus_tag LOCUS_47900 63135 42634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 84571 63128 gene locus_tag LOCUS_47910 84571 63128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 84594 85268 gene locus_tag LOCUS_47920 84594 85268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 85451 86215 gene locus_tag LOCUS_47930 85451 86215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 86372 86557 gene locus_tag LOCUS_47940 86372 86557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 86669 87427 gene locus_tag LOCUS_47950 86669 87427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 87554 88267 gene locus_tag LOCUS_47960 87554 88267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 88236 88745 gene locus_tag LOCUS_47970 88236 88745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 89022 89237 gene locus_tag LOCUS_47980 89022 89237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 102920 89919 gene locus_tag LOCUS_47990 102920 89919 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222548.1 protein_id gnl|my_center|LOCUS_47990 >Feature sequence23 75 545 gene locus_tag LOCUS_48000 75 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 1028 546 gene locus_tag LOCUS_48010 1028 546 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 protein_id gnl|my_center|LOCUS_48010 2383 1025 gene locus_tag LOCUS_48020 2383 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 3584 2385 gene locus_tag LOCUS_48030 3584 2385 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929590.1 protein_id gnl|my_center|LOCUS_48030 3705 4262 gene locus_tag LOCUS_48040 3705 4262 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_48040 4508 5533 gene locus_tag LOCUS_48050 4508 5533 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 protein_id gnl|my_center|LOCUS_48050 6288 5527 gene locus_tag LOCUS_48060 6288 5527 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727031.1 protein_id gnl|my_center|LOCUS_48060 7285 6281 gene locus_tag LOCUS_48070 7285 6281 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743398.1 protein_id gnl|my_center|LOCUS_48070 8135 7299 gene locus_tag LOCUS_48080 8135 7299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727032.1 protein_id gnl|my_center|LOCUS_48080 8880 8221 gene locus_tag LOCUS_48090 8880 8221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 protein_id gnl|my_center|LOCUS_48090 9908 8880 gene locus_tag LOCUS_48100 9908 8880 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_48100 10239 9913 gene locus_tag LOCUS_48110 10239 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 10987 10361 gene locus_tag LOCUS_48120 10987 10361 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227662.1 protein_id gnl|my_center|LOCUS_48120 11892 10984 gene locus_tag LOCUS_48130 11892 10984 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 protein_id gnl|my_center|LOCUS_48130 13180 11912 gene locus_tag LOCUS_48140 13180 11912 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_48140 15337 13193 gene locus_tag LOCUS_48150 15337 13193 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_48150 16104 15334 gene locus_tag LOCUS_48160 16104 15334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 17765 16101 gene locus_tag LOCUS_48170 17765 16101 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225322.1 protein_id gnl|my_center|LOCUS_48170 18768 17758 gene locus_tag LOCUS_48180 18768 17758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225321.1 protein_id gnl|my_center|LOCUS_48180 20327 18765 gene locus_tag LOCUS_48190 20327 18765 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384278.1 protein_id gnl|my_center|LOCUS_48190 21082 20324 gene locus_tag LOCUS_48200 21082 20324 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223914.1 protein_id gnl|my_center|LOCUS_48200 21972 21079 gene locus_tag LOCUS_48210 21972 21079 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540892.1 protein_id gnl|my_center|LOCUS_48210 22970 21969 gene locus_tag LOCUS_48220 22970 21969 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224785.1 protein_id gnl|my_center|LOCUS_48220 23426 23067 gene locus_tag LOCUS_48230 23426 23067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 23543 24550 gene locus_tag LOCUS_48240 23543 24550 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227111.1 protein_id gnl|my_center|LOCUS_48240 26221 24587 gene locus_tag LOCUS_48250 26221 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 28284 26251 gene locus_tag LOCUS_48260 28284 26251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 28383 28886 gene locus_tag LOCUS_48270 28383 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 28907 29713 gene locus_tag LOCUS_48280 28907 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 30677 29718 gene locus_tag LOCUS_48290 30677 29718 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_48290 31790 30930 gene locus_tag LOCUS_48300 31790 30930 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_48300 32593 31877 gene locus_tag LOCUS_48310 32593 31877 CDS product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888021.1 protein_id gnl|my_center|LOCUS_48310 32827 33477 gene locus_tag LOCUS_48320 32827 33477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 34487 33465 gene locus_tag LOCUS_48330 34487 33465 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726861.1 protein_id gnl|my_center|LOCUS_48330 41947 34484 gene locus_tag LOCUS_48340 41947 34484 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113143.1 protein_id gnl|my_center|LOCUS_48340 48072 41944 gene locus_tag LOCUS_48350 48072 41944 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031213.1 protein_id gnl|my_center|LOCUS_48350 48124 48396 gene locus_tag LOCUS_48360 48124 48396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 48389 48724 gene locus_tag LOCUS_48370 48389 48724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 48995 48726 gene locus_tag LOCUS_48380 48995 48726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 49101 50252 gene locus_tag LOCUS_48390 49101 50252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 50249 50638 gene locus_tag LOCUS_48400 50249 50638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 50742 51188 gene locus_tag LOCUS_48410 50742 51188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 54012 51277 gene locus_tag LOCUS_48420 54012 51277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 58424 54009 gene locus_tag LOCUS_48430 58424 54009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 58557 61292 gene locus_tag LOCUS_48440 58557 61292 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_48440 61660 61304 gene locus_tag LOCUS_48450 61660 61304 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730775.1 protein_id gnl|my_center|LOCUS_48450 64458 61723 gene locus_tag LOCUS_48460 64458 61723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 66301 64469 gene locus_tag LOCUS_48470 66301 64469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 69066 66298 gene locus_tag LOCUS_48480 69066 66298 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225437.1 protein_id gnl|my_center|LOCUS_48480 70097 69108 gene locus_tag LOCUS_48490 70097 69108 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223213.1 protein_id gnl|my_center|LOCUS_48490 70643 71860 gene locus_tag LOCUS_48500 70643 71860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 74347 72047 gene locus_tag LOCUS_48510 74347 72047 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179552221.1 protein_id gnl|my_center|LOCUS_48510 74432 75013 gene locus_tag LOCUS_48520 74432 75013 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730623.1 protein_id gnl|my_center|LOCUS_48520 75877 75017 gene locus_tag LOCUS_48530 75877 75017 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_48530 76067 77428 gene locus_tag LOCUS_48540 76067 77428 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 protein_id gnl|my_center|LOCUS_48540 77535 78362 gene locus_tag LOCUS_48550 77535 78362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 protein_id gnl|my_center|LOCUS_48550 78395 79225 gene locus_tag LOCUS_48560 78395 79225 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_48560 79222 80988 gene locus_tag LOCUS_48570 79222 80988 CDS product choline/carnitine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283925.1 protein_id gnl|my_center|LOCUS_48570 81591 80977 gene locus_tag LOCUS_48580 81591 80977 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_48580 82779 81628 gene locus_tag LOCUS_48590 82779 81628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 84077 82839 gene locus_tag LOCUS_48600 84077 82839 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842507.1 protein_id gnl|my_center|LOCUS_48600 84211 84978 gene locus_tag LOCUS_48610 84211 84978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_48610 84978 85682 gene locus_tag LOCUS_48620 84978 85682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_48620 85696 86574 gene locus_tag LOCUS_48630 85696 86574 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_48630 86576 87658 gene locus_tag LOCUS_48640 86576 87658 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 protein_id gnl|my_center|LOCUS_48640 87655 88980 gene locus_tag LOCUS_48650 87655 88980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_48650 89464 89024 gene locus_tag LOCUS_48660 89464 89024 CDS product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929034.1 protein_id gnl|my_center|LOCUS_48660 89565 90626 gene locus_tag LOCUS_48670 89565 90626 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225217.1 protein_id gnl|my_center|LOCUS_48670 90623 91813 gene locus_tag LOCUS_48680 90623 91813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 92799 91810 gene locus_tag LOCUS_48690 gene rfbB 92799 91810 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292882.1 protein_id gnl|my_center|LOCUS_48690 92911 93129 gene locus_tag LOCUS_48700 92911 93129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 93134 94006 gene locus_tag LOCUS_48710 93134 94006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223177.1 protein_id gnl|my_center|LOCUS_48710 95719 94007 gene locus_tag LOCUS_48720 gene ilvD 95719 94007 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_48720 97154 95730 gene locus_tag LOCUS_48730 97154 95730 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879259.1 protein_id gnl|my_center|LOCUS_48730 98285 97179 gene locus_tag LOCUS_48740 98285 97179 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226964.1 protein_id gnl|my_center|LOCUS_48740 102115 98369 gene locus_tag LOCUS_48750 102115 98369 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031394.1 protein_id gnl|my_center|LOCUS_48750 102765 102202 gene locus_tag LOCUS_48760 102765 102202 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_48760 102864 103796 gene locus_tag LOCUS_48770 102864 103796 CDS product TIGR03620 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223588.1 protein_id gnl|my_center|LOCUS_48770 104234 103782 gene locus_tag LOCUS_48780 104234 103782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 104338 104763 gene locus_tag LOCUS_48790 104338 104763 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_48790 105397 104783 gene locus_tag LOCUS_48800 105397 104783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 105746 105489 gene locus_tag LOCUS_48810 105746 105489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 105881 106255 gene locus_tag LOCUS_48820 105881 106255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 106252 106719 gene locus_tag LOCUS_48830 106252 106719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 106769 111214 gene locus_tag LOCUS_48840 106769 111214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_48840 111268 111636 gene locus_tag LOCUS_48850 111268 111636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 111672 112481 gene locus_tag LOCUS_48860 111672 112481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 112670 112930 gene locus_tag LOCUS_48870 112670 112930 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228157.1 protein_id gnl|my_center|LOCUS_48870 114088 113006 gene locus_tag LOCUS_48880 114088 113006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_48880 114969 114088 gene locus_tag LOCUS_48890 114969 114088 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_48890 115712 115053 gene locus_tag LOCUS_48900 115712 115053 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_48900 116995 115709 gene locus_tag LOCUS_48910 116995 115709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 117187 117534 gene locus_tag LOCUS_48920 117187 117534 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226040.1 protein_id gnl|my_center|LOCUS_48920 117800 117531 gene locus_tag LOCUS_48930 117800 117531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 117933 118607 gene locus_tag LOCUS_48940 117933 118607 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 protein_id gnl|my_center|LOCUS_48940 119662 118646 gene locus_tag LOCUS_48950 119662 118646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 119732 120202 gene locus_tag LOCUS_48960 119732 120202 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_48960 120199 122238 gene locus_tag LOCUS_48970 120199 122238 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965397.1 protein_id gnl|my_center|LOCUS_48970 122264 122707 gene locus_tag LOCUS_48980 122264 122707 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226972.1 protein_id gnl|my_center|LOCUS_48980 123715 122714 gene locus_tag LOCUS_48990 123715 122714 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_48990 123864 127790 gene locus_tag LOCUS_49000 123864 127790 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_49000 127989 131912 gene locus_tag LOCUS_49010 127989 131912 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_49010 132867 131959 gene locus_tag LOCUS_49020 132867 131959 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742052.1 protein_id gnl|my_center|LOCUS_49020 133053 134288 gene locus_tag LOCUS_49030 133053 134288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 134450 135301 gene locus_tag LOCUS_49040 134450 135301 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031714.1 protein_id gnl|my_center|LOCUS_49040 136897 135308 gene locus_tag LOCUS_49050 136897 135308 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028126.1 protein_id gnl|my_center|LOCUS_49050 137037 137582 gene locus_tag LOCUS_49060 137037 137582 CDS product DUF6069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227728.1 protein_id gnl|my_center|LOCUS_49060 137890 137588 gene locus_tag LOCUS_49070 137890 137588 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225091.1 protein_id gnl|my_center|LOCUS_49070 138211 138372 gene locus_tag LOCUS_49080 138211 138372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 139784 138381 gene locus_tag LOCUS_49090 139784 138381 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223979.1 protein_id gnl|my_center|LOCUS_49090 140110 139781 gene locus_tag LOCUS_49100 140110 139781 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223978.1 protein_id gnl|my_center|LOCUS_49100 140610 140260 gene locus_tag LOCUS_49110 140610 140260 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_49110 144023 140787 gene locus_tag LOCUS_49120 144023 140787 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_49120 144857 144180 gene locus_tag LOCUS_49130 144857 144180 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 protein_id gnl|my_center|LOCUS_49130 145016 146221 gene locus_tag LOCUS_49140 145016 146221 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972218.1 protein_id gnl|my_center|LOCUS_49140 146256 147473 gene locus_tag LOCUS_49150 146256 147473 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972218.1 protein_id gnl|my_center|LOCUS_49150 147503 149779 gene locus_tag LOCUS_49160 147503 149779 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_49160 149794 150270 gene locus_tag LOCUS_49170 149794 150270 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_49170 151259 150273 gene locus_tag LOCUS_49180 151259 150273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 151447 152532 gene locus_tag LOCUS_49190 151447 152532 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_49190 153212 152511 gene locus_tag LOCUS_49200 153212 152511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 154064 153225 gene locus_tag LOCUS_49210 154064 153225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 155308 154064 gene locus_tag LOCUS_49220 155308 154064 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_49220 155392 156048 gene locus_tag LOCUS_49230 155392 156048 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226773.1 protein_id gnl|my_center|LOCUS_49230 156050 157399 gene locus_tag LOCUS_49240 156050 157399 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 protein_id gnl|my_center|LOCUS_49240 157411 158358 gene locus_tag LOCUS_49250 157411 158358 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226775.1 protein_id gnl|my_center|LOCUS_49250 159127 158360 gene locus_tag LOCUS_49260 159127 158360 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_49260 159804 159145 gene locus_tag LOCUS_49270 159804 159145 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324691.1 protein_id gnl|my_center|LOCUS_49270 160547 159906 gene locus_tag LOCUS_49280 160547 159906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 162790 160544 gene locus_tag LOCUS_49290 162790 160544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 162932 164194 gene locus_tag LOCUS_49300 162932 164194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 165201 164206 gene locus_tag LOCUS_49310 165201 164206 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028254.1 protein_id gnl|my_center|LOCUS_49310 167268 165337 gene locus_tag LOCUS_49320 167268 165337 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_49320 167517 167852 gene locus_tag LOCUS_49330 167517 167852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 168439 167849 gene locus_tag LOCUS_49340 168439 167849 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_49340 169047 168436 gene locus_tag LOCUS_49350 169047 168436 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_49350 170217 169120 gene locus_tag LOCUS_49360 170217 169120 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_49360 171434 170214 gene locus_tag LOCUS_49370 171434 170214 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223998.1 protein_id gnl|my_center|LOCUS_49370 173101 171431 gene locus_tag LOCUS_49380 173101 171431 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_49380 175042 173114 gene locus_tag LOCUS_49390 175042 173114 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509311.1 protein_id gnl|my_center|LOCUS_49390 176561 175035 gene locus_tag LOCUS_49400 176561 175035 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_49400 177333 176572 gene locus_tag LOCUS_49410 177333 176572 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728235.1 protein_id gnl|my_center|LOCUS_49410 178097 177330 gene locus_tag LOCUS_49420 178097 177330 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228956.1 protein_id gnl|my_center|LOCUS_49420 179261 178116 gene locus_tag LOCUS_49430 179261 178116 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896231.1 protein_id gnl|my_center|LOCUS_49430 180411 179266 gene locus_tag LOCUS_49440 180411 179266 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228952.1 protein_id gnl|my_center|LOCUS_49440 180459 181658 gene locus_tag LOCUS_49450 180459 181658 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_49450 181651 182283 gene locus_tag LOCUS_49460 181651 182283 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892139.1 protein_id gnl|my_center|LOCUS_49460 182291 183034 gene locus_tag LOCUS_49470 182291 183034 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225713.1 protein_id gnl|my_center|LOCUS_49470 183161 184489 gene locus_tag LOCUS_49480 183161 184489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104732.1 protein_id gnl|my_center|LOCUS_49480 184937 184482 gene locus_tag LOCUS_49490 184937 184482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 185497 185000 gene locus_tag LOCUS_49500 185497 185000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 186421 185579 gene locus_tag LOCUS_49510 186421 185579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 190825 186443 gene locus_tag LOCUS_49520 190825 186443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_49520 190913 192139 gene locus_tag LOCUS_49530 190913 192139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 192142 192345 gene locus_tag LOCUS_49540 192142 192345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 192345 192716 gene locus_tag LOCUS_49550 192345 192716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 192713 193627 gene locus_tag LOCUS_49560 192713 193627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 193620 194441 gene locus_tag LOCUS_49570 193620 194441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 194389 195117 gene locus_tag LOCUS_49580 194389 195117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 195132 195569 gene locus_tag LOCUS_49590 195132 195569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 197484 195547 gene locus_tag LOCUS_49600 197484 195547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 196143 196237 gene locus_tag LOCUS_t00480 196143 196237 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 198769 197603 gene locus_tag LOCUS_49610 198769 197603 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840295.1 protein_id gnl|my_center|LOCUS_49610 198895 199554 gene locus_tag LOCUS_49620 198895 199554 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230194.1 protein_id gnl|my_center|LOCUS_49620 199608 200621 gene locus_tag LOCUS_49630 199608 200621 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_49630 200669 201286 gene locus_tag LOCUS_49640 200669 201286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 201738 201283 gene locus_tag LOCUS_49650 201738 201283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 202440 201832 gene locus_tag LOCUS_49660 202440 201832 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_49660 202792 202421 gene locus_tag LOCUS_49670 202792 202421 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_49670 203211 202804 gene locus_tag LOCUS_49680 203211 202804 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_49680 205667 203256 gene locus_tag LOCUS_49690 205667 203256 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229429.1 protein_id gnl|my_center|LOCUS_49690 206015 207616 gene locus_tag LOCUS_49700 206015 207616 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727011.1 protein_id gnl|my_center|LOCUS_49700 208830 207655 gene locus_tag LOCUS_49710 208830 207655 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_49710 209787 208885 gene locus_tag LOCUS_49720 209787 208885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 211261 209780 gene locus_tag LOCUS_49730 211261 209780 CDS product type B diterpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417905.1 protein_id gnl|my_center|LOCUS_49730 212407 211364 gene locus_tag LOCUS_49740 212407 211364 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_49740 212888 218350 gene locus_tag LOCUS_49750 212888 218350 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_49750 218911 218357 gene locus_tag LOCUS_49760 218911 218357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 220740 218953 gene locus_tag LOCUS_49770 220740 218953 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_49770 222267 220750 gene locus_tag LOCUS_49780 222267 220750 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 protein_id gnl|my_center|LOCUS_49780 222768 222271 gene locus_tag LOCUS_49790 222768 222271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 223735 222776 gene locus_tag LOCUS_49800 223735 222776 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339285.1 protein_id gnl|my_center|LOCUS_49800 225538 223796 gene locus_tag LOCUS_49810 225538 223796 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927003.1 protein_id gnl|my_center|LOCUS_49810 226674 225535 gene locus_tag LOCUS_49820 226674 225535 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726713.1 protein_id gnl|my_center|LOCUS_49820 226731 227630 gene locus_tag LOCUS_49830 226731 227630 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382895.1 protein_id gnl|my_center|LOCUS_49830 229015 227633 gene locus_tag LOCUS_49840 229015 227633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 230284 229112 gene locus_tag LOCUS_49850 230284 229112 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_49850 231282 230317 gene locus_tag LOCUS_49860 231282 230317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 231367 232620 gene locus_tag LOCUS_49870 231367 232620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 232661 232981 gene locus_tag LOCUS_49880 232661 232981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 234136 233090 gene locus_tag LOCUS_49890 234136 233090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 234179 235051 gene locus_tag LOCUS_49900 234179 235051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 235557 235048 gene locus_tag LOCUS_49910 235557 235048 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181390343.1 protein_id gnl|my_center|LOCUS_49910 235816 235640 gene locus_tag LOCUS_49920 235816 235640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 236135 236848 gene locus_tag LOCUS_49930 236135 236848 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_49930 238140 236932 gene locus_tag LOCUS_49940 238140 236932 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226337.1 protein_id gnl|my_center|LOCUS_49940 238268 238885 gene locus_tag LOCUS_49950 238268 238885 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226338.1 protein_id gnl|my_center|LOCUS_49950 239024 240619 gene locus_tag LOCUS_49960 239024 240619 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224830.1 protein_id gnl|my_center|LOCUS_49960 241332 240523 gene locus_tag LOCUS_49970 241332 240523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 241274 242260 gene locus_tag LOCUS_49980 241274 242260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 242624 242349 gene locus_tag LOCUS_49990 242624 242349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 242836 243492 gene locus_tag LOCUS_50000 242836 243492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 244443 243625 gene locus_tag LOCUS_50010 244443 243625 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225248.1 protein_id gnl|my_center|LOCUS_50010 244526 245194 gene locus_tag LOCUS_50020 244526 245194 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_50020 245622 245350 gene locus_tag LOCUS_50030 245622 245350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 246526 245636 gene locus_tag LOCUS_50040 246526 245636 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086155.1 protein_id gnl|my_center|LOCUS_50040 247629 246526 gene locus_tag LOCUS_50050 247629 246526 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530844.1 protein_id gnl|my_center|LOCUS_50050 248480 247626 gene locus_tag LOCUS_50060 248480 247626 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086157.1 protein_id gnl|my_center|LOCUS_50060 249474 248470 gene locus_tag LOCUS_50070 249474 248470 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530846.1 protein_id gnl|my_center|LOCUS_50070 250796 249477 gene locus_tag LOCUS_50080 250796 249477 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160700.1 protein_id gnl|my_center|LOCUS_50080 251191 250862 gene locus_tag LOCUS_50090 251191 250862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 252155 251358 gene locus_tag LOCUS_50100 252155 251358 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086161.1 protein_id gnl|my_center|LOCUS_50100 252273 252932 gene locus_tag LOCUS_50110 252273 252932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 253629 252940 gene locus_tag LOCUS_50120 253629 252940 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224063.1 protein_id gnl|my_center|LOCUS_50120 255086 253626 gene locus_tag LOCUS_50130 255086 253626 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742165.1 protein_id gnl|my_center|LOCUS_50130 255266 257647 gene locus_tag LOCUS_50140 255266 257647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 259298 257658 gene locus_tag LOCUS_50150 259298 257658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 260019 259312 gene locus_tag LOCUS_50160 260019 259312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 261169 260129 gene locus_tag LOCUS_50170 261169 260129 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226377.1 protein_id gnl|my_center|LOCUS_50170 261310 262818 gene locus_tag LOCUS_50180 261310 262818 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226378.1 protein_id gnl|my_center|LOCUS_50180 262815 263840 gene locus_tag LOCUS_50190 262815 263840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226379.1 protein_id gnl|my_center|LOCUS_50190 263830 264843 gene locus_tag LOCUS_50200 263830 264843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_50200 264858 265925 gene locus_tag LOCUS_50210 gene rhaS 264858 265925 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226381.1 protein_id gnl|my_center|LOCUS_50210 265925 266263 gene locus_tag LOCUS_50220 265925 266263 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_50220 266269 267435 gene locus_tag LOCUS_50230 gene rhaI 266269 267435 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226383.1 protein_id gnl|my_center|LOCUS_50230 267432 269459 gene locus_tag LOCUS_50240 267432 269459 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467133.1 protein_id gnl|my_center|LOCUS_50240 269472 270902 gene locus_tag LOCUS_50250 269472 270902 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_50250 270899 272347 gene locus_tag LOCUS_50260 270899 272347 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226386.1 protein_id gnl|my_center|LOCUS_50260 273189 272344 gene locus_tag LOCUS_50270 273189 272344 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029125.1 protein_id gnl|my_center|LOCUS_50270 274339 273251 gene locus_tag LOCUS_50280 274339 273251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966665.1 protein_id gnl|my_center|LOCUS_50280 275964 274660 gene locus_tag LOCUS_50290 275964 274660 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309483.1 protein_id gnl|my_center|LOCUS_50290 276113 276424 gene locus_tag LOCUS_50300 276113 276424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 276537 277730 gene locus_tag LOCUS_50310 276537 277730 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087142.1 protein_id gnl|my_center|LOCUS_50310 277727 278497 gene locus_tag LOCUS_50320 277727 278497 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087141.1 protein_id gnl|my_center|LOCUS_50320 279249 278503 gene locus_tag LOCUS_50330 279249 278503 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_50330 280563 279286 gene locus_tag LOCUS_50340 280563 279286 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400886.1 protein_id gnl|my_center|LOCUS_50340 280666 281832 gene locus_tag LOCUS_50350 280666 281832 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815469.1 protein_id gnl|my_center|LOCUS_50350 281832 284699 gene locus_tag LOCUS_50360 281832 284699 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_50360 284839 285771 gene locus_tag LOCUS_50370 284839 285771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314014.1 protein_id gnl|my_center|LOCUS_50370 285829 286581 gene locus_tag LOCUS_50380 285829 286581 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228660.1 protein_id gnl|my_center|LOCUS_50380 287836 286568 gene locus_tag LOCUS_50390 287836 286568 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_50390 288762 288253 gene locus_tag LOCUS_50400 288762 288253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 288885 290000 gene locus_tag LOCUS_50410 288885 290000 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_50410 290163 291806 gene locus_tag LOCUS_50420 290163 291806 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037618692.1 protein_id gnl|my_center|LOCUS_50420 291820 292776 gene locus_tag LOCUS_50430 291820 292776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853884.1 protein_id gnl|my_center|LOCUS_50430 292776 294734 gene locus_tag LOCUS_50440 292776 294734 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804463.1 protein_id gnl|my_center|LOCUS_50440 294731 295693 gene locus_tag LOCUS_50450 294731 295693 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_50450 295707 297584 gene locus_tag LOCUS_50460 295707 297584 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031005.1 protein_id gnl|my_center|LOCUS_50460 297596 298777 gene locus_tag LOCUS_50470 297596 298777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 298912 299826 gene locus_tag LOCUS_50480 298912 299826 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727260.1 protein_id gnl|my_center|LOCUS_50480 299848 300564 gene locus_tag LOCUS_50490 299848 300564 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804466.1 protein_id gnl|my_center|LOCUS_50490 301415 300561 gene locus_tag LOCUS_50500 301415 300561 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_50500 302977 301481 gene locus_tag LOCUS_50510 302977 301481 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_50510 304113 302974 gene locus_tag LOCUS_50520 304113 302974 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_50520 305438 304110 gene locus_tag LOCUS_50530 305438 304110 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731050.1 protein_id gnl|my_center|LOCUS_50530 306349 305435 gene locus_tag LOCUS_50540 gene kdgD 306349 305435 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038348.1 protein_id gnl|my_center|LOCUS_50540 310156 306878 gene locus_tag LOCUS_50550 310156 306878 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256783.1 protein_id gnl|my_center|LOCUS_50550 311215 310313 gene locus_tag LOCUS_50560 gene pelA 311215 310313 CDS product pectate trisaccharide-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865117.1 protein_id gnl|my_center|LOCUS_50560 312679 311396 gene locus_tag LOCUS_50570 312679 311396 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226279.1 protein_id gnl|my_center|LOCUS_50570 313944 312685 gene locus_tag LOCUS_50580 313944 312685 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_50580 315969 313993 gene locus_tag LOCUS_50590 315969 313993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 316850 315966 gene locus_tag LOCUS_50600 316850 315966 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_50600 317764 316847 gene locus_tag LOCUS_50610 317764 316847 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_50610 318017 318520 gene locus_tag LOCUS_50620 318017 318520 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467066.1 protein_id gnl|my_center|LOCUS_50620 318575 319672 gene locus_tag LOCUS_50630 318575 319672 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 protein_id gnl|my_center|LOCUS_50630 319714 320487 gene locus_tag LOCUS_50640 319714 320487 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_50640 320484 322100 gene locus_tag LOCUS_50650 320484 322100 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_50650 322149 322910 gene locus_tag LOCUS_50660 322149 322910 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027775.1 protein_id gnl|my_center|LOCUS_50660 324245 323517 gene locus_tag LOCUS_50670 gene ribA 324245 323517 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284081.1 protein_id gnl|my_center|LOCUS_50670 325204 324242 gene locus_tag LOCUS_50680 325204 324242 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230075.1 protein_id gnl|my_center|LOCUS_50680 326259 325201 gene locus_tag LOCUS_50690 326259 325201 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_50690 326654 326256 gene locus_tag LOCUS_50700 326654 326256 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_50700 327647 326676 gene locus_tag LOCUS_50710 327647 326676 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230079.1 protein_id gnl|my_center|LOCUS_50710 328970 327669 gene locus_tag LOCUS_50720 328970 327669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 329132 330136 gene locus_tag LOCUS_50730 329132 330136 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_50730 330219 331508 gene locus_tag LOCUS_50740 330219 331508 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_50740 331510 332409 gene locus_tag LOCUS_50750 331510 332409 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_50750 332406 333224 gene locus_tag LOCUS_50760 332406 333224 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_50760 333221 335482 gene locus_tag LOCUS_50770 gene yicI 333221 335482 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_50770 335501 338485 gene locus_tag LOCUS_50780 335501 338485 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226193.1 protein_id gnl|my_center|LOCUS_50780 336097 336007 gene locus_tag LOCUS_t00490 336097 336007 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 338482 341316 gene locus_tag LOCUS_50790 338482 341316 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226283.1 protein_id gnl|my_center|LOCUS_50790 341543 343672 gene locus_tag LOCUS_50800 341543 343672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 344976 343744 gene locus_tag LOCUS_50810 gene ilvA 344976 343744 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223532.1 protein_id gnl|my_center|LOCUS_50810 346052 345192 gene locus_tag LOCUS_50820 346052 345192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 346130 346324 gene locus_tag LOCUS_50830 346130 346324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50830 346378 347661 gene locus_tag LOCUS_50840 346378 347661 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226090.1 protein_id gnl|my_center|LOCUS_50840 347694 353633 gene locus_tag LOCUS_50850 347694 353633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 353684 353974 gene locus_tag LOCUS_50860 353684 353974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 354031 355095 gene locus_tag LOCUS_50870 354031 355095 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223768.1 protein_id gnl|my_center|LOCUS_50870 355104 355427 gene locus_tag LOCUS_50880 355104 355427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226018.1 protein_id gnl|my_center|LOCUS_50880 356760 355525 gene locus_tag LOCUS_50890 gene gguB 356760 355525 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226250.1 protein_id gnl|my_center|LOCUS_50890 358292 356757 gene locus_tag LOCUS_50900 gene gguA 358292 356757 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_50900 359404 358292 gene locus_tag LOCUS_50910 gene chvE 359404 358292 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_50910 360957 359449 gene locus_tag LOCUS_50920 gene araA 360957 359449 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_50920 361626 360979 gene locus_tag LOCUS_50930 361626 360979 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_50930 363278 361623 gene locus_tag LOCUS_50940 gene araB 363278 361623 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_50940 364411 363371 gene locus_tag LOCUS_50950 364411 363371 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_50950 367012 364514 gene locus_tag LOCUS_50960 367012 364514 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027862.1 protein_id gnl|my_center|LOCUS_50960 367186 368145 gene locus_tag LOCUS_50970 367186 368145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_50970 368150 369700 gene locus_tag LOCUS_50980 368150 369700 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_50980 369697 370671 gene locus_tag LOCUS_50990 369697 370671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877168.1 protein_id gnl|my_center|LOCUS_50990 370668 371645 gene locus_tag LOCUS_51000 gene yjfF 370668 371645 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_51000 374067 371599 gene locus_tag LOCUS_51010 374067 371599 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_51010 374979 374167 gene locus_tag LOCUS_51020 374979 374167 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218604714.1 protein_id gnl|my_center|LOCUS_51020 376420 375158 gene locus_tag LOCUS_51030 376420 375158 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742147.1 protein_id gnl|my_center|LOCUS_51030 378388 376496 gene locus_tag LOCUS_51040 378388 376496 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 protein_id gnl|my_center|LOCUS_51040 378605 379504 gene locus_tag LOCUS_51050 378605 379504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 379924 379508 gene locus_tag LOCUS_51060 379924 379508 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 protein_id gnl|my_center|LOCUS_51060 380727 379957 gene locus_tag LOCUS_51070 380727 379957 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_51070 381605 380724 gene locus_tag LOCUS_51080 381605 380724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_51080 381716 382867 gene locus_tag LOCUS_51090 381716 382867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 382917 383510 gene locus_tag LOCUS_51100 382917 383510 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228133.1 protein_id gnl|my_center|LOCUS_51100 383706 384212 gene locus_tag LOCUS_51110 383706 384212 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_51110 384209 384889 gene locus_tag LOCUS_51120 384209 384889 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227870.1 protein_id gnl|my_center|LOCUS_51120 384990 385847 gene locus_tag LOCUS_51130 384990 385847 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_51130 386284 385844 gene locus_tag LOCUS_51140 386284 385844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 386871 386308 gene locus_tag LOCUS_51150 386871 386308 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226520.1 protein_id gnl|my_center|LOCUS_51150 386939 387685 gene locus_tag LOCUS_51160 386939 387685 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_51160 388131 387682 gene locus_tag LOCUS_51170 388131 387682 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092399.1 protein_id gnl|my_center|LOCUS_51170 389261 388128 gene locus_tag LOCUS_51180 389261 388128 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_51180 389380 390348 gene locus_tag LOCUS_51190 389380 390348 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_51190 390345 391148 gene locus_tag LOCUS_51200 390345 391148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_51200 394257 391132 gene locus_tag LOCUS_51210 394257 391132 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_51210 394303 395235 gene locus_tag LOCUS_51220 394303 395235 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226704.1 protein_id gnl|my_center|LOCUS_51220 395383 395243 gene locus_tag LOCUS_51230 395383 395243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 396591 395383 gene locus_tag LOCUS_51240 396591 395383 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878254.1 protein_id gnl|my_center|LOCUS_51240 397300 396632 gene locus_tag LOCUS_51250 397300 396632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 400190 397425 gene locus_tag LOCUS_51260 400190 397425 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226708.1 protein_id gnl|my_center|LOCUS_51260 401447 400203 gene locus_tag LOCUS_51270 401447 400203 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_51270 401853 401455 gene locus_tag LOCUS_51280 401853 401455 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_51280 402829 401921 gene locus_tag LOCUS_51290 402829 401921 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_51290 403820 402858 gene locus_tag LOCUS_51300 gene tatC 403820 402858 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226711.1 protein_id gnl|my_center|LOCUS_51300 404149 403835 gene locus_tag LOCUS_51310 404149 403835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 404408 404142 gene locus_tag LOCUS_51320 404408 404142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 405462 404470 gene locus_tag LOCUS_51330 405462 404470 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_51330 406445 405459 gene locus_tag LOCUS_51340 406445 405459 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_51340 407237 406509 gene locus_tag LOCUS_51350 407237 406509 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 protein_id gnl|my_center|LOCUS_51350 407294 409501 gene locus_tag LOCUS_51360 407294 409501 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_51360 409601 410575 gene locus_tag LOCUS_51370 409601 410575 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831648.1 protein_id gnl|my_center|LOCUS_51370 410469 410744 gene locus_tag LOCUS_51380 410469 410744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 412106 410748 gene locus_tag LOCUS_51390 gene pafA 412106 410748 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226720.1 protein_id gnl|my_center|LOCUS_51390 412981 412211 gene locus_tag LOCUS_51400 gene prcA 412981 412211 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_51400 413902 413024 gene locus_tag LOCUS_51410 gene prcB 413902 413024 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226724.1 protein_id gnl|my_center|LOCUS_51410 414169 413975 gene locus_tag LOCUS_51420 414169 413975 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895347.1 protein_id gnl|my_center|LOCUS_51420 415737 414229 gene locus_tag LOCUS_51430 gene dop 415737 414229 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_51430 416706 415762 gene locus_tag LOCUS_51440 416706 415762 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226729.1 protein_id gnl|my_center|LOCUS_51440 418528 416711 gene locus_tag LOCUS_51450 gene arc 418528 416711 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284603.1 protein_id gnl|my_center|LOCUS_51450 418803 419540 gene locus_tag LOCUS_51460 418803 419540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 419712 420347 gene locus_tag LOCUS_51470 419712 420347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 420348 420842 gene locus_tag LOCUS_51480 420348 420842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 420832 421431 gene locus_tag LOCUS_51490 420832 421431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 422285 421440 gene locus_tag LOCUS_51500 422285 421440 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226739.1 protein_id gnl|my_center|LOCUS_51500 422426 423166 gene locus_tag LOCUS_51510 422426 423166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 424304 423177 gene locus_tag LOCUS_51520 424304 423177 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226740.1 protein_id gnl|my_center|LOCUS_51520 424409 425299 gene locus_tag LOCUS_51530 424409 425299 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226741.1 protein_id gnl|my_center|LOCUS_51530 425300 426079 gene locus_tag LOCUS_51540 425300 426079 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_51540 426932 426087 gene locus_tag LOCUS_51550 gene hisG 426932 426087 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226744.1 protein_id gnl|my_center|LOCUS_51550 427214 426951 gene locus_tag LOCUS_51560 427214 426951 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226745.1 protein_id gnl|my_center|LOCUS_51560 428109 427273 gene locus_tag LOCUS_51570 428109 427273 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467175.1 protein_id gnl|my_center|LOCUS_51570 428162 429070 gene locus_tag LOCUS_51580 428162 429070 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_51580 429080 430207 gene locus_tag LOCUS_51590 429080 430207 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015116.1 protein_id gnl|my_center|LOCUS_51590 430113 430207 gene locus_tag LOCUS_t00500 430113 430207 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 431449 430211 gene locus_tag LOCUS_51600 gene mshC 431449 430211 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226760.1 protein_id gnl|my_center|LOCUS_51600 431579 432745 gene locus_tag LOCUS_51610 431579 432745 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_51610 432762 432995 gene locus_tag LOCUS_51620 432762 432995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 433019 434401 gene locus_tag LOCUS_51630 433019 434401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 434338 434625 gene locus_tag LOCUS_51640 434338 434625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 436963 434924 gene locus_tag LOCUS_51650 436963 434924 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228686.1 protein_id gnl|my_center|LOCUS_51650 438020 437028 gene locus_tag LOCUS_51660 438020 437028 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456725.1 protein_id gnl|my_center|LOCUS_51660 438080 438766 gene locus_tag LOCUS_51670 438080 438766 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878120.1 protein_id gnl|my_center|LOCUS_51670 442637 438759 gene locus_tag LOCUS_51680 gene hrpA 442637 438759 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_51680 443312 442674 gene locus_tag LOCUS_51690 443312 442674 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_51690 443702 443322 gene locus_tag LOCUS_51700 443702 443322 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_51700 444480 443686 gene locus_tag LOCUS_51710 444480 443686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_51710 444634 446055 gene locus_tag LOCUS_51720 444634 446055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229629.1 protein_id gnl|my_center|LOCUS_51720 446067 446615 gene locus_tag LOCUS_51730 446067 446615 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484524.1 protein_id gnl|my_center|LOCUS_51730 448092 446785 gene locus_tag LOCUS_51740 448092 446785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 450112 448190 gene locus_tag LOCUS_51750 450112 448190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 452216 450207 gene locus_tag LOCUS_51760 452216 450207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 452443 453102 gene locus_tag LOCUS_51770 452443 453102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 454171 453224 gene locus_tag LOCUS_51780 454171 453224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 454331 455362 gene locus_tag LOCUS_51790 454331 455362 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_51790 455533 455787 gene locus_tag LOCUS_51800 455533 455787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_51800 455823 455978 gene locus_tag LOCUS_51810 455823 455978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 458557 456056 gene locus_tag LOCUS_51820 458557 456056 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_51820 458764 459150 gene locus_tag LOCUS_51830 458764 459150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 460097 459159 gene locus_tag LOCUS_51840 460097 459159 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086840011.1 protein_id gnl|my_center|LOCUS_51840 461548 460127 gene locus_tag LOCUS_51850 461548 460127 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083032.1 protein_id gnl|my_center|LOCUS_51850 461671 463842 gene locus_tag LOCUS_51860 461671 463842 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_51860 463882 464709 gene locus_tag LOCUS_51870 463882 464709 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_51870 465166 464714 gene locus_tag LOCUS_51880 465166 464714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 465271 465672 gene locus_tag LOCUS_51890 465271 465672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 466411 465677 gene locus_tag LOCUS_51900 466411 465677 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703348.1 protein_id gnl|my_center|LOCUS_51900 466896 466408 gene locus_tag LOCUS_51910 466896 466408 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703347.1 protein_id gnl|my_center|LOCUS_51910 468148 466889 gene locus_tag LOCUS_51920 468148 466889 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 protein_id gnl|my_center|LOCUS_51920 468522 468145 gene locus_tag LOCUS_51930 468522 468145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387554.1 protein_id gnl|my_center|LOCUS_51930 469656 468547 gene locus_tag LOCUS_51940 469656 468547 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369891.1 protein_id gnl|my_center|LOCUS_51940 469793 471271 gene locus_tag LOCUS_51950 469793 471271 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817147.1 protein_id gnl|my_center|LOCUS_51950 471268 471522 gene locus_tag LOCUS_51960 471268 471522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 471519 472715 gene locus_tag LOCUS_51970 471519 472715 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_51970 473316 472705 gene locus_tag LOCUS_51980 gene fixJ 473316 472705 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918644.1 protein_id gnl|my_center|LOCUS_51980 473885 473313 gene locus_tag LOCUS_51990 473885 473313 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 protein_id gnl|my_center|LOCUS_51990 474072 474851 gene locus_tag LOCUS_52000 474072 474851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 474862 475782 gene locus_tag LOCUS_52010 474862 475782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 475900 476430 gene locus_tag LOCUS_52020 475900 476430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 476455 477249 gene locus_tag LOCUS_52030 476455 477249 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531396.1 protein_id gnl|my_center|LOCUS_52030 477642 477250 gene locus_tag LOCUS_52040 477642 477250 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223509.1 protein_id gnl|my_center|LOCUS_52040 478157 477639 gene locus_tag LOCUS_52050 478157 477639 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223510.1 protein_id gnl|my_center|LOCUS_52050 479675 478395 gene locus_tag LOCUS_52060 479675 478395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 480744 479596 gene locus_tag LOCUS_52070 480744 479596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 480683 481294 gene locus_tag LOCUS_52080 480683 481294 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_52080 481325 481810 gene locus_tag LOCUS_52090 481325 481810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 482550 481801 gene locus_tag LOCUS_52100 482550 481801 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 protein_id gnl|my_center|LOCUS_52100 482661 482975 gene locus_tag LOCUS_52110 482661 482975 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_52110 483094 483852 gene locus_tag LOCUS_52120 483094 483852 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_52120 484030 484884 gene locus_tag LOCUS_52130 484030 484884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229149.1 protein_id gnl|my_center|LOCUS_52130 484881 485834 gene locus_tag LOCUS_52140 484881 485834 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_52140 485831 487006 gene locus_tag LOCUS_52150 485831 487006 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229151.1 protein_id gnl|my_center|LOCUS_52150 486981 488054 gene locus_tag LOCUS_52160 486981 488054 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468451.1 protein_id gnl|my_center|LOCUS_52160 488051 489037 gene locus_tag LOCUS_52170 488051 489037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229153.1 protein_id gnl|my_center|LOCUS_52170 489034 490299 gene locus_tag LOCUS_52180 489034 490299 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177242394.1 protein_id gnl|my_center|LOCUS_52180 490296 491726 gene locus_tag LOCUS_52190 490296 491726 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845897.1 protein_id gnl|my_center|LOCUS_52190 491732 492820 gene locus_tag LOCUS_52200 491732 492820 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229156.1 protein_id gnl|my_center|LOCUS_52200 492817 493932 gene locus_tag LOCUS_52210 492817 493932 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229157.1 protein_id gnl|my_center|LOCUS_52210 495136 493895 gene locus_tag LOCUS_52220 495136 493895 CDS product putative glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229158.1 protein_id gnl|my_center|LOCUS_52220 496596 495133 gene locus_tag LOCUS_52230 496596 495133 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_52230 496930 497742 gene locus_tag LOCUS_52240 496930 497742 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229160.1 protein_id gnl|my_center|LOCUS_52240 497742 499100 gene locus_tag LOCUS_52250 497742 499100 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_52250 500524 499004 gene locus_tag LOCUS_52260 500524 499004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 501495 500521 gene locus_tag LOCUS_52270 501495 500521 CDS product lysyl oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229163.1 protein_id gnl|my_center|LOCUS_52270 501868 502731 gene locus_tag LOCUS_52280 501868 502731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 503370 502852 gene locus_tag LOCUS_52290 503370 502852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 504103 503414 gene locus_tag LOCUS_52300 504103 503414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 504376 504194 gene locus_tag LOCUS_52310 504376 504194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 504873 504520 gene locus_tag LOCUS_52320 504873 504520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229145.1 protein_id gnl|my_center|LOCUS_52320 505276 506127 gene locus_tag LOCUS_52330 505276 506127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 506124 507065 gene locus_tag LOCUS_52340 506124 507065 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225143.1 protein_id gnl|my_center|LOCUS_52340 507977 507069 gene locus_tag LOCUS_52350 507977 507069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314014.1 protein_id gnl|my_center|LOCUS_52350 508548 507970 gene locus_tag LOCUS_52360 508548 507970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 508664 511555 gene locus_tag LOCUS_52370 508664 511555 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133852608.1 protein_id gnl|my_center|LOCUS_52370 512757 511552 gene locus_tag LOCUS_52380 512757 511552 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223469.1 protein_id gnl|my_center|LOCUS_52380 513020 512850 gene locus_tag LOCUS_52390 513020 512850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 513255 514160 gene locus_tag LOCUS_52400 513255 514160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 517328 514257 gene locus_tag LOCUS_52410 517328 514257 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729190.1 protein_id gnl|my_center|LOCUS_52410 