COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..74688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..1257 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene ychF CDS 1401..2414 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694586.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene truD CDS 2422..3198 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene surE CDS 3226..3810 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694589.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 3825..4316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 4329..4526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 4559..5788 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene nlpD CDS 5869..6453 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 6583..6948 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7028..7396 product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 7467..8126 product two-component system response regulator QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 8146..9513 product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene qseC CDS complement(9559..9828) product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene yedF CDS complement(9867..11084) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene yedE CDS complement(11341..11691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(11900..12118) product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 12300..13235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 13238..14056 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209983.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene proC CDS 14053..15213 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694357.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(15210..15800) product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(15860..16654) product peptide ABC transporter ATP-binding protein SapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096393.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene sapF CDS complement(16823..17899) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene fbaA CDS complement(17977..19152) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene pgk CDS complement(19356..19793) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene rimI CDS complement(19885..20829) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694569.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene arcC CDS complement(20841..21845) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651072.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(22131..22547) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 22680..23219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 note possible pseudo, internal stop codon CDS 23241..23570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 note possible pseudo, internal stop codon CDS complement(23567..24064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(24326..25423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 25508..25777 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693195.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 25819..26457 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 26529..27968 product surface lipoprotein assembly modifier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 27979..28716 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(28827..30884) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene metG CDS 31229..33844 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene adhE CDS 34564..35850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(36032..36676) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene adk CDS complement(36733..37329) product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(37307..38278) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 38664..39551 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 39560..40234 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene yjjG CDS complement(40289..41053) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996329.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene dnaQ CDS complement(41060..41560) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene recX CDS complement(41618..42793) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene recA CDS complement(43061..44311) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene lolE CDS complement(44311..44991) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene lolD CDS complement(44991..45719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(45694..47301) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(47294..48466) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654778.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(48576..49523) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(49650..50660) product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene mglC CDS complement(50675..52174) product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene mglA CDS complement(52237..53229) product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene mglB CDS 53446..54171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 assembly_