517891 517325 gene locus_tag LOCUS_52420 517891 517325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729189.1 protein_id gnl|my_center|LOCUS_52420 519497 517893 gene locus_tag LOCUS_52430 519497 517893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 520090 519494 gene locus_tag LOCUS_52440 520090 519494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 520269 520913 gene locus_tag LOCUS_52450 520269 520913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_52450 520910 521875 gene locus_tag LOCUS_52460 520910 521875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 521872 522624 gene locus_tag LOCUS_52470 521872 522624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_52470 522651 523610 gene locus_tag LOCUS_52480 522651 523610 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_52480 523925 523626 gene locus_tag LOCUS_52490 523925 523626 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_52490 525034 523922 gene locus_tag LOCUS_52500 525034 523922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_52500 526015 525137 gene locus_tag LOCUS_52510 526015 525137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 526164 526904 gene locus_tag LOCUS_52520 526164 526904 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225013.1 protein_id gnl|my_center|LOCUS_52520 529138 526937 gene locus_tag LOCUS_52530 gene katG 529138 526937 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_52530 529626 529198 gene locus_tag LOCUS_52540 529626 529198 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225955.1 protein_id gnl|my_center|LOCUS_52540 529733 530641 gene locus_tag LOCUS_52550 529733 530641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_52550 530756 531682 gene locus_tag LOCUS_52560 530756 531682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 531809 533047 gene locus_tag LOCUS_52570 531809 533047 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775268.1 protein_id gnl|my_center|LOCUS_52570 533059 534381 gene locus_tag LOCUS_52580 533059 534381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 534385 535374 gene locus_tag LOCUS_52590 534385 535374 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_52590 535364 536206 gene locus_tag LOCUS_52600 535364 536206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_52600 536203 536925 gene locus_tag LOCUS_52610 536203 536925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_52610 538603 536930 gene locus_tag LOCUS_52620 538603 536930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 539385 538600 gene locus_tag LOCUS_52630 539385 538600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 540393 539389 gene locus_tag LOCUS_52640 540393 539389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 540629 540420 gene locus_tag LOCUS_52650 540629 540420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 542258 540789 gene locus_tag LOCUS_52660 542258 540789 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_52660 543721 542255 gene locus_tag LOCUS_52670 543721 542255 CDS product hydrogenase HycQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400662.1 protein_id gnl|my_center|LOCUS_52670 544383 543721 gene locus_tag LOCUS_52680 544383 543721 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_52680 545335 544397 gene locus_tag LOCUS_52690 545335 544397 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_52690 547332 545332 gene locus_tag LOCUS_52700 547332 545332 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_52700 547814 547329 gene locus_tag LOCUS_52710 547814 547329 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_52710 548204 547848 gene locus_tag LOCUS_52720 548204 547848 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_52720 548453 549229 gene locus_tag LOCUS_52730 548453 549229 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_52730 550855 549230 gene locus_tag LOCUS_52740 550855 549230 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994177.1 protein_id gnl|my_center|LOCUS_52740 552084 550852 gene locus_tag LOCUS_52750 552084 550852 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_52750 552248 553291 gene locus_tag LOCUS_52760 gene hisC 552248 553291 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112910.1 protein_id gnl|my_center|LOCUS_52760 553288 553743 gene locus_tag LOCUS_52770 553288 553743 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932845.1 protein_id gnl|my_center|LOCUS_52770 554482 553727 gene locus_tag LOCUS_52780 554482 553727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 554745 554434 gene locus_tag LOCUS_52790 554745 554434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 555168 554815 gene locus_tag LOCUS_52800 555168 554815 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222780.1 protein_id gnl|my_center|LOCUS_52800 555241 555864 gene locus_tag LOCUS_52810 555241 555864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 556296 555856 gene locus_tag LOCUS_52820 556296 555856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 556840 556400 gene locus_tag LOCUS_52830 556840 556400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 558160 556895 gene locus_tag LOCUS_52840 558160 556895 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 protein_id gnl|my_center|LOCUS_52840 559326 558157 gene locus_tag LOCUS_52850 559326 558157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 559469 559636 gene locus_tag LOCUS_52860 559469 559636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 559686 563354 gene locus_tag LOCUS_52870 gene fxsT 559686 563354 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184695823.1 protein_id gnl|my_center|LOCUS_52870 563374 564354 gene locus_tag LOCUS_52880 563374 564354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229892.1 protein_id gnl|my_center|LOCUS_52880 564447 565616 gene locus_tag LOCUS_52890 564447 565616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211351449.1 protein_id gnl|my_center|LOCUS_52890 567819 565546 gene locus_tag LOCUS_52900 567819 565546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121008027.1 protein_id gnl|my_center|LOCUS_52900 568791 567832 gene locus_tag LOCUS_52910 568791 567832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229889.1 protein_id gnl|my_center|LOCUS_52910 569681 568788 gene locus_tag LOCUS_52920 569681 568788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 569931 571139 gene locus_tag LOCUS_52930 569931 571139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225298.1 protein_id gnl|my_center|LOCUS_52930 572515 571232 gene locus_tag LOCUS_52940 572515 571232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 573330 572638 gene locus_tag LOCUS_52950 573330 572638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_52950 574430 573327 gene locus_tag LOCUS_52960 574430 573327 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_52960 574629 574979 gene locus_tag LOCUS_52970 574629 574979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 578104 575180 gene locus_tag LOCUS_52980 578104 575180 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_52980 579073 578135 gene locus_tag LOCUS_52990 579073 578135 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225296.1 protein_id gnl|my_center|LOCUS_52990 579178 580146 gene locus_tag LOCUS_53000 579178 580146 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229597.1 protein_id gnl|my_center|LOCUS_53000 580951 580133 gene locus_tag LOCUS_53010 580951 580133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 >Feature sequence24 218 634 gene locus_tag LOCUS_53020 218 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 668 1732 gene locus_tag LOCUS_53030 668 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 2027 1776 gene locus_tag LOCUS_53040 2027 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 2347 2254 gene locus_tag LOCUS_t00510 2347 2254 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3199 2528 gene locus_tag LOCUS_53050 3199 2528 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223713.1 protein_id gnl|my_center|LOCUS_53050 5256 3262 gene locus_tag LOCUS_53060 gene ligA 5256 3262 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225034.1 protein_id gnl|my_center|LOCUS_53060 5349 5549 gene locus_tag LOCUS_53070 5349 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 6771 5611 gene locus_tag LOCUS_53080 6771 5611 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015602777.1 protein_id gnl|my_center|LOCUS_53080 8287 6890 gene locus_tag LOCUS_53090 8287 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 8619 8452 gene locus_tag LOCUS_53100 8619 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 9464 8619 gene locus_tag LOCUS_53110 9464 8619 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230877.1 protein_id gnl|my_center|LOCUS_53110 9627 10109 gene locus_tag LOCUS_53120 9627 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 10360 10094 gene locus_tag LOCUS_53130 10360 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 10428 11216 gene locus_tag LOCUS_53140 10428 11216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 11859 11206 gene locus_tag LOCUS_53150 11859 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 14262 11869 gene locus_tag LOCUS_53160 14262 11869 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 protein_id gnl|my_center|LOCUS_53160 14684 14274 gene locus_tag LOCUS_53170 14684 14274 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078910.1 protein_id gnl|my_center|LOCUS_53170 15139 14690 gene locus_tag LOCUS_53180 15139 14690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_53180 15849 15268 gene locus_tag LOCUS_53190 15849 15268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 15927 18695 gene locus_tag LOCUS_53200 15927 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 18704 19441 gene locus_tag LOCUS_53210 18704 19441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944199.1 protein_id gnl|my_center|LOCUS_53210 20387 19422 gene locus_tag LOCUS_53220 20387 19422 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_53220 21357 20377 gene locus_tag LOCUS_53230 21357 20377 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_53230 21714 21472 gene locus_tag LOCUS_53240 21714 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 21617 25321 gene locus_tag LOCUS_53250 21617 25321 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_53250 25400 26131 gene locus_tag LOCUS_53260 25400 26131 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_53260 26179 26439 gene locus_tag LOCUS_53270 26179 26439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 26436 26831 gene locus_tag LOCUS_53280 26436 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 27858 26899 gene locus_tag LOCUS_53290 27858 26899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 28069 28791 gene locus_tag LOCUS_53300 28069 28791 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224232.1 protein_id gnl|my_center|LOCUS_53300 28788 29657 gene locus_tag LOCUS_53310 28788 29657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 29654 30112 gene locus_tag LOCUS_53320 29654 30112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53320 30606 30109 gene locus_tag LOCUS_53330 30606 30109 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 protein_id gnl|my_center|LOCUS_53330 30683 31165 gene locus_tag LOCUS_53340 30683 31165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 32114 31152 gene locus_tag LOCUS_53350 32114 31152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 32611 32111 gene locus_tag LOCUS_53360 32611 32111 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_53360 35308 32675 gene locus_tag LOCUS_53370 35308 32675 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027310.1 protein_id gnl|my_center|LOCUS_53370 36870 35305 gene locus_tag LOCUS_53380 36870 35305 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466616.1 protein_id gnl|my_center|LOCUS_53380 37464 36934 gene locus_tag LOCUS_53390 37464 36934 CDS product QsdR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229248.1 protein_id gnl|my_center|LOCUS_53390 37686 38561 gene locus_tag LOCUS_53400 37686 38561 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_53400 38654 39208 gene locus_tag LOCUS_53410 38654 39208 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225836.1 protein_id gnl|my_center|LOCUS_53410 39299 42676 gene locus_tag LOCUS_53420 39299 42676 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_53420 42757 43290 gene locus_tag LOCUS_53430 42757 43290 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_53430 43620 44345 gene locus_tag LOCUS_53440 43620 44345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_53440 44428 45972 gene locus_tag LOCUS_53450 44428 45972 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222228.1 protein_id gnl|my_center|LOCUS_53450 46041 46175 gene locus_tag LOCUS_53460 46041 46175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 46997 46275 gene locus_tag LOCUS_53470 46997 46275 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_53470 48205 46994 gene locus_tag LOCUS_53480 48205 46994 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776617.1 protein_id gnl|my_center|LOCUS_53480 48544 49113 gene locus_tag LOCUS_53490 48544 49113 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225272.1 protein_id gnl|my_center|LOCUS_53490 49243 50136 gene locus_tag LOCUS_53500 49243 50136 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_53500 50158 50892 gene locus_tag LOCUS_53510 50158 50892 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582685.1 protein_id gnl|my_center|LOCUS_53510 50889 51407 gene locus_tag LOCUS_53520 50889 51407 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_53520 51545 51925 gene locus_tag LOCUS_53530 51545 51925 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227684.1 protein_id gnl|my_center|LOCUS_53530 51943 52371 gene locus_tag LOCUS_53540 51943 52371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227687.1 protein_id gnl|my_center|LOCUS_53540 52632 52384 gene locus_tag LOCUS_53550 52632 52384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 52874 52656 gene locus_tag LOCUS_53560 52874 52656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 52833 53849 gene locus_tag LOCUS_53570 52833 53849 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230602.1 protein_id gnl|my_center|LOCUS_53570 54801 53833 gene locus_tag LOCUS_53580 54801 53833 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 protein_id gnl|my_center|LOCUS_53580 54943 58314 gene locus_tag LOCUS_53590 54943 58314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 58720 58295 gene locus_tag LOCUS_53600 58720 58295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 60088 59105 gene locus_tag LOCUS_53610 60088 59105 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223676.1 protein_id gnl|my_center|LOCUS_53610 60027 60635 gene locus_tag LOCUS_53620 60027 60635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 60722 63460 gene locus_tag LOCUS_53630 60722 63460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 63498 63947 gene locus_tag LOCUS_53640 gene ybaK 63498 63947 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229713.1 protein_id gnl|my_center|LOCUS_53640 64406 63954 gene locus_tag LOCUS_53650 64406 63954 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_53650 64481 65068 gene locus_tag LOCUS_53660 64481 65068 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 protein_id gnl|my_center|LOCUS_53660 65072 65842 gene locus_tag LOCUS_53670 65072 65842 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 protein_id gnl|my_center|LOCUS_53670 65839 66639 gene locus_tag LOCUS_53680 65839 66639 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_53680 66636 67178 gene locus_tag LOCUS_53690 66636 67178 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224228.1 protein_id gnl|my_center|LOCUS_53690 69156 67858 gene locus_tag LOCUS_53700 69156 67858 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228763.1 protein_id gnl|my_center|LOCUS_53700 71166 69577 gene locus_tag LOCUS_53710 71166 69577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 71233 71709 gene locus_tag LOCUS_53720 71233 71709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 71843 72817 gene locus_tag LOCUS_53730 71843 72817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 72911 73294 gene locus_tag LOCUS_53740 72911 73294 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_53740 73414 73869 gene locus_tag LOCUS_53750 73414 73869 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230087.1 protein_id gnl|my_center|LOCUS_53750 73879 74544 gene locus_tag LOCUS_53760 73879 74544 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223717.1 protein_id gnl|my_center|LOCUS_53760 74757 74557 gene locus_tag LOCUS_53770 74757 74557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53770 75814 74933 gene locus_tag LOCUS_53780 75814 74933 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_53780 76155 75925 gene locus_tag LOCUS_53790 76155 75925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 76396 77223 gene locus_tag LOCUS_53800 76396 77223 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031938971.1 protein_id gnl|my_center|LOCUS_53800 77283 78119 gene locus_tag LOCUS_53810 77283 78119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53810 79170 78223 gene locus_tag LOCUS_53820 79170 78223 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_53820 79500 80147 gene locus_tag LOCUS_53830 79500 80147 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_53830 80863 80282 gene locus_tag LOCUS_53840 80863 80282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 80948 81988 gene locus_tag LOCUS_53850 80948 81988 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_53850 82621 81989 gene locus_tag LOCUS_53860 82621 81989 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972614.1 protein_id gnl|my_center|LOCUS_53860 83487 82756 gene locus_tag LOCUS_53870 83487 82756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 84650 83814 gene locus_tag LOCUS_53880 84650 83814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53880 85756 84770 gene locus_tag LOCUS_53890 85756 84770 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977544.1 protein_id gnl|my_center|LOCUS_53890 85990 87600 gene locus_tag LOCUS_53900 85990 87600 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110774.1 protein_id gnl|my_center|LOCUS_53900 87602 88741 gene locus_tag LOCUS_53910 87602 88741 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 protein_id gnl|my_center|LOCUS_53910 88741 89988 gene locus_tag LOCUS_53920 88741 89988 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110778.1 protein_id gnl|my_center|LOCUS_53920 90001 90465 gene locus_tag LOCUS_53930 90001 90465 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086023.1 protein_id gnl|my_center|LOCUS_53930 90465 90869 gene locus_tag LOCUS_53940 90465 90869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 90866 91783 gene locus_tag LOCUS_53950 90866 91783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 91783 92823 gene locus_tag LOCUS_53960 91783 92823 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_53960 92838 93077 gene locus_tag LOCUS_53970 92838 93077 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027681.1 protein_id gnl|my_center|LOCUS_53970 >Feature sequence25 210 494 gene locus_tag LOCUS_53980 210 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 612 1511 gene locus_tag LOCUS_53990 612 1511 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_53990 1573 2751 gene locus_tag LOCUS_54000 1573 2751 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_54000 2757 3413 gene locus_tag LOCUS_54010 2757 3413 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_54010 4312 3380 gene locus_tag LOCUS_54020 4312 3380 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539523.1 protein_id gnl|my_center|LOCUS_54020 5256 4324 gene locus_tag LOCUS_54030 5256 4324 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539523.1 protein_id gnl|my_center|LOCUS_54030 6611 5253 gene locus_tag LOCUS_54040 6611 5253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224969.1 protein_id gnl|my_center|LOCUS_54040 7528 6608 gene locus_tag LOCUS_54050 gene argF 7528 6608 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_54050 23168 7554 gene locus_tag LOCUS_54060 23168 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54060 23065 23340 gene locus_tag LOCUS_54070 23065 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 28849 23996 gene locus_tag LOCUS_54080 28849 23996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 29069 28863 gene locus_tag LOCUS_54090 29069 28863 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_54090 30076 29066 gene locus_tag LOCUS_54100 gene sbnA 30076 29066 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145344089.1 protein_id gnl|my_center|LOCUS_54100 31398 30082 gene locus_tag LOCUS_54110 31398 30082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 31660 31400 gene locus_tag LOCUS_54120 31660 31400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 31795 33084 gene locus_tag LOCUS_54130 31795 33084 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_54130 33084 33350 gene locus_tag LOCUS_54140 33084 33350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 33354 33896 gene locus_tag LOCUS_54150 33354 33896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 33880 34941 gene locus_tag LOCUS_54160 33880 34941 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225881.1 protein_id gnl|my_center|LOCUS_54160 35041 35973 gene locus_tag LOCUS_54170 35041 35973 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225871.1 protein_id gnl|my_center|LOCUS_54170 35990 36847 gene locus_tag LOCUS_54180 35990 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 36844 38316 gene locus_tag LOCUS_54190 36844 38316 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_54190 38821 38387 gene locus_tag LOCUS_54200 38821 38387 CDS product SUKH-3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015686.1 protein_id gnl|my_center|LOCUS_54200 39393 39605 gene locus_tag LOCUS_54210 39393 39605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54210 40413 39985 gene locus_tag LOCUS_54220 40413 39985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 42353 40584 gene locus_tag LOCUS_54230 42353 40584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 42655 45297 gene locus_tag LOCUS_54240 42655 45297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 45327 45539 gene locus_tag LOCUS_54250 45327 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 45557 48460 gene locus_tag LOCUS_54260 45557 48460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 48960 48472 gene locus_tag LOCUS_54270 48960 48472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 49036 49656 gene locus_tag LOCUS_54280 49036 49656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 50622 49693 gene locus_tag LOCUS_54290 50622 49693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 51303 50695 gene locus_tag LOCUS_54300 51303 50695 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_54300 51377 51709 gene locus_tag LOCUS_54310 gene cmtR 51377 51709 CDS product Cd(II)/Pb(II)-sensing metalloregulatory transcriptional regulator CmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410018.1 protein_id gnl|my_center|LOCUS_54310 52439 51714 gene locus_tag LOCUS_54320 52439 51714 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_54320 52527 53081 gene locus_tag LOCUS_54330 52527 53081 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_54330 53557 53051 gene locus_tag LOCUS_54340 53557 53051 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229654.1 protein_id gnl|my_center|LOCUS_54340 53870 53568 gene locus_tag LOCUS_54350 53870 53568 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223911.1 protein_id gnl|my_center|LOCUS_54350 54035 55318 gene locus_tag LOCUS_54360 54035 55318 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061609.1 protein_id gnl|my_center|LOCUS_54360 55402 55836 gene locus_tag LOCUS_54370 55402 55836 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_54370 56404 55823 gene locus_tag LOCUS_54380 56404 55823 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079730.1 protein_id gnl|my_center|LOCUS_54380 57383 56433 gene locus_tag LOCUS_54390 57383 56433 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_54390 57532 61308 gene locus_tag LOCUS_54400 57532 61308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 62266 61370 gene locus_tag LOCUS_54410 62266 61370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 64101 62263 gene locus_tag LOCUS_54420 64101 62263 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_54420 64838 64131 gene locus_tag LOCUS_54430 64838 64131 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227005.1 protein_id gnl|my_center|LOCUS_54430 66073 64859 gene locus_tag LOCUS_54440 66073 64859 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_54440 66312 66073 gene locus_tag LOCUS_54450 66312 66073 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039536.1 protein_id gnl|my_center|LOCUS_54450 67361 66309 gene locus_tag LOCUS_54460 67361 66309 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_54460 68314 67358 gene locus_tag LOCUS_54470 68314 67358 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062723274.1 protein_id gnl|my_center|LOCUS_54470 69454 68324 gene locus_tag LOCUS_54480 69454 68324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 70308 69451 gene locus_tag LOCUS_54490 70308 69451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54490 70965 70327 gene locus_tag LOCUS_54500 70965 70327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 71582 70962 gene locus_tag LOCUS_54510 71582 70962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 72478 71579 gene locus_tag LOCUS_54520 72478 71579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 75150 72475 gene locus_tag LOCUS_54530 75150 72475 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836868.1 protein_id gnl|my_center|LOCUS_54530 75362 76390 gene locus_tag LOCUS_54540 75362 76390 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_54540 76392 78035 gene locus_tag LOCUS_54550 76392 78035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 78402 78046 gene locus_tag LOCUS_54560 78402 78046 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 protein_id gnl|my_center|LOCUS_54560 79329 78406 gene locus_tag LOCUS_54570 79329 78406 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029244.1 protein_id gnl|my_center|LOCUS_54570 80282 79380 gene locus_tag LOCUS_54580 80282 79380 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029684.1 protein_id gnl|my_center|LOCUS_54580 80457 81563 gene locus_tag LOCUS_54590 80457 81563 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972783.1 protein_id gnl|my_center|LOCUS_54590 81560 82219 gene locus_tag LOCUS_54600 81560 82219 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222996.1 protein_id gnl|my_center|LOCUS_54600 82631 82221 gene locus_tag LOCUS_54610 82631 82221 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 protein_id gnl|my_center|LOCUS_54610 82735 82660 gene locus_tag LOCUS_t00520 82735 82660 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 82880 82806 gene locus_tag LOCUS_t00530 82880 82806 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 82978 82906 gene locus_tag LOCUS_t00540 82978 82906 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 83068 82994 gene locus_tag LOCUS_t00550 83068 82994 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83144 83073 gene locus_tag LOCUS_t00560 83144 83073 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 83451 84614 gene locus_tag LOCUS_54620 83451 84614 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015602777.1 protein_id gnl|my_center|LOCUS_54620 84778 85920 gene locus_tag LOCUS_54630 84778 85920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 85966 87015 gene locus_tag LOCUS_54640 85966 87015 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767735.1 protein_id gnl|my_center|LOCUS_54640 87581 87012 gene locus_tag LOCUS_54650 87581 87012 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_54650 88539 87895 gene locus_tag LOCUS_54660 88539 87895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 89052 88690 gene locus_tag LOCUS_54670 89052 88690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 89118 89483 gene locus_tag LOCUS_54680 89118 89483 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_54680 >Feature sequence26 946 458 gene locus_tag LOCUS_54690 946 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 834 1121 gene locus_tag LOCUS_54700 834 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 1224 1484 gene locus_tag LOCUS_54710 1224 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 1484 3181 gene locus_tag LOCUS_54720 1484 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 4197 3190 gene locus_tag LOCUS_54730 4197 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 4372 9033 gene locus_tag LOCUS_54740 4372 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 9039 10025 gene locus_tag LOCUS_54750 9039 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 10022 11341 gene locus_tag LOCUS_54760 10022 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 11381 12094 gene locus_tag LOCUS_54770 11381 12094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_54770 12834 12091 gene locus_tag LOCUS_54780 12834 12091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 16860 12946 gene locus_tag LOCUS_54790 16860 12946 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_54790 19969 17087 gene locus_tag LOCUS_54800 19969 17087 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_54800 20563 20069 gene locus_tag LOCUS_54810 20563 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 22737 21010 gene locus_tag LOCUS_54820 22737 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 23735 22767 gene locus_tag LOCUS_54830 23735 22767 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606051.1 protein_id gnl|my_center|LOCUS_54830 24679 23732 gene locus_tag LOCUS_54840 24679 23732 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_54840 25737 24691 gene locus_tag LOCUS_54850 25737 24691 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_54850 26496 25774 gene locus_tag LOCUS_54860 26496 25774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 27608 26493 gene locus_tag LOCUS_54870 27608 26493 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525264.1 protein_id gnl|my_center|LOCUS_54870 28576 27605 gene locus_tag LOCUS_54880 28576 27605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223413.1 protein_id gnl|my_center|LOCUS_54880 30126 28603 gene locus_tag LOCUS_54890 30126 28603 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223414.1 protein_id gnl|my_center|LOCUS_54890 31085 30117 gene locus_tag LOCUS_54900 31085 30117 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223415.1 protein_id gnl|my_center|LOCUS_54900 32074 31100 gene locus_tag LOCUS_54910 32074 31100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 33027 32071 gene locus_tag LOCUS_54920 33027 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 33836 33066 gene locus_tag LOCUS_54930 33836 33066 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538762.1 protein_id gnl|my_center|LOCUS_54930 33981 35138 gene locus_tag LOCUS_54940 33981 35138 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027990143.1 protein_id gnl|my_center|LOCUS_54940 35135 35515 gene locus_tag LOCUS_54950 35135 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 38456 35874 gene locus_tag LOCUS_54960 38456 35874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 38557 38889 gene locus_tag LOCUS_54970 38557 38889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 38898 40007 gene locus_tag LOCUS_54980 38898 40007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 40068 41291 gene locus_tag LOCUS_54990 40068 41291 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027428.1 protein_id gnl|my_center|LOCUS_54990 41784 41191 gene locus_tag LOCUS_55000 41784 41191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 41837 42202 gene locus_tag LOCUS_55010 41837 42202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55010 42271 43068 gene locus_tag LOCUS_55020 42271 43068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 43130 43984 gene locus_tag LOCUS_55030 43130 43984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 44886 43987 gene locus_tag LOCUS_55040 44886 43987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 45567 44977 gene locus_tag LOCUS_55050 45567 44977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 47095 45659 gene locus_tag LOCUS_55060 47095 45659 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_55060 50451 47185 gene locus_tag LOCUS_55070 50451 47185 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227589.1 protein_id gnl|my_center|LOCUS_55070 50613 51239 gene locus_tag LOCUS_55080 50613 51239 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228774.1 protein_id gnl|my_center|LOCUS_55080 52464 51346 gene locus_tag LOCUS_55090 52464 51346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 52479 53009 gene locus_tag LOCUS_55100 52479 53009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 53490 53002 gene locus_tag LOCUS_55110 53490 53002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 53721 53581 gene locus_tag LOCUS_55120 53721 53581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 54653 53718 gene locus_tag LOCUS_55130 54653 53718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 55123 54650 gene locus_tag LOCUS_55140 55123 54650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 55650 55120 gene locus_tag LOCUS_55150 55650 55120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 56374 55658 gene locus_tag LOCUS_55160 56374 55658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 57478 56489 gene locus_tag LOCUS_55170 gene selD 57478 56489 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_55170 57513 58805 gene locus_tag LOCUS_55180 gene selA 57513 58805 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_55180 60005 59004 gene locus_tag LOCUS_55190 60005 59004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 60762 60028 gene locus_tag LOCUS_55200 60762 60028 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972574.1 protein_id gnl|my_center|LOCUS_55200 61288 60896 gene locus_tag LOCUS_55210 61288 60896 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088836.1 protein_id gnl|my_center|LOCUS_55210 61468 62646 gene locus_tag LOCUS_55220 61468 62646 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072555.1 protein_id gnl|my_center|LOCUS_55220 64058 62697 gene locus_tag LOCUS_55230 64058 62697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55230 65671 64055 gene locus_tag LOCUS_55240 65671 64055 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 protein_id gnl|my_center|LOCUS_55240 69567 65668 gene locus_tag LOCUS_55250 69567 65668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 75022 69569 gene locus_tag LOCUS_55260 75022 69569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 75352 75053 gene locus_tag LOCUS_55270 75352 75053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 >Feature sequence27 571 128 gene locus_tag LOCUS_55280 571 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 971 591 gene locus_tag LOCUS_55290 971 591 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_55290 1095 2045 gene locus_tag LOCUS_55300 gene sigJ 1095 2045 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_55300 2198 4960 gene locus_tag LOCUS_55310 2198 4960 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226576.1 protein_id gnl|my_center|LOCUS_55310 5573 5788 gene locus_tag LOCUS_55320 5573 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 5927 6763 gene locus_tag LOCUS_55330 5927 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 6843 7727 gene locus_tag LOCUS_55340 6843 7727 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285158.1 protein_id gnl|my_center|LOCUS_55340 8286 7771 gene locus_tag LOCUS_55350 8286 7771 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_55350 8287 8847 gene locus_tag LOCUS_55360 8287 8847 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227382.1 protein_id gnl|my_center|LOCUS_55360 10183 8876 gene locus_tag LOCUS_55370 10183 8876 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730163.1 protein_id gnl|my_center|LOCUS_55370 11061 10228 gene locus_tag LOCUS_55380 11061 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 11192 12490 gene locus_tag LOCUS_55390 11192 12490 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047122783.1 protein_id gnl|my_center|LOCUS_55390 12487 13677 gene locus_tag LOCUS_55400 12487 13677 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064155.1 protein_id gnl|my_center|LOCUS_55400 13674 15269 gene locus_tag LOCUS_55410 13674 15269 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940324.1 protein_id gnl|my_center|LOCUS_55410 16677 15982 gene locus_tag LOCUS_55420 16677 15982 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731418.1 protein_id gnl|my_center|LOCUS_55420 17047 16748 gene locus_tag LOCUS_55430 17047 16748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 18797 17079 gene locus_tag LOCUS_55440 18797 17079 CDS product 3-oxoacid CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414123.1 protein_id gnl|my_center|LOCUS_55440 19615 18797 gene locus_tag LOCUS_55450 gene menB 19615 18797 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_55450 19673 20524 gene locus_tag LOCUS_55460 19673 20524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 21419 20985 gene locus_tag LOCUS_55470 21419 20985 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897712.1 protein_id gnl|my_center|LOCUS_55470 22710 21451 gene locus_tag LOCUS_55480 22710 21451 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731181.1 protein_id gnl|my_center|LOCUS_55480 24514 22973 gene locus_tag LOCUS_55490 24514 22973 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731180.1 protein_id gnl|my_center|LOCUS_55490 25067 24774 gene locus_tag LOCUS_55500 25067 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 26556 25078 gene locus_tag LOCUS_55510 26556 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 26845 26549 gene locus_tag LOCUS_55520 26845 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 26979 27371 gene locus_tag LOCUS_55530 26979 27371 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284752.1 protein_id gnl|my_center|LOCUS_55530 27368 28252 gene locus_tag LOCUS_55540 27368 28252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229213.1 protein_id gnl|my_center|LOCUS_55540 28249 29220 gene locus_tag LOCUS_55550 28249 29220 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229214.1 protein_id gnl|my_center|LOCUS_55550 29241 30362 gene locus_tag LOCUS_55560 29241 30362 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742129.1 protein_id gnl|my_center|LOCUS_55560 30359 31033 gene locus_tag LOCUS_55570 30359 31033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 31924 31037 gene locus_tag LOCUS_55580 31924 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 32426 31935 gene locus_tag LOCUS_55590 32426 31935 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_55590 33417 32500 gene locus_tag LOCUS_55600 33417 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 33534 34346 gene locus_tag LOCUS_55610 33534 34346 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_55610 34353 35054 gene locus_tag LOCUS_55620 34353 35054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391616.1 protein_id gnl|my_center|LOCUS_55620 35051 36046 gene locus_tag LOCUS_55630 35051 36046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_55630 36222 37487 gene locus_tag LOCUS_55640 36222 37487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55640 37998 37540 gene locus_tag LOCUS_55650 37998 37540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 38169 39005 gene locus_tag LOCUS_55660 38169 39005 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_55660 39018 39212 gene locus_tag LOCUS_55670 39018 39212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 39237 39422 gene locus_tag LOCUS_55680 39237 39422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 40821 39469 gene locus_tag LOCUS_55690 40821 39469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 42183 40990 gene locus_tag LOCUS_55700 42183 40990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230985.1 protein_id gnl|my_center|LOCUS_55700 43234 42242 gene locus_tag LOCUS_55710 43234 42242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 43845 43297 gene locus_tag LOCUS_55720 43845 43297 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_55720 43997 44749 gene locus_tag LOCUS_55730 43997 44749 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225248.1 protein_id gnl|my_center|LOCUS_55730 44868 45971 gene locus_tag LOCUS_55740 44868 45971 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027639.1 protein_id gnl|my_center|LOCUS_55740 45993 47093 gene locus_tag LOCUS_55750 45993 47093 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_55750 47268 47083 gene locus_tag LOCUS_55760 47268 47083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55760 49214 47424 gene locus_tag LOCUS_55770 49214 47424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 50122 49214 gene locus_tag LOCUS_55780 50122 49214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55780 50843 50223 gene locus_tag LOCUS_55790 50843 50223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 51580 50888 gene locus_tag LOCUS_55800 51580 50888 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031847.1 protein_id gnl|my_center|LOCUS_55800 53564 51600 gene locus_tag LOCUS_55810 53564 51600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 53949 53590 gene locus_tag LOCUS_55820 53949 53590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 53948 54178 gene locus_tag LOCUS_55830 53948 54178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 54354 54911 gene locus_tag LOCUS_55840 54354 54911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 54950 56098 gene locus_tag LOCUS_55850 54950 56098 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_55850 56108 56458 gene locus_tag LOCUS_55860 56108 56458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 57208 56576 gene locus_tag LOCUS_55870 57208 56576 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225434.1 protein_id gnl|my_center|LOCUS_55870 57272 58105 gene locus_tag LOCUS_55880 57272 58105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 58281 58102 gene locus_tag LOCUS_55890 58281 58102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 59185 58301 gene locus_tag LOCUS_55900 59185 58301 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_55900 59303 59578 gene locus_tag LOCUS_55910 59303 59578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 60911 59751 gene locus_tag LOCUS_55920 60911 59751 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_55920 61042 61950 gene locus_tag LOCUS_55930 61042 61950 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_55930 62017 62304 gene locus_tag LOCUS_55940 62017 62304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 62630 62298 gene locus_tag LOCUS_55950 62630 62298 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226049.1 protein_id gnl|my_center|LOCUS_55950 62715 63368 gene locus_tag LOCUS_55960 62715 63368 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224710.1 protein_id gnl|my_center|LOCUS_55960 63722 65452 gene locus_tag LOCUS_55970 63722 65452 CDS product cellulose 1,4-beta-cellobiosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031002.1 protein_id gnl|my_center|LOCUS_55970 65591 68476 gene locus_tag LOCUS_55980 65591 68476 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031000.1 protein_id gnl|my_center|LOCUS_55980 68561 70231 gene locus_tag LOCUS_55990 68561 70231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 70438 70875 gene locus_tag LOCUS_56000 70438 70875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467819.1 protein_id gnl|my_center|LOCUS_56000 70872 72506 gene locus_tag LOCUS_56010 70872 72506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 72503 73288 gene locus_tag LOCUS_56020 72503 73288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 73302 73871 gene locus_tag LOCUS_56030 73302 73871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 73893 74195 gene locus_tag LOCUS_56040 73893 74195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 >Feature sequence28 281 964 gene locus_tag LOCUS_56050 281 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 1101 2558 gene locus_tag LOCUS_56060 1101 2558 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222718.1 protein_id gnl|my_center|LOCUS_56060 2626 4818 gene locus_tag LOCUS_56070 2626 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 5023 6006 gene locus_tag LOCUS_56080 5023 6006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 protein_id gnl|my_center|LOCUS_56080 6072 6830 gene locus_tag LOCUS_56090 6072 6830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223675.1 protein_id gnl|my_center|LOCUS_56090 6832 7701 gene locus_tag LOCUS_56100 6832 7701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_56100 7698 8945 gene locus_tag LOCUS_56110 7698 8945 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223673.1 protein_id gnl|my_center|LOCUS_56110 8942 9946 gene locus_tag LOCUS_56120 8942 9946 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223672.1 protein_id gnl|my_center|LOCUS_56120 9943 10935 gene locus_tag LOCUS_56130 9943 10935 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223671.1 protein_id gnl|my_center|LOCUS_56130 10932 11903 gene locus_tag LOCUS_56140 10932 11903 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223670.1 protein_id gnl|my_center|LOCUS_56140 11900 12961 gene locus_tag LOCUS_56150 11900 12961 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223669.1 protein_id gnl|my_center|LOCUS_56150 12961 14178 gene locus_tag LOCUS_56160 12961 14178 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223668.1 protein_id gnl|my_center|LOCUS_56160 14160 14693 gene locus_tag LOCUS_56170 14160 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223667.1 protein_id gnl|my_center|LOCUS_56170 14707 15309 gene locus_tag LOCUS_56180 14707 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 15546 16148 gene locus_tag LOCUS_56190 15546 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 16250 16852 gene locus_tag LOCUS_56200 16250 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 16919 18397 gene locus_tag LOCUS_56210 16919 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028344.1 protein_id gnl|my_center|LOCUS_56210 18620 19402 gene locus_tag LOCUS_56220 18620 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028345.1 protein_id gnl|my_center|LOCUS_56220 19480 20082 gene locus_tag LOCUS_56230 19480 20082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 21441 20209 gene locus_tag LOCUS_56240 21441 20209 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223659.1 protein_id gnl|my_center|LOCUS_56240 21684 22475 gene locus_tag LOCUS_56250 21684 22475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 22421 23980 gene locus_tag LOCUS_56260 22421 23980 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285994.1 protein_id gnl|my_center|LOCUS_56260 24039 27413 gene locus_tag LOCUS_56270 24039 27413 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222728.1 protein_id gnl|my_center|LOCUS_56270 27478 27897 gene locus_tag LOCUS_56280 27478 27897 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_56280 27907 28503 gene locus_tag LOCUS_56290 27907 28503 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222730.1 protein_id gnl|my_center|LOCUS_56290 31529 28539 gene locus_tag LOCUS_56300 31529 28539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 31627 32574 gene locus_tag LOCUS_56310 31627 32574 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114440.1 protein_id gnl|my_center|LOCUS_56310 32592 33452 gene locus_tag LOCUS_56320 32592 33452 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 protein_id gnl|my_center|LOCUS_56320 33449 33730 gene locus_tag LOCUS_56330 33449 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 33837 34820 gene locus_tag LOCUS_56340 33837 34820 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_56340 34966 35367 gene locus_tag LOCUS_56350 34966 35367 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222214.1 protein_id gnl|my_center|LOCUS_56350 35606 35424 gene locus_tag LOCUS_56360 35606 35424 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_56360 35654 36313 gene locus_tag LOCUS_56370 35654 36313 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_56370 36395 36601 gene locus_tag LOCUS_56380 36395 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 36798 37646 gene locus_tag LOCUS_56390 36798 37646 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467855.1 protein_id gnl|my_center|LOCUS_56390 38248 37661 gene locus_tag LOCUS_56400 38248 37661 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_56400 38594 38229 gene locus_tag LOCUS_56410 38594 38229 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561733.1 protein_id gnl|my_center|LOCUS_56410 39004 38591 gene locus_tag LOCUS_56420 39004 38591 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229428.1 protein_id gnl|my_center|LOCUS_56420 41516 38982 gene locus_tag LOCUS_56430 41516 38982 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229429.1 protein_id gnl|my_center|LOCUS_56430 42277 41705 gene locus_tag LOCUS_56440 42277 41705 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059527.1 protein_id gnl|my_center|LOCUS_56440 42362 42559 gene locus_tag LOCUS_56450 42362 42559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 42588 43154 gene locus_tag LOCUS_56460 42588 43154 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_56460 43230 44399 gene locus_tag LOCUS_56470 43230 44399 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973365.1 protein_id gnl|my_center|LOCUS_56470 44486 45703 gene locus_tag LOCUS_56480 44486 45703 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_56480 45883 46236 gene locus_tag LOCUS_56490 45883 46236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222747.1 protein_id gnl|my_center|LOCUS_56490 46315 47376 gene locus_tag LOCUS_56500 46315 47376 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227080.1 protein_id gnl|my_center|LOCUS_56500 47941 47396 gene locus_tag LOCUS_56510 47941 47396 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_56510 48759 48004 gene locus_tag LOCUS_56520 48759 48004 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222750.1 protein_id gnl|my_center|LOCUS_56520 48814 49452 gene locus_tag LOCUS_56530 48814 49452 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_56530 49659 50036 gene locus_tag LOCUS_56540 49659 50036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 50075 51100 gene locus_tag LOCUS_56550 gene trpS 50075 51100 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_56550 51163 52188 gene locus_tag LOCUS_56560 gene yhjD 51163 52188 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222755.1 protein_id gnl|my_center|LOCUS_56560 52198 52497 gene locus_tag LOCUS_56570 52198 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 53770 52430 gene locus_tag LOCUS_56580 53770 52430 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222758.1 protein_id gnl|my_center|LOCUS_56580 54112 53915 gene locus_tag LOCUS_56590 54112 53915 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672132.1 protein_id gnl|my_center|LOCUS_56590 54339 55451 gene locus_tag LOCUS_56600 54339 55451 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_56600 56206 57402 gene locus_tag LOCUS_56610 56206 57402 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776795.1 protein_id gnl|my_center|LOCUS_56610 57399 58931 gene locus_tag LOCUS_56620 57399 58931 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225825.1 protein_id gnl|my_center|LOCUS_56620 59007 60029 gene locus_tag LOCUS_56630 59007 60029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 protein_id gnl|my_center|LOCUS_56630 60085 61140 gene locus_tag LOCUS_56640 60085 61140 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_56640 61205 62365 gene locus_tag LOCUS_56650 61205 62365 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_56650 62493 63650 gene locus_tag LOCUS_56660 gene xylA 62493 63650 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_56660 63762 68312 gene locus_tag LOCUS_56670 63762 68312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 68460 69782 gene locus_tag LOCUS_56680 68460 69782 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_56680 >Feature sequence29 131 733 gene locus_tag LOCUS_56690 131 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56690 764 1411 gene locus_tag LOCUS_56700 764 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 1649 1963 gene locus_tag LOCUS_56710 1649 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 2017 2304 gene locus_tag LOCUS_56720 2017 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 3254 2379 gene locus_tag LOCUS_56730 3254 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 3445 3888 gene locus_tag LOCUS_56740 gene rplM 3445 3888 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_56740 3918 4367 gene locus_tag LOCUS_56750 gene rpsI 3918 4367 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222642.1 protein_id gnl|my_center|LOCUS_56750 4484 5824 gene locus_tag LOCUS_56760 gene glmM 4484 5824 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_56760 5853 7217 gene locus_tag LOCUS_56770 5853 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 7373 7720 gene locus_tag LOCUS_56780 7373 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 7717 10584 gene locus_tag LOCUS_56790 7717 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_56790 10599 11108 gene locus_tag LOCUS_56800 10599 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 11105 11356 gene locus_tag LOCUS_56810 11105 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 11363 12550 gene locus_tag LOCUS_56820 11363 12550 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225893.1 protein_id gnl|my_center|LOCUS_56820 12550 13614 gene locus_tag LOCUS_56830 12550 13614 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225892.1 protein_id gnl|my_center|LOCUS_56830 13611 14120 gene locus_tag LOCUS_56840 13611 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 14130 16454 gene locus_tag LOCUS_56850 14130 16454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 17251 16451 gene locus_tag LOCUS_56860 17251 16451 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222650.1 protein_id gnl|my_center|LOCUS_56860 17314 18840 gene locus_tag LOCUS_56870 17314 18840 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222652.1 protein_id gnl|my_center|LOCUS_56870 18833 19948 gene locus_tag LOCUS_56880 gene alr 18833 19948 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222656.1 protein_id gnl|my_center|LOCUS_56880 19945 20997 gene locus_tag LOCUS_56890 19945 20997 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285971.1 protein_id gnl|my_center|LOCUS_56890 20994 21455 gene locus_tag LOCUS_56900 gene tsaE 20994 21455 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466589.1 protein_id gnl|my_center|LOCUS_56900 22101 21733 gene locus_tag LOCUS_56910 22101 21733 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_56910 22190 23065 gene locus_tag LOCUS_56920 22190 23065 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_56920 23685 23089 gene locus_tag LOCUS_56930 23685 23089 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_56930 23762 24796 gene locus_tag LOCUS_56940 23762 24796 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329802.1 protein_id gnl|my_center|LOCUS_56940 24821 25519 gene locus_tag LOCUS_56950 24821 25519 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385031.1 protein_id gnl|my_center|LOCUS_56950 25545 26195 gene locus_tag LOCUS_56960 gene tsaB 25545 26195 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_56960 26192 26665 gene locus_tag LOCUS_56970 gene rimI 26192 26665 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222663.1 protein_id gnl|my_center|LOCUS_56970 26662 27705 gene locus_tag LOCUS_56980 gene tsaD 26662 27705 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222664.1 protein_id gnl|my_center|LOCUS_56980 27735 28037 gene locus_tag LOCUS_56990 27735 28037 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223017.1 protein_id gnl|my_center|LOCUS_56990 29999 28092 gene locus_tag LOCUS_57000 29999 28092 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222670.1 protein_id gnl|my_center|LOCUS_57000 30329 30622 gene locus_tag LOCUS_57010 gene groES 30329 30622 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559922.1 protein_id gnl|my_center|LOCUS_57010 30700 32337 gene locus_tag LOCUS_57020 gene groL 30700 32337 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222677.1 protein_id gnl|my_center|LOCUS_57020 32837 32538 gene locus_tag LOCUS_57030 32837 32538 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_57030 33061 34020 gene locus_tag LOCUS_57040 33061 34020 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222679.1 protein_id gnl|my_center|LOCUS_57040 34017 34928 gene locus_tag LOCUS_57050 34017 34928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222680.1 protein_id gnl|my_center|LOCUS_57050 35050 35646 gene locus_tag LOCUS_57060 35050 35646 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073605.1 protein_id gnl|my_center|LOCUS_57060 35884 36456 gene locus_tag LOCUS_57070 35884 36456 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468912.1 protein_id gnl|my_center|LOCUS_57070 36457 37410 gene locus_tag LOCUS_57080 36457 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 37407 37601 gene locus_tag LOCUS_57090 37407 37601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 38054 37641 gene locus_tag LOCUS_57100 38054 37641 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_57100 38144 39646 gene locus_tag LOCUS_57110 gene guaB 38144 39646 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_57110 39672 40808 gene locus_tag LOCUS_57120 39672 40808 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222686.1 protein_id gnl|my_center|LOCUS_57120 40924 41955 gene locus_tag LOCUS_57130 40924 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 41990 43672 gene locus_tag LOCUS_57140 41990 43672 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_57140 43665 44621 gene locus_tag LOCUS_57150 43665 44621 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 protein_id gnl|my_center|LOCUS_57150 44642 45904 gene locus_tag LOCUS_57160 44642 45904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 45822 46181 gene locus_tag LOCUS_57170 45822 46181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 46206 47723 gene locus_tag LOCUS_57180 46206 47723 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_57180 49158 47704 gene locus_tag LOCUS_57190 49158 47704 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_57190 49198 50790 gene locus_tag LOCUS_57200 gene guaA 49198 50790 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222695.1 protein_id gnl|my_center|LOCUS_57200 51081 50851 gene locus_tag LOCUS_57210 51081 50851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 52453 51065 gene locus_tag LOCUS_57220 52453 51065 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222697.1 protein_id gnl|my_center|LOCUS_57220 52591 53868 gene locus_tag LOCUS_57230 52591 53868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222700.1 protein_id gnl|my_center|LOCUS_57230 53897 54547 gene locus_tag LOCUS_57240 53897 54547 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_57240 56195 54576 gene locus_tag LOCUS_57250 56195 54576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 57614 56235 gene locus_tag LOCUS_57260 57614 56235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 58725 57844 gene locus_tag LOCUS_57270 58725 57844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57270 60104 58857 gene locus_tag LOCUS_57280 60104 58857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 60973 60221 gene locus_tag LOCUS_57290 60973 60221 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_57290 61349 61044 gene locus_tag LOCUS_57300 61349 61044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222708.1 protein_id gnl|my_center|LOCUS_57300 61726 61412 gene locus_tag LOCUS_57310 61726 61412 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222709.1 protein_id gnl|my_center|LOCUS_57310 62018 64417 gene locus_tag LOCUS_57320 gene pcrA 62018 64417 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222711.1 protein_id gnl|my_center|LOCUS_57320 64492 64764 gene locus_tag LOCUS_57330 64492 64764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 65428 64739 gene locus_tag LOCUS_57340 65428 64739 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_57340 65465 65704 gene locus_tag LOCUS_57350 65465 65704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 66373 66864 gene locus_tag LOCUS_57360 66373 66864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 67005 68729 gene locus_tag LOCUS_57370 67005 68729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222713.1 protein_id gnl|my_center|LOCUS_57370 >Feature sequence30 504 800 gene locus_tag LOCUS_57380 504 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 810 1442 gene locus_tag LOCUS_57390 gene hisH 810 1442 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 protein_id gnl|my_center|LOCUS_57390 1869 1540 gene locus_tag LOCUS_57400 1869 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 2720 3463 gene locus_tag LOCUS_57410 2720 3463 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143050978.1 protein_id gnl|my_center|LOCUS_57410 3460 4194 gene locus_tag LOCUS_57420 gene priA 3460 4194 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466797.1 protein_id gnl|my_center|LOCUS_57420 4567 4160 gene locus_tag LOCUS_57430 4567 4160 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224150.1 protein_id gnl|my_center|LOCUS_57430 5338 4604 gene locus_tag LOCUS_57440 5338 4604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229140.1 protein_id gnl|my_center|LOCUS_57440 6131 5412 gene locus_tag LOCUS_57450 6131 5412 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229141.1 protein_id gnl|my_center|LOCUS_57450 6853 6278 gene locus_tag LOCUS_57460 6853 6278 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_57460 6906 7652 gene locus_tag LOCUS_57470 gene hisF 6906 7652 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_57470 7649 8074 gene locus_tag LOCUS_57480 gene hisI 7649 8074 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728899.1 protein_id gnl|my_center|LOCUS_57480 8681 8067 gene locus_tag LOCUS_57490 8681 8067 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224164.1 protein_id gnl|my_center|LOCUS_57490 8789 10342 gene locus_tag LOCUS_57500 8789 10342 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224165.1 protein_id gnl|my_center|LOCUS_57500 10335 10787 gene locus_tag LOCUS_57510 10335 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 10932 11744 gene locus_tag LOCUS_57520 gene trpC 10932 11744 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_57520 11741 12982 gene locus_tag LOCUS_57530 gene trpB 11741 12982 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284348.1 protein_id gnl|my_center|LOCUS_57530 12982 13773 gene locus_tag LOCUS_57540 gene trpA 12982 13773 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224169.1 protein_id gnl|my_center|LOCUS_57540 13841 14983 gene locus_tag LOCUS_57550 13841 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 16271 14919 gene locus_tag LOCUS_57560 16271 14919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_57560 16345 16929 gene locus_tag LOCUS_57570 16345 16929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 17993 16926 gene locus_tag LOCUS_57580 17993 16926 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_57580 18784 18002 gene locus_tag LOCUS_57590 18784 18002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_57590 19830 18781 gene locus_tag LOCUS_57600 19830 18781 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_57600 20783 19830 gene locus_tag LOCUS_57610 20783 19830 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_57610 21135 22106 gene locus_tag LOCUS_57620 21135 22106 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_57620 22116 22772 gene locus_tag LOCUS_57630 22116 22772 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_57630 23791 22769 gene locus_tag LOCUS_57640 23791 22769 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_57640 25182 23800 gene locus_tag LOCUS_57650 25182 23800 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_57650 26015 25179 gene locus_tag LOCUS_57660 26015 25179 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_57660 26934 26017 gene locus_tag LOCUS_57670 26934 26017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_57670 28225 26942 gene locus_tag LOCUS_57680 28225 26942 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_57680 29752 28334 gene locus_tag LOCUS_57690 29752 28334 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222084.1 protein_id gnl|my_center|LOCUS_57690 30124 34692 gene locus_tag LOCUS_57700 gene gltB 30124 34692 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224180.1 protein_id gnl|my_center|LOCUS_57700 34685 36196 gene locus_tag LOCUS_57710 34685 36196 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224181.1 protein_id gnl|my_center|LOCUS_57710 37708 36266 gene locus_tag LOCUS_57720 37708 36266 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224336.1 protein_id gnl|my_center|LOCUS_57720 37986 38903 gene locus_tag LOCUS_57730 37986 38903 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_57730 38986 39654 gene locus_tag LOCUS_57740 38986 39654 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_57740 39789 41153 gene locus_tag LOCUS_57750 gene pyk 39789 41153 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466825.1 protein_id gnl|my_center|LOCUS_57750 41182 42105 gene locus_tag LOCUS_57760 41182 42105 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_57760 42188 43717 gene locus_tag LOCUS_57770 gene dacB 42188 43717 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_57770 44251 43892 gene locus_tag LOCUS_57780 44251 43892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 44507 45358 gene locus_tag LOCUS_57790 44507 45358 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_57790 45381 45587 gene locus_tag LOCUS_57800 45381 45587 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_57800 45864 46049 gene locus_tag LOCUS_57810 45864 46049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 46061 49075 gene locus_tag LOCUS_57820 46061 49075 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224347.1 protein_id gnl|my_center|LOCUS_57820 49072 49827 gene locus_tag LOCUS_57830 49072 49827 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226080.1 protein_id gnl|my_center|LOCUS_57830 49902 50645 gene locus_tag LOCUS_57840 49902 50645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 50688 51359 gene locus_tag LOCUS_57850 50688 51359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 52910 51396 gene locus_tag LOCUS_57860 52910 51396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 52846 53061 gene locus_tag LOCUS_57870 52846 53061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 54172 53582 gene locus_tag LOCUS_57880 54172 53582 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_57880 54266 55417 gene locus_tag LOCUS_57890 54266 55417 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_57890 55439 56581 gene locus_tag LOCUS_57900 55439 56581 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_57900 56600 56887 gene locus_tag LOCUS_57910 56600 56887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 57682 56921 gene locus_tag LOCUS_57920 57682 56921 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742161.1 protein_id gnl|my_center|LOCUS_57920 57830 57970 gene locus_tag LOCUS_57930 57830 57970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 58249 58740 gene locus_tag LOCUS_57940 58249 58740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224355.1 protein_id gnl|my_center|LOCUS_57940 58779 59603 gene locus_tag LOCUS_57950 58779 59603 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224356.1 protein_id gnl|my_center|LOCUS_57950 59626 60009 gene locus_tag LOCUS_57960 59626 60009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742169.1 protein_id gnl|my_center|LOCUS_57960 60075 60380 gene locus_tag LOCUS_57970 60075 60380 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_57970 61958 60387 gene locus_tag LOCUS_57980 61958 60387 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224361.1 protein_id gnl|my_center|LOCUS_57980 62371 61955 gene locus_tag LOCUS_57990 62371 61955 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224362.1 protein_id gnl|my_center|LOCUS_57990 >Feature sequence31 1 564 gene locus_tag LOCUS_58000 1 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 1768 566 gene locus_tag LOCUS_58010 1768 566 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_58010 2691 1789 gene locus_tag LOCUS_58020 gene sigJ 2691 1789 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029962.1 protein_id gnl|my_center|LOCUS_58020 2851 3975 gene locus_tag LOCUS_58030 2851 3975 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896840.1 protein_id gnl|my_center|LOCUS_58030 4531 3935 gene locus_tag LOCUS_58040 4531 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 7612 4727 gene locus_tag LOCUS_58050 7612 4727 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_58050 7950 7735 gene locus_tag LOCUS_58060 7950 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 11061 8002 gene locus_tag LOCUS_58070 11061 8002 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_58070 11302 11910 gene locus_tag LOCUS_58080 11302 11910 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226659.1 protein_id gnl|my_center|LOCUS_58080 11966 12580 gene locus_tag LOCUS_58090 11966 12580 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 protein_id gnl|my_center|LOCUS_58090 12594 14813 gene locus_tag LOCUS_58100 12594 14813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 14810 15979 gene locus_tag LOCUS_58110 14810 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 16492 15983 gene locus_tag LOCUS_58120 16492 15983 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_58120 16566 18521 gene locus_tag LOCUS_58130 16566 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 18592 19614 gene locus_tag LOCUS_58140 18592 19614 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909511.1 protein_id gnl|my_center|LOCUS_58140 20209 19592 gene locus_tag LOCUS_58150 20209 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 20299 21192 gene locus_tag LOCUS_58160 20299 21192 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_58160 21217 22254 gene locus_tag LOCUS_58170 gene uxuA 21217 22254 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705361.1 protein_id gnl|my_center|LOCUS_58170 22306 23385 gene locus_tag LOCUS_58180 22306 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 24871 23372 gene locus_tag LOCUS_58190 24871 23372 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_58190 25708 24875 gene locus_tag LOCUS_58200 25708 24875 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776907.1 protein_id gnl|my_center|LOCUS_58200 26597 25710 gene locus_tag LOCUS_58210 26597 25710 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089403226.1 protein_id gnl|my_center|LOCUS_58210 27941 26619 gene locus_tag LOCUS_58220 27941 26619 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776909.1 protein_id gnl|my_center|LOCUS_58220 29534 28041 gene locus_tag LOCUS_58230 29534 28041 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226513.1 protein_id gnl|my_center|LOCUS_58230 29607 30188 gene locus_tag LOCUS_58240 29607 30188 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728980.1 protein_id gnl|my_center|LOCUS_58240 31091 30174 gene locus_tag LOCUS_58250 31091 30174 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_58250 31175 31735 gene locus_tag LOCUS_58260 31175 31735 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 protein_id gnl|my_center|LOCUS_58260 32561 31725 gene locus_tag LOCUS_58270 32561 31725 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 protein_id gnl|my_center|LOCUS_58270 32751 33665 gene locus_tag LOCUS_58280 32751 33665 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228428.1 protein_id gnl|my_center|LOCUS_58280 33674 34324 gene locus_tag LOCUS_58290 33674 34324 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977095.1 protein_id gnl|my_center|LOCUS_58290 34679 34984 gene locus_tag LOCUS_58300 34679 34984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 35265 36233 gene locus_tag LOCUS_58310 35265 36233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467269.1 protein_id gnl|my_center|LOCUS_58310 39448 36218 gene locus_tag LOCUS_58320 39448 36218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 42440 39606 gene locus_tag LOCUS_58330 42440 39606 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477744.1 protein_id gnl|my_center|LOCUS_58330 42986 44116 gene locus_tag LOCUS_58340 42986 44116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 46222 44090 gene locus_tag LOCUS_58350 46222 44090 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_58350 46840 47727 gene locus_tag LOCUS_58360 46840 47727 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227669.1 protein_id gnl|my_center|LOCUS_58360 47800 50349 gene locus_tag LOCUS_58370 47800 50349 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075138131.1 protein_id gnl|my_center|LOCUS_58370 50346 52076 gene locus_tag LOCUS_58380 gene irtB 50346 52076 CDS product iron ABC transporter ATP-binding protein/permease IrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900322.1 protein_id gnl|my_center|LOCUS_58380 52596 52066 gene locus_tag LOCUS_58390 52596 52066 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228717.1 protein_id gnl|my_center|LOCUS_58390 53779 52634 gene locus_tag LOCUS_58400 53779 52634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 55338 53983 gene locus_tag LOCUS_58410 55338 53983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 55513 58074 gene locus_tag LOCUS_58420 55513 58074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 58654 58046 gene locus_tag LOCUS_58430 58654 58046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 59400 58648 gene locus_tag LOCUS_58440 59400 58648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 59446 60696 gene locus_tag LOCUS_58450 59446 60696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086251.1 protein_id gnl|my_center|LOCUS_58450 >Feature sequence32 173 3628 gene locus_tag LOCUS_58460 173 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 3625 4623 gene locus_tag LOCUS_58470 3625 4623 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 protein_id gnl|my_center|LOCUS_58470 4628 4798 gene locus_tag LOCUS_58480 4628 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 4802 5599 gene locus_tag LOCUS_58490 4802 5599 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_58490 5596 6483 gene locus_tag LOCUS_58500 5596 6483 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_58500 6574 8346 gene locus_tag LOCUS_58510 gene recN 6574 8346 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467394.1 protein_id gnl|my_center|LOCUS_58510 8471 9655 gene locus_tag LOCUS_58520 gene steA 8471 9655 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286379.1 protein_id gnl|my_center|LOCUS_58520 9652 10593 gene locus_tag LOCUS_58530 9652 10593 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_58530 10652 12436 gene locus_tag LOCUS_58540 10652 12436 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063606961.1 protein_id gnl|my_center|LOCUS_58540 12433 13074 gene locus_tag LOCUS_58550 12433 13074 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227807.1 protein_id gnl|my_center|LOCUS_58550 14519 13071 gene locus_tag LOCUS_58560 gene eat 14519 13071 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114906.1 protein_id gnl|my_center|LOCUS_58560 14664 16028 gene locus_tag LOCUS_58570 14664 16028 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876257.1 protein_id gnl|my_center|LOCUS_58570 16009 16716 gene locus_tag LOCUS_58580 16009 16716 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908409.1 protein_id gnl|my_center|LOCUS_58580 16713 18080 gene locus_tag LOCUS_58590 16713 18080 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223703.1 protein_id gnl|my_center|LOCUS_58590 18077 18841 gene locus_tag LOCUS_58600 18077 18841 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223704.1 protein_id gnl|my_center|LOCUS_58600 18841 19572 gene locus_tag LOCUS_58610 18841 19572 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466719.1 protein_id gnl|my_center|LOCUS_58610 20042 19569 gene locus_tag LOCUS_58620 20042 19569 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227806.1 protein_id gnl|my_center|LOCUS_58620 20164 21096 gene locus_tag LOCUS_58630 gene xerD 20164 21096 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286377.1 protein_id gnl|my_center|LOCUS_58630 21227 22165 gene locus_tag LOCUS_58640 21227 22165 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_58640 22162 22500 gene locus_tag LOCUS_58650 22162 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227803.1 protein_id gnl|my_center|LOCUS_58650 22507 23331 gene locus_tag LOCUS_58660 22507 23331 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227802.1 protein_id gnl|my_center|LOCUS_58660 23328 24200 gene locus_tag LOCUS_58670 23328 24200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 24190 24924 gene locus_tag LOCUS_58680 24190 24924 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227800.1 protein_id gnl|my_center|LOCUS_58680 24924 26081 gene locus_tag LOCUS_58690 24924 26081 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225994.1 protein_id gnl|my_center|LOCUS_58690 27259 26078 gene locus_tag LOCUS_58700 27259 26078 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227797.1 protein_id gnl|my_center|LOCUS_58700 27751 27266 gene locus_tag LOCUS_58710 27751 27266 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_58710 27843 29207 gene locus_tag LOCUS_58720 27843 29207 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_58720 30306 29212 gene locus_tag LOCUS_58730 30306 29212 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230094.1 protein_id gnl|my_center|LOCUS_58730 30737 30303 gene locus_tag LOCUS_58740 30737 30303 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_58740 31525 30698 gene locus_tag LOCUS_58750 31525 30698 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228734.1 protein_id gnl|my_center|LOCUS_58750 32208 31522 gene locus_tag LOCUS_58760 32208 31522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228733.1 protein_id gnl|my_center|LOCUS_58760 33752 32205 gene locus_tag LOCUS_58770 33752 32205 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228732.1 protein_id gnl|my_center|LOCUS_58770 34492 33752 gene locus_tag LOCUS_58780 34492 33752 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228731.1 protein_id gnl|my_center|LOCUS_58780 36543 34489 gene locus_tag LOCUS_58790 36543 34489 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230093.1 protein_id gnl|my_center|LOCUS_58790 37364 36543 gene locus_tag LOCUS_58800 37364 36543 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030940.1 protein_id gnl|my_center|LOCUS_58800 37421 38239 gene locus_tag LOCUS_58810 37421 38239 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228730.1 protein_id gnl|my_center|LOCUS_58810 38243 39058 gene locus_tag LOCUS_58820 38243 39058 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_58820 39055 40254 gene locus_tag LOCUS_58830 39055 40254 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_58830 40817 40251 gene locus_tag LOCUS_58840 40817 40251 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_58840 40992 41723 gene locus_tag LOCUS_58850 gene cmk 40992 41723 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227793.1 protein_id gnl|my_center|LOCUS_58850 41717 42364 gene locus_tag LOCUS_58860 41717 42364 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227792.1 protein_id gnl|my_center|LOCUS_58860 42380 43792 gene locus_tag LOCUS_58870 gene der 42380 43792 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467391.1 protein_id gnl|my_center|LOCUS_58870 43846 43921 gene locus_tag LOCUS_t00570 43846 43921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44229 44420 gene locus_tag LOCUS_58880 44229 44420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 45377 44397 gene locus_tag LOCUS_58890 45377 44397 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223366.1 protein_id gnl|my_center|LOCUS_58890 45908 46357 gene locus_tag LOCUS_58900 45908 46357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 47583 47233 gene locus_tag LOCUS_58910 47583 47233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 47669 48073 gene locus_tag LOCUS_58920 47669 48073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 48590 49162 gene locus_tag LOCUS_58930 48590 49162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 49409 50791 gene locus_tag LOCUS_58940 49409 50791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 51225 51019 gene locus_tag LOCUS_58950 51225 51019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 51282 51761 gene locus_tag LOCUS_58960 51282 51761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 52225 51782 gene locus_tag LOCUS_58970 52225 51782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 52513 52235 gene locus_tag LOCUS_58980 52513 52235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 54069 52510 gene locus_tag LOCUS_58990 54069 52510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 54433 54062 gene locus_tag LOCUS_59000 54433 54062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 54648 54436 gene locus_tag LOCUS_59010 54648 54436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 55599 55051 gene locus_tag LOCUS_59020 55599 55051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 55712 56227 gene locus_tag LOCUS_59030 55712 56227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 57155 57535 gene locus_tag LOCUS_59040 57155 57535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 57784 57951 gene locus_tag LOCUS_59050 57784 57951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 58293 58628 gene locus_tag LOCUS_59060 58293 58628 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410200.1 protein_id gnl|my_center|LOCUS_59060 58625 59107 gene locus_tag LOCUS_59070 58625 59107 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899141.1 protein_id gnl|my_center|LOCUS_59070 59109 59567 gene locus_tag LOCUS_59080 59109 59567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 60111 60284 gene locus_tag LOCUS_59090 60111 60284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 >Feature sequence33 313 1140 gene locus_tag LOCUS_59100 313 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 2178 1327 gene locus_tag LOCUS_59110 2178 1327 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230708.1 protein_id gnl|my_center|LOCUS_59110 2837 2355 gene locus_tag LOCUS_59120 2837 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 4017 2884 gene locus_tag LOCUS_59130 gene dusB 4017 2884 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230697.1 protein_id gnl|my_center|LOCUS_59130 4100 4759 gene locus_tag LOCUS_59140 4100 4759 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977728.1 protein_id gnl|my_center|LOCUS_59140 4807 5292 gene locus_tag LOCUS_59150 4807 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 5307 6032 gene locus_tag LOCUS_59160 5307 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 6070 6558 gene locus_tag LOCUS_59170 6070 6558 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677243.1 protein_id gnl|my_center|LOCUS_59170 7178 6561 gene locus_tag LOCUS_59180 7178 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 7781 7275 gene locus_tag LOCUS_59190 7781 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150070773.1 protein_id gnl|my_center|LOCUS_59190 7809 8435 gene locus_tag LOCUS_59200 7809 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 9025 8453 gene locus_tag LOCUS_59210 9025 8453 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222191.1 protein_id gnl|my_center|LOCUS_59210 9181 10344 gene locus_tag LOCUS_59220 9181 10344 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222192.1 protein_id gnl|my_center|LOCUS_59220 11597 10617 gene locus_tag LOCUS_59230 11597 10617 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222193.1 protein_id gnl|my_center|LOCUS_59230 11760 13292 gene locus_tag LOCUS_59240 11760 13292 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_59240 13788 14264 gene locus_tag LOCUS_59250 13788 14264 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742106.1 protein_id gnl|my_center|LOCUS_59250 14287 14372 gene locus_tag LOCUS_t00580 14287 14372 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15847 14471 gene locus_tag LOCUS_59260 15847 14471 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183125562.1 protein_id gnl|my_center|LOCUS_59260 16363 15920 gene locus_tag LOCUS_59270 16363 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 16492 16932 gene locus_tag LOCUS_59280 16492 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 16929 17270 gene locus_tag LOCUS_59290 16929 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 17267 18682 gene locus_tag LOCUS_59300 17267 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 18953 19138 gene locus_tag LOCUS_59310 18953 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 19135 19368 gene locus_tag LOCUS_59320 19135 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 19841 20032 gene locus_tag LOCUS_59330 19841 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59330 20032 20559 gene locus_tag LOCUS_59340 20032 20559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 20549 20719 gene locus_tag LOCUS_59350 20549 20719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 20722 21270 gene locus_tag LOCUS_59360 20722 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 21361 21768 gene locus_tag LOCUS_59370 21361 21768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224064.1 protein_id gnl|my_center|LOCUS_59370 21878 21690 gene locus_tag LOCUS_59380 21878 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 22012 22263 gene locus_tag LOCUS_59390 22012 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 23502 22303 gene locus_tag LOCUS_59400 23502 22303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59400 23656 24426 gene locus_tag LOCUS_59410 23656 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 24813 24466 gene locus_tag LOCUS_59420 24813 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 25017 24829 gene locus_tag LOCUS_59430 25017 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 25707 26635 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgcgccggccctccgggaccggcgaggatcgcaac 28015 26693 gene locus_tag LOCUS_59440 28015 26693 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_59440 28301 28017 gene locus_tag LOCUS_59450 28301 28017 CDS product excisionase family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477090.1 protein_id gnl|my_center|LOCUS_59450 29008 28298 gene locus_tag LOCUS_59460 29008 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 29832 31829 gene locus_tag LOCUS_59470 29832 31829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776109.1 protein_id gnl|my_center|LOCUS_59470 31981 32463 gene locus_tag LOCUS_59480 31981 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_59480 32648 32472 gene locus_tag LOCUS_59490 32648 32472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 33091 33660 gene locus_tag LOCUS_59500 33091 33660 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_59500 34650 33685 gene locus_tag LOCUS_59510 34650 33685 CDS product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203909262.1 protein_id gnl|my_center|LOCUS_59510 35391 34726 gene locus_tag LOCUS_59520 35391 34726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 36261 35446 gene locus_tag LOCUS_59530 36261 35446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 36399 38567 gene locus_tag LOCUS_59540 gene helR 36399 38567 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081619.1 protein_id gnl|my_center|LOCUS_59540 38765 39139 gene locus_tag LOCUS_59550 38765 39139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59550 39078 40817 gene locus_tag LOCUS_59560 39078 40817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59560 41065 40814 gene locus_tag LOCUS_59570 41065 40814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 41187 41330 gene locus_tag LOCUS_59580 41187 41330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 41350 42084 gene locus_tag LOCUS_59590 41350 42084 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181773352.1 protein_id gnl|my_center|LOCUS_59590 42081 42914 gene locus_tag LOCUS_59600 42081 42914 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223086.1 protein_id gnl|my_center|LOCUS_59600 42934 44277 gene locus_tag LOCUS_59610 42934 44277 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223087.1 protein_id gnl|my_center|LOCUS_59610 44338 45783 gene locus_tag LOCUS_59620 44338 45783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59620 45846 45921 gene locus_tag LOCUS_t00590 45846 45921 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 46003 46224 gene locus_tag LOCUS_59630 46003 46224 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402915.1 protein_id gnl|my_center|LOCUS_59630 46221 46664 gene locus_tag LOCUS_59640 46221 46664 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_59640 47603 46719 gene locus_tag LOCUS_59650 47603 46719 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_59650 47979 47773 gene locus_tag LOCUS_59660 47979 47773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 48993 48079 gene locus_tag LOCUS_59670 48993 48079 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905435.1 protein_id gnl|my_center|LOCUS_59670 49152 49508 gene locus_tag LOCUS_59680 49152 49508 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_59680 49952 49539 gene locus_tag LOCUS_59690 49952 49539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 50997 50002 gene locus_tag LOCUS_59700 50997 50002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 53794 51029 gene locus_tag LOCUS_59710 53794 51029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 53875 55242 gene locus_tag LOCUS_59720 53875 55242 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028409.1 protein_id gnl|my_center|LOCUS_59720 55239 56444 gene locus_tag LOCUS_59730 55239 56444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222038.1 protein_id gnl|my_center|LOCUS_59730 56586 58097 gene locus_tag LOCUS_59740 56586 58097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 58067 58348 gene locus_tag LOCUS_59750 58067 58348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 >Feature sequence34 990 1979 gene locus_tag LOCUS_59760 990 1979 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 protein_id gnl|my_center|LOCUS_59760 2306 1965 gene locus_tag LOCUS_59770 2306 1965 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230896.1 protein_id gnl|my_center|LOCUS_59770 2313 3320 gene locus_tag LOCUS_59780 2313 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 4167 3310 gene locus_tag LOCUS_59790 4167 3310 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_59790 8439 4216 gene locus_tag LOCUS_59800 8439 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 9535 8624 gene locus_tag LOCUS_59810 9535 8624 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_59810 10386 9553 gene locus_tag LOCUS_59820 10386 9553 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224394.1 protein_id gnl|my_center|LOCUS_59820 11540 10377 gene locus_tag LOCUS_59830 11540 10377 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_59830 11657 12352 gene locus_tag LOCUS_59840 11657 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 14103 12355 gene locus_tag LOCUS_59850 14103 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 14177 15850 gene locus_tag LOCUS_59860 gene kstD 14177 15850 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224391.1 protein_id gnl|my_center|LOCUS_59860 15847 16977 gene locus_tag LOCUS_59870 15847 16977 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224390.1 protein_id gnl|my_center|LOCUS_59870 16974 17333 gene locus_tag LOCUS_59880 16974 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 17326 18348 gene locus_tag LOCUS_59890 17326 18348 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224388.1 protein_id gnl|my_center|LOCUS_59890 18357 19214 gene locus_tag LOCUS_59900 18357 19214 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_59900 20244 19207 gene locus_tag LOCUS_59910 20244 19207 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228834.1 protein_id gnl|my_center|LOCUS_59910 20278 20751 gene locus_tag LOCUS_59920 20278 20751 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972016.1 protein_id gnl|my_center|LOCUS_59920 21526 20804 gene locus_tag LOCUS_59930 21526 20804 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_59930 22194 21556 gene locus_tag LOCUS_59940 22194 21556 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230170.1 protein_id gnl|my_center|LOCUS_59940 23614 22262 gene locus_tag LOCUS_59950 gene accC 23614 22262 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_59950 24155 23625 gene locus_tag LOCUS_59960 24155 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 25854 24160 gene locus_tag LOCUS_59970 25854 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 26384 25950 gene locus_tag LOCUS_59980 26384 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59980 26534 27859 gene locus_tag LOCUS_59990 26534 27859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 protein_id gnl|my_center|LOCUS_59990 29644 27860 gene locus_tag LOCUS_60000 29644 27860 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228529.1 protein_id gnl|my_center|LOCUS_60000 30792 29641 gene locus_tag LOCUS_60010 30792 29641 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228528.1 protein_id gnl|my_center|LOCUS_60010 32418 30997 gene locus_tag LOCUS_60020 32418 30997 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876236.1 protein_id gnl|my_center|LOCUS_60020 33148 32432 gene locus_tag LOCUS_60030 33148 32432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230642.1 protein_id gnl|my_center|LOCUS_60030 33283 33789 gene locus_tag LOCUS_60040 33283 33789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 34874 33795 gene locus_tag LOCUS_60050 34874 33795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 35738 35016 gene locus_tag LOCUS_60060 35738 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 36610 35735 gene locus_tag LOCUS_60070 36610 35735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 protein_id gnl|my_center|LOCUS_60070 36996 36613 gene locus_tag LOCUS_60080 36996 36613 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_60080 37142 38017 gene locus_tag LOCUS_60090 37142 38017 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_60090 38058 39464 gene locus_tag LOCUS_60100 38058 39464 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_60100 41108 39582 gene locus_tag LOCUS_60110 41108 39582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 41214 42047 gene locus_tag LOCUS_60120 41214 42047 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230452.1 protein_id gnl|my_center|LOCUS_60120 42423 42037 gene locus_tag LOCUS_60130 42423 42037 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225795.1 protein_id gnl|my_center|LOCUS_60130 42526 43605 gene locus_tag LOCUS_60140 42526 43605 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_60140 43602 44198 gene locus_tag LOCUS_60150 43602 44198 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_60150 44742 44293 gene locus_tag LOCUS_60160 44742 44293 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230930.1 protein_id gnl|my_center|LOCUS_60160 44886 46496 gene locus_tag LOCUS_60170 gene boxC 44886 46496 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_60170 46498 47916 gene locus_tag LOCUS_60180 gene boxB 46498 47916 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_60180 47943 49544 gene locus_tag LOCUS_60190 47943 49544 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_60190 50185 49622 gene locus_tag LOCUS_60200 50185 49622 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226551.1 protein_id gnl|my_center|LOCUS_60200 51441 50725 gene locus_tag LOCUS_60210 51441 50725 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226783.1 protein_id gnl|my_center|LOCUS_60210 52346 51438 gene locus_tag LOCUS_60220 52346 51438 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_60220 52538 52912 gene locus_tag LOCUS_60230 52538 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 52927 53175 gene locus_tag LOCUS_60240 52927 53175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 54237 53389 gene locus_tag LOCUS_60250 54237 53389 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081655931.1 protein_id gnl|my_center|LOCUS_60250 54899 54354 gene locus_tag LOCUS_60260 54899 54354 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_60260 55192 54956 gene locus_tag LOCUS_60270 55192 54956 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_60270 56048 55197 gene locus_tag LOCUS_60280 56048 55197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_60280 57007 56045 gene locus_tag LOCUS_60290 57007 56045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_60290 57883 57071 gene locus_tag LOCUS_60300 57883 57071 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189433.1 protein_id gnl|my_center|LOCUS_60300 58691 57891 gene locus_tag LOCUS_60310 58691 57891 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 protein_id gnl|my_center|LOCUS_60310 60019 58688 gene locus_tag LOCUS_60320 60019 58688 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 protein_id gnl|my_center|LOCUS_60320 60137 61084 gene locus_tag LOCUS_60330 60137 61084 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_60330 61145 62161 gene locus_tag LOCUS_60340 61145 62161 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_60340 62385 62170 gene locus_tag LOCUS_60350 62385 62170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60350 63476 62682 gene locus_tag LOCUS_60360 63476 62682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 65986 63473 gene locus_tag LOCUS_60370 65986 63473 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226543.1 protein_id gnl|my_center|LOCUS_60370 66790 65999 gene locus_tag LOCUS_60380 66790 65999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226542.1 protein_id gnl|my_center|LOCUS_60380 67740 66787 gene locus_tag LOCUS_60390 67740 66787 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_60390 67808 68608 gene locus_tag LOCUS_60400 67808 68608 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_60400 68765 69379 gene locus_tag LOCUS_60410 68765 69379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 69376 69894 gene locus_tag LOCUS_60420 69376 69894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 71193 70354 gene locus_tag LOCUS_60430 71193 70354 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229849.1 protein_id gnl|my_center|LOCUS_60430 71296 71775 gene locus_tag LOCUS_60440 71296 71775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 73146 72481 gene locus_tag LOCUS_60450 73146 72481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 73501 73223 gene locus_tag LOCUS_60460 73501 73223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 73751 73524 gene locus_tag LOCUS_60470 73751 73524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 74214 73801 gene locus_tag LOCUS_60480 74214 73801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224064.1 protein_id gnl|my_center|LOCUS_60480 74303 75130 gene locus_tag LOCUS_60490 74303 75130 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831648.1 protein_id gnl|my_center|LOCUS_60490 75127 75294 gene locus_tag LOCUS_60500 75127 75294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 75388 75552 gene locus_tag LOCUS_60510 75388 75552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 76373 75549 gene locus_tag LOCUS_60520 76373 75549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 76490 77380 gene locus_tag LOCUS_60530 76490 77380 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_60530 77463 79724 gene locus_tag LOCUS_60540 77463 79724 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_60540 79779 81680 gene locus_tag LOCUS_60550 79779 81680 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_60550 81677 82720 gene locus_tag LOCUS_60560 81677 82720 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_60560 82836 82717 gene locus_tag LOCUS_60570 82836 82717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 83052 83561 gene locus_tag LOCUS_60580 83052 83561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 83620 84495 gene locus_tag LOCUS_60590 83620 84495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 84510 85004 gene locus_tag LOCUS_60600 gene actVB 84510 85004 CDS product actinorhodin polyketide dimerase ActVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973886.1 protein_id gnl|my_center|LOCUS_60600 85117 86916 gene locus_tag LOCUS_60610 gene fadD11 85117 86916 CDS product fatty acid--CoA ligase FadD11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083132908.1 protein_id gnl|my_center|LOCUS_60610 87155 87676 gene locus_tag LOCUS_60620 87155 87676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 88577 87762 gene locus_tag LOCUS_60630 88577 87762 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224747.1 protein_id gnl|my_center|LOCUS_60630 89147 88587 gene locus_tag LOCUS_60640 89147 88587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143060529.1 protein_id gnl|my_center|LOCUS_60640 89199 90371 gene locus_tag LOCUS_60650 89199 90371 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_60650 90442 91128 gene locus_tag LOCUS_60660 90442 91128 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228838.1 protein_id gnl|my_center|LOCUS_60660 91143 92402 gene locus_tag LOCUS_60670 91143 92402 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228837.1 protein_id gnl|my_center|LOCUS_60670 92755 93615 gene locus_tag LOCUS_60680 92755 93615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 94062 93583 gene locus_tag LOCUS_60690 94062 93583 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_60690 94024 94950 gene locus_tag LOCUS_60700 94024 94950 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229677.1 protein_id gnl|my_center|LOCUS_60700 96062 95046 gene locus_tag LOCUS_60710 96062 95046 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228701.1 protein_id gnl|my_center|LOCUS_60710 96191 96931 gene locus_tag LOCUS_60720 96191 96931 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_60720 97018 100884 gene locus_tag LOCUS_60730 97018 100884 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_60730 100886 101758 gene locus_tag LOCUS_60740 100886 101758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_60740 101771 102799 gene locus_tag LOCUS_60750 101771 102799 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286161.1 protein_id gnl|my_center|LOCUS_60750 102799 103584 gene locus_tag LOCUS_60760 102799 103584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728488.1 protein_id gnl|my_center|LOCUS_60760 103611 104771 gene locus_tag LOCUS_60770 103611 104771 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_60770 105052 106218 gene locus_tag LOCUS_60780 105052 106218 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_60780 106381 107175 gene locus_tag LOCUS_60790 106381 107175 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_60790 107277 107678 gene locus_tag LOCUS_60800 107277 107678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60800 107779 108348 gene locus_tag LOCUS_60810 107779 108348 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080300.1 protein_id gnl|my_center|LOCUS_60810 108813 108316 gene locus_tag LOCUS_60820 108813 108316 CDS product DUF6228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108989910.1 protein_id gnl|my_center|LOCUS_60820 109766 108813 gene locus_tag LOCUS_60830 109766 108813 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028255.1 protein_id gnl|my_center|LOCUS_60830 110025 110825 gene locus_tag LOCUS_60840 110025 110825 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_60840 110801 110983 gene locus_tag LOCUS_60850 110801 110983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60850 111002 111607 gene locus_tag LOCUS_60860 111002 111607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_60860 111604 112998 gene locus_tag LOCUS_60870 111604 112998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230955.1 protein_id gnl|my_center|LOCUS_60870 113182 114975 gene locus_tag LOCUS_60880 gene ctaD 113182 114975 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_60880 114979 116205 gene locus_tag LOCUS_60890 gene serB 114979 116205 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229475.1 protein_id gnl|my_center|LOCUS_60890 116202 116957 gene locus_tag LOCUS_60900 116202 116957 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_60900 117731 116973 gene locus_tag LOCUS_60910 117731 116973 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_60910 117798 118532 gene locus_tag LOCUS_60920 117798 118532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 119994 118579 gene locus_tag LOCUS_60930 119994 118579 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_60930 121524 120010 gene locus_tag LOCUS_60940 121524 120010 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_60940 124673 121680 gene locus_tag LOCUS_60950 124673 121680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 125015 124695 gene locus_tag LOCUS_60960 125015 124695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229471.1 protein_id gnl|my_center|LOCUS_60960 127068 125035 gene locus_tag LOCUS_60970 127068 125035 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_60970 127726 127121 gene locus_tag LOCUS_60980 127726 127121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 128286 127723 gene locus_tag LOCUS_60990 128286 127723 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_60990 128912 128337 gene locus_tag LOCUS_61000 128912 128337 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_61000 130218 128926 gene locus_tag LOCUS_61010 130218 128926 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229465.1 protein_id gnl|my_center|LOCUS_61010 130217 130576 gene locus_tag LOCUS_61020 gene clpS 130217 130576 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229464.1 protein_id gnl|my_center|LOCUS_61020 130573 131136 gene locus_tag LOCUS_61030 130573 131136 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229463.1 protein_id gnl|my_center|LOCUS_61030 131126 132154 gene locus_tag LOCUS_61040 131126 132154 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229462.1 protein_id gnl|my_center|LOCUS_61040 132164 132589 gene locus_tag LOCUS_61050 132164 132589 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084685.1 protein_id gnl|my_center|LOCUS_61050 132653 132925 gene locus_tag LOCUS_61060 132653 132925 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_61060 132931 133881 gene locus_tag LOCUS_61070 132931 133881 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229459.1 protein_id gnl|my_center|LOCUS_61070 133966 134577 gene locus_tag LOCUS_61080 133966 134577 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229455.1 protein_id gnl|my_center|LOCUS_61080 134517 135323 gene locus_tag LOCUS_61090 gene murI 134517 135323 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467674.1 protein_id gnl|my_center|LOCUS_61090 137108 135966 gene locus_tag LOCUS_61100 137108 135966 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 protein_id gnl|my_center|LOCUS_61100 137199 137954 gene locus_tag LOCUS_61110 gene rph 137199 137954 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229452.1 protein_id gnl|my_center|LOCUS_61110 137951 138550 gene locus_tag LOCUS_61120 gene rdgB 137951 138550 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229451.1 protein_id gnl|my_center|LOCUS_61120 139178 138561 gene locus_tag LOCUS_61130 139178 138561 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_61130 140126 139248 gene locus_tag LOCUS_61140 140126 139248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222267.1 protein_id gnl|my_center|LOCUS_61140 140724 140251 gene locus_tag LOCUS_61150 gene bcp 140724 140251 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_61150 141282 140758 gene locus_tag LOCUS_61160 141282 140758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 141636 141460 gene locus_tag LOCUS_61170 141636 141460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 142844 141657 gene locus_tag LOCUS_61180 142844 141657 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222508.1 protein_id gnl|my_center|LOCUS_61180 142963 143038 gene locus_tag LOCUS_t00600 142963 143038 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 144767 143076 gene locus_tag LOCUS_61190 144767 143076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 145501 147174 gene locus_tag LOCUS_61200 145501 147174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 147202 148065 gene locus_tag LOCUS_61210 147202 148065 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224644.1 protein_id gnl|my_center|LOCUS_61210 148588 148028 gene locus_tag LOCUS_61220 148588 148028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 149617 148904 gene locus_tag LOCUS_61230 149617 148904 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_61230 150421 149762 gene locus_tag LOCUS_61240 150421 149762 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_61240 150564 151649 gene locus_tag LOCUS_61250 150564 151649 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_61250 152719 152174 gene locus_tag LOCUS_61260 152719 152174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 153508 152999 gene locus_tag LOCUS_61270 153508 152999 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229692.1 protein_id gnl|my_center|LOCUS_61270 154172 153672 gene locus_tag LOCUS_61280 154172 153672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 154573 154169 gene locus_tag LOCUS_61290 154573 154169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61290 154788 154567 gene locus_tag LOCUS_61300 154788 154567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61300 156194 154776 gene locus_tag LOCUS_61310 156194 154776 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782908.1 protein_id gnl|my_center|LOCUS_61310 156885 156244 gene locus_tag LOCUS_61320 156885 156244 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742240.1 protein_id gnl|my_center|LOCUS_61320 159304 156872 gene locus_tag LOCUS_61330 159304 156872 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223386.1 protein_id gnl|my_center|LOCUS_61330 162099 159301 gene locus_tag LOCUS_61340 162099 159301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 162362 163384 gene locus_tag LOCUS_61350 162362 163384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 163499 165316 gene locus_tag LOCUS_61360 163499 165316 CDS product isoniazid inducible protein IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193353532.1 protein_id gnl|my_center|LOCUS_61360 165313 166749 gene locus_tag LOCUS_61370 165313 166749 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 protein_id gnl|my_center|LOCUS_61370 166820 167041 gene locus_tag LOCUS_61380 166820 167041 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559246.1 protein_id gnl|my_center|LOCUS_61380 167447 167034 gene locus_tag LOCUS_61390 167447 167034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467672.1 protein_id gnl|my_center|LOCUS_61390 168118 167528 gene locus_tag LOCUS_61400 168118 167528 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229440.1 protein_id gnl|my_center|LOCUS_61400 168219 169703 gene locus_tag LOCUS_61410 168219 169703 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_61410 170182 169700 gene locus_tag LOCUS_61420 170182 169700 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229438.1 protein_id gnl|my_center|LOCUS_61420 171794 170352 gene locus_tag LOCUS_61430 171794 170352 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229437.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61430 174470 172263 gene locus_tag LOCUS_61440 174470 172263 CDS product phospholipase A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229436.1 protein_id gnl|my_center|LOCUS_61440 175826 174582 gene locus_tag LOCUS_61450 175826 174582 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229434.1 protein_id gnl|my_center|LOCUS_61450 177527 176295 gene locus_tag LOCUS_61460 177527 176295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229433.1 protein_id gnl|my_center|LOCUS_61460 177996 179144 gene locus_tag LOCUS_61470 177996 179144 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229631.1 protein_id gnl|my_center|LOCUS_61470 179141 179830 gene locus_tag LOCUS_61480 179141 179830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 protein_id gnl|my_center|LOCUS_61480 179873 182002 gene locus_tag LOCUS_61490 179873 182002 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229633.1 protein_id gnl|my_center|LOCUS_61490 182110 183333 gene locus_tag LOCUS_61500 182110 183333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 183394 183759 gene locus_tag LOCUS_61510 183394 183759 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029168.1 protein_id gnl|my_center|LOCUS_61510 186936 183763 gene locus_tag LOCUS_61520 186936 183763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 188207 186999 gene locus_tag LOCUS_61530 188207 186999 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_61530 189458 188283 gene locus_tag LOCUS_61540 189458 188283 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_61540 189537 190868 gene locus_tag LOCUS_61550 189537 190868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 protein_id gnl|my_center|LOCUS_61550 191422 190901 gene locus_tag LOCUS_61560 191422 190901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 192180 191419 gene locus_tag LOCUS_61570 192180 191419 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223420.1 protein_id gnl|my_center|LOCUS_61570 193354 192233 gene locus_tag LOCUS_61580 gene ispG 193354 192233 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_61580 195111 193351 gene locus_tag LOCUS_61590 195111 193351 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417910.1 protein_id gnl|my_center|LOCUS_61590 196040 195108 gene locus_tag LOCUS_61600 gene ispH 196040 195108 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417912.1 protein_id gnl|my_center|LOCUS_61600 197110 196073 gene locus_tag LOCUS_61610 197110 196073 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134732678.1 protein_id gnl|my_center|LOCUS_61610 198509 197112 gene locus_tag LOCUS_61620 198509 197112 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_61620 199934 198516 gene locus_tag LOCUS_61630 199934 198516 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_61630 200639 200382 gene locus_tag LOCUS_61640 200639 200382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 200747 201616 gene locus_tag LOCUS_61650 200747 201616 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_61650 202671 201622 gene locus_tag LOCUS_61660 202671 201622 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742196.1 protein_id gnl|my_center|LOCUS_61660 202696 203583 gene locus_tag LOCUS_61670 gene oxyR 202696 203583 CDS product hydrogen peroxide-inducible genes activator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887260.1 protein_id gnl|my_center|LOCUS_61670 203580 204443 gene locus_tag LOCUS_61680 203580 204443 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_61680 204440 207196 gene locus_tag LOCUS_61690 204440 207196 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_61690 207233 207643 gene locus_tag LOCUS_61700 207233 207643 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224900.1 protein_id gnl|my_center|LOCUS_61700 208986 207724 gene locus_tag LOCUS_61710 208986 207724 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 protein_id gnl|my_center|LOCUS_61710 210516 209140 gene locus_tag LOCUS_61720 210516 209140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143229435.1 protein_id gnl|my_center|LOCUS_61720 211940 210723 gene locus_tag LOCUS_61730 211940 210723 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228689.1 protein_id gnl|my_center|LOCUS_61730 212232 212384 gene locus_tag LOCUS_61740 212232 212384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 212430 214193 gene locus_tag LOCUS_61750 212430 214193 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_61750 214190 214915 gene locus_tag LOCUS_61760 214190 214915 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228687.1 protein_id gnl|my_center|LOCUS_61760 217710 215107 gene locus_tag LOCUS_61770 217710 215107 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228686.1 protein_id gnl|my_center|LOCUS_61770 218253 217759 gene locus_tag LOCUS_61780 218253 217759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223700.1 protein_id gnl|my_center|LOCUS_61780 219318 218362 gene locus_tag LOCUS_61790 219318 218362 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_61790 219349 220311 gene locus_tag LOCUS_61800 219349 220311 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224591.1 protein_id gnl|my_center|LOCUS_61800 221359 220400 gene locus_tag LOCUS_61810 221359 220400 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_61810 221669 221364 gene locus_tag LOCUS_61820 221669 221364 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 protein_id gnl|my_center|LOCUS_61820 222227 221811 gene locus_tag LOCUS_61830 222227 221811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_61830 222600 222220 gene locus_tag LOCUS_61840 222600 222220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222284.1 protein_id gnl|my_center|LOCUS_61840 222637 222873 gene locus_tag LOCUS_61850 222637 222873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 223616 222870 gene locus_tag LOCUS_61860 223616 222870 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_61860 224192 223683 gene locus_tag LOCUS_61870 224192 223683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 225204 224236 gene locus_tag LOCUS_61880 225204 224236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314014.1 protein_id gnl|my_center|LOCUS_61880 226084 225512 gene locus_tag LOCUS_61890 226084 225512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 226501 227184 gene locus_tag LOCUS_61900 226501 227184 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027773.1 protein_id gnl|my_center|LOCUS_61900 227533 228156 gene locus_tag LOCUS_61910 227533 228156 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229111.1 protein_id gnl|my_center|LOCUS_61910 228157 229347 gene locus_tag LOCUS_61920 228157 229347 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_61920 233114 229503 gene locus_tag LOCUS_61930 233114 229503 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 protein_id gnl|my_center|LOCUS_61930 234424 233111 gene locus_tag LOCUS_61940 234424 233111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_61940 234531 234923 gene locus_tag LOCUS_61950 234531 234923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 235596 238817 gene locus_tag LOCUS_61960 235596 238817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 238858 240330 gene locus_tag LOCUS_61970 238858 240330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 240344 242341 gene locus_tag LOCUS_61980 240344 242341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 242945 242349 gene locus_tag LOCUS_61990 242945 242349 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_61990 244018 242945 gene locus_tag LOCUS_62000 244018 242945 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_62000 244187 245755 gene locus_tag LOCUS_62010 244187 245755 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029996.1 protein_id gnl|my_center|LOCUS_62010 245752 247503 gene locus_tag LOCUS_62020 245752 247503 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229337.1 protein_id gnl|my_center|LOCUS_62020 247576 248031 gene locus_tag LOCUS_62030 247576 248031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 249871 248012 gene locus_tag LOCUS_62040 249871 248012 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230694.1 protein_id gnl|my_center|LOCUS_62040 251037 249919 gene locus_tag LOCUS_62050 251037 249919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 251137 253242 gene locus_tag LOCUS_62060 251137 253242 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 protein_id gnl|my_center|LOCUS_62060 253349 253128 gene locus_tag LOCUS_62070 253349 253128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 253686 254003 gene locus_tag LOCUS_62080 253686 254003 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483310.1 protein_id gnl|my_center|LOCUS_62080 254892 253978 gene locus_tag LOCUS_62090 254892 253978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 256538 255228 gene locus_tag LOCUS_62100 256538 255228 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_62100 257176 256535 gene locus_tag LOCUS_62110 gene tmk 257176 256535 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975452.1 protein_id gnl|my_center|LOCUS_62110 257697 257530 gene locus_tag LOCUS_62120 257697 257530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 258562 257717 gene locus_tag LOCUS_62130 258562 257717 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_62130 258754 258990 gene locus_tag LOCUS_62140 258754 258990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 259012 259746 gene locus_tag LOCUS_62150 259012 259746 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_62150 263342 259731 gene locus_tag LOCUS_62160 gene metH 263342 259731 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227000.1 protein_id gnl|my_center|LOCUS_62160 265500 263782 gene locus_tag LOCUS_62170 265500 263782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 266642 265584 gene locus_tag LOCUS_62180 266642 265584 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226650.1 protein_id gnl|my_center|LOCUS_62180 267979 266660 gene locus_tag LOCUS_62190 267979 266660 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284065.1 protein_id gnl|my_center|LOCUS_62190 268142 268960 gene locus_tag LOCUS_62200 268142 268960 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226652.1 protein_id gnl|my_center|LOCUS_62200 269046 269387 gene locus_tag LOCUS_62210 269046 269387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 270840 269365 gene locus_tag LOCUS_62220 270840 269365 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226148.1 protein_id gnl|my_center|LOCUS_62220 270926 272149 gene locus_tag LOCUS_62230 270926 272149 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225903.1 protein_id gnl|my_center|LOCUS_62230 272209 272517 gene locus_tag LOCUS_62240 272209 272517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 272514 272783 gene locus_tag LOCUS_62250 272514 272783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 272785 273108 gene locus_tag LOCUS_62260 272785 273108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 273127 273834 gene locus_tag LOCUS_62270 273127 273834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 276847 273839 gene locus_tag LOCUS_62280 276847 273839 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223918.1 protein_id gnl|my_center|LOCUS_62280 277004 277351 gene locus_tag LOCUS_62290 277004 277351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387149.1 protein_id gnl|my_center|LOCUS_62290 277358 278242 gene locus_tag LOCUS_62300 277358 278242 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112619.1 protein_id gnl|my_center|LOCUS_62300 278239 278634 gene locus_tag LOCUS_62310 278239 278634 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_62310 278644 279264 gene locus_tag LOCUS_62320 278644 279264 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228116.1 protein_id gnl|my_center|LOCUS_62320 280952 279789 gene locus_tag LOCUS_62330 280952 279789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 281882 281025 gene locus_tag LOCUS_62340 281882 281025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 282441 281890 gene locus_tag LOCUS_62350 282441 281890 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_62350 282921 282685 gene locus_tag LOCUS_62360 282921 282685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 283223 283149 gene locus_tag LOCUS_t00610 283223 283149 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 283382 284602 gene locus_tag LOCUS_62370 283382 284602 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_62370 285149 284586 gene locus_tag LOCUS_62380 285149 284586 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_62380 285832 285341 gene locus_tag LOCUS_62390 285832 285341 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 protein_id gnl|my_center|LOCUS_62390 285797 286642 gene locus_tag LOCUS_62400 285797 286642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_62400 287338 287263 gene locus_tag LOCUS_t00620 287338 287263 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 288009 287404 gene locus_tag LOCUS_62410 gene orn 288009 287404 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831683.1 protein_id gnl|my_center|LOCUS_62410 288065 289543 gene locus_tag LOCUS_62420 288065 289543 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031712.1 protein_id gnl|my_center|LOCUS_62420 289748 289545 gene locus_tag LOCUS_62430 289748 289545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223722.1 protein_id gnl|my_center|LOCUS_62430 289890 291107 gene locus_tag LOCUS_62440 289890 291107 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223723.1 protein_id gnl|my_center|LOCUS_62440 291125 292141 gene locus_tag LOCUS_62450 291125 292141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 292176 293102 gene locus_tag LOCUS_62460 292176 293102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62460 293099 294259 gene locus_tag LOCUS_62470 293099 294259 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228751.1 protein_id gnl|my_center|LOCUS_62470 295196 294222 gene locus_tag LOCUS_62480 295196 294222 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_62480 296864 295212 gene locus_tag LOCUS_62490 296864 295212 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_62490 296980 298584 gene locus_tag LOCUS_62500 296980 298584 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 protein_id gnl|my_center|LOCUS_62500 298963 300150 gene locus_tag LOCUS_62510 298963 300150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 300288 301511 gene locus_tag LOCUS_62520 300288 301511 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_62520 301585 302649 gene locus_tag LOCUS_62530 301585 302649 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_62530 302651 303313 gene locus_tag LOCUS_62540 302651 303313 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228740.1 protein_id gnl|my_center|LOCUS_62540 303349 304374 gene locus_tag LOCUS_62550 303349 304374 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_62550 304843 306138 gene locus_tag LOCUS_62560 304843 306138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_62560 306221 307204 gene locus_tag LOCUS_62570 306221 307204 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 protein_id gnl|my_center|LOCUS_62570 307201 308043 gene locus_tag LOCUS_62580 307201 308043 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 protein_id gnl|my_center|LOCUS_62580 308045 310651 gene locus_tag LOCUS_62590 308045 310651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 310726 311721 gene locus_tag LOCUS_62600 310726 311721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 311740 312795 gene locus_tag LOCUS_62610 311740 312795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 313619 312843 gene locus_tag LOCUS_62620 313619 312843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837831.1 protein_id gnl|my_center|LOCUS_62620 314577 313612 gene locus_tag LOCUS_62630 314577 313612 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_62630 314692 315441 gene locus_tag LOCUS_62640 314692 315441 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_62640 315486 316148 gene locus_tag LOCUS_62650 315486 316148 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225214.1 protein_id gnl|my_center|LOCUS_62650 316162 316794 gene locus_tag LOCUS_62660 316162 316794 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224664.1 protein_id gnl|my_center|LOCUS_62660 316967 318154 gene locus_tag LOCUS_62670 316967 318154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_62670 319110 318121 gene locus_tag LOCUS_62680 319110 318121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 319211 319606 gene locus_tag LOCUS_62690 319211 319606 CDS product DUF6319 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230538.1 protein_id gnl|my_center|LOCUS_62690 319611 320639 gene locus_tag LOCUS_62700 gene mgrA 319611 320639 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_62700 320636 321511 gene locus_tag LOCUS_62710 320636 321511 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231023.1 protein_id gnl|my_center|LOCUS_62710 322485 321520 gene locus_tag LOCUS_62720 322485 321520 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230276.1 protein_id gnl|my_center|LOCUS_62720 322569 323975 gene locus_tag LOCUS_62730 322569 323975 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_62730 324444 323950 gene locus_tag LOCUS_62740 324444 323950 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891774.1 protein_id gnl|my_center|LOCUS_62740 324498 325001 gene locus_tag LOCUS_62750 324498 325001 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467244.1 protein_id gnl|my_center|LOCUS_62750 325001 326044 gene locus_tag LOCUS_62760 325001 326044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227168.1 protein_id gnl|my_center|LOCUS_62760 326065 326331 gene locus_tag LOCUS_62770 326065 326331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 327077 326322 gene locus_tag LOCUS_62780 327077 326322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 328250 327090 gene locus_tag LOCUS_62790 328250 327090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 328819 328262 gene locus_tag LOCUS_62800 328819 328262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 329160 328816 gene locus_tag LOCUS_62810 329160 328816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 329666 329235 gene locus_tag LOCUS_62820 329666 329235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 329842 330699 gene locus_tag LOCUS_62830 329842 330699 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_62830 330704 330886 gene locus_tag LOCUS_62840 330704 330886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 333372 330883 gene locus_tag LOCUS_62850 333372 330883 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223208.1 protein_id gnl|my_center|LOCUS_62850 334412 333402 gene locus_tag LOCUS_62860 334412 333402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223209.1 protein_id gnl|my_center|LOCUS_62860 335362 334409 gene locus_tag LOCUS_62870 335362 334409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 protein_id gnl|my_center|LOCUS_62870 336876 335359 gene locus_tag LOCUS_62880 336876 335359 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_62880 337985 336900 gene locus_tag LOCUS_62890 337985 336900 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 protein_id gnl|my_center|LOCUS_62890 338270 340336 gene locus_tag LOCUS_62900 338270 340336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 340342 341289 gene locus_tag LOCUS_62910 340342 341289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 341990 341286 gene locus_tag LOCUS_62920 341990 341286 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227889.1 protein_id gnl|my_center|LOCUS_62920 342039 342695 gene locus_tag LOCUS_62930 342039 342695 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223522.1 protein_id gnl|my_center|LOCUS_62930 342840 343844 gene locus_tag LOCUS_62940 342840 343844 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_62940 343844 344620 gene locus_tag LOCUS_62950 343844 344620 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_62950 344696 345643 gene locus_tag LOCUS_62960 344696 345643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 346557 345664 gene locus_tag LOCUS_62970 346557 345664 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226008.1 protein_id gnl|my_center|LOCUS_62970 346629 347813 gene locus_tag LOCUS_62980 346629 347813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 347865 349193 gene locus_tag LOCUS_62990 347865 349193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226840.1 protein_id gnl|my_center|LOCUS_62990 349193 350620 gene locus_tag LOCUS_63000 349193 350620 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226839.1 protein_id gnl|my_center|LOCUS_63000 351554 350592 gene locus_tag LOCUS_63010 351554 350592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 351666 352433 gene locus_tag LOCUS_63020 351666 352433 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 protein_id gnl|my_center|LOCUS_63020 353349 352441 gene locus_tag LOCUS_63030 353349 352441 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057810.1 protein_id gnl|my_center|LOCUS_63030 353745 354158 gene locus_tag LOCUS_63040 353745 354158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 357739 355130 gene locus_tag LOCUS_63050 357739 355130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 358027 358452 gene locus_tag LOCUS_63060 358027 358452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 358695 359339 gene locus_tag LOCUS_63070 358695 359339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 360011 359391 gene locus_tag LOCUS_63080 360011 359391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 360070 361476 gene locus_tag LOCUS_63090 360070 361476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 361488 361901 gene locus_tag LOCUS_63100 361488 361901 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226817.1 protein_id gnl|my_center|LOCUS_63100 361894 362229 gene locus_tag LOCUS_63110 gene trxA 361894 362229 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731639.1 protein_id gnl|my_center|LOCUS_63110 363332 362205 gene locus_tag LOCUS_63120 363332 362205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 366535 363476 gene locus_tag LOCUS_63130 366535 363476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 367310 366882 gene locus_tag LOCUS_63140 367310 366882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 367418 367816 gene locus_tag LOCUS_63150 367418 367816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227687.1 protein_id gnl|my_center|LOCUS_63150 367866 369002 gene locus_tag LOCUS_63160 367866 369002 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_63160 370196 369513 gene locus_tag LOCUS_63170 370196 369513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 371272 370253 gene locus_tag LOCUS_63180 371272 370253 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_63180 371707 371276 gene locus_tag LOCUS_63190 371707 371276 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_63190 371850 372731 gene locus_tag LOCUS_63200 371850 372731 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 protein_id gnl|my_center|LOCUS_63200 374360 372717 gene locus_tag LOCUS_63210 374360 372717 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_63210 374502 374912 gene locus_tag LOCUS_63220 374502 374912 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227496.1 protein_id gnl|my_center|LOCUS_63220 374909 375403 gene locus_tag LOCUS_63230 374909 375403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 375400 376263 gene locus_tag LOCUS_63240 375400 376263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 376367 376594 gene locus_tag LOCUS_63250 376367 376594 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_63250 376621 377544 gene locus_tag LOCUS_63260 376621 377544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_63260 377531 379756 gene locus_tag LOCUS_63270 377531 379756 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 protein_id gnl|my_center|LOCUS_63270 379858 381783 gene locus_tag LOCUS_63280 379858 381783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63280 382328 381780 gene locus_tag LOCUS_63290 382328 381780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 383311 382259 gene locus_tag LOCUS_63300 383311 382259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228145.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63300 383497 385185 gene locus_tag LOCUS_63310 383497 385185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 385205 387664 gene locus_tag LOCUS_63320 385205 387664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 387693 388655 gene locus_tag LOCUS_63330 387693 388655 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_63330 388657 389787 gene locus_tag LOCUS_63340 388657 389787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 389784 391817 gene locus_tag LOCUS_63350 389784 391817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 391814 393028 gene locus_tag LOCUS_63360 391814 393028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 393039 393827 gene locus_tag LOCUS_63370 393039 393827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 394161 393838 gene locus_tag LOCUS_63380 394161 393838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 394187 394582 gene locus_tag LOCUS_63390 394187 394582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 395185 394637 gene locus_tag LOCUS_63400 395185 394637 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226048.1 protein_id gnl|my_center|LOCUS_63400 395294 397045 gene locus_tag LOCUS_63410 395294 397045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485997.1 protein_id gnl|my_center|LOCUS_63410 397042 398787 gene locus_tag LOCUS_63420 397042 398787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 protein_id gnl|my_center|LOCUS_63420 399500 398691 gene locus_tag LOCUS_63430 399500 398691 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223645.1 protein_id gnl|my_center|LOCUS_63430 399603 399941 gene locus_tag LOCUS_63440 399603 399941 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226535.1 protein_id gnl|my_center|LOCUS_63440 399938 401164 gene locus_tag LOCUS_63450 399938 401164 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_63450 402564 401113 gene locus_tag LOCUS_63460 gene rox 402564 401113 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877344.1 protein_id gnl|my_center|LOCUS_63460 403810 402647 gene locus_tag LOCUS_63470 403810 402647 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202991912.1 protein_id gnl|my_center|LOCUS_63470 404475 403831 gene locus_tag LOCUS_63480 404475 403831 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270136.1 protein_id gnl|my_center|LOCUS_63480 405098 404541 gene locus_tag LOCUS_63490 405098 404541 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223301.1 protein_id gnl|my_center|LOCUS_63490 405176 406081 gene locus_tag LOCUS_63500 405176 406081 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_63500 406745 406128 gene locus_tag LOCUS_63510 406745 406128 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224523.1 protein_id gnl|my_center|LOCUS_63510 408348 406792 gene locus_tag LOCUS_63520 408348 406792 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_63520 408435 409139 gene locus_tag LOCUS_63530 408435 409139 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971520.1 protein_id gnl|my_center|LOCUS_63530 409766 409155 gene locus_tag LOCUS_63540 409766 409155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 410314 409889 gene locus_tag LOCUS_63550 410314 409889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63550 410870 410343 gene locus_tag LOCUS_63560 410870 410343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 410755 410976 gene locus_tag LOCUS_63570 410755 410976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 411379 411143 gene locus_tag LOCUS_63580 411379 411143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 412424 411390 gene locus_tag LOCUS_63590 412424 411390 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_63590 415026 412816 gene locus_tag LOCUS_63600 415026 412816 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_63600 415207 416181 gene locus_tag LOCUS_63610 gene argF 415207 416181 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_63610 416178 417206 gene locus_tag LOCUS_63620 416178 417206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 417199 418242 gene locus_tag LOCUS_63630 417199 418242 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228012.1 protein_id gnl|my_center|LOCUS_63630 418239 419348 gene locus_tag LOCUS_63640 gene thrC 418239 419348 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_63640 419345 424333 gene locus_tag LOCUS_63650 419345 424333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 424411 434709 gene locus_tag LOCUS_63660 424411 434709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63660 434727 442208 gene locus_tag LOCUS_63670 434727 442208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 442256 443227 gene locus_tag LOCUS_63680 442256 443227 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_63680 443224 449757 gene locus_tag LOCUS_63690 443224 449757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 449754 449972 gene locus_tag LOCUS_63700 449754 449972 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_63700 449965 450915 gene locus_tag LOCUS_63710 449965 450915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 450912 451685 gene locus_tag LOCUS_63720 450912 451685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 451714 452454 gene locus_tag LOCUS_63730 451714 452454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 452471 453709 gene locus_tag LOCUS_63740 452471 453709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63740 453715 454137 gene locus_tag LOCUS_63750 453715 454137 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 protein_id gnl|my_center|LOCUS_63750 454437 455219 gene locus_tag LOCUS_63760 454437 455219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230577.1 protein_id gnl|my_center|LOCUS_63760 455216 456271 gene locus_tag LOCUS_63770 455216 456271 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230576.1 protein_id gnl|my_center|LOCUS_63770 456268 456525 gene locus_tag LOCUS_63780 456268 456525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 458327 456444 gene locus_tag LOCUS_63790 458327 456444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63790 459215 458685 gene locus_tag LOCUS_63800 459215 458685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63800 459388 459315 gene locus_tag LOCUS_t00630 459388 459315 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 460581 459499 gene locus_tag LOCUS_63810 460581 459499 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_63810 460690 461892 gene locus_tag LOCUS_63820 460690 461892 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228603.1 protein_id gnl|my_center|LOCUS_63820 461924 463990 gene locus_tag LOCUS_63830 461924 463990 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_63830 464166 464591 gene locus_tag LOCUS_63840 464166 464591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 464673 466349 gene locus_tag LOCUS_63850 gene ettA 464673 466349 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_63850 >Feature sequence35 3195 241 gene locus_tag LOCUS_63860 gene secA 3195 241 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229725.1 protein_id gnl|my_center|LOCUS_63860 4082 3408 gene locus_tag LOCUS_63870 gene raiA 4082 3408 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229726.1 protein_id gnl|my_center|LOCUS_63870 4496 4191 gene locus_tag LOCUS_63880 4496 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 5399 4764 gene locus_tag LOCUS_63890 5399 4764 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_63890 7186 5453 gene locus_tag LOCUS_63900 7186 5453 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229728.1 protein_id gnl|my_center|LOCUS_63900 8922 7183 gene locus_tag LOCUS_63910 gene mtrB 8922 7183 CDS product MtrAB system histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229729.1 protein_id gnl|my_center|LOCUS_63910 9628 8951 gene locus_tag LOCUS_63920 gene mtrA 9628 8951 CDS product MtrAB system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005150760.1 protein_id gnl|my_center|LOCUS_63920 9765 10247 gene locus_tag LOCUS_63930 9765 10247 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_63930 10870 10244 gene locus_tag LOCUS_63940 10870 10244 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_63940 11623 10880 gene locus_tag LOCUS_63950 11623 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 11688 12476 gene locus_tag LOCUS_63960 11688 12476 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728510.1 protein_id gnl|my_center|LOCUS_63960 12466 13044 gene locus_tag LOCUS_63970 12466 13044 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969624.1 protein_id gnl|my_center|LOCUS_63970 14596 13106 gene locus_tag LOCUS_63980 gene ahcY 14596 13106 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229742.1 protein_id gnl|my_center|LOCUS_63980 14693 17035 gene locus_tag LOCUS_63990 14693 17035 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229743.1 protein_id gnl|my_center|LOCUS_63990 18302 17052 gene locus_tag LOCUS_64000 gene glmL 18302 17052 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_64000 19792 18299 gene locus_tag LOCUS_64010 19792 18299 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229745.1 protein_id gnl|my_center|LOCUS_64010 20815 19895 gene locus_tag LOCUS_64020 20815 19895 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_64020 22142 20895 gene locus_tag LOCUS_64030 gene manA 22142 20895 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229748.1 protein_id gnl|my_center|LOCUS_64030 23242 22142 gene locus_tag LOCUS_64040 23242 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283989.1 protein_id gnl|my_center|LOCUS_64040 23519 23313 gene locus_tag LOCUS_64050 23519 23313 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229750.1 protein_id gnl|my_center|LOCUS_64050 24897 23539 gene locus_tag LOCUS_64060 24897 23539 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229751.1 protein_id gnl|my_center|LOCUS_64060 25285 24974 gene locus_tag LOCUS_64070 25285 24974 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086677666.1 protein_id gnl|my_center|LOCUS_64070 25381 25869 gene locus_tag LOCUS_64080 25381 25869 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559274.1 protein_id gnl|my_center|LOCUS_64080 29821 25850 gene locus_tag LOCUS_64090 29821 25850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 30187 29870 gene locus_tag LOCUS_64100 30187 29870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 30454 31200 gene locus_tag LOCUS_64110 30454 31200 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229755.1 protein_id gnl|my_center|LOCUS_64110 31238 32191 gene locus_tag LOCUS_64120 gene cofD 31238 32191 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_64120 32188 33555 gene locus_tag LOCUS_64130 32188 33555 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222932.1 protein_id gnl|my_center|LOCUS_64130 33564 34088 gene locus_tag LOCUS_64140 33564 34088 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222931.1 protein_id gnl|my_center|LOCUS_64140 34927 34073 gene locus_tag LOCUS_64150 34927 34073 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222927.1 protein_id gnl|my_center|LOCUS_64150 35022 36128 gene locus_tag LOCUS_64160 35022 36128 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_64160 36309 36842 gene locus_tag LOCUS_64170 36309 36842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 37674 36862 gene locus_tag LOCUS_64180 37674 36862 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742156.1 protein_id gnl|my_center|LOCUS_64180 38881 37733 gene locus_tag LOCUS_64190 38881 37733 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222923.1 protein_id gnl|my_center|LOCUS_64190 40064 38949 gene locus_tag LOCUS_64200 40064 38949 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222922.1 protein_id gnl|my_center|LOCUS_64200 40104 41063 gene locus_tag LOCUS_64210 40104 41063 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742155.1 protein_id gnl|my_center|LOCUS_64210 41161 43647 gene locus_tag LOCUS_64220 41161 43647 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222920.1 protein_id gnl|my_center|LOCUS_64220 43640 44728 gene locus_tag LOCUS_64230 43640 44728 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222919.1 protein_id gnl|my_center|LOCUS_64230 45059 44733 gene locus_tag LOCUS_64240 45059 44733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 45958 45056 gene locus_tag LOCUS_64250 gene rfbD 45958 45056 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_64250 46185 47681 gene locus_tag LOCUS_64260 46185 47681 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222916.1 protein_id gnl|my_center|LOCUS_64260 47760 49121 gene locus_tag LOCUS_64270 47760 49121 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876538.1 protein_id gnl|my_center|LOCUS_64270 49135 49833 gene locus_tag LOCUS_64280 49135 49833 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222913.1 protein_id gnl|my_center|LOCUS_64280 50226 50423 gene locus_tag LOCUS_64290 50226 50423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 51579 50425 gene locus_tag LOCUS_64300 51579 50425 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222907.1 protein_id gnl|my_center|LOCUS_64300 52132 51617 gene locus_tag LOCUS_64310 gene purE 52132 51617 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_64310 53328 52129 gene locus_tag LOCUS_64320 53328 52129 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222902.1 protein_id gnl|my_center|LOCUS_64320 54633 53338 gene locus_tag LOCUS_64330 54633 53338 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222900.1 protein_id gnl|my_center|LOCUS_64330 55502 54666 gene locus_tag LOCUS_64340 55502 54666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222899.1 protein_id gnl|my_center|LOCUS_64340 >Feature sequence36 1889 138 gene locus_tag LOCUS_64350 1889 138 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_64350 2084 2839 gene locus_tag LOCUS_64360 2084 2839 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 protein_id gnl|my_center|LOCUS_64360 2857 4371 gene locus_tag LOCUS_64370 gene glpK 2857 4371 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_64370 4449 4961 gene locus_tag LOCUS_64380 4449 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 6295 4892 gene locus_tag LOCUS_64390 6295 4892 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_64390 6413 6865 gene locus_tag LOCUS_64400 6413 6865 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222831.1 protein_id gnl|my_center|LOCUS_64400 6876 7166 gene locus_tag LOCUS_64410 6876 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 8411 7170 gene locus_tag LOCUS_64420 8411 7170 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222829.1 protein_id gnl|my_center|LOCUS_64420 8938 8621 gene locus_tag LOCUS_64430 8938 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 9947 8949 gene locus_tag LOCUS_64440 gene meaB 9947 8949 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_64440 12133 9947 gene locus_tag LOCUS_64450 gene scpA 12133 9947 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_64450 13569 12130 gene locus_tag LOCUS_64460 13569 12130 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_64460 13630 15354 gene locus_tag LOCUS_64470 13630 15354 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222824.1 protein_id gnl|my_center|LOCUS_64470 15388 16173 gene locus_tag LOCUS_64480 15388 16173 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_64480 16170 17789 gene locus_tag LOCUS_64490 16170 17789 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222818.1 protein_id gnl|my_center|LOCUS_64490 17830 18279 gene locus_tag LOCUS_64500 17830 18279 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_64500 18919 18272 gene locus_tag LOCUS_64510 18919 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 19371 18967 gene locus_tag LOCUS_64520 19371 18967 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222802.1 protein_id gnl|my_center|LOCUS_64520 19730 19410 gene locus_tag LOCUS_64530 19730 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 20038 19832 gene locus_tag LOCUS_64540 20038 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 20702 20079 gene locus_tag LOCUS_64550 gene upp 20702 20079 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222797.1 protein_id gnl|my_center|LOCUS_64550 21491 20733 gene locus_tag LOCUS_64560 21491 20733 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_64560 22526 21504 gene locus_tag LOCUS_64570 22526 21504 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243786.1 protein_id gnl|my_center|LOCUS_64570 23405 22545 gene locus_tag LOCUS_64580 23405 22545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 24271 23402 gene locus_tag LOCUS_64590 24271 23402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_64590 25065 24268 gene locus_tag LOCUS_64600 25065 24268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532455.1 protein_id gnl|my_center|LOCUS_64600 25827 25099 gene locus_tag LOCUS_64610 25827 25099 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_64610 25971 26579 gene locus_tag LOCUS_64620 25971 26579 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878216.1 protein_id gnl|my_center|LOCUS_64620 26881 26591 gene locus_tag LOCUS_64630 26881 26591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64630 27630 26947 gene locus_tag LOCUS_64640 27630 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64640 27872 28840 gene locus_tag LOCUS_64650 gene deoC 27872 28840 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_64650 28842 30275 gene locus_tag LOCUS_64660 28842 30275 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_64660 30268 31134 gene locus_tag LOCUS_64670 30268 31134 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_64670 31321 31668 gene locus_tag LOCUS_64680 31321 31668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 31665 32771 gene locus_tag LOCUS_64690 31665 32771 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223191.1 protein_id gnl|my_center|LOCUS_64690 32803 33213 gene locus_tag LOCUS_64700 32803 33213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223192.1 protein_id gnl|my_center|LOCUS_64700 33210 33719 gene locus_tag LOCUS_64710 33210 33719 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223193.1 protein_id gnl|my_center|LOCUS_64710 33796 35097 gene locus_tag LOCUS_64720 33796 35097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222777.1 protein_id gnl|my_center|LOCUS_64720 36202 35099 gene locus_tag LOCUS_64730 36202 35099 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222775.1 protein_id gnl|my_center|LOCUS_64730 36425 37603 gene locus_tag LOCUS_64740 36425 37603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222774.1 protein_id gnl|my_center|LOCUS_64740 38947 37670 gene locus_tag LOCUS_64750 38947 37670 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222773.1 protein_id gnl|my_center|LOCUS_64750 39366 38944 gene locus_tag LOCUS_64760 39366 38944 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086839697.1 protein_id gnl|my_center|LOCUS_64760 40636 39359 gene locus_tag LOCUS_64770 40636 39359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222771.1 protein_id gnl|my_center|LOCUS_64770 41730 40633 gene locus_tag LOCUS_64780 41730 40633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_64780 43337 41727 gene locus_tag LOCUS_64790 43337 41727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222769.1 protein_id gnl|my_center|LOCUS_64790 44580 43420 gene locus_tag LOCUS_64800 44580 43420 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_64800 46101 44914 gene locus_tag LOCUS_64810 46101 44914 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_64810 46197 46625 gene locus_tag LOCUS_64820 46197 46625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64820 47087 46737 gene locus_tag LOCUS_64830 47087 46737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 48580 47174 gene locus_tag LOCUS_64840 gene xylB 48580 47174 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_64840 49470 48631 gene locus_tag LOCUS_64850 49470 48631 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_64850 50545 49541 gene locus_tag LOCUS_64860 50545 49541 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_64860 51948 50542 gene locus_tag LOCUS_64870 51948 50542 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_64870 53081 51945 gene locus_tag LOCUS_64880 gene eboE 53081 51945 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_64880 53941 53078 gene locus_tag LOCUS_64890 53941 53078 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_64890 55410 53938 gene locus_tag LOCUS_64900 55410 53938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 >Feature sequence37 284 1012 gene locus_tag LOCUS_64910 284 1012 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231008.1 protein_id gnl|my_center|LOCUS_64910 2120 984 gene locus_tag LOCUS_64920 2120 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 3623 2187 gene locus_tag LOCUS_64930 3623 2187 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467877.1 protein_id gnl|my_center|LOCUS_64930 3821 3639 gene locus_tag LOCUS_64940 3821 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 4247 5452 gene locus_tag LOCUS_64950 gene pdhA 4247 5452 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_64950 5452 6474 gene locus_tag LOCUS_64960 5452 6474 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230924.1 protein_id gnl|my_center|LOCUS_64960 6481 7809 gene locus_tag LOCUS_64970 6481 7809 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230925.1 protein_id gnl|my_center|LOCUS_64970 7968 8381 gene locus_tag LOCUS_64980 7968 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64980 8350 9354 gene locus_tag LOCUS_64990 8350 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 9351 10760 gene locus_tag LOCUS_65000 9351 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 11002 11394 gene locus_tag LOCUS_65010 11002 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 11414 13225 gene locus_tag LOCUS_65020 11414 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 13222 14622 gene locus_tag LOCUS_65030 13222 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 14804 15652 gene locus_tag LOCUS_65040 14804 15652 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_65040 15655 15831 gene locus_tag LOCUS_65050 15655 15831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 15890 18862 gene locus_tag LOCUS_65060 15890 18862 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223918.1 protein_id gnl|my_center|LOCUS_65060 19593 18868 gene locus_tag LOCUS_65070 19593 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 19928 19605 gene locus_tag LOCUS_65080 19928 19605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 20197 19910 gene locus_tag LOCUS_65090 20197 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65090 20508 20194 gene locus_tag LOCUS_65100 20508 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65100 20638 21282 gene locus_tag LOCUS_65110 20638 21282 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_65110 21295 22725 gene locus_tag LOCUS_65120 21295 22725 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_65120 23547 22726 gene locus_tag LOCUS_65130 23547 22726 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_65130 24892 23549 gene locus_tag LOCUS_65140 24892 23549 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_65140 25183 24920 gene locus_tag LOCUS_65150 25183 24920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 25118 26275 gene locus_tag LOCUS_65160 25118 26275 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230941.1 protein_id gnl|my_center|LOCUS_65160 26514 26341 gene locus_tag LOCUS_65170 26514 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 27176 26511 gene locus_tag LOCUS_65180 27176 26511 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224161.1 protein_id gnl|my_center|LOCUS_65180 27093 27368 gene locus_tag LOCUS_65190 27093 27368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 27365 27604 gene locus_tag LOCUS_65200 27365 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 27727 28923 gene locus_tag LOCUS_65210 27727 28923 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_65210 29117 29260 gene locus_tag LOCUS_65220 29117 29260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 29423 33592 gene locus_tag LOCUS_65230 29423 33592 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727624.1 protein_id gnl|my_center|LOCUS_65230 33589 34359 gene locus_tag LOCUS_65240 33589 34359 CDS product malonyl CoA-ACP transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403326.1 protein_id gnl|my_center|LOCUS_65240 34424 35359 gene locus_tag LOCUS_65250 34424 35359 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_65250 35375 35605 gene locus_tag LOCUS_65260 35375 35605 CDS product antitoxin VapB29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403213.1 protein_id gnl|my_center|LOCUS_65260 35602 36000 gene locus_tag LOCUS_65270 gene vapC29 35602 36000 CDS product type II toxin-antitoxin system ribonuclease VapC29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403218.1 protein_id gnl|my_center|LOCUS_65270 36584 35997 gene locus_tag LOCUS_65280 36584 35997 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230947.1 protein_id gnl|my_center|LOCUS_65280 38670 36847 gene locus_tag LOCUS_65290 38670 36847 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230959.1 protein_id gnl|my_center|LOCUS_65290 39759 39010 gene locus_tag LOCUS_65300 39759 39010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230960.1 protein_id gnl|my_center|LOCUS_65300 41702 39846 gene locus_tag LOCUS_65310 41702 39846 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_65310 42199 41699 gene locus_tag LOCUS_65320 gene grpE 42199 41699 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831423.1 protein_id gnl|my_center|LOCUS_65320 43832 42273 gene locus_tag LOCUS_65330 43832 42273 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742061.1 protein_id gnl|my_center|LOCUS_65330 44060 45217 gene locus_tag LOCUS_65340 44060 45217 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230965.1 protein_id gnl|my_center|LOCUS_65340 45227 45892 gene locus_tag LOCUS_65350 45227 45892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230966.1 protein_id gnl|my_center|LOCUS_65350 46104 47060 gene locus_tag LOCUS_65360 46104 47060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_65360 47065 47826 gene locus_tag LOCUS_65370 47065 47826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230970.1 protein_id gnl|my_center|LOCUS_65370 48179 48856 gene locus_tag LOCUS_65380 48179 48856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230973.1 protein_id gnl|my_center|LOCUS_65380 48866 49573 gene locus_tag LOCUS_65390 gene trmB 48866 49573 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230974.1 protein_id gnl|my_center|LOCUS_65390 49691 50230 gene locus_tag LOCUS_65400 49691 50230 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 protein_id gnl|my_center|LOCUS_65400 50218 50715 gene locus_tag LOCUS_65410 50218 50715 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_65410 50712 52235 gene locus_tag LOCUS_65420 50712 52235 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_65420 52276 53304 gene locus_tag LOCUS_65430 52276 53304 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_65430 53304 54638 gene locus_tag LOCUS_65440 53304 54638 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230981.1 protein_id gnl|my_center|LOCUS_65440 55491 54811 gene locus_tag LOCUS_65450 55491 54811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_65450 >Feature sequence38 1510 572 gene locus_tag LOCUS_65460 1510 572 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222397.1 protein_id gnl|my_center|LOCUS_65460 2241 1555 gene locus_tag LOCUS_65470 2241 1555 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222396.1 protein_id gnl|my_center|LOCUS_65470 3389 2238 gene locus_tag LOCUS_65480 3389 2238 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285858.1 protein_id gnl|my_center|LOCUS_65480 4384 3497 gene locus_tag LOCUS_65490 4384 3497 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222394.1 protein_id gnl|my_center|LOCUS_65490 4480 5124 gene locus_tag LOCUS_65500 4480 5124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222393.1 protein_id gnl|my_center|LOCUS_65500 5908 5159 gene locus_tag LOCUS_65510 5908 5159 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_65510 6833 6336 gene locus_tag LOCUS_65520 6833 6336 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222390.1 protein_id gnl|my_center|LOCUS_65520 8134 6839 gene locus_tag LOCUS_65530 gene mshA 8134 6839 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742053.1 protein_id gnl|my_center|LOCUS_65530 8972 8148 gene locus_tag LOCUS_65540 8972 8148 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222388.1 protein_id gnl|my_center|LOCUS_65540 10120 8972 gene locus_tag LOCUS_65550 10120 8972 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222387.1 protein_id gnl|my_center|LOCUS_65550 10243 10977 gene locus_tag LOCUS_65560 10243 10977 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402359.1 protein_id gnl|my_center|LOCUS_65560 11292 11483 gene locus_tag LOCUS_65570 11292 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 11485 12198 gene locus_tag LOCUS_65580 11485 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 13304 12195 gene locus_tag LOCUS_65590 13304 12195 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_65590 13294 13821 gene locus_tag LOCUS_65600 13294 13821 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_65600 13800 14600 gene locus_tag LOCUS_65610 13800 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222384.1 protein_id gnl|my_center|LOCUS_65610 15486 14587 gene locus_tag LOCUS_65620 15486 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65620 16823 15483 gene locus_tag LOCUS_65630 16823 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 17133 16828 gene locus_tag LOCUS_65640 17133 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 17278 18015 gene locus_tag LOCUS_65650 17278 18015 CDS product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 protein_id gnl|my_center|LOCUS_65650 18054 18827 gene locus_tag LOCUS_65660 18054 18827 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831404.1 protein_id gnl|my_center|LOCUS_65660 18824 19690 gene locus_tag LOCUS_65670 gene purU 18824 19690 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 protein_id gnl|my_center|LOCUS_65670 19701 20666 gene locus_tag LOCUS_65680 19701 20666 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_65680 20699 21076 gene locus_tag LOCUS_65690 20699 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742095.1 protein_id gnl|my_center|LOCUS_65690 21076 21690 gene locus_tag LOCUS_65700 21076 21690 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223382.1 protein_id gnl|my_center|LOCUS_65700 22232 21687 gene locus_tag LOCUS_65710 22232 21687 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_65710 22519 22226 gene locus_tag LOCUS_65720 22519 22226 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222364.1 protein_id gnl|my_center|LOCUS_65720 23095 22607 gene locus_tag LOCUS_65730 23095 22607 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222363.1 protein_id gnl|my_center|LOCUS_65730 23527 23099 gene locus_tag LOCUS_65740 23527 23099 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222362.1 protein_id gnl|my_center|LOCUS_65740 24368 23742 gene locus_tag LOCUS_65750 24368 23742 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222360.1 protein_id gnl|my_center|LOCUS_65750 24801 24400 gene locus_tag LOCUS_65760 24801 24400 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081656034.1 protein_id gnl|my_center|LOCUS_65760 27135 24802 gene locus_tag LOCUS_65770 27135 24802 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225032.1 protein_id gnl|my_center|LOCUS_65770 27821 27132 gene locus_tag LOCUS_65780 27821 27132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225031.1 protein_id gnl|my_center|LOCUS_65780 28342 27818 gene locus_tag LOCUS_65790 28342 27818 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_65790 28451 28933 gene locus_tag LOCUS_65800 28451 28933 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222357.1 protein_id gnl|my_center|LOCUS_65800 30206 28923 gene locus_tag LOCUS_65810 30206 28923 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_65810 30230 31402 gene locus_tag LOCUS_65820 30230 31402 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_65820 31680 32540 gene locus_tag LOCUS_65830 31680 32540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 34298 32889 gene locus_tag LOCUS_65840 34298 32889 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 protein_id gnl|my_center|LOCUS_65840 34429 35004 gene locus_tag LOCUS_65850 34429 35004 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_65850 35551 35009 gene locus_tag LOCUS_65860 35551 35009 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030137.1 protein_id gnl|my_center|LOCUS_65860 35762 35553 gene locus_tag LOCUS_65870 35762 35553 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_65870 35825 36658 gene locus_tag LOCUS_65880 35825 36658 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466552.1 protein_id gnl|my_center|LOCUS_65880 37959 36655 gene locus_tag LOCUS_65890 37959 36655 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831529.1 protein_id gnl|my_center|LOCUS_65890 38229 39560 gene locus_tag LOCUS_65900 38229 39560 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_65900 39550 40740 gene locus_tag LOCUS_65910 39550 40740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_65910 >Feature sequence39 327 1796 gene locus_tag LOCUS_65920 327 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 1810 3723 gene locus_tag LOCUS_65930 gene asnB 1810 3723 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_65930 3754 5934 gene locus_tag LOCUS_65940 3754 5934 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222483.1 protein_id gnl|my_center|LOCUS_65940 5931 7895 gene locus_tag LOCUS_65950 5931 7895 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484340.1 protein_id gnl|my_center|LOCUS_65950 7910 9409 gene locus_tag LOCUS_65960 7910 9409 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027078.1 protein_id gnl|my_center|LOCUS_65960 9411 10640 gene locus_tag LOCUS_65970 9411 10640 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222486.1 protein_id gnl|my_center|LOCUS_65970 10637 11302 gene locus_tag LOCUS_65980 10637 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878513.1 protein_id gnl|my_center|LOCUS_65980 11299 12471 gene locus_tag LOCUS_65990 11299 12471 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222487.1 protein_id gnl|my_center|LOCUS_65990 12476 16054 gene locus_tag LOCUS_66000 12476 16054 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_66000 16093 16677 gene locus_tag LOCUS_66010 16093 16677 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222488.1 protein_id gnl|my_center|LOCUS_66010 17987 16668 gene locus_tag LOCUS_66020 17987 16668 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027086.1 protein_id gnl|my_center|LOCUS_66020 18544 17984 gene locus_tag LOCUS_66030 18544 17984 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027085.1 protein_id gnl|my_center|LOCUS_66030 19704 18541 gene locus_tag LOCUS_66040 19704 18541 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222493.1 protein_id gnl|my_center|LOCUS_66040 20645 19701 gene locus_tag LOCUS_66050 20645 19701 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027083.1 protein_id gnl|my_center|LOCUS_66050 21892 20642 gene locus_tag LOCUS_66060 21892 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978468.1 protein_id gnl|my_center|LOCUS_66060 23154 21889 gene locus_tag LOCUS_66070 23154 21889 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_66070 24179 23151 gene locus_tag LOCUS_66080 24179 23151 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978470.1 protein_id gnl|my_center|LOCUS_66080 24797 24183 gene locus_tag LOCUS_66090 24797 24183 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222498.1 protein_id gnl|my_center|LOCUS_66090 25735 24824 gene locus_tag LOCUS_66100 25735 24824 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222499.1 protein_id gnl|my_center|LOCUS_66100 26964 25732 gene locus_tag LOCUS_66110 26964 25732 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_66110 28451 26964 gene locus_tag LOCUS_66120 28451 26964 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467238.1 protein_id gnl|my_center|LOCUS_66120 29059 30450 gene locus_tag LOCUS_66130 29059 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 30968 30501 gene locus_tag LOCUS_66140 30968 30501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 31960 31070 gene locus_tag LOCUS_66150 31960 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 33409 31976 gene locus_tag LOCUS_66160 33409 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 33700 35304 gene locus_tag LOCUS_66170 33700 35304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 35424 35903 gene locus_tag LOCUS_66180 35424 35903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 36100 36026 gene locus_tag LOCUS_t00640 36100 36026 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 36188 36114 gene locus_tag LOCUS_t00650 36188 36114 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 36919 36245 gene locus_tag LOCUS_66190 36919 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 38070 36898 gene locus_tag LOCUS_66200 38070 36898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 39164 38067 gene locus_tag LOCUS_66210 39164 38067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 39476 40405 gene locus_tag LOCUS_66220 39476 40405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 >Feature sequence40 274 1941 gene locus_tag LOCUS_66230 gene lysS 274 1941 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_66230 2027 3547 gene locus_tag LOCUS_66240 2027 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 4703 3477 gene locus_tag LOCUS_66250 4703 3477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_66250 4776 5648 gene locus_tag LOCUS_66260 4776 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 5687 6193 gene locus_tag LOCUS_66270 5687 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 6274 6672 gene locus_tag LOCUS_66280 6274 6672 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_66280 6674 7474 gene locus_tag LOCUS_66290 gene modA 6674 7474 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_66290 7651 8280 gene locus_tag LOCUS_66300 7651 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66300 8277 9326 gene locus_tag LOCUS_66310 8277 9326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_66310 9369 9644 gene locus_tag LOCUS_66320 9369 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 9677 10864 gene locus_tag LOCUS_66330 9677 10864 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229236.1 protein_id gnl|my_center|LOCUS_66330 10929 11798 gene locus_tag LOCUS_66340 10929 11798 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227302.1 protein_id gnl|my_center|LOCUS_66340 12626 11805 gene locus_tag LOCUS_66350 12626 11805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 13819 12626 gene locus_tag LOCUS_66360 13819 12626 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_66360 20178 13816 gene locus_tag LOCUS_66370 20178 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 20609 23608 gene locus_tag LOCUS_66380 20609 23608 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113094.1 protein_id gnl|my_center|LOCUS_66380 23608 24615 gene locus_tag LOCUS_66390 23608 24615 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115897.1 protein_id gnl|my_center|LOCUS_66390 24612 25625 gene locus_tag LOCUS_66400 24612 25625 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_66400 25626 30794 gene locus_tag LOCUS_66410 25626 30794 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895606.1 protein_id gnl|my_center|LOCUS_66410 31681 30803 gene locus_tag LOCUS_66420 31681 30803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187364534.1 protein_id gnl|my_center|LOCUS_66420 >Feature sequence41 442 777 gene locus_tag LOCUS_66430 442 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 1277 690 gene locus_tag LOCUS_66440 1277 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466964.1 protein_id gnl|my_center|LOCUS_66440 2280 1372 gene locus_tag LOCUS_66450 2280 1372 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222582.1 protein_id gnl|my_center|LOCUS_66450 2960 2280 gene locus_tag LOCUS_66460 2960 2280 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222581.1 protein_id gnl|my_center|LOCUS_66460 3055 3519 gene locus_tag LOCUS_66470 gene soxR 3055 3519 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224136.1 protein_id gnl|my_center|LOCUS_66470 4045 3902 gene locus_tag LOCUS_66480 4045 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 4670 4071 gene locus_tag LOCUS_66490 gene hisB 4670 4071 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224129.1 protein_id gnl|my_center|LOCUS_66490 5767 4667 gene locus_tag LOCUS_66500 5767 4667 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_66500 7086 5764 gene locus_tag LOCUS_66510 gene hisD 7086 5764 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224127.1 protein_id gnl|my_center|LOCUS_66510 7274 8536 gene locus_tag LOCUS_66520 7274 8536 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_66520 10100 8559 gene locus_tag LOCUS_66530 10100 8559 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_66530 10165 10956 gene locus_tag LOCUS_66540 10165 10956 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224126.1 protein_id gnl|my_center|LOCUS_66540 12261 10951 gene locus_tag LOCUS_66550 12261 10951 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401650.1 protein_id gnl|my_center|LOCUS_66550 13127 12270 gene locus_tag LOCUS_66560 gene nadC 13127 12270 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224104.1 protein_id gnl|my_center|LOCUS_66560 14757 13144 gene locus_tag LOCUS_66570 14757 13144 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831489.1 protein_id gnl|my_center|LOCUS_66570 15761 14754 gene locus_tag LOCUS_66580 gene nadA 15761 14754 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 protein_id gnl|my_center|LOCUS_66580 15833 16549 gene locus_tag LOCUS_66590 15833 16549 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224101.1 protein_id gnl|my_center|LOCUS_66590 16559 17251 gene locus_tag LOCUS_66600 16559 17251 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466787.1 protein_id gnl|my_center|LOCUS_66600 17919 17248 gene locus_tag LOCUS_66610 17919 17248 CDS product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224098.1 protein_id gnl|my_center|LOCUS_66610 19219 18170 gene locus_tag LOCUS_66620 gene bioB 19219 18170 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307266.1 protein_id gnl|my_center|LOCUS_66620 20048 19329 gene locus_tag LOCUS_66630 gene bioD 20048 19329 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742103.1 protein_id gnl|my_center|LOCUS_66630 21366 20098 gene locus_tag LOCUS_66640 21366 20098 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_66640 26088 21418 gene locus_tag LOCUS_66650 26088 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 26267 26902 gene locus_tag LOCUS_66660 26267 26902 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224090.1 protein_id gnl|my_center|LOCUS_66660 27056 27481 gene locus_tag LOCUS_66670 27056 27481 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_66670 27524 28048 gene locus_tag LOCUS_66680 27524 28048 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224353.1 protein_id gnl|my_center|LOCUS_66680 28682 28059 gene locus_tag LOCUS_66690 28682 28059 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 protein_id gnl|my_center|LOCUS_66690 29760 28714 gene locus_tag LOCUS_66700 gene ugpC 29760 28714 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727007.1 protein_id gnl|my_center|LOCUS_66700 30581 29760 gene locus_tag LOCUS_66710 30581 29760 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805140.1 protein_id gnl|my_center|LOCUS_66710 31483 30578 gene locus_tag LOCUS_66720 31483 30578 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_66720 32879 31476 gene locus_tag LOCUS_66730 32879 31476 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_66730 <33837 32987 gene locus_tag LOCUS_66740 <33837 32987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226019.1:CehA/McbA family metallohydrolase >Feature sequence42 431 1762 gene locus_tag LOCUS_66750 431 1762 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726710.1 protein_id gnl|my_center|LOCUS_66750 1987 1823 gene locus_tag LOCUS_66760 1987 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 2841 2101 gene locus_tag LOCUS_66770 2841 2101 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972414.1 protein_id gnl|my_center|LOCUS_66770 3146 4852 gene locus_tag LOCUS_66780 3146 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 5935 4934 gene locus_tag LOCUS_66790 5935 4934 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_66790 6692 6036 gene locus_tag LOCUS_66800 6692 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 8195 6696 gene locus_tag LOCUS_66810 8195 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 10444 8306 gene locus_tag LOCUS_66820 10444 8306 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226412.1 protein_id gnl|my_center|LOCUS_66820 11678 10449 gene locus_tag LOCUS_66830 gene frc 11678 10449 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_66830 13405 11690 gene locus_tag LOCUS_66840 13405 11690 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_66840 13679 14680 gene locus_tag LOCUS_66850 13679 14680 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031008.1 protein_id gnl|my_center|LOCUS_66850 14760 15305 gene locus_tag LOCUS_66860 14760 15305 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_66860 16201 15341 gene locus_tag LOCUS_66870 16201 15341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_66870 17175 16198 gene locus_tag LOCUS_66880 17175 16198 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_66880 17743 17186 gene locus_tag LOCUS_66890 17743 17186 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080770.1 protein_id gnl|my_center|LOCUS_66890 18127 17912 gene locus_tag LOCUS_66900 18127 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 21317 18165 gene locus_tag LOCUS_66910 21317 18165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304129.1 protein_id gnl|my_center|LOCUS_66910 21862 21419 gene locus_tag LOCUS_66920 21862 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 22230 22607 gene locus_tag LOCUS_66930 22230 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 22604 23005 gene locus_tag LOCUS_66940 22604 23005 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405651.1 protein_id gnl|my_center|LOCUS_66940 23486 23130 gene locus_tag LOCUS_66950 23486 23130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 23714 23508 gene locus_tag LOCUS_66960 23714 23508 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_66960 24111 24872 gene locus_tag LOCUS_66970 24111 24872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 24996 25295 gene locus_tag LOCUS_66980 24996 25295 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897230.1 protein_id gnl|my_center|LOCUS_66980 25386 26204 gene locus_tag LOCUS_66990 25386 26204 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026871.1 protein_id gnl|my_center|LOCUS_66990 26598 26353 gene locus_tag LOCUS_67000 26598 26353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 26897 27718 gene locus_tag LOCUS_67010 26897 27718 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971565.1 protein_id gnl|my_center|LOCUS_67010 27740 27946 gene locus_tag LOCUS_67020 27740 27946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 28835 27930 gene locus_tag LOCUS_67030 28835 27930 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_67030 30071 28962 gene locus_tag LOCUS_67040 30071 28962 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226964.1 protein_id gnl|my_center|LOCUS_67040 30218 31159 gene locus_tag LOCUS_67050 30218 31159 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_67050 >Feature sequence43 790 2424 gene locus_tag LOCUS_67060 790 2424 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224256.1 protein_id gnl|my_center|LOCUS_67060 2977 2480 gene locus_tag LOCUS_67070 2977 2480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224254.1 protein_id gnl|my_center|LOCUS_67070 4398 2974 gene locus_tag LOCUS_67080 gene miaB 4398 2974 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224253.1 protein_id gnl|my_center|LOCUS_67080 4590 5345 gene locus_tag LOCUS_67090 4590 5345 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_67090 5428 6291 gene locus_tag LOCUS_67100 5428 6291 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_67100 6374 7048 gene locus_tag LOCUS_67110 6374 7048 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_67110 7045 7968 gene locus_tag LOCUS_67120 7045 7968 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_67120 8869 8105 gene locus_tag LOCUS_67130 8869 8105 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_67130 10779 8866 gene locus_tag LOCUS_67140 10779 8866 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_67140 11589 10789 gene locus_tag LOCUS_67150 11589 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224225.1 protein_id gnl|my_center|LOCUS_67150 12634 12047 gene locus_tag LOCUS_67160 12634 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 13685 12639 gene locus_tag LOCUS_67170 gene recA 13685 12639 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_67170 14068 13874 gene locus_tag LOCUS_67180 14068 13874 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224216.1 protein_id gnl|my_center|LOCUS_67180 16013 14214 gene locus_tag LOCUS_67190 16013 14214 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224215.1 protein_id gnl|my_center|LOCUS_67190 17958 16015 gene locus_tag LOCUS_67200 17958 16015 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224215.1 protein_id gnl|my_center|LOCUS_67200 >Feature sequence44 219 1769 gene locus_tag LOCUS_67210 219 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 3049 1829 gene locus_tag LOCUS_67220 3049 1829 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_67220 3895 3086 gene locus_tag LOCUS_67230 3895 3086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_67230 4854 3892 gene locus_tag LOCUS_67240 4854 3892 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_67240 5726 4881 gene locus_tag LOCUS_67250 5726 4881 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_67250 6315 5800 gene locus_tag LOCUS_67260 6315 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_67260 6785 6393 gene locus_tag LOCUS_67270 6785 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 7752 6844 gene locus_tag LOCUS_67280 7752 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 7843 8223 gene locus_tag LOCUS_67290 7843 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67290 10472 8301 gene locus_tag LOCUS_67300 10472 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 11436 10984 gene locus_tag LOCUS_67310 gene rplI 11436 10984 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231004.1 protein_id gnl|my_center|LOCUS_67310 11701 11453 gene locus_tag LOCUS_67320 gene rpsR 11701 11453 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098744.1 protein_id gnl|my_center|LOCUS_67320 12246 11743 gene locus_tag LOCUS_67330 12246 11743 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231003.1 protein_id gnl|my_center|LOCUS_67330 12563 12258 gene locus_tag LOCUS_67340 gene rpsF 12563 12258 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742059.1 protein_id gnl|my_center|LOCUS_67340 13644 12643 gene locus_tag LOCUS_67350 13644 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 13801 14571 gene locus_tag LOCUS_67360 13801 14571 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_67360 14574 16094 gene locus_tag LOCUS_67370 14574 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 16614 17306 gene locus_tag LOCUS_67380 16614 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 <20298 17804 gene locus_tag LOCUS_67390 <20298 17804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230993.1:transglycosylase domain-containing protein >Feature sequence45 1771 428 gene locus_tag LOCUS_67400 gene glnA 1771 428 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223124.1 protein_id gnl|my_center|LOCUS_67400 3096 1795 gene locus_tag LOCUS_67410 3096 1795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_67410 3202 4149 gene locus_tag LOCUS_67420 3202 4149 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730373.1 protein_id gnl|my_center|LOCUS_67420 4220 4912 gene locus_tag LOCUS_67430 4220 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 4912 6441 gene locus_tag LOCUS_67440 4912 6441 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082328.1 protein_id gnl|my_center|LOCUS_67440 6441 6830 gene locus_tag LOCUS_67450 6441 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 8996 7401 gene locus_tag LOCUS_67460 8996 7401 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223121.1 protein_id gnl|my_center|LOCUS_67460 9115 11460 gene locus_tag LOCUS_67470 gene secA2 9115 11460 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_67470 11502 13205 gene locus_tag LOCUS_67480 11502 13205 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223119.1 protein_id gnl|my_center|LOCUS_67480 14169 13213 gene locus_tag LOCUS_67490 gene ftrA 14169 13213 CDS product transcriptional regulator FtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265949.1 protein_id gnl|my_center|LOCUS_67490 14168 14359 gene locus_tag LOCUS_67500 14168 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 14496 15389 gene locus_tag LOCUS_67510 gene panB 14496 15389 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223113.1 protein_id gnl|my_center|LOCUS_67510 15513 16145 gene locus_tag LOCUS_67520 15513 16145 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_67520 16666 16139 gene locus_tag LOCUS_67530 16666 16139 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742062.1 protein_id gnl|my_center|LOCUS_67530 17619 16684 gene locus_tag LOCUS_67540 17619 16684 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226183.1 protein_id gnl|my_center|LOCUS_67540 17653 18603 gene locus_tag LOCUS_67550 gene pip 17653 18603 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223110.1 protein_id gnl|my_center|LOCUS_67550 20898 18604 gene locus_tag LOCUS_67560 20898 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 21051 23585 gene locus_tag LOCUS_67570 21051 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 23605 24339 gene locus_tag LOCUS_67580 23605 24339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 24336 25097 gene locus_tag LOCUS_67590 24336 25097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 25101 26285 gene locus_tag LOCUS_67600 gene rifK 25101 26285 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_67600 26349 27356 gene locus_tag LOCUS_67610 26349 27356 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_67610 27359 28402 gene locus_tag LOCUS_67620 27359 28402 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086978.1 protein_id gnl|my_center|LOCUS_67620 29618 28407 gene locus_tag LOCUS_67630 29618 28407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 30627 29671 gene locus_tag LOCUS_67640 gene axeA 30627 29671 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_67640 31369 30638 gene locus_tag LOCUS_67650 31369 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67650 31442 33451 gene locus_tag LOCUS_67660 31442 33451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 33483 34688 gene locus_tag LOCUS_67670 33483 34688 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257104.1 protein_id gnl|my_center|LOCUS_67670 34745 35428 gene locus_tag LOCUS_67680 34745 35428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 35425 36174 gene locus_tag LOCUS_67690 35425 36174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 36259 37497 gene locus_tag LOCUS_67700 36259 37497 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776530.1 protein_id gnl|my_center|LOCUS_67700 37512 38408 gene locus_tag LOCUS_67710 37512 38408 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_67710 38405 39223 gene locus_tag LOCUS_67720 38405 39223 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_67720 39253 40155 gene locus_tag LOCUS_67730 39253 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 40158 41057 gene locus_tag LOCUS_67740 40158 41057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 42013 41243 gene locus_tag LOCUS_67750 42013 41243 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_67750 43017 42013 gene locus_tag LOCUS_67760 gene fgd 43017 42013 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225239.1 protein_id gnl|my_center|LOCUS_67760 43258 43064 gene locus_tag LOCUS_67770 43258 43064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223095.1 protein_id gnl|my_center|LOCUS_67770 43742 43275 gene locus_tag LOCUS_67780 43742 43275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 44762 43761 gene locus_tag LOCUS_67790 44762 43761 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223093.1 protein_id gnl|my_center|LOCUS_67790 45384 44764 gene locus_tag LOCUS_67800 45384 44764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223092.1 protein_id gnl|my_center|LOCUS_67800 47458 45386 gene locus_tag LOCUS_67810 47458 45386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223091.1 protein_id gnl|my_center|LOCUS_67810 51738 47455 gene locus_tag LOCUS_67820 51738 47455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 51842 52072 gene locus_tag LOCUS_67830 51842 52072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67830 52577 52311 gene locus_tag LOCUS_67840 52577 52311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562703.1 protein_id gnl|my_center|LOCUS_67840 54615 53458 gene locus_tag LOCUS_67850 54615 53458 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_67850 55349 54612 gene locus_tag LOCUS_67860 55349 54612 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_67860 56179 55346 gene locus_tag LOCUS_67870 56179 55346 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_67870 57231 56179 gene locus_tag LOCUS_67880 gene cobC 57231 56179 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_67880 57568 57999 gene locus_tag LOCUS_67890 57568 57999 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_67890 57996 58766 gene locus_tag LOCUS_67900 57996 58766 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_67900 58786 59592 gene locus_tag LOCUS_67910 58786 59592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223073.1 protein_id gnl|my_center|LOCUS_67910 60072 59665 gene locus_tag LOCUS_67920 60072 59665 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284305.1 protein_id gnl|my_center|LOCUS_67920 60134 60730 gene locus_tag LOCUS_67930 60134 60730 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029748.1 protein_id gnl|my_center|LOCUS_67930 61678 60740 gene locus_tag LOCUS_67940 61678 60740 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_67940 61784 62239 gene locus_tag LOCUS_67950 61784 62239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 62236 63090 gene locus_tag LOCUS_67960 gene galE 62236 63090 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_67960 63141 63743 gene locus_tag LOCUS_67970 63141 63743 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_67970 64207 63731 gene locus_tag LOCUS_67980 64207 63731 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226865.1 protein_id gnl|my_center|LOCUS_67980 64647 64228 gene locus_tag LOCUS_67990 64647 64228 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_67990 65614 64640 gene locus_tag LOCUS_68000 gene nudC 65614 64640 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223057.1 protein_id gnl|my_center|LOCUS_68000 66972 65611 gene locus_tag LOCUS_68010 66972 65611 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_68010 68252 66969 gene locus_tag LOCUS_68020 68252 66969 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_68020 69825 68275 gene locus_tag LOCUS_68030 69825 68275 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_68030 70360 70088 gene locus_tag LOCUS_68040 70360 70088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 70597 71457 gene locus_tag LOCUS_68050 70597 71457 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223052.1 protein_id gnl|my_center|LOCUS_68050 71891 71415 gene locus_tag LOCUS_68060 71891 71415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 73033 71924 gene locus_tag LOCUS_68070 73033 71924 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223041.1 protein_id gnl|my_center|LOCUS_68070 76319 73071 gene locus_tag LOCUS_68080 76319 73071 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223039.1 protein_id gnl|my_center|LOCUS_68080 76545 76312 gene locus_tag LOCUS_68090 76545 76312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 79646 76542 gene locus_tag LOCUS_68100 79646 76542 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_68100 79751 80077 gene locus_tag LOCUS_68110 79751 80077 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286299.1 protein_id gnl|my_center|LOCUS_68110 81703 80300 gene locus_tag LOCUS_68120 81703 80300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 82726 82112 gene locus_tag LOCUS_68130 82726 82112 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_68130 83849 82734 gene locus_tag LOCUS_68140 83849 82734 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_68140 84166 83846 gene locus_tag LOCUS_68150 gene nirD 84166 83846 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223030.1 protein_id gnl|my_center|LOCUS_68150 86649 84163 gene locus_tag LOCUS_68160 gene nirB 86649 84163 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_68160 88243 86738 gene locus_tag LOCUS_68170 88243 86738 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401380.1 protein_id gnl|my_center|LOCUS_68170 89682 88240 gene locus_tag LOCUS_68180 89682 88240 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_68180 91715 89679 gene locus_tag LOCUS_68190 91715 89679 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_68190 91806 92327 gene locus_tag LOCUS_68200 91806 92327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 93075 92314 gene locus_tag LOCUS_68210 93075 92314 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223025.1 protein_id gnl|my_center|LOCUS_68210 94335 93157 gene locus_tag LOCUS_68220 gene moeZ 94335 93157 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223024.1 protein_id gnl|my_center|LOCUS_68220 95049 94570 gene locus_tag LOCUS_68230 95049 94570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 95703 95095 gene locus_tag LOCUS_68240 95703 95095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 96482 95700 gene locus_tag LOCUS_68250 96482 95700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 97269 96550 gene locus_tag LOCUS_68260 97269 96550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 98251 97262 gene locus_tag LOCUS_68270 98251 97262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 98585 98280 gene locus_tag LOCUS_68280 98585 98280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 98949 98602 gene locus_tag LOCUS_68290 98949 98602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 99226 98993 gene locus_tag LOCUS_68300 99226 98993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 99475 100290 gene locus_tag LOCUS_68310 99475 100290 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230877.1 protein_id gnl|my_center|LOCUS_68310 100302 100475 gene locus_tag LOCUS_68320 100302 100475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 101576 100560 gene locus_tag LOCUS_68330 101576 100560 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223023.1 protein_id gnl|my_center|LOCUS_68330 102665 101640 gene locus_tag LOCUS_68340 102665 101640 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223022.1 protein_id gnl|my_center|LOCUS_68340 102744 103394 gene locus_tag LOCUS_68350 102744 103394 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223021.1 protein_id gnl|my_center|LOCUS_68350 103423 104136 gene locus_tag LOCUS_68360 103423 104136 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223018.1 protein_id gnl|my_center|LOCUS_68360 104362 104138 gene locus_tag LOCUS_68370 104362 104138 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080983.1 protein_id gnl|my_center|LOCUS_68370 105054 104404 gene locus_tag LOCUS_68380 105054 104404 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223015.1 protein_id gnl|my_center|LOCUS_68380 105132 106910 gene locus_tag LOCUS_68390 105132 106910 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223014.1 protein_id gnl|my_center|LOCUS_68390 106917 108305 gene locus_tag LOCUS_68400 106917 108305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187324690.1 protein_id gnl|my_center|LOCUS_68400 108357 109241 gene locus_tag LOCUS_68410 108357 109241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_68410 109610 109245 gene locus_tag LOCUS_68420 109610 109245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 110461 109613 gene locus_tag LOCUS_68430 110461 109613 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_68430 111125 110517 gene locus_tag LOCUS_68440 111125 110517 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223009.1 protein_id gnl|my_center|LOCUS_68440 112158 111295 gene locus_tag LOCUS_68450 112158 111295 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223008.1 protein_id gnl|my_center|LOCUS_68450 112776 112219 gene locus_tag LOCUS_68460 112776 112219 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_68460 112958 112794 gene locus_tag LOCUS_68470 112958 112794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 113219 113572 gene locus_tag LOCUS_68480 113219 113572 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_68480 114712 113597 gene locus_tag LOCUS_68490 114712 113597 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223005.1 protein_id gnl|my_center|LOCUS_68490 115224 114718 gene locus_tag LOCUS_68500 115224 114718 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223004.1 protein_id gnl|my_center|LOCUS_68500 115501 116580 gene locus_tag LOCUS_68510 gene corA 115501 116580 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_68510 116653 116781 gene locus_tag LOCUS_68520 116653 116781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68520 117902 116841 gene locus_tag LOCUS_68530 117902 116841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 118333 117902 gene locus_tag LOCUS_68540 118333 117902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 119928 118330 gene locus_tag LOCUS_68550 gene eccB 119928 118330 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081911197.1 protein_id gnl|my_center|LOCUS_68550 120357 121547 gene locus_tag LOCUS_68560 gene eccE 120357 121547 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304772.1 protein_id gnl|my_center|LOCUS_68560 121544 122281 gene locus_tag LOCUS_68570 121544 122281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222627.1 protein_id gnl|my_center|LOCUS_68570 122514 124097 gene locus_tag LOCUS_68580 122514 124097 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027742.1 protein_id gnl|my_center|LOCUS_68580 125011 124298 gene locus_tag LOCUS_68590 gene truA 125011 124298 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086862314.1 protein_id gnl|my_center|LOCUS_68590 125865 125137 gene locus_tag LOCUS_68600 125865 125137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 126920 125865 gene locus_tag LOCUS_68610 126920 125865 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558887.1 protein_id gnl|my_center|LOCUS_68610 127710 127105 gene locus_tag LOCUS_68620 gene rpsD 127710 127105 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222624.1 protein_id gnl|my_center|LOCUS_68620 128140 127733 gene locus_tag LOCUS_68630 gene rpsK 128140 127733 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558885.1 protein_id gnl|my_center|LOCUS_68630 128374 128159 gene locus_tag LOCUS_68640 128374 128159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68640 128751 128371 gene locus_tag LOCUS_68650 gene rpsM 128751 128371 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_68650 129353 129042 gene locus_tag LOCUS_68660 129353 129042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 129730 129350 gene locus_tag LOCUS_68670 129730 129350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 130669 129842 gene locus_tag LOCUS_68680 gene map 130669 129842 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_68680 131220 130666 gene locus_tag LOCUS_68690 131220 130666 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222620.1 protein_id gnl|my_center|LOCUS_68690 132518 131217 gene locus_tag LOCUS_68700 gene secY 132518 131217 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222619.1 protein_id gnl|my_center|LOCUS_68700 133668 132793 gene locus_tag LOCUS_68710 133668 132793 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226448.1 protein_id gnl|my_center|LOCUS_68710 134189 133743 gene locus_tag LOCUS_68720 gene rplO 134189 133743 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222616.1 protein_id gnl|my_center|LOCUS_68720 134374 134189 gene locus_tag LOCUS_68730 gene rpmD 134374 134189 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_68730 135026 134379 gene locus_tag LOCUS_68740 gene rpsE 135026 134379 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222614.1 protein_id gnl|my_center|LOCUS_68740 135462 135061 gene locus_tag LOCUS_68750 gene rplR 135462 135061 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_68750 136003 135464 gene locus_tag LOCUS_68760 gene rplF 136003 135464 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222612.1 protein_id gnl|my_center|LOCUS_68760 136418 136020 gene locus_tag LOCUS_68770 gene rpsH 136418 136020 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_68770 136674 136489 gene locus_tag LOCUS_68780 136674 136489 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558870.1 protein_id gnl|my_center|LOCUS_68780 137237 136674 gene locus_tag LOCUS_68790 gene rplE 137237 136674 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222611.1 protein_id gnl|my_center|LOCUS_68790 137551 137237 gene locus_tag LOCUS_68800 gene rplX 137551 137237 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222610.1 protein_id gnl|my_center|LOCUS_68800 137923 137555 gene locus_tag LOCUS_68810 gene rplN 137923 137555 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_68810 138201 137920 gene locus_tag LOCUS_68820 gene rpsQ 138201 137920 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_68820 138446 138198 gene locus_tag LOCUS_68830 gene rpmC 138446 138198 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222608.1 protein_id gnl|my_center|LOCUS_68830 138865 138446 gene locus_tag LOCUS_68840 gene rplP 138865 138446 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558864.1 protein_id gnl|my_center|LOCUS_68840 139717 138869 gene locus_tag LOCUS_68850 gene rpsC 139717 138869 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222607.1 protein_id gnl|my_center|LOCUS_68850 140139 139717 gene locus_tag LOCUS_68860 gene rplV 140139 139717 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222606.1 protein_id gnl|my_center|LOCUS_68860 140437 140156 gene locus_tag LOCUS_68870 gene rpsS 140437 140156 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_68870 141293 140457 gene locus_tag LOCUS_68880 gene rplB 141293 140457 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_68880 141625 141329 gene locus_tag LOCUS_68890 gene rplW 141625 141329 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102087.1 protein_id gnl|my_center|LOCUS_68890 142515 141622 gene locus_tag LOCUS_68900 gene rplD 142515 141622 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776376.1 protein_id gnl|my_center|LOCUS_68900 143165 142512 gene locus_tag LOCUS_68910 gene rplC 143165 142512 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_68910 143484 143179 gene locus_tag LOCUS_68920 gene rpsJ 143484 143179 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102098.1 protein_id gnl|my_center|LOCUS_68920 144940 143747 gene locus_tag LOCUS_68930 gene tuf 144940 143747 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_68930 147157 145058 gene locus_tag LOCUS_68940 gene fusA 147157 145058 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222602.1 protein_id gnl|my_center|LOCUS_68940 147689 147219 gene locus_tag LOCUS_68950 gene rpsG 147689 147219 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 protein_id gnl|my_center|LOCUS_68950 148065 147691 gene locus_tag LOCUS_68960 gene rpsL 148065 147691 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_68960 148804 148400 gene locus_tag LOCUS_68970 148804 148400 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230831.1 protein_id gnl|my_center|LOCUS_68970 149076 148801 gene locus_tag LOCUS_68980 149076 148801 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304855.1 protein_id gnl|my_center|LOCUS_68980 149712 149176 gene locus_tag LOCUS_68990 149712 149176 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111272.1 protein_id gnl|my_center|LOCUS_68990 153687 149788 gene locus_tag LOCUS_69000 153687 149788 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_69000 157224 153733 gene locus_tag LOCUS_69010 157224 153733 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222586.1 protein_id gnl|my_center|LOCUS_69010 158141 157515 gene locus_tag LOCUS_69020 158141 157515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 158758 158138 gene locus_tag LOCUS_69030 158758 158138 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028337.1 protein_id gnl|my_center|LOCUS_69030 159885 158752 gene locus_tag LOCUS_69040 159885 158752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 160604 159918 gene locus_tag LOCUS_69050 160604 159918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 161886 160627 gene locus_tag LOCUS_69060 161886 160627 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222539.1 protein_id gnl|my_center|LOCUS_69060 163058 161886 gene locus_tag LOCUS_69070 163058 161886 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 protein_id gnl|my_center|LOCUS_69070 164248 163058 gene locus_tag LOCUS_69080 164248 163058 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_69080 165228 164245 gene locus_tag LOCUS_69090 165228 164245 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222536.1 protein_id gnl|my_center|LOCUS_69090 166259 165225 gene locus_tag LOCUS_69100 166259 165225 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 protein_id gnl|my_center|LOCUS_69100 167575 166256 gene locus_tag LOCUS_69110 167575 166256 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222534.1 protein_id gnl|my_center|LOCUS_69110 168434 167595 gene locus_tag LOCUS_69120 168434 167595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222533.1 protein_id gnl|my_center|LOCUS_69120 169228 168437 gene locus_tag LOCUS_69130 169228 168437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223675.1 protein_id gnl|my_center|LOCUS_69130 170343 169225 gene locus_tag LOCUS_69140 170343 169225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 protein_id gnl|my_center|LOCUS_69140 170872 170480 gene locus_tag LOCUS_69150 gene rplL 170872 170480 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908596.1 protein_id gnl|my_center|LOCUS_69150 171450 170908 gene locus_tag LOCUS_69160 gene rplJ 171450 170908 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 protein_id gnl|my_center|LOCUS_69160 171739 172623 gene locus_tag LOCUS_69170 171739 172623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69170 172697 173620 gene locus_tag LOCUS_69180 172697 173620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 174404 173685 gene locus_tag LOCUS_69190 gene rplA 174404 173685 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222526.1 protein_id gnl|my_center|LOCUS_69190 174981 174550 gene locus_tag LOCUS_69200 gene rplK 174981 174550 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222525.1 protein_id gnl|my_center|LOCUS_69200 175899 175030 gene locus_tag LOCUS_69210 gene nusG 175899 175030 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222524.1 protein_id gnl|my_center|LOCUS_69210 176393 175944 gene locus_tag LOCUS_69220 gene secE 176393 175944 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222523.1 protein_id gnl|my_center|LOCUS_69220 176508 176435 gene locus_tag LOCUS_t00660 176508 176435 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 176694 177911 gene locus_tag LOCUS_69230 176694 177911 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_69230 178111 178857 gene locus_tag LOCUS_69240 178111 178857 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029312.1 protein_id gnl|my_center|LOCUS_69240 179283 178861 gene locus_tag LOCUS_69250 179283 178861 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222518.1 protein_id gnl|my_center|LOCUS_69250 179726 179280 gene locus_tag LOCUS_69260 179726 179280 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_69260 179892 179728 gene locus_tag LOCUS_69270 gene rpmG 179892 179728 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_69270 179991 179918 gene locus_tag LOCUS_t00670 179991 179918 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 180125 180052 gene locus_tag LOCUS_t00680 180125 180052 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 182847 180199 gene locus_tag LOCUS_69280 182847 180199 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222516.1 protein_id gnl|my_center|LOCUS_69280 183968 182997 gene locus_tag LOCUS_69290 183968 182997 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_69290 184653 184048 gene locus_tag LOCUS_69300 184653 184048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 184676 185023 gene locus_tag LOCUS_69310 184676 185023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 185495 185782 gene locus_tag LOCUS_69320 185495 185782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 186212 185973 gene locus_tag LOCUS_69330 186212 185973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 186739 186212 gene locus_tag LOCUS_69340 186739 186212 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230489.1 protein_id gnl|my_center|LOCUS_69340 187235 187154 gene locus_tag LOCUS_t00690 187235 187154 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 187380 187871 gene locus_tag LOCUS_69350 187380 187871 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222510.1 protein_id gnl|my_center|LOCUS_69350 187941 188822 gene locus_tag LOCUS_69360 gene rfbA 187941 188822 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222507.1 protein_id gnl|my_center|LOCUS_69360 190088 189225 gene locus_tag LOCUS_69370 gene htpX 190088 189225 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222504.1 protein_id gnl|my_center|LOCUS_69370 190942 190181 gene locus_tag LOCUS_69380 190942 190181 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_69380 190982 191305 gene locus_tag LOCUS_69390 190982 191305 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 protein_id gnl|my_center|LOCUS_69390 192187 191285 gene locus_tag LOCUS_69400 192187 191285 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_69400 192901 192260 gene locus_tag LOCUS_69410 192901 192260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 193760 192927 gene locus_tag LOCUS_69420 193760 192927 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_69420 193919 194284 gene locus_tag LOCUS_69430 193919 194284 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261465.1 protein_id gnl|my_center|LOCUS_69430 194468 196378 gene locus_tag LOCUS_69440 194468 196378 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_69440 196375 197427 gene locus_tag LOCUS_69450 196375 197427 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222471.1 protein_id gnl|my_center|LOCUS_69450 198141 197431 gene locus_tag LOCUS_69460 198141 197431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 199826 198249 gene locus_tag LOCUS_69470 199826 198249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69470 200966 199923 gene locus_tag LOCUS_69480 200966 199923 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222468.1 protein_id gnl|my_center|LOCUS_69480 202693 201077 gene locus_tag LOCUS_69490 gene nuoN 202693 201077 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222464.1 protein_id gnl|my_center|LOCUS_69490 204269 202695 gene locus_tag LOCUS_69500 204269 202695 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222463.1 protein_id gnl|my_center|LOCUS_69500 206191 204269 gene locus_tag LOCUS_69510 gene nuoL 206191 204269 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222462.1 protein_id gnl|my_center|LOCUS_69510 206549 206250 gene locus_tag LOCUS_69520 gene nuoK 206549 206250 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_69520 207394 206546 gene locus_tag LOCUS_69530 207394 206546 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222461.1 protein_id gnl|my_center|LOCUS_69530 207939 207391 gene locus_tag LOCUS_69540 gene nuoI 207939 207391 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_69540 209251 207926 gene locus_tag LOCUS_69550 gene nuoH 209251 207926 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222459.1 protein_id gnl|my_center|LOCUS_69550 211731 209248 gene locus_tag LOCUS_69560 211731 209248 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222458.1 protein_id gnl|my_center|LOCUS_69560 213050 211728 gene locus_tag LOCUS_69570 gene nuoF 213050 211728 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222457.1 protein_id gnl|my_center|LOCUS_69570 213790 213047 gene locus_tag LOCUS_69580 gene nuoE 213790 213047 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222456.1 protein_id gnl|my_center|LOCUS_69580 214650 213787 gene locus_tag LOCUS_69590 214650 213787 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222454.1 protein_id gnl|my_center|LOCUS_69590 215204 214656 gene locus_tag LOCUS_69600 215204 214656 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_69600 215562 215221 gene locus_tag LOCUS_69610 215562 215221 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222453.1 protein_id gnl|my_center|LOCUS_69610 217064 215835 gene locus_tag LOCUS_69620 217064 215835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_69620 217124 218089 gene locus_tag LOCUS_69630 217124 218089 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_69630 218958 218155 gene locus_tag LOCUS_69640 218958 218155 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229844.1 protein_id gnl|my_center|LOCUS_69640 219260 220399 gene locus_tag LOCUS_69650 219260 220399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225785.1 protein_id gnl|my_center|LOCUS_69650 221393 220464 gene locus_tag LOCUS_69660 221393 220464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69660 221458 223452 gene locus_tag LOCUS_69670 221458 223452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_69670 223526 224389 gene locus_tag LOCUS_69680 223526 224389 CDS product cell division protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229848.1 protein_id gnl|my_center|LOCUS_69680 224815 224399 gene locus_tag LOCUS_69690 224815 224399 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_69690 225647 224850 gene locus_tag LOCUS_69700 225647 224850 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_69700 225944 225870 gene locus_tag LOCUS_t00700 225944 225870 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 227411 226092 gene locus_tag LOCUS_69710 227411 226092 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_69710 227983 227381 gene locus_tag LOCUS_69720 227983 227381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 229344 227980 gene locus_tag LOCUS_69730 229344 227980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69730 230315 229341 gene locus_tag LOCUS_69740 230315 229341 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804471.1 protein_id gnl|my_center|LOCUS_69740 230776 230312 gene locus_tag LOCUS_69750 230776 230312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69750 231474 230773 gene locus_tag LOCUS_69760 231474 230773 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804478.1 protein_id gnl|my_center|LOCUS_69760 232083 231484 gene locus_tag LOCUS_69770 232083 231484 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_69770 232202 233671 gene locus_tag LOCUS_69780 232202 233671 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229918.1 protein_id gnl|my_center|LOCUS_69780 233825 235513 gene locus_tag LOCUS_69790 233825 235513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072481751.1 protein_id gnl|my_center|LOCUS_69790 237297 235573 gene locus_tag LOCUS_69800 237297 235573 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_69800 238353 237346 gene locus_tag LOCUS_69810 238353 237346 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229920.1 protein_id gnl|my_center|LOCUS_69810 239377 238346 gene locus_tag LOCUS_69820 239377 238346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_69820 240344 239382 gene locus_tag LOCUS_69830 240344 239382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229922.1 protein_id gnl|my_center|LOCUS_69830 241263 240337 gene locus_tag LOCUS_69840 241263 240337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229923.1 protein_id gnl|my_center|LOCUS_69840 243001 241340 gene locus_tag LOCUS_69850 243001 241340 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949626.1 protein_id gnl|my_center|LOCUS_69850 244171 243218 gene locus_tag LOCUS_69860 244171 243218 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_69860 245489 244212 gene locus_tag LOCUS_69870 245489 244212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 246168 245680 gene locus_tag LOCUS_69880 246168 245680 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229927.1 protein_id gnl|my_center|LOCUS_69880 246725 246165 gene locus_tag LOCUS_69890 246725 246165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 248015 246729 gene locus_tag LOCUS_69900 gene eno 248015 246729 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229929.1 protein_id gnl|my_center|LOCUS_69900 248461 248847 gene locus_tag LOCUS_69910 248461 248847 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284181.1 protein_id gnl|my_center|LOCUS_69910 249707 248844 gene locus_tag LOCUS_69920 249707 248844 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229932.1 protein_id gnl|my_center|LOCUS_69920 252982 249761 gene locus_tag LOCUS_69930 252982 249761 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_69930 253936 252992 gene locus_tag LOCUS_69940 253936 252992 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229944.1 protein_id gnl|my_center|LOCUS_69940 254775 253933 gene locus_tag LOCUS_69950 254775 253933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630323.1 protein_id gnl|my_center|LOCUS_69950 254999 255169 gene locus_tag LOCUS_69960 254999 255169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 259428 255847 gene locus_tag LOCUS_69970 gene mfd 259428 255847 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229948.1 protein_id gnl|my_center|LOCUS_69970 260284 259514 gene locus_tag LOCUS_69980 260284 259514 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284474.1 protein_id gnl|my_center|LOCUS_69980 261235 260312 gene locus_tag LOCUS_69990 261235 260312 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977970.1 protein_id gnl|my_center|LOCUS_69990 263021 261510 gene locus_tag LOCUS_70000 263021 261510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 263084 264313 gene locus_tag LOCUS_70010 263084 264313 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_70010 264916 264317 gene locus_tag LOCUS_70020 264916 264317 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467756.1 protein_id gnl|my_center|LOCUS_70020 266010 265048 gene locus_tag LOCUS_70030 266010 265048 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229961.1 protein_id gnl|my_center|LOCUS_70030 266247 266318 gene locus_tag LOCUS_t00710 266247 266318 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 266366 268084 gene locus_tag LOCUS_70040 266366 268084 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229962.1 protein_id gnl|my_center|LOCUS_70040 268150 269619 gene locus_tag LOCUS_70050 gene glmU 268150 269619 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467757.1 protein_id gnl|my_center|LOCUS_70050 269616 270596 gene locus_tag LOCUS_70060 269616 270596 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_70060 270792 271418 gene locus_tag LOCUS_70070 270792 271418 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229968.1 protein_id gnl|my_center|LOCUS_70070 271476 272060 gene locus_tag LOCUS_70080 gene pth 271476 272060 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_70080 273204 272455 gene locus_tag LOCUS_70090 273204 272455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 273663 273211 gene locus_tag LOCUS_70100 273663 273211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70100 273698 274000 gene locus_tag LOCUS_70110 273698 274000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70110 275642 273972 gene locus_tag LOCUS_70120 275642 273972 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229972.1 protein_id gnl|my_center|LOCUS_70120 277432 275663 gene locus_tag LOCUS_70130 277432 275663 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229973.1 protein_id gnl|my_center|LOCUS_70130 278418 277456 gene locus_tag LOCUS_70140 278418 277456 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_70140 279458 278457 gene locus_tag LOCUS_70150 279458 278457 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229976.1 protein_id gnl|my_center|LOCUS_70150 279541 279705 gene locus_tag LOCUS_70160 279541 279705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 280685 279825 gene locus_tag LOCUS_70170 gene rsmA 280685 279825 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_70170 282265 280703 gene locus_tag LOCUS_70180 282265 280703 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_70180 283319 282462 gene locus_tag LOCUS_70190 283319 282462 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229979.1 protein_id gnl|my_center|LOCUS_70190 285184 283388 gene locus_tag LOCUS_70200 gene metG 285184 283388 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_70200 285249 285851 gene locus_tag LOCUS_70210 285249 285851 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_70210 285928 286893 gene locus_tag LOCUS_70220 285928 286893 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_70220 286883 287650 gene locus_tag LOCUS_70230 286883 287650 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_70230 287973 287791 gene locus_tag LOCUS_70240 287973 287791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 288510 288091 gene locus_tag LOCUS_70250 288510 288091 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965703.1 protein_id gnl|my_center|LOCUS_70250 289581 288601 gene locus_tag LOCUS_70260 289581 288601 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_70260 290481 289645 gene locus_tag LOCUS_70270 gene rsmI 290481 289645 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_70270 290553 292127 gene locus_tag LOCUS_70280 290553 292127 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229989.1 protein_id gnl|my_center|LOCUS_70280 293972 292152 gene locus_tag LOCUS_70290 293972 292152 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229992.1 protein_id gnl|my_center|LOCUS_70290 294207 296087 gene locus_tag LOCUS_70300 294207 296087 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_70300 297554 296160 gene locus_tag LOCUS_70310 gene lpdA 297554 296160 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_70310 297885 299180 gene locus_tag LOCUS_70320 297885 299180 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226207.1 protein_id gnl|my_center|LOCUS_70320 299177 300148 gene locus_tag LOCUS_70330 299177 300148 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226208.1 protein_id gnl|my_center|LOCUS_70330 300145 300960 gene locus_tag LOCUS_70340 300145 300960 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226209.1 protein_id gnl|my_center|LOCUS_70340 301153 302625 gene locus_tag LOCUS_70350 301153 302625 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_70350 303912 302653 gene locus_tag LOCUS_70360 303912 302653 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_70360 304746 303913 gene locus_tag LOCUS_70370 304746 303913 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_70370 306097 304748 gene locus_tag LOCUS_70380 306097 304748 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_70380 306245 306970 gene locus_tag LOCUS_70390 306245 306970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 308227 307187 gene locus_tag LOCUS_70400 308227 307187 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_70400 310251 308224 gene locus_tag LOCUS_70410 gene pabB 310251 308224 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_70410 311096 310380 gene locus_tag LOCUS_70420 311096 310380 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226466.1 protein_id gnl|my_center|LOCUS_70420 311183 312694 gene locus_tag LOCUS_70430 311183 312694 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_70430 312702 313115 gene locus_tag LOCUS_70440 312702 313115 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554466.1 protein_id gnl|my_center|LOCUS_70440 313102 313791 gene locus_tag LOCUS_70450 313102 313791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70450 315106 313781 gene locus_tag LOCUS_70460 315106 313781 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_70460 316516 315173 gene locus_tag LOCUS_70470 316516 315173 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222455.1 protein_id gnl|my_center|LOCUS_70470 316752 317459 gene locus_tag LOCUS_70480 316752 317459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70480 317788 318237 gene locus_tag LOCUS_70490 317788 318237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 318990 318915 gene locus_tag LOCUS_t00720 318990 318915 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 319945 319016 gene locus_tag LOCUS_70500 319945 319016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230036.1 protein_id gnl|my_center|LOCUS_70500 320686 320045 gene locus_tag LOCUS_70510 320686 320045 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230037.1 protein_id gnl|my_center|LOCUS_70510 321938 320715 gene locus_tag LOCUS_70520 321938 320715 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230038.1 protein_id gnl|my_center|LOCUS_70520 322814 321960 gene locus_tag LOCUS_70530 322814 321960 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230039.1 protein_id gnl|my_center|LOCUS_70530 322726 322950 gene locus_tag LOCUS_70540 322726 322950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 322947 323516 gene locus_tag LOCUS_70550 322947 323516 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048375.1 protein_id gnl|my_center|LOCUS_70550 324070 323774 gene locus_tag LOCUS_70560 324070 323774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 324117 324776 gene locus_tag LOCUS_70570 324117 324776 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230042.1 protein_id gnl|my_center|LOCUS_70570 324836 325309 gene locus_tag LOCUS_70580 gene mscL 324836 325309 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230043.1 protein_id gnl|my_center|LOCUS_70580 325437 326051 gene locus_tag LOCUS_70590 325437 326051 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229206.1 protein_id gnl|my_center|LOCUS_70590 326048 326236 gene locus_tag LOCUS_70600 326048 326236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230044.1 protein_id gnl|my_center|LOCUS_70600 326995 326495 gene locus_tag LOCUS_70610 326995 326495 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230045.1 protein_id gnl|my_center|LOCUS_70610 327851 327471 gene locus_tag LOCUS_70620 327851 327471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224578.1 protein_id gnl|my_center|LOCUS_70620 327973 329895 gene locus_tag LOCUS_70630 327973 329895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70630 330962 329892 gene locus_tag LOCUS_70640 330962 329892 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230049.1 protein_id gnl|my_center|LOCUS_70640 331632 330946 gene locus_tag LOCUS_70650 331632 330946 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_70650 332219 331629 gene locus_tag LOCUS_70660 332219 331629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 332344 333384 gene locus_tag LOCUS_70670 332344 333384 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284184.1 protein_id gnl|my_center|LOCUS_70670 334816 333401 gene locus_tag LOCUS_70680 334816 333401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230051.1 protein_id gnl|my_center|LOCUS_70680 334926 335594 gene locus_tag LOCUS_70690 334926 335594 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230052.1 protein_id gnl|my_center|LOCUS_70690 335591 336259 gene locus_tag LOCUS_70700 335591 336259 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230053.1 protein_id gnl|my_center|LOCUS_70700 336256 336876 gene locus_tag LOCUS_70710 336256 336876 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_70710 336873 338006 gene locus_tag LOCUS_70720 336873 338006 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230055.1 protein_id gnl|my_center|LOCUS_70720 338003 338431 gene locus_tag LOCUS_70730 338003 338431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 340304 338610 gene locus_tag LOCUS_70740 340304 338610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 341753 340368 gene locus_tag LOCUS_70750 341753 340368 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_70750 342442 341750 gene locus_tag LOCUS_70760 342442 341750 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_70760 343890 342514 gene locus_tag LOCUS_70770 343890 342514 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_70770 344197 345651 gene locus_tag LOCUS_70780 344197 345651 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043779113.1 protein_id gnl|my_center|LOCUS_70780 345648 346070 gene locus_tag LOCUS_70790 345648 346070 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223333.1 protein_id gnl|my_center|LOCUS_70790 346067 346426 gene locus_tag LOCUS_70800 346067 346426 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223334.1 protein_id gnl|my_center|LOCUS_70800 346407 347012 gene locus_tag LOCUS_70810 346407 347012 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862774.1 protein_id gnl|my_center|LOCUS_70810 347009 348214 gene locus_tag LOCUS_70820 347009 348214 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223336.1 protein_id gnl|my_center|LOCUS_70820 348746 348249 gene locus_tag LOCUS_70830 348746 348249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 349366 348743 gene locus_tag LOCUS_70840 349366 348743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70840 350723 349410 gene locus_tag LOCUS_70850 350723 349410 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855336.1 protein_id gnl|my_center|LOCUS_70850 350904 351299 gene locus_tag LOCUS_70860 350904 351299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224064.1 protein_id gnl|my_center|LOCUS_70860 351296 351742 gene locus_tag LOCUS_70870 351296 351742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70870 351739 351975 gene locus_tag LOCUS_70880 351739 351975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 352759 351989 gene locus_tag LOCUS_70890 352759 351989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 353346 352759 gene locus_tag LOCUS_70900 353346 352759 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466608.1 protein_id gnl|my_center|LOCUS_70900 353757 353389 gene locus_tag LOCUS_70910 353757 353389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70910 354683 353754 gene locus_tag LOCUS_70920 354683 353754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70920 355206 354814 gene locus_tag LOCUS_70930 355206 354814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 356455 355283 gene locus_tag LOCUS_70940 356455 355283 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_70940 357313 356468 gene locus_tag LOCUS_70950 357313 356468 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_70950 357627 357310 gene locus_tag LOCUS_70960 357627 357310 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_70960 357693 358346 gene locus_tag LOCUS_70970 357693 358346 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228601.1 protein_id gnl|my_center|LOCUS_70970 358388 358855 gene locus_tag LOCUS_70980 358388 358855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 358858 359217 gene locus_tag LOCUS_70990 358858 359217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 359709 359846 gene locus_tag LOCUS_71000 359709 359846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 360406 359843 gene locus_tag LOCUS_71010 360406 359843 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230063.1 protein_id gnl|my_center|LOCUS_71010 361795 360584 gene locus_tag LOCUS_71020 361795 360584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_71020 362703 361792 gene locus_tag LOCUS_71030 362703 361792 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_71030 362869 362942 gene locus_tag LOCUS_t00730 362869 362942 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 363079 363447 gene locus_tag LOCUS_71040 363079 363447 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_71040 363835 363614 gene locus_tag LOCUS_71050 363835 363614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71050 363758 365422 gene locus_tag LOCUS_71060 363758 365422 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_71060 367160 365523 gene locus_tag LOCUS_71070 367160 365523 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_71070 369384 368098 gene locus_tag LOCUS_71080 369384 368098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71080 370172 369381 gene locus_tag LOCUS_71090 370172 369381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 370491 370300 gene locus_tag LOCUS_71100 370491 370300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71100 370800 370522 gene locus_tag LOCUS_71110 370800 370522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71110 373704 370939 gene locus_tag LOCUS_71120 373704 370939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71120 374638 374372 gene locus_tag LOCUS_71130 374638 374372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 374813 375424 gene locus_tag LOCUS_71140 374813 375424 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_71140 379056 375421 gene locus_tag LOCUS_71150 379056 375421 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179846880.1 protein_id gnl|my_center|LOCUS_71150 379949 379053 gene locus_tag LOCUS_71160 379949 379053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 380870 381985 gene locus_tag LOCUS_71170 380870 381985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 382048 383583 gene locus_tag LOCUS_71180 382048 383583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 383580 384824 gene locus_tag LOCUS_71190 383580 384824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71190 384821 388864 gene locus_tag LOCUS_71200 384821 388864 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052667156.1 protein_id gnl|my_center|LOCUS_71200 389100 389225 gene locus_tag LOCUS_71210 389100 389225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 389235 389903 gene locus_tag LOCUS_71220 389235 389903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71220 390041 391225 gene locus_tag LOCUS_71230 390041 391225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71230 391232 391858 gene locus_tag LOCUS_71240 391232 391858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71240 394452 392095 gene locus_tag LOCUS_71250 394452 392095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 395442 394675 gene locus_tag LOCUS_71260 395442 394675 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_71260 396710 395454 gene locus_tag LOCUS_71270 396710 395454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 398251 396707 gene locus_tag LOCUS_71280 398251 396707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71280 398513 400027 gene locus_tag LOCUS_71290 398513 400027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71290 400093 400782 gene locus_tag LOCUS_71300 400093 400782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71300 402636 401203 gene locus_tag LOCUS_71310 gene eccB 402636 401203 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224123.1 protein_id gnl|my_center|LOCUS_71310 404019 402640 gene locus_tag LOCUS_71320 gene eccD 404019 402640 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224120.1 protein_id gnl|my_center|LOCUS_71320 405800 405525 gene locus_tag LOCUS_71330 405800 405525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 406388 406858 gene locus_tag LOCUS_71340 406388 406858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 409168 406997 gene locus_tag LOCUS_71350 409168 406997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 410552 409416 gene locus_tag LOCUS_71360 410552 409416 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_71360 411510 410557 gene locus_tag LOCUS_71370 411510 410557 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_71370 413741 411507 gene locus_tag LOCUS_71380 413741 411507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 414297 415454 gene locus_tag LOCUS_71390 414297 415454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71390 415667 416281 gene locus_tag LOCUS_71400 415667 416281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 416275 416913 gene locus_tag LOCUS_71410 416275 416913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 417643 416984 gene locus_tag LOCUS_71420 417643 416984 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 protein_id gnl|my_center|LOCUS_71420 419285 417657 gene locus_tag LOCUS_71430 419285 417657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 420670 419285 gene locus_tag LOCUS_71440 420670 419285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 420705 421367 gene locus_tag LOCUS_71450 420705 421367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_71450 421364 422626 gene locus_tag LOCUS_71460 421364 422626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71460 423026 422613 gene locus_tag LOCUS_71470 423026 422613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71470 429099 423079 gene locus_tag LOCUS_71480 429099 423079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 429514 429104 gene locus_tag LOCUS_71490 429514 429104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71490 429879 429517 gene locus_tag LOCUS_71500 429879 429517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 429977 431233 gene locus_tag LOCUS_71510 429977 431233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71510 431336 432196 gene locus_tag LOCUS_71520 431336 432196 CDS product DUF3626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226733.1 protein_id gnl|my_center|LOCUS_71520 432258 433238 gene locus_tag LOCUS_71530 432258 433238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 433310 433927 gene locus_tag LOCUS_71540 433310 433927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 434004 434894 gene locus_tag LOCUS_71550 434004 434894 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957882.1 protein_id gnl|my_center|LOCUS_71550 434989 435558 gene locus_tag LOCUS_71560 434989 435558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_71560 435545 435877 gene locus_tag LOCUS_71570 435545 435877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71570 436313 436002 gene locus_tag LOCUS_71580 436313 436002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 436655 436326 gene locus_tag LOCUS_71590 436655 436326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 436834 440757 gene locus_tag LOCUS_71600 436834 440757 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224114.1 protein_id gnl|my_center|LOCUS_71600 440822 441205 gene locus_tag LOCUS_71610 440822 441205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 >Feature sequence46 1998 1675 gene locus_tag LOCUS_71620 1998 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 2420 1995 gene locus_tag LOCUS_71630 2420 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 3120 2515 gene locus_tag LOCUS_71640 3120 2515 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878897.1 protein_id gnl|my_center|LOCUS_71640 4064 3117 gene locus_tag LOCUS_71650 4064 3117 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222886.1 protein_id gnl|my_center|LOCUS_71650 4612 4061 gene locus_tag LOCUS_71660 4612 4061 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_71660 5557 4706 gene locus_tag LOCUS_71670 5557 4706 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286032.1 protein_id gnl|my_center|LOCUS_71670 5675 7312 gene locus_tag LOCUS_71680 5675 7312 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222858.1 protein_id gnl|my_center|LOCUS_71680 7309 7524 gene locus_tag LOCUS_71690 7309 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 7618 9213 gene locus_tag LOCUS_71700 7618 9213 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831451.1 protein_id gnl|my_center|LOCUS_71700 9224 9850 gene locus_tag LOCUS_71710 9224 9850 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222850.1 protein_id gnl|my_center|LOCUS_71710 10520 9858 gene locus_tag LOCUS_71720 10520 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 10679 12484 gene locus_tag LOCUS_71730 10679 12484 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222846.1 protein_id gnl|my_center|LOCUS_71730 12503 12934 gene locus_tag LOCUS_71740 12503 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71740 12981 13400 gene locus_tag LOCUS_71750 12981 13400 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222845.1 protein_id gnl|my_center|LOCUS_71750 13561 13920 gene locus_tag LOCUS_71760 13561 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71760 13917 15206 gene locus_tag LOCUS_71770 13917 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71770 15217 15999 gene locus_tag LOCUS_71780 15217 15999 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_71780 >Feature sequence47 2168 126 gene locus_tag LOCUS_71790 2168 126 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_71790 4340 2313 gene locus_tag LOCUS_71800 4340 2313 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_71800 5188 4433 gene locus_tag LOCUS_71810 5188 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71810 5715 5188 gene locus_tag LOCUS_71820 5715 5188 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838322.1 protein_id gnl|my_center|LOCUS_71820 6418 5753 gene locus_tag LOCUS_71830 6418 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 6528 6896 gene locus_tag LOCUS_71840 6528 6896 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 protein_id gnl|my_center|LOCUS_71840 7992 6898 gene locus_tag LOCUS_71850 7992 6898 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230990.1 protein_id gnl|my_center|LOCUS_71850 8648 8076 gene locus_tag LOCUS_71860 8648 8076 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230991.1 protein_id gnl|my_center|LOCUS_71860 8860 9294 gene locus_tag LOCUS_71870 8860 9294 CDS product DUF5318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230992.1 protein_id gnl|my_center|LOCUS_71870 >Feature sequence48 5194 1196 gene locus_tag LOCUS_71880 5194 1196 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222635.1 protein_id gnl|my_center|LOCUS_71880 5374 6747 gene locus_tag LOCUS_71890 gene eccD 5374 6747 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222634.1 protein_id gnl|my_center|LOCUS_71890 6747 8192 gene locus_tag LOCUS_71900 gene mycP1 6747 8192 CDS product type VII secretion system ESX-1 serine protease mycosin MycP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726654.1 protein_id gnl|my_center|LOCUS_71900 9011 8196 gene locus_tag LOCUS_71910 9011 8196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 >Feature sequence49 <1 964 gene locus_tag LOCUS_71920 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222887.1:TNT domain-containing protein 961 1245 gene locus_tag LOCUS_71930 961 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105220.1 protein_id gnl|my_center|LOCUS_71930 2029 1232 gene locus_tag LOCUS_71940 gene hisN 2029 1232 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222889.1 protein_id gnl|my_center|LOCUS_71940 2089 2628 gene locus_tag LOCUS_71950 2089 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 2825 3484 gene locus_tag LOCUS_71960 2825 3484 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_71960 3487 4773 gene locus_tag LOCUS_71970 3487 4773 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 protein_id gnl|my_center|LOCUS_71970 5321 4776 gene locus_tag LOCUS_71980 5321 4776 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286038.1 protein_id gnl|my_center|LOCUS_71980 >Feature sequence50 847 86 gene locus_tag LOCUS_71990 847 86 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970345.1 protein_id gnl|my_center|LOCUS_71990 2229 2038 gene locus_tag LOCUS_72000 2229 2038 CDS product Rop family plasmid primer RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213433.1 protein_id gnl|my_center|LOCUS_72000 2596 2333 gene locus_tag LOCUS_72010 2596 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72010 2931 2626 gene locus_tag LOCUS_72020 2931 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 4120 3038 gene locus_tag LOCUS_72030 gene lacI 4120 3038 CDS product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805902.1 protein_id gnl|my_center|LOCUS_72030 4296 4535 gene locus_tag LOCUS_72040 4296 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 4654 5910 gene locus_tag LOCUS_72050 4654 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72050 >Feature sequence51 >Feature sequence52 111 1624 gene locus_tag LOCUS_r00010 111 1624 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1984 5099 gene locus_tag LOCUS_r00020 1984 5099 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence53 >Feature sequence54 93 1364 gene locus_tag LOCUS_72060 93 1364 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229302.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72060 >Feature sequence55 365 1360 gene locus_tag LOCUS_72070 365 1360 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043791004.1 protein_id gnl|my_center|LOCUS_72070 >Feature sequence56 58 357 gene locus_tag LOCUS_72080 58 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 347 1999 gene locus_tag LOCUS_72090 347 1999 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088458.1 protein_id gnl|my_center|LOCUS_72090 2014 3048 gene locus_tag LOCUS_72100 2014 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 3045 3989 gene locus_tag LOCUS_72110 3045 3989 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_72110 3986 4873 gene locus_tag LOCUS_72120 3986 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 4886 6262 gene locus_tag LOCUS_72130 4886 6262 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_72130 7318 6326 gene locus_tag LOCUS_72140 7318 6326 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110699.1 protein_id gnl|my_center|LOCUS_72140 8182 7772 gene locus_tag LOCUS_72150 8182 7772 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_72150 8272 9210 gene locus_tag LOCUS_72160 8272 9210 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227751.1 protein_id gnl|my_center|LOCUS_72160 10956 9211 gene locus_tag LOCUS_72170 10956 9211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030252.1 protein_id gnl|my_center|LOCUS_72170 12764 10953 gene locus_tag LOCUS_72180 12764 10953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_72180 12974 13873 gene locus_tag LOCUS_72190 12974 13873 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_72190 15212 13896 gene locus_tag LOCUS_72200 15212 13896 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841829.1 protein_id gnl|my_center|LOCUS_72200 15735 15310 gene locus_tag LOCUS_72210 15735 15310 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226504.1 protein_id gnl|my_center|LOCUS_72210 16580 15771 gene locus_tag LOCUS_72220 16580 15771 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 protein_id gnl|my_center|LOCUS_72220 16663 17190 gene locus_tag LOCUS_72230 16663 17190 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222061.1 protein_id gnl|my_center|LOCUS_72230 17187 17699 gene locus_tag LOCUS_72240 17187 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72240 18874 17723 gene locus_tag LOCUS_72250 gene aruH 18874 17723 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 protein_id gnl|my_center|LOCUS_72250 19220 20326 gene locus_tag LOCUS_72260 19220 20326 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_72260 21131 20337 gene locus_tag LOCUS_72270 21131 20337 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226501.1 protein_id gnl|my_center|LOCUS_72270 21707 21135 gene locus_tag LOCUS_72280 21707 21135 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_72280 21827 23788 gene locus_tag LOCUS_72290 21827 23788 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226499.1 protein_id gnl|my_center|LOCUS_72290 23785 24696 gene locus_tag LOCUS_72300 23785 24696 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_72300 25865 24750 gene locus_tag LOCUS_72310 25865 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 27353 25905 gene locus_tag LOCUS_72320 gene mptB 27353 25905 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226496.1 protein_id gnl|my_center|LOCUS_72320 28857 27376 gene locus_tag LOCUS_72330 gene mptB 28857 27376 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226496.1 protein_id gnl|my_center|LOCUS_72330 29070 30404 gene locus_tag LOCUS_72340 29070 30404 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 protein_id gnl|my_center|LOCUS_72340 32003 30372 gene locus_tag LOCUS_72350 32003 30372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226495.1 protein_id gnl|my_center|LOCUS_72350 32911 32009 gene locus_tag LOCUS_72360 32911 32009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_72360 33933 32908 gene locus_tag LOCUS_72370 33933 32908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_72370 35696 33954 gene locus_tag LOCUS_72380 35696 33954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_72380 35662 35874 gene locus_tag LOCUS_72390 35662 35874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 35956 36783 gene locus_tag LOCUS_72400 35956 36783 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_72400 36776 38092 gene locus_tag LOCUS_72410 36776 38092 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_72410 39051 38320 gene locus_tag LOCUS_72420 39051 38320 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640437.1 protein_id gnl|my_center|LOCUS_72420 40935 39055 gene locus_tag LOCUS_72430 40935 39055 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_72430 41107 44406 gene locus_tag LOCUS_72440 41107 44406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 44972 44409 gene locus_tag LOCUS_72450 44972 44409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72450 45820 45125 gene locus_tag LOCUS_72460 45820 45125 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_72460 46672 45833 gene locus_tag LOCUS_72470 46672 45833 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_72470 47722 46676 gene locus_tag LOCUS_72480 47722 46676 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_72480 47882 48823 gene locus_tag LOCUS_72490 47882 48823 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_72490 48975 49985 gene locus_tag LOCUS_72500 48975 49985 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226470.1 protein_id gnl|my_center|LOCUS_72500 49982 50197 gene locus_tag LOCUS_72510 49982 50197 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561940.1 protein_id gnl|my_center|LOCUS_72510 50751 50209 gene locus_tag LOCUS_72520 50751 50209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_72520 52170 50842 gene locus_tag LOCUS_72530 52170 50842 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226464.1 protein_id gnl|my_center|LOCUS_72530 52308 52392 gene locus_tag LOCUS_t00740 52308 52392 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54124 52373 gene locus_tag LOCUS_72540 54124 52373 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227625.1 protein_id gnl|my_center|LOCUS_72540 54928 54491 gene locus_tag LOCUS_72550 54928 54491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72550 55033 56073 gene locus_tag LOCUS_72560 55033 56073 CDS product IS481-like element ISMsm9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731392.1 protein_id gnl|my_center|LOCUS_72560 56211 56026 gene locus_tag LOCUS_72570 56211 56026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72570 57758 56211 gene locus_tag LOCUS_72580 57758 56211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72580 58024 57755 gene locus_tag LOCUS_72590 58024 57755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 58005 58292 gene locus_tag LOCUS_72600 58005 58292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72600 58812 58489 gene locus_tag LOCUS_72610 58812 58489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 59129 58809 gene locus_tag LOCUS_72620 59129 58809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 59329 59126 gene locus_tag LOCUS_72630 59329 59126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 59497 59880 gene locus_tag LOCUS_72640 59497 59880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72640 59999 61567 gene locus_tag LOCUS_72650 59999 61567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 61567 61917 gene locus_tag LOCUS_72660 61567 61917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029512.1 protein_id gnl|my_center|LOCUS_72660 63453 61918 gene locus_tag LOCUS_72670 63453 61918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 63617 63892 gene locus_tag LOCUS_72680 63617 63892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 63936 64580 gene locus_tag LOCUS_72690 63936 64580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 64585 64824 gene locus_tag LOCUS_72700 64585 64824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 66425 65007 gene locus_tag LOCUS_72710 66425 65007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72710 68347 67133 gene locus_tag LOCUS_72720 68347 67133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 69197 68736 gene locus_tag LOCUS_72730 69197 68736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72730 70970 69477 gene locus_tag LOCUS_72740 70970 69477 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467505.1 protein_id gnl|my_center|LOCUS_72740 72000 70999 gene locus_tag LOCUS_72750 72000 70999 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_72750 72101 73099 gene locus_tag LOCUS_72760 72101 73099 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_72760 73096 73956 gene locus_tag LOCUS_72770 73096 73956 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_72770 73953 74882 gene locus_tag LOCUS_72780 gene iolC 73953 74882 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223777.1 protein_id gnl|my_center|LOCUS_72780 74879 75769 gene locus_tag LOCUS_72790 74879 75769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223776.1 protein_id gnl|my_center|LOCUS_72790 75766 76632 gene locus_tag LOCUS_72800 gene iolB 75766 76632 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223775.1 protein_id gnl|my_center|LOCUS_72800 76629 78470 gene locus_tag LOCUS_72810 gene iolD 76629 78470 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_72810 79854 78529 gene locus_tag LOCUS_72820 79854 78529 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928935.1 protein_id gnl|my_center|LOCUS_72820 80686 79946 gene locus_tag LOCUS_72830 80686 79946 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 protein_id gnl|my_center|LOCUS_72830 81391 80771 gene locus_tag LOCUS_72840 81391 80771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72840 82404 81406 gene locus_tag LOCUS_72850 82404 81406 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_72850 82673 83821 gene locus_tag LOCUS_72860 82673 83821 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243488.1 protein_id gnl|my_center|LOCUS_72860 83852 85708 gene locus_tag LOCUS_72870 83852 85708 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_72870 85716 86825 gene locus_tag LOCUS_72880 85716 86825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969593.1 protein_id gnl|my_center|LOCUS_72880 86813 87595 gene locus_tag LOCUS_72890 86813 87595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72890 87592 88404 gene locus_tag LOCUS_72900 87592 88404 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975071.1 protein_id gnl|my_center|LOCUS_72900 88401 89198 gene locus_tag LOCUS_72910 88401 89198 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_72910 89558 89857 gene locus_tag LOCUS_72920 89558 89857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 90011 89772 gene locus_tag LOCUS_72930 90011 89772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72930 90043 90405 gene locus_tag LOCUS_72940 90043 90405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_72940 90405 90650 gene locus_tag LOCUS_72950 90405 90650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72950 90803 91267 gene locus_tag LOCUS_72960 90803 91267 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227282.1 protein_id gnl|my_center|LOCUS_72960 91569 91315 gene locus_tag LOCUS_72970 91569 91315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72970 91796 91536 gene locus_tag LOCUS_72980 91796 91536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 92035 91844 gene locus_tag LOCUS_72990 92035 91844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72990 93003 92032 gene locus_tag LOCUS_73000 93003 92032 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_73000 93239 93823 gene locus_tag LOCUS_73010 93239 93823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73010 94307 97177 gene locus_tag LOCUS_73020 94307 97177 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_73020 97210 97365 gene locus_tag LOCUS_73030 97210 97365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73030 97506 101411 gene locus_tag LOCUS_73040 97506 101411 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_73040 101865 101587 gene locus_tag LOCUS_73050 101865 101587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 102179 101889 gene locus_tag LOCUS_73060 102179 101889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73060 103534 102371 gene locus_tag LOCUS_73070 103534 102371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73070 104101 103562 gene locus_tag LOCUS_73080 104101 103562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 104543 104148 gene locus_tag LOCUS_73090 104543 104148 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895387.1 protein_id gnl|my_center|LOCUS_73090 104638 105558 gene locus_tag LOCUS_73100 104638 105558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 107231 105555 gene locus_tag LOCUS_73110 107231 105555 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080372.1 protein_id gnl|my_center|LOCUS_73110 107980 107363 gene locus_tag LOCUS_73120 107980 107363 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227299.1 protein_id gnl|my_center|LOCUS_73120 110682 108013 gene locus_tag LOCUS_73130 110682 108013 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227290.1 protein_id gnl|my_center|LOCUS_73130 110954 110679 gene locus_tag LOCUS_73140 110954 110679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73140 111139 111294 gene locus_tag LOCUS_73150 111139 111294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 111318 111587 gene locus_tag LOCUS_73160 111318 111587 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 protein_id gnl|my_center|LOCUS_73160 112186 111605 gene locus_tag LOCUS_73170 112186 111605 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227299.1 protein_id gnl|my_center|LOCUS_73170 112599 112204 gene locus_tag LOCUS_73180 112599 112204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 113074 113796 gene locus_tag LOCUS_73190 113074 113796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73190 114718 113822 gene locus_tag LOCUS_73200 114718 113822 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_73200 115577 114729 gene locus_tag LOCUS_73210 115577 114729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 116182 115574 gene locus_tag LOCUS_73220 116182 115574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 116477 116247 gene locus_tag LOCUS_73230 116477 116247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73230 117082 116426 gene locus_tag LOCUS_73240 117082 116426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73240 118748 117648 gene locus_tag LOCUS_73250 118748 117648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_73250 119190 120329 gene locus_tag LOCUS_73260 119190 120329 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_73260 120363 121139 gene locus_tag LOCUS_73270 120363 121139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73270 122614 121682 gene locus_tag LOCUS_73280 122614 121682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 122911 123759 gene locus_tag LOCUS_73290 122911 123759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73290 124099 123866 gene locus_tag LOCUS_73300 124099 123866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73300 124657 124184 gene locus_tag LOCUS_73310 124657 124184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73310 124696 124836 gene locus_tag LOCUS_73320 124696 124836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 126236 125157 gene locus_tag LOCUS_73330 126236 125157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73330 128065 126251 gene locus_tag LOCUS_73340 128065 126251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73340 128214 128948 gene locus_tag LOCUS_73350 128214 128948 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742194.1 protein_id gnl|my_center|LOCUS_73350 129450 129157 gene locus_tag LOCUS_73360 129450 129157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 131826 129670 gene locus_tag LOCUS_73370 131826 129670 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137396889.1 protein_id gnl|my_center|LOCUS_73370 132177 132105 gene locus_tag LOCUS_t00750 132177 132105 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 132297 132208 gene locus_tag LOCUS_t00760 132297 132208 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 133677 132943 gene locus_tag LOCUS_73380 133677 132943 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_73380 133840 135504 gene locus_tag LOCUS_73390 133840 135504 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228014.1 protein_id gnl|my_center|LOCUS_73390 137269 135488 gene locus_tag LOCUS_73400 137269 135488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 138635 137250 gene locus_tag LOCUS_73410 gene glnA4 138635 137250 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_73410 139210 138632 gene locus_tag LOCUS_73420 139210 138632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 139828 139244 gene locus_tag LOCUS_73430 139828 139244 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872526.1 protein_id gnl|my_center|LOCUS_73430 144354 139942 gene locus_tag LOCUS_73440 144354 139942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 145448 144351 gene locus_tag LOCUS_73450 gene thiO 145448 144351 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_73450 146568 145435 gene locus_tag LOCUS_73460 146568 145435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028605124.1 protein_id gnl|my_center|LOCUS_73460 147270 146617 gene locus_tag LOCUS_73470 147270 146617 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 protein_id gnl|my_center|LOCUS_73470 147950 147354 gene locus_tag LOCUS_73480 147950 147354 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971478.1 protein_id gnl|my_center|LOCUS_73480 149322 147970 gene locus_tag LOCUS_73490 gene glyA 149322 147970 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_73490 151673 149322 gene locus_tag LOCUS_73500 gene hypF 151673 149322 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_73500 152709 151684 gene locus_tag LOCUS_73510 gene hypE 152709 151684 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778917.1 protein_id gnl|my_center|LOCUS_73510 154111 152867 gene locus_tag LOCUS_73520 154111 152867 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_73520 154378 157758 gene locus_tag LOCUS_73530 154378 157758 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228028.1 protein_id gnl|my_center|LOCUS_73530 160504 157772 gene locus_tag LOCUS_73540 160504 157772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_73540 161877 160501 gene locus_tag LOCUS_73550 161877 160501 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258402.1 protein_id gnl|my_center|LOCUS_73550 162854 161874 gene locus_tag LOCUS_73560 162854 161874 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_73560 163863 162868 gene locus_tag LOCUS_73570 163863 162868 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115897.1 protein_id gnl|my_center|LOCUS_73570 167229 163951 gene locus_tag LOCUS_73580 167229 163951 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228028.1 protein_id gnl|my_center|LOCUS_73580 167498 167241 gene locus_tag LOCUS_73590 167498 167241 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228022.1 protein_id gnl|my_center|LOCUS_73590 169963 167546 gene locus_tag LOCUS_73600 169963 167546 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184990288.1 protein_id gnl|my_center|LOCUS_73600 175053 170353 gene locus_tag LOCUS_73610 175053 170353 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228023.1 protein_id gnl|my_center|LOCUS_73610 176298 175225 gene locus_tag LOCUS_73620 176298 175225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 177922 176363 gene locus_tag LOCUS_73630 177922 176363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73630 178235 179200 gene locus_tag LOCUS_73640 178235 179200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223096.1 protein_id gnl|my_center|LOCUS_73640 179197 180216 gene locus_tag LOCUS_73650 179197 180216 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_73650 180611 180219 gene locus_tag LOCUS_73660 180611 180219 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221993.1 protein_id gnl|my_center|LOCUS_73660 180753 181574 gene locus_tag LOCUS_73670 180753 181574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73670 181791 182204 gene locus_tag LOCUS_73680 181791 182204 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_73680 182326 183897 gene locus_tag LOCUS_73690 182326 183897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 183908 184837 gene locus_tag LOCUS_73700 183908 184837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 184834 185577 gene locus_tag LOCUS_73710 184834 185577 CDS product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 protein_id gnl|my_center|LOCUS_73710 185577 186476 gene locus_tag LOCUS_73720 185577 186476 CDS product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 protein_id gnl|my_center|LOCUS_73720 186655 186533 gene locus_tag LOCUS_73730 gene ykgO 186655 186533 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 protein_id gnl|my_center|LOCUS_73730 187100 186834 gene locus_tag LOCUS_73740 187100 186834 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226832.1 protein_id gnl|my_center|LOCUS_73740 188212 187097 gene locus_tag LOCUS_73750 188212 187097 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878548.1 protein_id gnl|my_center|LOCUS_73750 188204 188392 gene locus_tag LOCUS_73760 188204 188392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73760 188424 188660 gene locus_tag LOCUS_73770 gene rpmB 188424 188660 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_73770 188692 188823 gene locus_tag LOCUS_73780 gene rpmG 188692 188823 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889348.1 protein_id gnl|my_center|LOCUS_73780 188823 189128 gene locus_tag LOCUS_73790 gene rpsN 188823 189128 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_73790 189125 189373 gene locus_tag LOCUS_73800 gene rpsR 189125 189373 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777137.1 protein_id gnl|my_center|LOCUS_73800 189786 189577 gene locus_tag LOCUS_73810 189786 189577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73810 191503 189872 gene locus_tag LOCUS_73820 191503 189872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 192942 191500 gene locus_tag LOCUS_73830 192942 191500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 193055 193732 gene locus_tag LOCUS_73840 193055 193732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73840 195409 194105 gene locus_tag LOCUS_73850 195409 194105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 195666 197219 gene locus_tag LOCUS_73860 195666 197219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_73860 197224 197484 gene locus_tag LOCUS_73870 197224 197484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 197462 198679 gene locus_tag LOCUS_73880 197462 198679 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972783.1 protein_id gnl|my_center|LOCUS_73880 198676 199359 gene locus_tag LOCUS_73890 198676 199359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222996.1 protein_id gnl|my_center|LOCUS_73890 199574 204352 gene locus_tag LOCUS_73900 199574 204352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73900 204355 204978 gene locus_tag LOCUS_73910 204355 204978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73910 205547 208432 gene locus_tag LOCUS_73920 205547 208432 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742130.1 protein_id gnl|my_center|LOCUS_73920 208502 209791 gene locus_tag LOCUS_73930 208502 209791 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466944.1 protein_id gnl|my_center|LOCUS_73930 209999 213433 gene locus_tag LOCUS_73940 209999 213433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73940 213895 213722 gene locus_tag LOCUS_73950 213895 213722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 218025 214075 gene locus_tag LOCUS_73960 218025 214075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 221118 218140 gene locus_tag LOCUS_73970 221118 218140 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222212.1 protein_id gnl|my_center|LOCUS_73970 221436 222254 gene locus_tag LOCUS_73980 221436 222254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73980 223737 222319 gene locus_tag LOCUS_73990 223737 222319 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_73990 224528 223734 gene locus_tag LOCUS_74000 224528 223734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74000 225535 224525 gene locus_tag LOCUS_74010 225535 224525 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_74010 226344 225532 gene locus_tag LOCUS_74020 226344 225532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_74020 227185 226346 gene locus_tag LOCUS_74030 227185 226346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_74030 228233 227178 gene locus_tag LOCUS_74040 228233 227178 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_74040 228952 228230 gene locus_tag LOCUS_74050 gene fabG 228952 228230 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_74050 229727 228945 gene locus_tag LOCUS_74060 229727 228945 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_74060 230455 229727 gene locus_tag LOCUS_74070 230455 229727 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_74070 230835 230452 gene locus_tag LOCUS_74080 230835 230452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74080 232842 230839 gene locus_tag LOCUS_74090 232842 230839 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_74090 234506 232839 gene locus_tag LOCUS_74100 234506 232839 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 protein_id gnl|my_center|LOCUS_74100 234663 236630 gene locus_tag LOCUS_74110 234663 236630 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461059.1 protein_id gnl|my_center|LOCUS_74110 236654 237400 gene locus_tag LOCUS_74120 236654 237400 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026361.1 protein_id gnl|my_center|LOCUS_74120 238025 237585 gene locus_tag LOCUS_74130 238025 237585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74130 238506 240170 gene locus_tag LOCUS_74140 238506 240170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74140 240690 240295 gene locus_tag LOCUS_74150 240690 240295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74150 241900 240755 gene locus_tag LOCUS_74160 241900 240755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74160 243126 241897 gene locus_tag LOCUS_74170 243126 241897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 243607 243095 gene locus_tag LOCUS_74180 243607 243095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 244938 243604 gene locus_tag LOCUS_74190 244938 243604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 246152 244935 gene locus_tag LOCUS_74200 246152 244935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74200 247543 246149 gene locus_tag LOCUS_74210 247543 246149 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_74210 248592 247540 gene locus_tag LOCUS_74220 248592 247540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 250349 248589 gene locus_tag LOCUS_74230 250349 248589 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945510.1 protein_id gnl|my_center|LOCUS_74230 250588 253533 gene locus_tag LOCUS_74240 250588 253533 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225870.1 protein_id gnl|my_center|LOCUS_74240 254071 253610 gene locus_tag LOCUS_74250 254071 253610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 254263 255537 gene locus_tag LOCUS_74260 254263 255537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74260 255938 255801 gene locus_tag LOCUS_74270 255938 255801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74270 256556 255963 gene locus_tag LOCUS_74280 256556 255963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74280 257039 256593 gene locus_tag LOCUS_74290 257039 256593 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079498.1 protein_id gnl|my_center|LOCUS_74290 257134 258576 gene locus_tag LOCUS_74300 257134 258576 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921534.1 protein_id gnl|my_center|LOCUS_74300 259051 258557 gene locus_tag LOCUS_74310 259051 258557 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_74310 260348 259185 gene locus_tag LOCUS_74320 260348 259185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74320 260465 260959 gene locus_tag LOCUS_74330 260465 260959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74330 260970 261299 gene locus_tag LOCUS_74340 260970 261299 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887754.1 protein_id gnl|my_center|LOCUS_74340 261335 262318 gene locus_tag LOCUS_74350 261335 262318 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225780.1 protein_id gnl|my_center|LOCUS_74350 263555 262326 gene locus_tag LOCUS_74360 263555 262326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74360 263740 263552 gene locus_tag LOCUS_74370 263740 263552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74370 263678 264859 gene locus_tag LOCUS_74380 263678 264859 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104227.1 protein_id gnl|my_center|LOCUS_74380 267296 264840 gene locus_tag LOCUS_74390 267296 264840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74390 268241 267339 gene locus_tag LOCUS_74400 268241 267339 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_74400 269036 268350 gene locus_tag LOCUS_74410 269036 268350 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_74410 269157 270356 gene locus_tag LOCUS_74420 269157 270356 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_74420 271495 270344 gene locus_tag LOCUS_74430 271495 270344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74430 273323 271539 gene locus_tag LOCUS_74440 273323 271539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74440 273459 274070 gene locus_tag LOCUS_74450 273459 274070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74450 274063 274653 gene locus_tag LOCUS_74460 274063 274653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74460 274766 275407 gene locus_tag LOCUS_74470 274766 275407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74470 275431 276051 gene locus_tag LOCUS_74480 275431 276051 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083697.1 protein_id gnl|my_center|LOCUS_74480 276048 277955 gene locus_tag LOCUS_74490 gene phzE 276048 277955 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_74490 277891 278232 gene locus_tag LOCUS_74500 277891 278232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74500 278229 278822 gene locus_tag LOCUS_74510 gene phzG 278229 278822 CDS product phenazine biosynthesis FMN-dependent oxidase PhzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112073.1 protein_id gnl|my_center|LOCUS_74510 279640 278813 gene locus_tag LOCUS_74520 gene phzF 279640 278813 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093628.1 protein_id gnl|my_center|LOCUS_74520 279753 280223 gene locus_tag LOCUS_74530 gene phzB 279753 280223 CDS product phenazine biosynthesis protein PhzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115119.1 protein_id gnl|my_center|LOCUS_74530 280220 281218 gene locus_tag LOCUS_74540 gene phzM 280220 281218 CDS product phenazine-1-carboxylate N-methyltransferase PhzM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093617.1 protein_id gnl|my_center|LOCUS_74540 282467 281259 gene locus_tag LOCUS_74550 282467 281259 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225160.1 protein_id gnl|my_center|LOCUS_74550 282651 284255 gene locus_tag LOCUS_74560 282651 284255 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224348.1 protein_id gnl|my_center|LOCUS_74560 284252 284716 gene locus_tag LOCUS_74570 284252 284716 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972215.1 protein_id gnl|my_center|LOCUS_74570 284713 285795 gene locus_tag LOCUS_74580 284713 285795 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112348.1 protein_id gnl|my_center|LOCUS_74580 287317 285749 gene locus_tag LOCUS_74590 gene fadD5 287317 285749 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127917152.1 protein_id gnl|my_center|LOCUS_74590 287559 288644 gene locus_tag LOCUS_74600 287559 288644 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225161.1 protein_id gnl|my_center|LOCUS_74600 289884 288658 gene locus_tag LOCUS_74610 289884 288658 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229859.1 protein_id gnl|my_center|LOCUS_74610 289944 292904 gene locus_tag LOCUS_74620 289944 292904 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_74620 294134 292908 gene locus_tag LOCUS_74630 294134 292908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74630 295881 294178 gene locus_tag LOCUS_74640 295881 294178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74640 295807 296076 gene locus_tag LOCUS_74650 295807 296076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74650 296281 296838 gene locus_tag LOCUS_74660 gene ssuE 296281 296838 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142759.1 protein_id gnl|my_center|LOCUS_74660 298229 296841 gene locus_tag LOCUS_74670 298229 296841 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_74670 300399 298291 gene locus_tag LOCUS_74680 300399 298291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74680 300637 301869 gene locus_tag LOCUS_74690 300637 301869 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225903.1 protein_id gnl|my_center|LOCUS_74690 301911 302441 gene locus_tag LOCUS_74700 301911 302441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74700 303678 302428 gene locus_tag LOCUS_74710 303678 302428 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_74710 305444 303675 gene locus_tag LOCUS_74720 305444 303675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74720 307297 305489 gene locus_tag LOCUS_74730 307297 305489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74730 308222 307290 gene locus_tag LOCUS_74740 308222 307290 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727260.1 protein_id gnl|my_center|LOCUS_74740 309829 308222 gene locus_tag LOCUS_74750 309829 308222 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_74750 310644 309826 gene locus_tag LOCUS_74760 310644 309826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74760 311624 310641 gene locus_tag LOCUS_74770 311624 310641 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267878.1 protein_id gnl|my_center|LOCUS_74770 313017 311617 gene locus_tag LOCUS_74780 313017 311617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973928.1 protein_id gnl|my_center|LOCUS_74780 314027 313170 gene locus_tag LOCUS_74790 314027 313170 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731601.1 protein_id gnl|my_center|LOCUS_74790 314953 314024 gene locus_tag LOCUS_74800 314953 314024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_74800 315996 314950 gene locus_tag LOCUS_74810 315996 314950 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739092.1 protein_id gnl|my_center|LOCUS_74810 316804 316133 gene locus_tag LOCUS_74820 316804 316133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74820 317068 318069 gene locus_tag LOCUS_74830 317068 318069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731487.1 protein_id gnl|my_center|LOCUS_74830 318804 318118 gene locus_tag LOCUS_74840 318804 318118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74840 319476 318943 gene locus_tag LOCUS_74850 319476 318943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74850 320813 319503 gene locus_tag LOCUS_74860 320813 319503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74860 320655 320747 gene locus_tag LOCUS_t00770 320655 320747 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 321857 320901 gene locus_tag LOCUS_74870 321857 320901 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 protein_id gnl|my_center|LOCUS_74870 321966 322526 gene locus_tag LOCUS_74880 321966 322526 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978089.1 protein_id gnl|my_center|LOCUS_74880 323298 322600 gene locus_tag LOCUS_74890 323298 322600 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_74890 324044 323295 gene locus_tag LOCUS_74900 324044 323295 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969450.1 protein_id gnl|my_center|LOCUS_74900 324731 324084 gene locus_tag LOCUS_74910 324731 324084 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930315.1 protein_id gnl|my_center|LOCUS_74910 326493 324772 gene locus_tag LOCUS_74920 gene selB 326493 324772 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_74920 326600 326506 gene locus_tag LOCUS_t00780 326600 326506 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 326657 326923 gene locus_tag LOCUS_74930 326657 326923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74930 326984 327667 gene locus_tag LOCUS_74940 326984 327667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74940 328805 327654 gene locus_tag LOCUS_74950 328805 327654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74950 330208 328802 gene locus_tag LOCUS_74960 330208 328802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 330444 331112 gene locus_tag LOCUS_74970 330444 331112 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888709.1 protein_id gnl|my_center|LOCUS_74970 331787 331131 gene locus_tag LOCUS_74980 gene lexA 331787 331131 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225332.1 protein_id gnl|my_center|LOCUS_74980 332694 331768 gene locus_tag LOCUS_74990 332694 331768 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108987323.1 protein_id gnl|my_center|LOCUS_74990 332773 333651 gene locus_tag LOCUS_75000 332773 333651 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_75000 333987 333658 gene locus_tag LOCUS_75010 333987 333658 CDS product CU044_2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227643.1 protein_id gnl|my_center|LOCUS_75010 335443 334004 gene locus_tag LOCUS_75020 335443 334004 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227646.1 protein_id gnl|my_center|LOCUS_75020 337568 335463 gene locus_tag LOCUS_75030 337568 335463 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227647.1 protein_id gnl|my_center|LOCUS_75030 339058 337565 gene locus_tag LOCUS_75040 339058 337565 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170155743.1 protein_id gnl|my_center|LOCUS_75040 340356 339046 gene locus_tag LOCUS_75050 340356 339046 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227644.1 protein_id gnl|my_center|LOCUS_75050 341525 340365 gene locus_tag LOCUS_75060 341525 340365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75060 342792 341629 gene locus_tag LOCUS_75070 342792 341629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75070 343057 342830 gene locus_tag LOCUS_75080 343057 342830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75080 343164 343841 gene locus_tag LOCUS_75090 343164 343841 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449647.1 protein_id gnl|my_center|LOCUS_75090 343838 344890 gene locus_tag LOCUS_75100 343838 344890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228416.1 protein_id gnl|my_center|LOCUS_75100 344963 346459 gene locus_tag LOCUS_75110 344963 346459 CDS product DUF4173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261187.1 protein_id gnl|my_center|LOCUS_75110 346604 347563 gene locus_tag LOCUS_75120 346604 347563 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_75120 348854 347589 gene locus_tag LOCUS_75130 348854 347589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75130 350448 348994 gene locus_tag LOCUS_75140 350448 348994 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229408.1 protein_id gnl|my_center|LOCUS_75140 350599 351402 gene locus_tag LOCUS_75150 350599 351402 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_75150 351555 353897 gene locus_tag LOCUS_75160 351555 353897 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727677.1 protein_id gnl|my_center|LOCUS_75160 355446 353902 gene locus_tag LOCUS_75170 355446 353902 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866890.1 protein_id gnl|my_center|LOCUS_75170 357278 355668 gene locus_tag LOCUS_75180 357278 355668 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093951984.1 protein_id gnl|my_center|LOCUS_75180 359929 357323 gene locus_tag LOCUS_75190 359929 357323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75190 360319 359939 gene locus_tag LOCUS_75200 360319 359939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75200 361251 360316 gene locus_tag LOCUS_75210 361251 360316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75210 362714 361248 gene locus_tag LOCUS_75220 362714 361248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75220 363579 362773 gene locus_tag LOCUS_75230 363579 362773 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223252.1 protein_id gnl|my_center|LOCUS_75230 364733 363678 gene locus_tag LOCUS_75240 364733 363678 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_75240 364890 365330 gene locus_tag LOCUS_75250 364890 365330 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 protein_id gnl|my_center|LOCUS_75250 365405 366796 gene locus_tag LOCUS_75260 365405 366796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257475.1 protein_id gnl|my_center|LOCUS_75260 367232 366732 gene locus_tag LOCUS_75270 367232 366732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75270 368080 367229 gene locus_tag LOCUS_75280 368080 367229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75280 368199 368570 gene locus_tag LOCUS_75290 368199 368570 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_75290 368738 372076 gene locus_tag LOCUS_75300 368738 372076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75300 373525 372125 gene locus_tag LOCUS_75310 373525 372125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75310 375003 373558 gene locus_tag LOCUS_75320 375003 373558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75320 376086 375172 gene locus_tag LOCUS_75330 376086 375172 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088045.1 protein_id gnl|my_center|LOCUS_75330 378124 376175 gene locus_tag LOCUS_75340 378124 376175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75340 378508 380601 gene locus_tag LOCUS_75350 378508 380601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75350 380663 382051 gene locus_tag LOCUS_75360 380663 382051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75360 382139 383179 gene locus_tag LOCUS_75370 382139 383179 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_75370 383275 384276 gene locus_tag LOCUS_75380 383275 384276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75380 384310 386256 gene locus_tag LOCUS_75390 384310 386256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75390 >Feature sequence57 >Feature sequence58 359 1351 gene locus_tag LOCUS_75400 359 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75400 >Feature sequence59 >Feature sequence60 >Feature sequence61 >Feature sequence62 >Feature sequence63 >Feature sequence64 >Feature sequence65 >Feature sequence66 >Feature sequence67 1581 310 gene locus_tag LOCUS_75410 gene tyrS 1581 310 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227826.1 protein_id gnl|my_center|LOCUS_75410 2282 1638 gene locus_tag LOCUS_75420 2282 1638 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227827.1 protein_id gnl|my_center|LOCUS_75420 3534 2293 gene locus_tag LOCUS_75430 3534 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75430 4106 3531 gene locus_tag LOCUS_75440 4106 3531 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230116.1 protein_id gnl|my_center|LOCUS_75440 5552 4143 gene locus_tag LOCUS_75450 gene argH 5552 4143 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_75450 6747 5545 gene locus_tag LOCUS_75460 6747 5545 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729313.1 protein_id gnl|my_center|LOCUS_75460 7261 6740 gene locus_tag LOCUS_75470 7261 6740 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227833.1 protein_id gnl|my_center|LOCUS_75470 8178 7258 gene locus_tag LOCUS_75480 gene argF 8178 7258 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227834.1 protein_id gnl|my_center|LOCUS_75480 9371 8178 gene locus_tag LOCUS_75490 9371 8178 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227835.1 protein_id gnl|my_center|LOCUS_75490 10258 9368 gene locus_tag LOCUS_75500 gene argB 10258 9368 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_75500 11409 10255 gene locus_tag LOCUS_75510 gene argJ 11409 10255 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227837.1 protein_id gnl|my_center|LOCUS_75510 12440 11406 gene locus_tag LOCUS_75520 gene argC 12440 11406 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227838.1 protein_id gnl|my_center|LOCUS_75520 13178 12594 gene locus_tag LOCUS_75530 13178 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75530 14623 13277 gene locus_tag LOCUS_75540 14623 13277 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227841.1 protein_id gnl|my_center|LOCUS_75540 15030 15725 gene locus_tag LOCUS_75550 15030 15725 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_75550 19387 16868 gene locus_tag LOCUS_75560 gene pheT 19387 16868 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227843.1 protein_id gnl|my_center|LOCUS_75560 20491 19421 gene locus_tag LOCUS_75570 gene pheS 20491 19421 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227844.1 protein_id gnl|my_center|LOCUS_75570 21559 20891 gene locus_tag LOCUS_75580 21559 20891 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084642168.1 protein_id gnl|my_center|LOCUS_75580 22107 21733 gene locus_tag LOCUS_75590 gene rplT 22107 21733 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559056.1 protein_id gnl|my_center|LOCUS_75590 22364 22170 gene locus_tag LOCUS_75600 gene rpmI 22364 22170 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_75600 23076 22498 gene locus_tag LOCUS_75610 gene infC 23076 22498 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227848.1 protein_id gnl|my_center|LOCUS_75610 23823 23362 gene locus_tag LOCUS_75620 23823 23362 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229196.1 protein_id gnl|my_center|LOCUS_75620 23894 24469 gene locus_tag LOCUS_75630 23894 24469 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230968.1 protein_id gnl|my_center|LOCUS_75630 24519 25388 gene locus_tag LOCUS_75640 24519 25388 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109967.1 protein_id gnl|my_center|LOCUS_75640 28236 25375 gene locus_tag LOCUS_75650 gene uvrA 28236 25375 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467399.1 protein_id gnl|my_center|LOCUS_75650 28621 29250 gene locus_tag LOCUS_75660 28621 29250 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222689.1 protein_id gnl|my_center|LOCUS_75660 29784 29233 gene locus_tag LOCUS_75670 29784 29233 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976199.1 protein_id gnl|my_center|LOCUS_75670 29831 30508 gene locus_tag LOCUS_75680 29831 30508 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227876.1 protein_id gnl|my_center|LOCUS_75680 30691 31098 gene locus_tag LOCUS_75690 30691 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75690 31088 31540 gene locus_tag LOCUS_75700 31088 31540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75700 31566 31832 gene locus_tag LOCUS_75710 31566 31832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75710 31970 32782 gene locus_tag LOCUS_75720 31970 32782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75720 33943 32795 gene locus_tag LOCUS_75730 33943 32795 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_75730 34108 34533 gene locus_tag LOCUS_75740 34108 34533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75740 34586 34960 gene locus_tag LOCUS_75750 34586 34960 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_75750 35756 35004 gene locus_tag LOCUS_75760 35756 35004 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223917.1 protein_id gnl|my_center|LOCUS_75760 35799 37130 gene locus_tag LOCUS_75770 35799 37130 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223916.1 protein_id gnl|my_center|LOCUS_75770 37742 37206 gene locus_tag LOCUS_75780 37742 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_75780 39430 37937 gene locus_tag LOCUS_75790 39430 37937 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_75790 41479 39524 gene locus_tag LOCUS_75800 41479 39524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75800 41652 42242 gene locus_tag LOCUS_75810 41652 42242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75810 42514 42239 gene locus_tag LOCUS_75820 42514 42239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75820 44039 42555 gene locus_tag LOCUS_75830 44039 42555 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_75830 45444 44032 gene locus_tag LOCUS_75840 45444 44032 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_75840 45558 46550 gene locus_tag LOCUS_75850 45558 46550 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_75850 47572 46568 gene locus_tag LOCUS_75860 47572 46568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75860 48613 47603 gene locus_tag LOCUS_75870 48613 47603 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315915.1 protein_id gnl|my_center|LOCUS_75870 50175 48610 gene locus_tag LOCUS_75880 50175 48610 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976197.1 protein_id gnl|my_center|LOCUS_75880 50296 50880 gene locus_tag LOCUS_75890 50296 50880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227894.1 protein_id gnl|my_center|LOCUS_75890 50974 51615 gene locus_tag LOCUS_75900 50974 51615 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227895.1 protein_id gnl|my_center|LOCUS_75900 52684 51662 gene locus_tag LOCUS_75910 52684 51662 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227898.1 protein_id gnl|my_center|LOCUS_75910 52965 55832 gene locus_tag LOCUS_75920 52965 55832 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_75920 55829 56776 gene locus_tag LOCUS_75930 55829 56776 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227901.1 protein_id gnl|my_center|LOCUS_75930 56825 57457 gene locus_tag LOCUS_75940 56825 57457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75940 58656 57454 gene locus_tag LOCUS_75950 58656 57454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75950 60613 58679 gene locus_tag LOCUS_75960 60613 58679 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_75960 62159 60735 gene locus_tag LOCUS_75970 62159 60735 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_75970 63408 62194 gene locus_tag LOCUS_75980 63408 62194 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_75980 63448 63999 gene locus_tag LOCUS_75990 63448 63999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75990 64132 64857 gene locus_tag LOCUS_76000 64132 64857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226765.1 protein_id gnl|my_center|LOCUS_76000 64867 65448 gene locus_tag LOCUS_76010 64867 65448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_76010 66468 65437 gene locus_tag LOCUS_76020 66468 65437 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_76020 67235 66468 gene locus_tag LOCUS_76030 gene fabI 67235 66468 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_76030 68002 67298 gene locus_tag LOCUS_76040 68002 67298 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226771.1 protein_id gnl|my_center|LOCUS_76040 69132 68140 gene locus_tag LOCUS_76050 69132 68140 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_76050 70101 69133 gene locus_tag LOCUS_76060 70101 69133 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_76060 71162 70098 gene locus_tag LOCUS_76070 71162 70098 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_76070 71303 71833 gene locus_tag LOCUS_76080 71303 71833 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_76080 71830 72579 gene locus_tag LOCUS_76090 71830 72579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76090 72597 72884 gene locus_tag LOCUS_76100 72597 72884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76100 72881 73744 gene locus_tag LOCUS_76110 72881 73744 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533789.1 protein_id gnl|my_center|LOCUS_76110 74009 73725 gene locus_tag LOCUS_76120 74009 73725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76120 75391 74003 gene locus_tag LOCUS_76130 gene rox 75391 74003 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223527.1 protein_id gnl|my_center|LOCUS_76130 76758 75442 gene locus_tag LOCUS_76140 76758 75442 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226784.1 protein_id gnl|my_center|LOCUS_76140 77243 78514 gene locus_tag LOCUS_76150 77243 78514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76150 78938 78573 gene locus_tag LOCUS_76160 78938 78573 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_76160 79037 81835 gene locus_tag LOCUS_76170 79037 81835 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_76170 83228 82227 gene locus_tag LOCUS_76180 83228 82227 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_76180 84221 83250 gene locus_tag LOCUS_76190 gene egtD 84221 83250 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226791.1 protein_id gnl|my_center|LOCUS_76190 84967 84218 gene locus_tag LOCUS_76200 gene egtC 84967 84218 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226792.1 protein_id gnl|my_center|LOCUS_76200 86329 84968 gene locus_tag LOCUS_76210 gene egtB 86329 84968 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_76210 87564 86326 gene locus_tag LOCUS_76220 gene egtA 87564 86326 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226794.1 protein_id gnl|my_center|LOCUS_76220 87689 88264 gene locus_tag LOCUS_76230 87689 88264 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226802.1 protein_id gnl|my_center|LOCUS_76230 88312 88878 gene locus_tag LOCUS_76240 88312 88878 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_76240 88930 90255 gene locus_tag LOCUS_76250 88930 90255 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226803.1 protein_id gnl|my_center|LOCUS_76250 90252 91301 gene locus_tag LOCUS_76260 90252 91301 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226804.1 protein_id gnl|my_center|LOCUS_76260 91298 92134 gene locus_tag LOCUS_76270 91298 92134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_76270 92878 92135 gene locus_tag LOCUS_76280 92878 92135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76280 94070 92883 gene locus_tag LOCUS_76290 94070 92883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76290 94655 94071 gene locus_tag LOCUS_76300 94655 94071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76300 94999 94655 gene locus_tag LOCUS_76310 94999 94655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76310 95129 95608 gene locus_tag LOCUS_76320 95129 95608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76320 95830 95648 gene locus_tag LOCUS_76330 95830 95648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76330 96630 95806 gene locus_tag LOCUS_76340 96630 95806 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_76340 96762 97118 gene locus_tag LOCUS_76350 96762 97118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76350 99987 97123 gene locus_tag LOCUS_76360 gene gcvP 99987 97123 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_76360 100985 100284 gene locus_tag LOCUS_76370 100985 100284 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226814.1 protein_id gnl|my_center|LOCUS_76370 101539 101066 gene locus_tag LOCUS_76380 101539 101066 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559569.1 protein_id gnl|my_center|LOCUS_76380 102432 101710 gene locus_tag LOCUS_76390 102432 101710 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_76390 102925 102479 gene locus_tag LOCUS_76400 102925 102479 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559567.1 protein_id gnl|my_center|LOCUS_76400 103404 103021 gene locus_tag LOCUS_76410 gene gcvH 103404 103021 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226819.1 protein_id gnl|my_center|LOCUS_76410 104046 103450 gene locus_tag LOCUS_76420 104046 103450 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226820.1 protein_id gnl|my_center|LOCUS_76420 104404 104210 gene locus_tag LOCUS_76430 104404 104210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76430 106252 104546 gene locus_tag LOCUS_76440 106252 104546 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_76440 107238 106399 gene locus_tag LOCUS_76450 107238 106399 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226825.1 protein_id gnl|my_center|LOCUS_76450 107411 107581 gene locus_tag LOCUS_76460 107411 107581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76460 108093 109643 gene locus_tag LOCUS_76470 108093 109643 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 protein_id gnl|my_center|LOCUS_76470 109615 110223 gene locus_tag LOCUS_76480 109615 110223 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261752.1 protein_id gnl|my_center|LOCUS_76480 112387 110213 gene locus_tag LOCUS_76490 112387 110213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76490 114523 112448 gene locus_tag LOCUS_76500 gene uvrB 114523 112448 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958334.1 protein_id gnl|my_center|LOCUS_76500 114690 115211 gene locus_tag LOCUS_76510 114690 115211 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227910.1 protein_id gnl|my_center|LOCUS_76510 115346 115873 gene locus_tag LOCUS_76520 115346 115873 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898953.1 protein_id gnl|my_center|LOCUS_76520 115974 116888 gene locus_tag LOCUS_76530 115974 116888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_76530 116885 117625 gene locus_tag LOCUS_76540 116885 117625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_76540 117640 118884 gene locus_tag LOCUS_76550 117640 118884 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_76550 118881 119525 gene locus_tag LOCUS_76560 118881 119525 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_76560 119586 120620 gene locus_tag LOCUS_76570 gene moaA 119586 120620 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950828.1 protein_id gnl|my_center|LOCUS_76570 121814 120639 gene locus_tag LOCUS_76580 gene coaE 121814 120639 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286284.1 protein_id gnl|my_center|LOCUS_76580 121936 122163 gene locus_tag LOCUS_76590 121936 122163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76590 122461 122673 gene locus_tag LOCUS_76600 122461 122673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76600 122734 122982 gene locus_tag LOCUS_76610 122734 122982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76610 122966 123220 gene locus_tag LOCUS_76620 122966 123220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76620 124772 123273 gene locus_tag LOCUS_76630 gene rpsA 124772 123273 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227916.1 protein_id gnl|my_center|LOCUS_76630 125519 125615 gene locus_tag LOCUS_t00790 125519 125615 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 125913 126944 gene locus_tag LOCUS_76640 125913 126944 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227918.1 protein_id gnl|my_center|LOCUS_76640 127004 127492 gene locus_tag LOCUS_76650 127004 127492 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975229.1 protein_id gnl|my_center|LOCUS_76650 127485 128780 gene locus_tag LOCUS_76660 127485 128780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76660 129285 128746 gene locus_tag LOCUS_76670 129285 128746 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887413.1 protein_id gnl|my_center|LOCUS_76670 129789 129349 gene locus_tag LOCUS_76680 129789 129349 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 protein_id gnl|my_center|LOCUS_76680 130260 129823 gene locus_tag LOCUS_76690 130260 129823 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_76690 132898 130244 gene locus_tag LOCUS_76700 gene polA 132898 130244 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_76700 133032 133472 gene locus_tag LOCUS_76710 133032 133472 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227928.1 protein_id gnl|my_center|LOCUS_76710 133526 134341 gene locus_tag LOCUS_76720 133526 134341 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973953.1 protein_id gnl|my_center|LOCUS_76720 134361 134912 gene locus_tag LOCUS_76730 134361 134912 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227936.1 protein_id gnl|my_center|LOCUS_76730 135196 134900 gene locus_tag LOCUS_76740 135196 134900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76740 136424 135198 gene locus_tag LOCUS_76750 136424 135198 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_76750 137164 136448 gene locus_tag LOCUS_76760 137164 136448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 protein_id gnl|my_center|LOCUS_76760 137969 137154 gene locus_tag LOCUS_76770 137969 137154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227934.1 protein_id gnl|my_center|LOCUS_76770 139132 137966 gene locus_tag LOCUS_76780 139132 137966 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093952556.1 protein_id gnl|my_center|LOCUS_76780 140091 139129 gene locus_tag LOCUS_76790 140091 139129 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227932.1 protein_id gnl|my_center|LOCUS_76790 141402 140212 gene locus_tag LOCUS_76800 141402 140212 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227931.1 protein_id gnl|my_center|LOCUS_76800 141719 143593 gene locus_tag LOCUS_76810 141719 143593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76810 144194 143586 gene locus_tag LOCUS_76820 144194 143586 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227937.1 protein_id gnl|my_center|LOCUS_76820 144387 144462 gene locus_tag LOCUS_t00800 144387 144462 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 144863 145321 gene locus_tag LOCUS_76830 144863 145321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76830 146114 145287 gene locus_tag LOCUS_76840 146114 145287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_76840 146566 146138 gene locus_tag LOCUS_76850 146566 146138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76850 146985 146671 gene locus_tag LOCUS_76860 146985 146671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76860 150131 147030 gene locus_tag LOCUS_76870 150131 147030 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533561.1 protein_id gnl|my_center|LOCUS_76870 151294 150128 gene locus_tag LOCUS_76880 151294 150128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76880 151548 152702 gene locus_tag LOCUS_76890 151548 152702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76890 152699 155887 gene locus_tag LOCUS_76900 152699 155887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76900 155887 158439 gene locus_tag LOCUS_76910 155887 158439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76910 160764 158587 gene locus_tag LOCUS_76920 160764 158587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76920 161235 162071 gene locus_tag LOCUS_76930 161235 162071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76930 163083 162265 gene locus_tag LOCUS_76940 163083 162265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229834.1 protein_id gnl|my_center|LOCUS_76940 163898 163080 gene locus_tag LOCUS_76950 163898 163080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76950 168208 163979 gene locus_tag LOCUS_76960 168208 163979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76960 168513 168208 gene locus_tag LOCUS_76970 168513 168208 CDS product type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229831.1 protein_id gnl|my_center|LOCUS_76970 169076 168534 gene locus_tag LOCUS_76980 169076 168534 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467736.1 protein_id gnl|my_center|LOCUS_76980 170161 169214 gene locus_tag LOCUS_76990 170161 169214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_76990 170300 170644 gene locus_tag LOCUS_77000 170300 170644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77000 170641 171222 gene locus_tag LOCUS_77010 170641 171222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77010 171379 171822 gene locus_tag LOCUS_77020 171379 171822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77020 172582 171836 gene locus_tag LOCUS_77030 172582 171836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77030 173304 172591 gene locus_tag LOCUS_77040 173304 172591 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113058.1 protein_id gnl|my_center|LOCUS_77040 174122 173379 gene locus_tag LOCUS_77050 174122 173379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777027.1 protein_id gnl|my_center|LOCUS_77050 175056 174109 gene locus_tag LOCUS_77060 175056 174109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777026.1 protein_id gnl|my_center|LOCUS_77060 180907 175088 gene locus_tag LOCUS_77070 180907 175088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77070 184123 180911 gene locus_tag LOCUS_77080 184123 180911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77080 190915 184136 gene locus_tag LOCUS_77090 190915 184136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77090 195579 190912 gene locus_tag LOCUS_77100 195579 190912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77100 200098 195572 gene locus_tag LOCUS_77110 200098 195572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77110 201348 200095 gene locus_tag LOCUS_77120 201348 200095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77120 211229 201345 gene locus_tag LOCUS_77130 211229 201345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77130 212365 211226 gene locus_tag LOCUS_77140 212365 211226 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_77140 212630 212358 gene locus_tag LOCUS_77150 212630 212358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77150 213672 212647 gene locus_tag LOCUS_77160 213672 212647 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_77160 214547 213696 gene locus_tag LOCUS_77170 214547 213696 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_77170 215923 215273 gene locus_tag LOCUS_77180 215923 215273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_77180 217092 215959 gene locus_tag LOCUS_77190 217092 215959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77190 217944 217216 gene locus_tag LOCUS_77200 217944 217216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77200 218847 218026 gene locus_tag LOCUS_77210 218847 218026 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_77210 218962 219615 gene locus_tag LOCUS_77220 218962 219615 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224786.1 protein_id gnl|my_center|LOCUS_77220 219612 219755 gene locus_tag LOCUS_77230 219612 219755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77230 222534 219760 gene locus_tag LOCUS_77240 222534 219760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77240 223532 222537 gene locus_tag LOCUS_77250 223532 222537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77250 223940 223587 gene locus_tag LOCUS_77260 223940 223587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77260 224910 224527 gene locus_tag LOCUS_77270 224910 224527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77270 225266 224922 gene locus_tag LOCUS_77280 225266 224922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77280 226272 225376 gene locus_tag LOCUS_77290 226272 225376 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071928696.1 protein_id gnl|my_center|LOCUS_77290 226318 227055 gene locus_tag LOCUS_77300 226318 227055 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225743.1 protein_id gnl|my_center|LOCUS_77300 227978 227058 gene locus_tag LOCUS_77310 227978 227058 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410060.1 protein_id gnl|my_center|LOCUS_77310 228200 228039 gene locus_tag LOCUS_77320 228200 228039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77320 228326 228236 gene locus_tag LOCUS_t00810 228326 228236 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 228518 229318 gene locus_tag LOCUS_77330 228518 229318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77330 229381 229722 gene locus_tag LOCUS_77340 229381 229722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77340 229713 230630 gene locus_tag LOCUS_77350 229713 230630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77350 230623 231537 gene locus_tag LOCUS_77360 gene nuoH 230623 231537 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_77360 231546 232103 gene locus_tag LOCUS_77370 231546 232103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77370 232100 232405 gene locus_tag LOCUS_77380 gene nuoK 232100 232405 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_77380 232407 234248 gene locus_tag LOCUS_77390 232407 234248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77390 234252 235730 gene locus_tag LOCUS_77400 234252 235730 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886373.1 protein_id gnl|my_center|LOCUS_77400 235732 237156 gene locus_tag LOCUS_77410 235732 237156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77410 237526 237161 gene locus_tag LOCUS_77420 237526 237161 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728177.1 protein_id gnl|my_center|LOCUS_77420 238649 237591 gene locus_tag LOCUS_77430 238649 237591 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_77430 238779 239714 gene locus_tag LOCUS_77440 238779 239714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77440 240253 239702 gene locus_tag LOCUS_77450 240253 239702 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222336.1 protein_id gnl|my_center|LOCUS_77450 240639 240343 gene locus_tag LOCUS_77460 240639 240343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77460 242726 240645 gene locus_tag LOCUS_77470 242726 240645 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_77470 244731 242728 gene locus_tag LOCUS_77480 244731 242728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77480 245252 244728 gene locus_tag LOCUS_77490 245252 244728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77490 246379 245252 gene locus_tag LOCUS_77500 246379 245252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77500 248346 246376 gene locus_tag LOCUS_77510 248346 246376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77510 249500 248343 gene locus_tag LOCUS_77520 249500 248343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77520 251417 249513 gene locus_tag LOCUS_77530 251417 249513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77530 253426 251414 gene locus_tag LOCUS_77540 253426 251414 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_77540 255425 253497 gene locus_tag LOCUS_77550 255425 253497 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_77550 255826 255422 gene locus_tag LOCUS_77560 255826 255422 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_77560 256461 255823 gene locus_tag LOCUS_77570 256461 255823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77570 257642 256458 gene locus_tag LOCUS_77580 257642 256458 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941649.1 protein_id gnl|my_center|LOCUS_77580 258321 257653 gene locus_tag LOCUS_77590 258321 257653 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_77590 258506 258318 gene locus_tag LOCUS_77600 258506 258318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184612929.1 protein_id gnl|my_center|LOCUS_77600 258989 258519 gene locus_tag LOCUS_77610 258989 258519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77610 260461 258986 gene locus_tag LOCUS_77620 260461 258986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77620 260924 260466 gene locus_tag LOCUS_77630 260924 260466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77630 263198 260955 gene locus_tag LOCUS_77640 263198 260955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77640 263925 263224 gene locus_tag LOCUS_77650 263925 263224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77650 264503 263922 gene locus_tag LOCUS_77660 264503 263922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77660 264681 264923 gene locus_tag LOCUS_77670 264681 264923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77670 265023 265727 gene locus_tag LOCUS_77680 265023 265727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77680 265740 266090 gene locus_tag LOCUS_77690 265740 266090 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 protein_id gnl|my_center|LOCUS_77690 266965 266087 gene locus_tag LOCUS_77700 266965 266087 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_77700 268392 266971 gene locus_tag LOCUS_77710 268392 266971 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082963.1 protein_id gnl|my_center|LOCUS_77710 268542 269525 gene locus_tag LOCUS_77720 268542 269525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085654.1 protein_id gnl|my_center|LOCUS_77720 269522 270478 gene locus_tag LOCUS_77730 269522 270478 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083809.1 protein_id gnl|my_center|LOCUS_77730 270497 272080 gene locus_tag LOCUS_77740 270497 272080 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_77740 272080 273123 gene locus_tag LOCUS_77750 272080 273123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_77750 273127 273978 gene locus_tag LOCUS_77760 273127 273978 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_77760 273986 276247 gene locus_tag LOCUS_77770 273986 276247 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_77770 276244 277455 gene locus_tag LOCUS_77780 276244 277455 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_77780 277452 278543 gene locus_tag LOCUS_77790 277452 278543 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225683.1 protein_id gnl|my_center|LOCUS_77790 278570 279409 gene locus_tag LOCUS_77800 278570 279409 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_77800 279406 280413 gene locus_tag LOCUS_77810 279406 280413 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_77810 280438 281028 gene locus_tag LOCUS_77820 280438 281028 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_77820 281043 282254 gene locus_tag LOCUS_77830 281043 282254 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_77830 283514 283074 gene locus_tag LOCUS_77840 283514 283074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77840 286387 283511 gene locus_tag LOCUS_77850 286387 283511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77850 288110 286401 gene locus_tag LOCUS_77860 288110 286401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77860 288952 288746 gene locus_tag LOCUS_77870 288952 288746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77870 293635 289691 gene locus_tag LOCUS_77880 293635 289691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_77880 293955 295058 gene locus_tag LOCUS_77890 293955 295058 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364967.1 protein_id gnl|my_center|LOCUS_77890 297160 295055 gene locus_tag LOCUS_77900 297160 295055 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_77900 298295 297468 gene locus_tag LOCUS_77910 298295 297468 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_77910 299037 298276 gene locus_tag LOCUS_77920 299037 298276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77920 299545 299452 gene locus_tag LOCUS_t00820 299545 299452 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 301496 299610 gene locus_tag LOCUS_77930 301496 299610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_77930 303226 301493 gene locus_tag LOCUS_77940 303226 301493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_77940 303319 303921 gene locus_tag LOCUS_77950 303319 303921 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 protein_id gnl|my_center|LOCUS_77950 304029 304298 gene locus_tag LOCUS_77960 304029 304298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77960 304419 305504 gene locus_tag LOCUS_77970 304419 305504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_77970 305560 306546 gene locus_tag LOCUS_77980 305560 306546 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027112.1 protein_id gnl|my_center|LOCUS_77980 310239 306547 gene locus_tag LOCUS_77990 310239 306547 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027111.1 protein_id gnl|my_center|LOCUS_77990 311824 310364 gene locus_tag LOCUS_78000 311824 310364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78000 314237 311949 gene locus_tag LOCUS_78010 314237 311949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78010 314393 315253 gene locus_tag LOCUS_78020 gene sigJ 314393 315253 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_78020 315686 315255 gene locus_tag LOCUS_78030 315686 315255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78030 316384 315770 gene locus_tag LOCUS_78040 316384 315770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78040 316503 317102 gene locus_tag LOCUS_78050 316503 317102 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978024.1 protein_id gnl|my_center|LOCUS_78050 317114 317953 gene locus_tag LOCUS_78060 317114 317953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118889.1 protein_id gnl|my_center|LOCUS_78060 317940 318347 gene locus_tag LOCUS_78070 317940 318347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78070 319336 318344 gene locus_tag LOCUS_78080 gene ligD 319336 318344 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225998.1 protein_id gnl|my_center|LOCUS_78080 320282 319344 gene locus_tag LOCUS_78090 320282 319344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78090 320342 320725 gene locus_tag LOCUS_78100 320342 320725 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110060.1 protein_id gnl|my_center|LOCUS_78100 320765 321433 gene locus_tag LOCUS_78110 320765 321433 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_78110 322739 321417 gene locus_tag LOCUS_78120 322739 321417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78120 322960 323475 gene locus_tag LOCUS_78130 322960 323475 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224813.1 protein_id gnl|my_center|LOCUS_78130 323566 324783 gene locus_tag LOCUS_78140 323566 324783 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229351.1 protein_id gnl|my_center|LOCUS_78140 324780 326327 gene locus_tag LOCUS_78150 324780 326327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229350.1 protein_id gnl|my_center|LOCUS_78150 326324 326767 gene locus_tag LOCUS_78160 326324 326767 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_78160 326767 328212 gene locus_tag LOCUS_78170 326767 328212 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285813.1 protein_id gnl|my_center|LOCUS_78170 329434 328220 gene locus_tag LOCUS_78180 329434 328220 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731466.1 protein_id gnl|my_center|LOCUS_78180 329771 329607 gene locus_tag LOCUS_78190 329771 329607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78190 330421 329774 gene locus_tag LOCUS_78200 330421 329774 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831648.1 protein_id gnl|my_center|LOCUS_78200 330808 331017 gene locus_tag LOCUS_78210 330808 331017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78210 331564 331064 gene locus_tag LOCUS_78220 331564 331064 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_78220 332821 331571 gene locus_tag LOCUS_78230 332821 331571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976412.1 protein_id gnl|my_center|LOCUS_78230 333914 332862 gene locus_tag LOCUS_78240 333914 332862 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339268.1 protein_id gnl|my_center|LOCUS_78240 334970 334107 gene locus_tag LOCUS_78250 334970 334107 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225080.1 protein_id gnl|my_center|LOCUS_78250 336762 335002 gene locus_tag LOCUS_78260 336762 335002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_78260 336838 337413 gene locus_tag LOCUS_78270 336838 337413 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897643.1 protein_id gnl|my_center|LOCUS_78270 338817 337444 gene locus_tag LOCUS_78280 338817 337444 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_78280 339676 338939 gene locus_tag LOCUS_78290 339676 338939 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_78290 340630 339890 gene locus_tag LOCUS_78300 340630 339890 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_78300 341629 340736 gene locus_tag LOCUS_78310 341629 340736 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526374.1 protein_id gnl|my_center|LOCUS_78310 342572 341631 gene locus_tag LOCUS_78320 342572 341631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061268.1 protein_id gnl|my_center|LOCUS_78320 343627 342569 gene locus_tag LOCUS_78330 343627 342569 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013851.1 protein_id gnl|my_center|LOCUS_78330 345073 343640 gene locus_tag LOCUS_78340 345073 343640 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976184.1 protein_id gnl|my_center|LOCUS_78340 346878 345247 gene locus_tag LOCUS_78350 346878 345247 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_78350 346932 347672 gene locus_tag LOCUS_78360 346932 347672 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_78360 347717 348451 gene locus_tag LOCUS_78370 347717 348451 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 protein_id gnl|my_center|LOCUS_78370 348522 350867 gene locus_tag LOCUS_78380 348522 350867 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224843.1 protein_id gnl|my_center|LOCUS_78380 354078 351106 gene locus_tag LOCUS_78390 354078 351106 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_78390 354077 354799 gene locus_tag LOCUS_78400 354077 354799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78400 354796 355977 gene locus_tag LOCUS_78410 354796 355977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78410 356006 356851 gene locus_tag LOCUS_78420 356006 356851 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_78420 357135 356836 gene locus_tag LOCUS_78430 357135 356836 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893002.1 protein_id gnl|my_center|LOCUS_78430 357277 358224 gene locus_tag LOCUS_78440 357277 358224 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227029.1 protein_id gnl|my_center|LOCUS_78440 358308 359840 gene locus_tag LOCUS_78450 358308 359840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78450 361205 359961 gene locus_tag LOCUS_78460 361205 359961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78460 362374 361283 gene locus_tag LOCUS_78470 gene gcvT 362374 361283 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223708.1 protein_id gnl|my_center|LOCUS_78470 363229 362438 gene locus_tag LOCUS_78480 363229 362438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78480 363736 363233 gene locus_tag LOCUS_78490 363736 363233 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_78490 364553 363798 gene locus_tag LOCUS_78500 364553 363798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728469.1 protein_id gnl|my_center|LOCUS_78500 365299 364541 gene locus_tag LOCUS_78510 gene cbiQ 365299 364541 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893990.1 protein_id gnl|my_center|LOCUS_78510 365642 365292 gene locus_tag LOCUS_78520 365642 365292 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728468.1 protein_id gnl|my_center|LOCUS_78520 366409 365639 gene locus_tag LOCUS_78530 366409 365639 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104219.1 protein_id gnl|my_center|LOCUS_78530 367607 366444 gene locus_tag LOCUS_78540 367607 366444 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027926.1 protein_id gnl|my_center|LOCUS_78540 368185 367622 gene locus_tag LOCUS_78550 368185 367622 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_78550 368756 368220 gene locus_tag LOCUS_78560 368756 368220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78560 369193 368753 gene locus_tag LOCUS_78570 369193 368753 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561253.1 protein_id gnl|my_center|LOCUS_78570 <369992 369190 gene locus_tag LOCUS_78580 <369992 369190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224363.1:nitrate- and nitrite sensing domain-containing protein >Feature sequence68 >Feature sequence69 >Feature sequence70 >Feature sequence71 73 948 gene locus_tag LOCUS_78590 73 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78590 2157 952 gene locus_tag LOCUS_78600 2157 952 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_78600 17629 2165 gene locus_tag LOCUS_78610 17629 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78610 20808 17626 gene locus_tag LOCUS_78620 20808 17626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78620 22385 20865 gene locus_tag LOCUS_78630 22385 20865 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_78630 23900 22395 gene locus_tag LOCUS_78640 23900 22395 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467045.1 protein_id gnl|my_center|LOCUS_78640 29869 23915 gene locus_tag LOCUS_78650 29869 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78650 30147 31004 gene locus_tag LOCUS_78660 30147 31004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533469.1 protein_id gnl|my_center|LOCUS_78660 31235 31020 gene locus_tag LOCUS_78670 31235 31020 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192056.1 protein_id gnl|my_center|LOCUS_78670 31469 32059 gene locus_tag LOCUS_78680 31469 32059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78680 32334 32071 gene locus_tag LOCUS_78690 32334 32071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78690 33430 32327 gene locus_tag LOCUS_78700 33430 32327 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_78700 33665 33486 gene locus_tag LOCUS_78710 33665 33486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78710 33922 34503 gene locus_tag LOCUS_78720 33922 34503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_78720 34546 36267 gene locus_tag LOCUS_78730 34546 36267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78730 36264 37553 gene locus_tag LOCUS_78740 36264 37553 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228024.1 protein_id gnl|my_center|LOCUS_78740 37553 38311 gene locus_tag LOCUS_78750 37553 38311 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228015.1 protein_id gnl|my_center|LOCUS_78750 38315 39403 gene locus_tag LOCUS_78760 38315 39403 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_78760 39413 40366 gene locus_tag LOCUS_78770 39413 40366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78770 40363 42192 gene locus_tag LOCUS_78780 40363 42192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78780 42224 43489 gene locus_tag LOCUS_78790 42224 43489 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226021.1 protein_id gnl|my_center|LOCUS_78790 43822 43607 gene locus_tag LOCUS_78800 43822 43607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78800 43725 46211 gene locus_tag LOCUS_78810 gene leuS 43725 46211 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_78810 46496 47407 gene locus_tag LOCUS_78820 46496 47407 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_78820 48082 47411 gene locus_tag LOCUS_78830 48082 47411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78830 49182 48067 gene locus_tag LOCUS_78840 49182 48067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78840 50239 49175 gene locus_tag LOCUS_78850 50239 49175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78850 50748 50494 gene locus_tag LOCUS_78860 50748 50494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78860 53918 51462 gene locus_tag LOCUS_78870 53918 51462 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184990288.1 protein_id gnl|my_center|LOCUS_78870 54296 54111 gene locus_tag LOCUS_78880 54296 54111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78880 57100 55499 gene locus_tag LOCUS_78890 57100 55499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78890 57734 57162 gene locus_tag LOCUS_78900 57734 57162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78900 58692 57745 gene locus_tag LOCUS_78910 58692 57745 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_78910 58908 62732 gene locus_tag LOCUS_78920 58908 62732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_78920 66105 63058 gene locus_tag LOCUS_78930 66105 63058 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223275.1 protein_id gnl|my_center|LOCUS_78930 66215 67111 gene locus_tag LOCUS_78940 66215 67111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78940 67603 68427 gene locus_tag LOCUS_78950 67603 68427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78950 68449 69513 gene locus_tag LOCUS_78960 68449 69513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78960 69990 71960 gene locus_tag LOCUS_78970 gene fusA 69990 71960 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031026.1 protein_id gnl|my_center|LOCUS_78970 73995 72046 gene locus_tag LOCUS_78980 73995 72046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78980 75219 74134 gene locus_tag LOCUS_78990 75219 74134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_78990 75364 75747 gene locus_tag LOCUS_79000 75364 75747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228571.1 protein_id gnl|my_center|LOCUS_79000 78772 75914 gene locus_tag LOCUS_79010 78772 75914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79010 81482 78774 gene locus_tag LOCUS_79020 81482 78774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79020 81810 81583 gene locus_tag LOCUS_79030 81810 81583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79030 84691 81818 gene locus_tag LOCUS_79040 84691 81818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79040 85449 84784 gene locus_tag LOCUS_79050 85449 84784 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225799.1 protein_id gnl|my_center|LOCUS_79050 85550 86494 gene locus_tag LOCUS_79060 85550 86494 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_79060 87737 86466 gene locus_tag LOCUS_79070 87737 86466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79070 87913 88212 gene locus_tag LOCUS_79080 87913 88212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79080 89768 88263 gene locus_tag LOCUS_79090 89768 88263 CDS product non-reducing end alpha-L-arabinofuranosidase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224773.1 protein_id gnl|my_center|LOCUS_79090 91870 89810 gene locus_tag LOCUS_79100 91870 89810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79100 92804 92049 gene locus_tag LOCUS_79110 92804 92049 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190909.1 protein_id gnl|my_center|LOCUS_79110 92980 93543 gene locus_tag LOCUS_79120 92980 93543 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 protein_id gnl|my_center|LOCUS_79120 94854 93592 gene locus_tag LOCUS_79130 94854 93592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79130 97750 94901 gene locus_tag LOCUS_79140 97750 94901 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225834.1 protein_id gnl|my_center|LOCUS_79140 99215 97779 gene locus_tag LOCUS_79150 99215 97779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_79150 100848 99262 gene locus_tag LOCUS_79160 100848 99262 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229143.1 protein_id gnl|my_center|LOCUS_79160 102387 101461 gene locus_tag LOCUS_79170 gene ispH 102387 101461 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417912.1 protein_id gnl|my_center|LOCUS_79170 102541 102398 gene locus_tag LOCUS_79180 102541 102398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79180 102982 103749 gene locus_tag LOCUS_79190 102982 103749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79190 103850 104530 gene locus_tag LOCUS_79200 103850 104530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79200 105680 104583 gene locus_tag LOCUS_79210 gene arsB 105680 104583 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727470.1 protein_id gnl|my_center|LOCUS_79210 106348 105677 gene locus_tag LOCUS_79220 106348 105677 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112712.1 protein_id gnl|my_center|LOCUS_79220 106563 106659 gene locus_tag LOCUS_t00830 106563 106659 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 108092 107067 gene locus_tag LOCUS_79230 108092 107067 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_79230 109515 108199 gene locus_tag LOCUS_79240 109515 108199 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485197.1 protein_id gnl|my_center|LOCUS_79240 109656 110498 gene locus_tag LOCUS_79250 109656 110498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79250 111219 110521 gene locus_tag LOCUS_79260 111219 110521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79260 112114 111140 gene locus_tag LOCUS_79270 112114 111140 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544457.1 protein_id gnl|my_center|LOCUS_79270 112518 112111 gene locus_tag LOCUS_79280 112518 112111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79280 112640 113869 gene locus_tag LOCUS_79290 112640 113869 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_79290 114948 113914 gene locus_tag LOCUS_79300 114948 113914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79300 115251 116000 gene locus_tag LOCUS_79310 115251 116000 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230125.1 protein_id gnl|my_center|LOCUS_79310 116048 116665 gene locus_tag LOCUS_79320 116048 116665 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_79320 117843 116779 gene locus_tag LOCUS_79330 gene pstS 117843 116779 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_79330 119229 117874 gene locus_tag LOCUS_79340 gene glnX 119229 117874 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876871.1 protein_id gnl|my_center|LOCUS_79340 120363 119311 gene locus_tag LOCUS_79350 120363 119311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79350 120579 121652 gene locus_tag LOCUS_79360 120579 121652 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224332.1 protein_id gnl|my_center|LOCUS_79360 121727 122098 gene locus_tag LOCUS_79370 121727 122098 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_79370 122821 129480 gene locus_tag LOCUS_79380 122821 129480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79380 129486 133829 gene locus_tag LOCUS_79390 129486 133829 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319909.1 protein_id gnl|my_center|LOCUS_79390 133826 134128 gene locus_tag LOCUS_79400 133826 134128 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226445.1 protein_id gnl|my_center|LOCUS_79400 134125 134937 gene locus_tag LOCUS_79410 134125 134937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226446.1 protein_id gnl|my_center|LOCUS_79410 134934 136160 gene locus_tag LOCUS_79420 134934 136160 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226447.1 protein_id gnl|my_center|LOCUS_79420 136157 136966 gene locus_tag LOCUS_79430 136157 136966 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229662.1 protein_id gnl|my_center|LOCUS_79430 138775 136997 gene locus_tag LOCUS_79440 gene ctaD 138775 136997 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229476.1 protein_id gnl|my_center|LOCUS_79440 139735 138884 gene locus_tag LOCUS_79450 139735 138884 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229089.1 protein_id gnl|my_center|LOCUS_79450 140200 139748 gene locus_tag LOCUS_79460 140200 139748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79460 140301 140576 gene locus_tag LOCUS_79470 140301 140576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79470 143295 140578 gene locus_tag LOCUS_79480 143295 140578 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225837.1 protein_id gnl|my_center|LOCUS_79480 144638 143292 gene locus_tag LOCUS_79490 144638 143292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79490 144565 144915 gene locus_tag LOCUS_79500 144565 144915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79500 144919 145569 gene locus_tag LOCUS_79510 144919 145569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79510 145562 145900 gene locus_tag LOCUS_79520 145562 145900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79520 146390 145923 gene locus_tag LOCUS_79530 146390 145923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79530 148867 146390 gene locus_tag LOCUS_79540 148867 146390 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_79540 149124 148921 gene locus_tag LOCUS_79550 149124 148921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79550 149036 150070 gene locus_tag LOCUS_79560 149036 150070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79560 150676 150089 gene locus_tag LOCUS_79570 150676 150089 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226114.1 protein_id gnl|my_center|LOCUS_79570 150755 152848 gene locus_tag LOCUS_79580 150755 152848 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111053.1 protein_id gnl|my_center|LOCUS_79580 152861 154174 gene locus_tag LOCUS_79590 152861 154174 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_79590 154217 154447 gene locus_tag LOCUS_79600 154217 154447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228349.1 protein_id gnl|my_center|LOCUS_79600 155438 154497 gene locus_tag LOCUS_79610 155438 154497 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_79610 156618 155476 gene locus_tag LOCUS_79620 156618 155476 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228338.1 protein_id gnl|my_center|LOCUS_79620 157103 156840 gene locus_tag LOCUS_79630 157103 156840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79630 157972 157445 gene locus_tag LOCUS_79640 157972 157445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79640 158209 157976 gene locus_tag LOCUS_79650 158209 157976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79650 159336 158329 gene locus_tag LOCUS_79660 159336 158329 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727584.1 protein_id gnl|my_center|LOCUS_79660 159409 160230 gene locus_tag LOCUS_79670 159409 160230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79670 160455 160219 gene locus_tag LOCUS_79680 160455 160219 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222201.1 protein_id gnl|my_center|LOCUS_79680 162515 160470 gene locus_tag LOCUS_79690 162515 160470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79690 162658 165261 gene locus_tag LOCUS_79700 162658 165261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79700 165797 165243 gene locus_tag LOCUS_79710 165797 165243 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_79710 165948 168137 gene locus_tag LOCUS_79720 165948 168137 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_79720 168861 168106 gene locus_tag LOCUS_79730 168861 168106 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 protein_id gnl|my_center|LOCUS_79730 168916 169257 gene locus_tag LOCUS_79740 168916 169257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031460.1 protein_id gnl|my_center|LOCUS_79740 169793 169311 gene locus_tag LOCUS_79750 169793 169311 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028548.1 protein_id gnl|my_center|LOCUS_79750 170285 171376 gene locus_tag LOCUS_79760 170285 171376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79760 171395 172222 gene locus_tag LOCUS_79770 171395 172222 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_79770 172902 172342 gene locus_tag LOCUS_79780 172902 172342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79780 173786 172974 gene locus_tag LOCUS_79790 173786 172974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79790 174366 174025 gene locus_tag LOCUS_79800 174366 174025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79800 175443 174556 gene locus_tag LOCUS_79810 175443 174556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79810 176261 175560 gene locus_tag LOCUS_79820 176261 175560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_79820 177313 176258 gene locus_tag LOCUS_79830 177313 176258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_79830 177447 178664 gene locus_tag LOCUS_79840 177447 178664 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_79840 178661 179296 gene locus_tag LOCUS_79850 178661 179296 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_79850 180093 179323 gene locus_tag LOCUS_79860 gene trpA 180093 179323 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_79860 181268 180090 gene locus_tag LOCUS_79870 gene trpB 181268 180090 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383536.1 protein_id gnl|my_center|LOCUS_79870 181533 182768 gene locus_tag LOCUS_79880 181533 182768 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_79880 182872 185109 gene locus_tag LOCUS_79890 182872 185109 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313782.1 protein_id gnl|my_center|LOCUS_79890 185232 186623 gene locus_tag LOCUS_79900 185232 186623 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_79900 186632 187750 gene locus_tag LOCUS_79910 186632 187750 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456645.1 protein_id gnl|my_center|LOCUS_79910 188867 188022 gene locus_tag LOCUS_79920 188867 188022 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_79920 188945 189841 gene locus_tag LOCUS_79930 188945 189841 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226696.1 protein_id gnl|my_center|LOCUS_79930 192317 189843 gene locus_tag LOCUS_79940 192317 189843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79940 193473 192442 gene locus_tag LOCUS_79950 193473 192442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037665946.1 protein_id gnl|my_center|LOCUS_79950 193521 194108 gene locus_tag LOCUS_79960 193521 194108 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031854.1 protein_id gnl|my_center|LOCUS_79960 194318 195679 gene locus_tag LOCUS_79970 194318 195679 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524102.1 protein_id gnl|my_center|LOCUS_79970 195689 196204 gene locus_tag LOCUS_79980 195689 196204 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707712.1 protein_id gnl|my_center|LOCUS_79980 196670 197041 gene locus_tag LOCUS_79990 196670 197041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_79990 197102 197686 gene locus_tag LOCUS_80000 197102 197686 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_80000 198100 201498 gene locus_tag LOCUS_80010 198100 201498 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316076.1 protein_id gnl|my_center|LOCUS_80010 202129 201506 gene locus_tag LOCUS_80020 202129 201506 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229858.1 protein_id gnl|my_center|LOCUS_80020 203008 202205 gene locus_tag LOCUS_80030 203008 202205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_80030 203880 203347 gene locus_tag LOCUS_80040 203880 203347 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_80040 205808 203877 gene locus_tag LOCUS_80050 205808 203877 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974731.1 protein_id gnl|my_center|LOCUS_80050 206221 205808 gene locus_tag LOCUS_80060 206221 205808 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_80060 206532 206218 gene locus_tag LOCUS_80070 206532 206218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80070 208225 206546 gene locus_tag LOCUS_80080 208225 206546 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 protein_id gnl|my_center|LOCUS_80080 208941 208222 gene locus_tag LOCUS_80090 208941 208222 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974728.1 protein_id gnl|my_center|LOCUS_80090 209363 208938 gene locus_tag LOCUS_80100 209363 208938 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974727.1 protein_id gnl|my_center|LOCUS_80100 210161 209643 gene locus_tag LOCUS_80110 210161 209643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80110 211192 212487 gene locus_tag LOCUS_80120 211192 212487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80120 212816 212658 gene locus_tag LOCUS_80130 212816 212658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_80130 213250 212813 gene locus_tag LOCUS_80140 213250 212813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_80140 213687 213247 gene locus_tag LOCUS_80150 213687 213247 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226672.1 protein_id gnl|my_center|LOCUS_80150 215208 213700 gene locus_tag LOCUS_80160 215208 213700 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_80160 217370 215322 gene locus_tag LOCUS_80170 217370 215322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80170 219406 217406 gene locus_tag LOCUS_80180 219406 217406 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_80180 220083 219403 gene locus_tag LOCUS_80190 220083 219403 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029538.1 protein_id gnl|my_center|LOCUS_80190 223168 220097 gene locus_tag LOCUS_80200 223168 220097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80200 223905 223279 gene locus_tag LOCUS_80210 223905 223279 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 protein_id gnl|my_center|LOCUS_80210 224123 225331 gene locus_tag LOCUS_80220 224123 225331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80220 225767 225447 gene locus_tag LOCUS_80230 225767 225447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80230 227671 225911 gene locus_tag LOCUS_80240 227671 225911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80240 228401 227673 gene locus_tag LOCUS_80250 228401 227673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_80250 228921 228412 gene locus_tag LOCUS_80260 228921 228412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80260 229080 230468 gene locus_tag LOCUS_80270 229080 230468 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_80270 232260 230449 gene locus_tag LOCUS_80280 232260 230449 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_80280 233632 232268 gene locus_tag LOCUS_80290 233632 232268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 protein_id gnl|my_center|LOCUS_80290 234436 233672 gene locus_tag LOCUS_80300 234436 233672 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_80300 236793 234559 gene locus_tag LOCUS_80310 gene metE 236793 234559 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_80310 237261 238181 gene locus_tag LOCUS_80320 237261 238181 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_80320 239410 238178 gene locus_tag LOCUS_80330 239410 238178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80330 241008 239407 gene locus_tag LOCUS_80340 241008 239407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_80340 242096 241005 gene locus_tag LOCUS_80350 242096 241005 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790914.1 protein_id gnl|my_center|LOCUS_80350 242992 242096 gene locus_tag LOCUS_80360 242992 242096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80360 243588 243001 gene locus_tag LOCUS_80370 243588 243001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80370 246050 243585 gene locus_tag LOCUS_80380 246050 243585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80380 247190 246327 gene locus_tag LOCUS_80390 247190 246327 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225433.1 protein_id gnl|my_center|LOCUS_80390 248474 247224 gene locus_tag LOCUS_80400 248474 247224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80400 248663 249676 gene locus_tag LOCUS_80410 248663 249676 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_80410 249673 250692 gene locus_tag LOCUS_80420 249673 250692 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_80420 250689 251498 gene locus_tag LOCUS_80430 250689 251498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_80430 251495 252445 gene locus_tag LOCUS_80440 251495 252445 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014237.1 protein_id gnl|my_center|LOCUS_80440 253502 252447 gene locus_tag LOCUS_80450 253502 252447 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230016.1 protein_id gnl|my_center|LOCUS_80450 254202 253513 gene locus_tag LOCUS_80460 254202 253513 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_80460 254295 254735 gene locus_tag LOCUS_80470 254295 254735 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847367.1 protein_id gnl|my_center|LOCUS_80470 254726 255823 gene locus_tag LOCUS_80480 gene alr 254726 255823 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110568702.1 protein_id gnl|my_center|LOCUS_80480 255820 256785 gene locus_tag LOCUS_80490 gene ddlA 255820 256785 CDS product D-alanine--D-alanine ligase DdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950808.1 protein_id gnl|my_center|LOCUS_80490 256937 258853 gene locus_tag LOCUS_80500 256937 258853 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468380.1 protein_id gnl|my_center|LOCUS_80500 259153 259743 gene locus_tag LOCUS_80510 259153 259743 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_80510 259922 261268 gene locus_tag LOCUS_80520 259922 261268 CDS product salicylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031835.1 protein_id gnl|my_center|LOCUS_80520 261284 261493 gene locus_tag LOCUS_80530 261284 261493 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_80530 261493 264843 gene locus_tag LOCUS_80540 261493 264843 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110650.1 protein_id gnl|my_center|LOCUS_80540 264840 266468 gene locus_tag LOCUS_80550 264840 266468 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031826.1 protein_id gnl|my_center|LOCUS_80550 266465 270955 gene locus_tag LOCUS_80560 266465 270955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80560 270952 278289 gene locus_tag LOCUS_80570 270952 278289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_80570 278286 279200 gene locus_tag LOCUS_80580 278286 279200 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_80580 279213 280259 gene locus_tag LOCUS_80590 279213 280259 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_80590 280256 281287 gene locus_tag LOCUS_80600 280256 281287 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_80600 281305 282159 gene locus_tag LOCUS_80610 281305 282159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_80610 283136 282111 gene locus_tag LOCUS_80620 283136 282111 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978370.1 protein_id gnl|my_center|LOCUS_80620 287616 283240 gene locus_tag LOCUS_80630 287616 283240 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_80630 289086 287767 gene locus_tag LOCUS_80640 289086 287767 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086072.1 protein_id gnl|my_center|LOCUS_80640 289177 292209 gene locus_tag LOCUS_80650 289177 292209 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226577.1 protein_id gnl|my_center|LOCUS_80650 292351 292536 gene locus_tag LOCUS_80660 292351 292536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80660 292574 295486 gene locus_tag LOCUS_80670 292574 295486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80670 296257 295490 gene locus_tag LOCUS_80680 296257 295490 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090312.1 protein_id gnl|my_center|LOCUS_80680 297483 296254 gene locus_tag LOCUS_80690 297483 296254 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392450.1 protein_id gnl|my_center|LOCUS_80690 298645 297638 gene locus_tag LOCUS_80700 298645 297638 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098374.1 protein_id gnl|my_center|LOCUS_80700 298976 300208 gene locus_tag LOCUS_80710 298976 300208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80710 300205 301473 gene locus_tag LOCUS_80720 gene leuC 300205 301473 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_80720 301470 301958 gene locus_tag LOCUS_80730 301470 301958 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256237.1 protein_id gnl|my_center|LOCUS_80730 303316 301910 gene locus_tag LOCUS_80740 303316 301910 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_80740 304377 303325 gene locus_tag LOCUS_80750 304377 303325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80750 305626 304427 gene locus_tag LOCUS_80760 305626 304427 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228761.1 protein_id gnl|my_center|LOCUS_80760 305735 306865 gene locus_tag LOCUS_80770 305735 306865 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014490.1 protein_id gnl|my_center|LOCUS_80770 306881 307873 gene locus_tag LOCUS_80780 306881 307873 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804086.1 protein_id gnl|my_center|LOCUS_80780 307870 308643 gene locus_tag LOCUS_80790 307870 308643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014492.1 protein_id gnl|my_center|LOCUS_80790 308640 309359 gene locus_tag LOCUS_80800 308640 309359 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015241.1 protein_id gnl|my_center|LOCUS_80800 309457 310392 gene locus_tag LOCUS_80810 309457 310392 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230010.1 protein_id gnl|my_center|LOCUS_80810 310389 311129 gene locus_tag LOCUS_80820 310389 311129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230011.1 protein_id gnl|my_center|LOCUS_80820 311123 312517 gene locus_tag LOCUS_80830 311123 312517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847384.1 protein_id gnl|my_center|LOCUS_80830 313142 312528 gene locus_tag LOCUS_80840 313142 312528 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_80840 314507 313191 gene locus_tag LOCUS_80850 314507 313191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80850 314711 314511 gene locus_tag LOCUS_80860 314711 314511 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_80860 316051 314708 gene locus_tag LOCUS_80870 316051 314708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80870 317145 316048 gene locus_tag LOCUS_80880 317145 316048 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731184.1 protein_id gnl|my_center|LOCUS_80880 317942 317142 gene locus_tag LOCUS_80890 317942 317142 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173807.1 protein_id gnl|my_center|LOCUS_80890 318681 317929 gene locus_tag LOCUS_80900 318681 317929 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552045.1 protein_id gnl|my_center|LOCUS_80900 319445 318678 gene locus_tag LOCUS_80910 319445 318678 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552045.1 protein_id gnl|my_center|LOCUS_80910 320763 319468 gene locus_tag LOCUS_80920 320763 319468 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730842.1 protein_id gnl|my_center|LOCUS_80920 322528 320774 gene locus_tag LOCUS_80930 322528 320774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80930 322965 322525 gene locus_tag LOCUS_80940 322965 322525 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525161.1 protein_id gnl|my_center|LOCUS_80940 330026 322962 gene locus_tag LOCUS_80950 330026 322962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_80950 331774 330029 gene locus_tag LOCUS_80960 331774 330029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_80960 333492 331771 gene locus_tag LOCUS_80970 333492 331771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_80970 334869 333502 gene locus_tag LOCUS_80980 gene lysA 334869 333502 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_80980 335834 334851 gene locus_tag LOCUS_80990 gene sbnA 335834 334851 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228013.1 protein_id gnl|my_center|LOCUS_80990 342016 335831 gene locus_tag LOCUS_81000 342016 335831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81000 <342701 342025 gene locus_tag LOCUS_81010 <342701 342025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950382.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence72 483 1499 gene locus_tag LOCUS_81020 483 1499 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224400.1 protein_id gnl|my_center|LOCUS_81020 1487 2398 gene locus_tag LOCUS_81030 1487 2398 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027281.1 protein_id gnl|my_center|LOCUS_81030 2729 2358 gene locus_tag LOCUS_81040 2729 2358 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528288.1 protein_id gnl|my_center|LOCUS_81040 3825 2857 gene locus_tag LOCUS_81050 3825 2857 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 protein_id gnl|my_center|LOCUS_81050 3913 4062 gene locus_tag LOCUS_81060 3913 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81060 4417 4130 gene locus_tag LOCUS_81070 4417 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81070 4604 4744 gene locus_tag LOCUS_81080 4604 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81080 4904 5740 gene locus_tag LOCUS_81090 4904 5740 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_81090 5740 7290 gene locus_tag LOCUS_81100 5740 7290 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 protein_id gnl|my_center|LOCUS_81100 7489 9162 gene locus_tag LOCUS_81110 7489 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81110 9198 10379 gene locus_tag LOCUS_81120 9198 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81120 10531 10331 gene locus_tag LOCUS_81130 10531 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81130 10837 12624 gene locus_tag LOCUS_81140 10837 12624 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_81140 12682 14391 gene locus_tag LOCUS_81150 12682 14391 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_81150 14459 16276 gene locus_tag LOCUS_81160 14459 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313987.1 protein_id gnl|my_center|LOCUS_81160 16982 16284 gene locus_tag LOCUS_81170 16982 16284 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229293.1 protein_id gnl|my_center|LOCUS_81170 17032 21141 gene locus_tag LOCUS_81180 17032 21141 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229292.1 protein_id gnl|my_center|LOCUS_81180 21770 22189 gene locus_tag LOCUS_81190 21770 22189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81190 22339 24330 gene locus_tag LOCUS_81200 22339 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81200 24336 24518 gene locus_tag LOCUS_81210 24336 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81210 25279 24515 gene locus_tag LOCUS_81220 25279 24515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81220 26375 25257 gene locus_tag LOCUS_81230 26375 25257 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_81230 26508 27203 gene locus_tag LOCUS_81240 26508 27203 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_81240 28231 27200 gene locus_tag LOCUS_81250 28231 27200 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_81250 28359 29066 gene locus_tag LOCUS_81260 28359 29066 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230130.1 protein_id gnl|my_center|LOCUS_81260 30190 29063 gene locus_tag LOCUS_81270 gene dhbC 30190 29063 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_81270 30627 30316 gene locus_tag LOCUS_81280 gene mihF 30627 30316 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_81280 30919 32553 gene locus_tag LOCUS_81290 30919 32553 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230133.1 protein_id gnl|my_center|LOCUS_81290 32577 32720 gene locus_tag LOCUS_81300 32577 32720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81300 32717 33328 gene locus_tag LOCUS_81310 32717 33328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81310 33369 34646 gene locus_tag LOCUS_81320 33369 34646 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742198.1 protein_id gnl|my_center|LOCUS_81320 34657 35670 gene locus_tag LOCUS_81330 34657 35670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81330 35786 36238 gene locus_tag LOCUS_81340 35786 36238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81340 37687 36203 gene locus_tag LOCUS_81350 37687 36203 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230144.1 protein_id gnl|my_center|LOCUS_81350 37878 38477 gene locus_tag LOCUS_81360 37878 38477 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230145.1 protein_id gnl|my_center|LOCUS_81360 38474 39973 gene locus_tag LOCUS_81370 38474 39973 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230146.1 protein_id gnl|my_center|LOCUS_81370 41429 40041 gene locus_tag LOCUS_81380 41429 40041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81380 41749 41426 gene locus_tag LOCUS_81390 41749 41426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81390 42271 41819 gene locus_tag LOCUS_81400 42271 41819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81400 42435 43637 gene locus_tag LOCUS_81410 42435 43637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_81410 45049 43691 gene locus_tag LOCUS_81420 45049 43691 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_81420 46108 45143 gene locus_tag LOCUS_81430 46108 45143 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230154.1 protein_id gnl|my_center|LOCUS_81430 46190 47323 gene locus_tag LOCUS_81440 46190 47323 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230156.1 protein_id gnl|my_center|LOCUS_81440 48589 47372 gene locus_tag LOCUS_81450 48589 47372 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230159.1 protein_id gnl|my_center|LOCUS_81450 49506 48595 gene locus_tag LOCUS_81460 49506 48595 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 protein_id gnl|my_center|LOCUS_81460 50937 49531 gene locus_tag LOCUS_81470 50937 49531 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_81470 52312 50990 gene locus_tag LOCUS_81480 52312 50990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_81480 53019 52360 gene locus_tag LOCUS_81490 gene pdxH 53019 52360 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230168.1 protein_id gnl|my_center|LOCUS_81490 53467 53563 gene locus_tag LOCUS_t00840 53467 53563 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 54938 54216 gene locus_tag LOCUS_81500 54938 54216 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230172.1 protein_id gnl|my_center|LOCUS_81500 55582 54935 gene locus_tag LOCUS_81510 gene ureG 55582 54935 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_81510 56276 55596 gene locus_tag LOCUS_81520 56276 55596 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230174.1 protein_id gnl|my_center|LOCUS_81520 57997 56291 gene locus_tag LOCUS_81530 57997 56291 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230175.1 protein_id gnl|my_center|LOCUS_81530 58278 57994 gene locus_tag LOCUS_81540 58278 57994 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_81540 58592 58275 gene locus_tag LOCUS_81550 58592 58275 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230177.1 protein_id gnl|my_center|LOCUS_81550 58782 59936 gene locus_tag LOCUS_81560 58782 59936 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230178.1 protein_id gnl|my_center|LOCUS_81560 60060 60896 gene locus_tag LOCUS_81570 60060 60896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_81570 60893 61717 gene locus_tag LOCUS_81580 60893 61717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731519.1 protein_id gnl|my_center|LOCUS_81580 61714 62925 gene locus_tag LOCUS_81590 61714 62925 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230183.1 protein_id gnl|my_center|LOCUS_81590 62922 63548 gene locus_tag LOCUS_81600 62922 63548 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_81600 63614 64984 gene locus_tag LOCUS_81610 63614 64984 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230185.1 protein_id gnl|my_center|LOCUS_81610 65143 66285 gene locus_tag LOCUS_81620 gene serC 65143 66285 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230187.1 protein_id gnl|my_center|LOCUS_81620 66285 67121 gene locus_tag LOCUS_81630 66285 67121 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_81630 67246 69438 gene locus_tag LOCUS_81640 67246 69438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81640 69967 69740 gene locus_tag LOCUS_81650 69967 69740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81650 70143 71930 gene locus_tag LOCUS_81660 70143 71930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_81660 71927 73777 gene locus_tag LOCUS_81670 71927 73777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_81670 74961 73780 gene locus_tag LOCUS_81680 74961 73780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_81680 75624 74962 gene locus_tag LOCUS_81690 75624 74962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_81690 76661 75621 gene locus_tag LOCUS_81700 76661 75621 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_81700 77209 76658 gene locus_tag LOCUS_81710 77209 76658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230193.1 protein_id gnl|my_center|LOCUS_81710 77340 77990 gene locus_tag LOCUS_81720 77340 77990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_81720 77987 79075 gene locus_tag LOCUS_81730 77987 79075 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_81730 79660 79079 gene locus_tag LOCUS_81740 79660 79079 CDS product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230199.1 protein_id gnl|my_center|LOCUS_81740 80510 79683 gene locus_tag LOCUS_81750 80510 79683 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230200.1 protein_id gnl|my_center|LOCUS_81750 80607 82103 gene locus_tag LOCUS_81760 80607 82103 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261568.1 protein_id gnl|my_center|LOCUS_81760 82184 83032 gene locus_tag LOCUS_81770 82184 83032 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230235.1 protein_id gnl|my_center|LOCUS_81770 83091 84740 gene locus_tag LOCUS_81780 83091 84740 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_81780 84905 85291 gene locus_tag LOCUS_81790 84905 85291 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230216.1 protein_id gnl|my_center|LOCUS_81790 85766 85296 gene locus_tag LOCUS_81800 85766 85296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81800 87675 85792 gene locus_tag LOCUS_81810 87675 85792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81810 88507 87725 gene locus_tag LOCUS_81820 88507 87725 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230213.1 protein_id gnl|my_center|LOCUS_81820 88550 90760 gene locus_tag LOCUS_81830 88550 90760 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230212.1 protein_id gnl|my_center|LOCUS_81830 90742 93564 gene locus_tag LOCUS_81840 90742 93564 CDS product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 protein_id gnl|my_center|LOCUS_81840 93590 94081 gene locus_tag LOCUS_81850 93590 94081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81850 94368 94078 gene locus_tag LOCUS_81860 94368 94078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81860 94389 95855 gene locus_tag LOCUS_81870 94389 95855 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_81870 95887 96333 gene locus_tag LOCUS_81880 95887 96333 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_81880 96444 97715 gene locus_tag LOCUS_81890 96444 97715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_81890 98621 97836 gene locus_tag LOCUS_81900 98621 97836 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_81900 98671 98916 gene locus_tag LOCUS_81910 98671 98916 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230244.1 protein_id gnl|my_center|LOCUS_81910 99574 100272 gene locus_tag LOCUS_81920 99574 100272 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230245.1 protein_id gnl|my_center|LOCUS_81920 101371 100364 gene locus_tag LOCUS_81930 101371 100364 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230247.1 protein_id gnl|my_center|LOCUS_81930 101847 101368 gene locus_tag LOCUS_81940 gene moaC 101847 101368 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_81940 103249 101861 gene locus_tag LOCUS_81950 103249 101861 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230249.1 protein_id gnl|my_center|LOCUS_81950 103440 103252 gene locus_tag LOCUS_81960 103440 103252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230250.1 protein_id gnl|my_center|LOCUS_81960 103515 105824 gene locus_tag LOCUS_81970 103515 105824 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_81970 105889 106164 gene locus_tag LOCUS_81980 105889 106164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_81980 106807 106196 gene locus_tag LOCUS_81990 106807 106196 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_81990 107564 106788 gene locus_tag LOCUS_82000 107564 106788 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230255.1 protein_id gnl|my_center|LOCUS_82000 107958 107533 gene locus_tag LOCUS_82010 107958 107533 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085368.1 protein_id gnl|my_center|LOCUS_82010 110861 107955 gene locus_tag LOCUS_82020 110861 107955 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230257.1 protein_id gnl|my_center|LOCUS_82020 111593 112630 gene locus_tag LOCUS_82030 111593 112630 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225347.1 protein_id gnl|my_center|LOCUS_82030 112638 113411 gene locus_tag LOCUS_82040 112638 113411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_82040 113408 114229 gene locus_tag LOCUS_82050 113408 114229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_82050 114231 115088 gene locus_tag LOCUS_82060 114231 115088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230261.1 protein_id gnl|my_center|LOCUS_82060 115189 115650 gene locus_tag LOCUS_82070 115189 115650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82070 117297 115729 gene locus_tag LOCUS_82080 gene mdlC 117297 115729 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230262.1 protein_id gnl|my_center|LOCUS_82080 117376 119040 gene locus_tag LOCUS_82090 117376 119040 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230272.1 protein_id gnl|my_center|LOCUS_82090 120400 119030 gene locus_tag LOCUS_82100 120400 119030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110819.1 protein_id gnl|my_center|LOCUS_82100 120944 120507 gene locus_tag LOCUS_82110 120944 120507 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110475.1 protein_id gnl|my_center|LOCUS_82110 121772 120963 gene locus_tag LOCUS_82120 121772 120963 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_82120 122922 121798 gene locus_tag LOCUS_82130 122922 121798 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_82130 123722 122994 gene locus_tag LOCUS_82140 123722 122994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82140 124034 123768 gene locus_tag LOCUS_82150 124034 123768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82150 124483 124031 gene locus_tag LOCUS_82160 124483 124031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82160 124778 124990 gene locus_tag LOCUS_82170 124778 124990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82170 125679 125053 gene locus_tag LOCUS_82180 125679 125053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82180 126684 125695 gene locus_tag LOCUS_82190 126684 125695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82190 128319 127465 gene locus_tag LOCUS_82200 128319 127465 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_82200 130751 128316 gene locus_tag LOCUS_82210 130751 128316 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_82210 131095 130751 gene locus_tag LOCUS_82220 131095 130751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82220 131003 131356 gene locus_tag LOCUS_82230 131003 131356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82230 131366 131971 gene locus_tag LOCUS_82240 131366 131971 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_82240 132001 132936 gene locus_tag LOCUS_82250 gene rarD 132001 132936 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_82250 133337 132921 gene locus_tag LOCUS_82260 133337 132921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82260 134683 133565 gene locus_tag LOCUS_82270 134683 133565 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_82270 135791 134676 gene locus_tag LOCUS_82280 135791 134676 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_82280 136086 135910 gene locus_tag LOCUS_82290 136086 135910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82290 137415 136177 gene locus_tag LOCUS_82300 137415 136177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82300 138530 137613 gene locus_tag LOCUS_82310 138530 137613 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_82310 138634 138840 gene locus_tag LOCUS_82320 138634 138840 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230277.1 protein_id gnl|my_center|LOCUS_82320 138860 139201 gene locus_tag LOCUS_82330 138860 139201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82330 139404 140006 gene locus_tag LOCUS_82340 139404 140006 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222253.1 protein_id gnl|my_center|LOCUS_82340 140003 140464 gene locus_tag LOCUS_82350 140003 140464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222254.1 protein_id gnl|my_center|LOCUS_82350 140813 143491 gene locus_tag LOCUS_82360 140813 143491 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229380.1 protein_id gnl|my_center|LOCUS_82360 143496 144776 gene locus_tag LOCUS_82370 143496 144776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082818.1 protein_id gnl|my_center|LOCUS_82370 144778 145482 gene locus_tag LOCUS_82380 144778 145482 CDS product DUF4393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064586.1 protein_id gnl|my_center|LOCUS_82380 147401 145776 gene locus_tag LOCUS_82390 gene groL 147401 145776 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230279.1 protein_id gnl|my_center|LOCUS_82390 148820 147573 gene locus_tag LOCUS_82400 148820 147573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82400 149567 148923 gene locus_tag LOCUS_82410 149567 148923 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230281.1 protein_id gnl|my_center|LOCUS_82410 149649 150860 gene locus_tag LOCUS_82420 149649 150860 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230283.1 protein_id gnl|my_center|LOCUS_82420 151099 151812 gene locus_tag LOCUS_82430 151099 151812 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230287.1 protein_id gnl|my_center|LOCUS_82430 151813 152808 gene locus_tag LOCUS_82440 gene pssA 151813 152808 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230288.1 protein_id gnl|my_center|LOCUS_82440 152820 155042 gene locus_tag LOCUS_82450 152820 155042 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230289.1 protein_id gnl|my_center|LOCUS_82450 155711 155082 gene locus_tag LOCUS_82460 155711 155082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82460 156010 155711 gene locus_tag LOCUS_82470 156010 155711 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 protein_id gnl|my_center|LOCUS_82470 156150 156722 gene locus_tag LOCUS_82480 156150 156722 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230292.1 protein_id gnl|my_center|LOCUS_82480 156801 157718 gene locus_tag LOCUS_82490 156801 157718 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230294.1 protein_id gnl|my_center|LOCUS_82490 158289 159947 gene locus_tag LOCUS_82500 gene thiC 158289 159947 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230295.1 protein_id gnl|my_center|LOCUS_82500 159944 160786 gene locus_tag LOCUS_82510 gene thiD 159944 160786 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230296.1 protein_id gnl|my_center|LOCUS_82510 160878 161705 gene locus_tag LOCUS_82520 160878 161705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82520 161755 162132 gene locus_tag LOCUS_82530 161755 162132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82530 162967 162212 gene locus_tag LOCUS_82540 162967 162212 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230300.1 protein_id gnl|my_center|LOCUS_82540 163169 162969 gene locus_tag LOCUS_82550 gene thiS 163169 162969 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062394.1 protein_id gnl|my_center|LOCUS_82550 164230 163175 gene locus_tag LOCUS_82560 gene thiO 164230 163175 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230302.1 protein_id gnl|my_center|LOCUS_82560 164362 165027 gene locus_tag LOCUS_82570 gene thiE 164362 165027 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230303.1 protein_id gnl|my_center|LOCUS_82570 166033 165128 gene locus_tag LOCUS_82580 166033 165128 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226964.1 protein_id gnl|my_center|LOCUS_82580 167450 166167 gene locus_tag LOCUS_82590 167450 166167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82590 167347 168324 gene locus_tag LOCUS_82600 167347 168324 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230305.1 protein_id gnl|my_center|LOCUS_82600 169170 168343 gene locus_tag LOCUS_82610 gene sigJ 169170 168343 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_82610 170735 169224 gene locus_tag LOCUS_82620 170735 169224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230306.1 protein_id gnl|my_center|LOCUS_82620 171487 170732 gene locus_tag LOCUS_82630 171487 170732 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_82630 171820 172242 gene locus_tag LOCUS_82640 171820 172242 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_82640 172239 173201 gene locus_tag LOCUS_82650 172239 173201 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230309.1 protein_id gnl|my_center|LOCUS_82650 173751 173206 gene locus_tag LOCUS_82660 173751 173206 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729409.1 protein_id gnl|my_center|LOCUS_82660 174419 173763 gene locus_tag LOCUS_82670 174419 173763 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_82670 175185 174382 gene locus_tag LOCUS_82680 175185 174382 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228048.1 protein_id gnl|my_center|LOCUS_82680 175754 175182 gene locus_tag LOCUS_82690 175754 175182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82690 176336 175911 gene locus_tag LOCUS_82700 176336 175911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82700 176483 177277 gene locus_tag LOCUS_82710 176483 177277 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_82710 179634 177457 gene locus_tag LOCUS_82720 179634 177457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82720 180709 179807 gene locus_tag LOCUS_82730 gene thpD 180709 179807 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230318.1 protein_id gnl|my_center|LOCUS_82730 181125 180706 gene locus_tag LOCUS_82740 181125 180706 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071625.1 protein_id gnl|my_center|LOCUS_82740 182341 181148 gene locus_tag LOCUS_82750 gene ectB 182341 181148 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230319.1 protein_id gnl|my_center|LOCUS_82750 183027 182473 gene locus_tag LOCUS_82760 gene ectA 183027 182473 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449632.1 protein_id gnl|my_center|LOCUS_82760 183189 183830 gene locus_tag LOCUS_82770 183189 183830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077716.1 protein_id gnl|my_center|LOCUS_82770 185548 183851 gene locus_tag LOCUS_82780 185548 183851 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878257.1 protein_id gnl|my_center|LOCUS_82780 185675 186532 gene locus_tag LOCUS_82790 185675 186532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82790 186655 187059 gene locus_tag LOCUS_82800 186655 187059 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400656.1 protein_id gnl|my_center|LOCUS_82800 188205 187075 gene locus_tag LOCUS_82810 188205 187075 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_82810 188374 188550 gene locus_tag LOCUS_82820 188374 188550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82820 189121 188540 gene locus_tag LOCUS_82830 189121 188540 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229995.1 protein_id gnl|my_center|LOCUS_82830 189282 189815 gene locus_tag LOCUS_82840 189282 189815 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284350.1 protein_id gnl|my_center|LOCUS_82840 189841 190428 gene locus_tag LOCUS_82850 189841 190428 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111108.1 protein_id gnl|my_center|LOCUS_82850 190449 191429 gene locus_tag LOCUS_82860 190449 191429 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_82860 191859 191413 gene locus_tag LOCUS_82870 191859 191413 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_82870 191949 192362 gene locus_tag LOCUS_82880 191949 192362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82880 193287 192370 gene locus_tag LOCUS_82890 193287 192370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82890 194516 193455 gene locus_tag LOCUS_82900 194516 193455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82900 195151 194513 gene locus_tag LOCUS_82910 195151 194513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82910 195584 195153 gene locus_tag LOCUS_82920 195584 195153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_82920 195683 198346 gene locus_tag LOCUS_82930 195683 198346 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_82930 198479 199234 gene locus_tag LOCUS_82940 198479 199234 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_82940 199318 200136 gene locus_tag LOCUS_82950 199318 200136 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_82950 200133 200924 gene locus_tag LOCUS_82960 200133 200924 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_82960 201002 203230 gene locus_tag LOCUS_82970 201002 203230 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230913.1 protein_id gnl|my_center|LOCUS_82970 203285 203776 gene locus_tag LOCUS_82980 203285 203776 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742062.1 protein_id gnl|my_center|LOCUS_82980 203818 204138 gene locus_tag LOCUS_82990 203818 204138 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_82990 204151 206010 gene locus_tag LOCUS_83000 204151 206010 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_83000 207899 206067 gene locus_tag LOCUS_83010 207899 206067 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_83010 208732 208019 gene locus_tag LOCUS_83020 208732 208019 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230902.1 protein_id gnl|my_center|LOCUS_83020 208886 209341 gene locus_tag LOCUS_83030 208886 209341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83030 210500 209493 gene locus_tag LOCUS_83040 210500 209493 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_83040 210819 210746 gene locus_tag LOCUS_t00850 210819 210746 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 210880 211461 gene locus_tag LOCUS_83050 gene dcd 210880 211461 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003058109.1 protein_id gnl|my_center|LOCUS_83050 212613 211417 gene locus_tag LOCUS_83060 212613 211417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222776.1 protein_id gnl|my_center|LOCUS_83060 212792 213511 gene locus_tag LOCUS_83070 212792 213511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83070 213673 215526 gene locus_tag LOCUS_83080 gene dnaK 213673 215526 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230874.1 protein_id gnl|my_center|LOCUS_83080 215523 216284 gene locus_tag LOCUS_83090 gene grpE 215523 216284 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230873.1 protein_id gnl|my_center|LOCUS_83090 216314 217507 gene locus_tag LOCUS_83100 gene dnaJ 216314 217507 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230872.1 protein_id gnl|my_center|LOCUS_83100 217504 217932 gene locus_tag LOCUS_83110 217504 217932 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467870.1 protein_id gnl|my_center|LOCUS_83110 219133 217937 gene locus_tag LOCUS_83120 219133 217937 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742063.1 protein_id gnl|my_center|LOCUS_83120 219604 220338 gene locus_tag LOCUS_83130 219604 220338 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 protein_id gnl|my_center|LOCUS_83130 220629 223220 gene locus_tag LOCUS_83140 gene clpB 220629 223220 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_83140 223752 223267 gene locus_tag LOCUS_83150 223752 223267 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 protein_id gnl|my_center|LOCUS_83150 224102 223749 gene locus_tag LOCUS_83160 224102 223749 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225945.1 protein_id gnl|my_center|LOCUS_83160 224256 224957 gene locus_tag LOCUS_83170 224256 224957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230862.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_83170 225001 225777 gene locus_tag LOCUS_83180 225001 225777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284395.1 protein_id gnl|my_center|LOCUS_83180 225870 226379 gene locus_tag LOCUS_83190 gene pyrE 225870 226379 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230857.1 protein_id gnl|my_center|LOCUS_83190 226400 226765 gene locus_tag LOCUS_83200 226400 226765 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230852.1 protein_id gnl|my_center|LOCUS_83200 226762 227412 gene locus_tag LOCUS_83210 226762 227412 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892159.1 protein_id gnl|my_center|LOCUS_83210 229617 227422 gene locus_tag LOCUS_83220 229617 227422 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_83220 229698 230828 gene locus_tag LOCUS_83230 229698 230828 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230849.1 protein_id gnl|my_center|LOCUS_83230 231571 230822 gene locus_tag LOCUS_83240 231571 230822 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230841.1 protein_id gnl|my_center|LOCUS_83240 231986 231576 gene locus_tag LOCUS_83250 231986 231576 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230839.1 protein_id gnl|my_center|LOCUS_83250 232773 232096 gene locus_tag LOCUS_83260 232773 232096 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230838.1 protein_id gnl|my_center|LOCUS_83260 233841 232870 gene locus_tag LOCUS_83270 233841 232870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83270 233964 235340 gene locus_tag LOCUS_83280 233964 235340 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467865.1 protein_id gnl|my_center|LOCUS_83280 236108 235344 gene locus_tag LOCUS_83290 236108 235344 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_83290 236488 236132 gene locus_tag LOCUS_83300 236488 236132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83300 237593 236457 gene locus_tag LOCUS_83310 gene nagA 237593 236457 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_83310 238320 237811 gene locus_tag LOCUS_83320 238320 237811 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_83320 238488 238772 gene locus_tag LOCUS_83330 238488 238772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83330 239242 238778 gene locus_tag LOCUS_83340 239242 238778 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_83340 240175 239273 gene locus_tag LOCUS_83350 240175 239273 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_83350 240291 241961 gene locus_tag LOCUS_83360 240291 241961 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_83360 242029 243063 gene locus_tag LOCUS_83370 gene fbaA 242029 243063 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_83370 243068 243487 gene locus_tag LOCUS_83380 243068 243487 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_83380 244386 243745 gene locus_tag LOCUS_83390 244386 243745 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_83390 245160 244513 gene locus_tag LOCUS_83400 245160 244513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230807.1 protein_id gnl|my_center|LOCUS_83400 245240 246529 gene locus_tag LOCUS_83410 245240 246529 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230806.1 protein_id gnl|my_center|LOCUS_83410 246534 247184 gene locus_tag LOCUS_83420 246534 247184 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_83420 248348 247227 gene locus_tag LOCUS_83430 248348 247227 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 protein_id gnl|my_center|LOCUS_83430 248454 250511 gene locus_tag LOCUS_83440 248454 250511 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191316996.1 protein_id gnl|my_center|LOCUS_83440 250514 251497 gene locus_tag LOCUS_83450 250514 251497 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_83450 251524 252768 gene locus_tag LOCUS_83460 gene purD 251524 252768 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230794.1 protein_id gnl|my_center|LOCUS_83460 252823 253224 gene locus_tag LOCUS_83470 252823 253224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83470 253205 253840 gene locus_tag LOCUS_83480 253205 253840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83480 253848 255056 gene locus_tag LOCUS_83490 253848 255056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83490 255046 255816 gene locus_tag LOCUS_83500 255046 255816 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_83500 255855 257012 gene locus_tag LOCUS_83510 255855 257012 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230787.1 protein_id gnl|my_center|LOCUS_83510 257129 257299 gene locus_tag LOCUS_83520 257129 257299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83520 258336 257296 gene locus_tag LOCUS_83530 258336 257296 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230783.1 protein_id gnl|my_center|LOCUS_83530 258468 258998 gene locus_tag LOCUS_83540 258468 258998 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230782.1 protein_id gnl|my_center|LOCUS_83540 259014 259739 gene locus_tag LOCUS_83550 259014 259739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83550 259766 260353 gene locus_tag LOCUS_83560 259766 260353 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230780.1 protein_id gnl|my_center|LOCUS_83560 260419 260952 gene locus_tag LOCUS_83570 260419 260952 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223685.1 protein_id gnl|my_center|LOCUS_83570 260949 261632 gene locus_tag LOCUS_83580 260949 261632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83580 261644 263077 gene locus_tag LOCUS_83590 gene purB 261644 263077 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_83590 263097 263909 gene locus_tag LOCUS_83600 263097 263909 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029509.1 protein_id gnl|my_center|LOCUS_83600 263944 264405 gene locus_tag LOCUS_83610 263944 264405 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222856.1 protein_id gnl|my_center|LOCUS_83610 264450 265388 gene locus_tag LOCUS_83620 264450 265388 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222855.1 protein_id gnl|my_center|LOCUS_83620 265385 266197 gene locus_tag LOCUS_83630 265385 266197 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_83630 266855 266205 gene locus_tag LOCUS_83640 266855 266205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230765.1 protein_id gnl|my_center|LOCUS_83640 266919 268433 gene locus_tag LOCUS_83650 266919 268433 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_83650 270377 268827 gene locus_tag LOCUS_83660 270377 268827 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_83660 271394 270390 gene locus_tag LOCUS_83670 271394 270390 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089460.1 protein_id gnl|my_center|LOCUS_83670 272551 271646 gene locus_tag LOCUS_83680 272551 271646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83680 272647 272886 gene locus_tag LOCUS_83690 gene purS 272647 272886 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230759.1 protein_id gnl|my_center|LOCUS_83690 272883 273551 gene locus_tag LOCUS_83700 gene purQ 272883 273551 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230758.1 protein_id gnl|my_center|LOCUS_83700 273548 275815 gene locus_tag LOCUS_83710 gene purL 273548 275815 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230755.1 protein_id gnl|my_center|LOCUS_83710 275819 276514 gene locus_tag LOCUS_83720 275819 276514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83720 277652 276504 gene locus_tag LOCUS_83730 277652 276504 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230753.1 protein_id gnl|my_center|LOCUS_83730 278570 277704 gene locus_tag LOCUS_83740 278570 277704 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230751.1 protein_id gnl|my_center|LOCUS_83740 278876 280897 gene locus_tag LOCUS_83750 gene rmdA 278876 280897 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_83750 280907 281566 gene locus_tag LOCUS_83760 280907 281566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83760 281689 282078 gene locus_tag LOCUS_83770 281689 282078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83770 282130 283500 gene locus_tag LOCUS_83780 282130 283500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83780 283582 284394 gene locus_tag LOCUS_83790 283582 284394 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230790.1 protein_id gnl|my_center|LOCUS_83790 284448 284774 gene locus_tag LOCUS_83800 284448 284774 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284386.1 protein_id gnl|my_center|LOCUS_83800 285213 284779 gene locus_tag LOCUS_83810 gene arfB 285213 284779 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_83810 286049 285216 gene locus_tag LOCUS_83820 286049 285216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83820 286555 286049 gene locus_tag LOCUS_83830 286555 286049 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223533.1 protein_id gnl|my_center|LOCUS_83830 287699 286614 gene locus_tag LOCUS_83840 gene purM 287699 286614 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230742.1 protein_id gnl|my_center|LOCUS_83840 289222 287711 gene locus_tag LOCUS_83850 gene purF 289222 287711 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230743.1 protein_id gnl|my_center|LOCUS_83850 290033 289308 gene locus_tag LOCUS_83860 290033 289308 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031856.1 protein_id gnl|my_center|LOCUS_83860 290150 290464 gene locus_tag LOCUS_83870 290150 290464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83870 290461 292392 gene locus_tag LOCUS_83880 290461 292392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911742.1 protein_id gnl|my_center|LOCUS_83880 293365 292373 gene locus_tag LOCUS_83890 293365 292373 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_83890 293442 294485 gene locus_tag LOCUS_83900 293442 294485 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742135.1 protein_id gnl|my_center|LOCUS_83900 294482 295351 gene locus_tag LOCUS_83910 294482 295351 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_83910 295381 296400 gene locus_tag LOCUS_83920 295381 296400 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_83920 296411 297460 gene locus_tag LOCUS_83930 296411 297460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_83930 297457 298236 gene locus_tag LOCUS_83940 297457 298236 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_83940 298236 300095 gene locus_tag LOCUS_83950 gene iolD 298236 300095 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 protein_id gnl|my_center|LOCUS_83950 300287 300105 gene locus_tag LOCUS_83960 300287 300105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_83960 300475 301365 gene locus_tag LOCUS_83970 300475 301365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467854.1 protein_id gnl|my_center|LOCUS_83970 301895 301362 gene locus_tag LOCUS_83980 301895 301362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230729.1 protein_id gnl|my_center|LOCUS_83980 302809 301982 gene locus_tag LOCUS_83990 302809 301982 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_83990 303940 302837 gene locus_tag LOCUS_84000 303940 302837 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230728.1 protein_id gnl|my_center|LOCUS_84000 304389 303937 gene locus_tag LOCUS_84010 304389 303937 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_84010 304438 305268 gene locus_tag LOCUS_84020 304438 305268 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230727.1 protein_id gnl|my_center|LOCUS_84020 305914 305273 gene locus_tag LOCUS_84030 305914 305273 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230723.1 protein_id gnl|my_center|LOCUS_84030 306386 306075 gene locus_tag LOCUS_84040 306386 306075 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467851.1 protein_id gnl|my_center|LOCUS_84040 307251 306409 gene locus_tag LOCUS_84050 307251 306409 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230721.1 protein_id gnl|my_center|LOCUS_84050 308416 307523 gene locus_tag LOCUS_84060 308416 307523 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230718.1 protein_id gnl|my_center|LOCUS_84060 308590 309306 gene locus_tag LOCUS_84070 308590 309306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284398.1 protein_id gnl|my_center|LOCUS_84070 309331 310227 gene locus_tag LOCUS_84080 gene mshD 309331 310227 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230716.1 protein_id gnl|my_center|LOCUS_84080 310327 311499 gene locus_tag LOCUS_84090 gene pstS 310327 311499 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776547.1 protein_id gnl|my_center|LOCUS_84090 311604 312581 gene locus_tag LOCUS_84100 gene pstC 311604 312581 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_84100 312581 313678 gene locus_tag LOCUS_84110 gene pstA 312581 313678 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776545.1 protein_id gnl|my_center|LOCUS_84110 313700 314479 gene locus_tag LOCUS_84120 gene pstB 313700 314479 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230712.1 protein_id gnl|my_center|LOCUS_84120 314702 315094 gene locus_tag LOCUS_84130 314702 315094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84130 315109 315672 gene locus_tag LOCUS_84140 315109 315672 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831438.1 protein_id gnl|my_center|LOCUS_84140 315685 317322 gene locus_tag LOCUS_84150 315685 317322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_84150 317322 318101 gene locus_tag LOCUS_84160 317322 318101 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222184.1 protein_id gnl|my_center|LOCUS_84160 318777 318112 gene locus_tag LOCUS_84170 gene phoU 318777 318112 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230711.1 protein_id gnl|my_center|LOCUS_84170 <320825 318856 gene locus_tag LOCUS_84180 <320825 318856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230710.1:LCP family protein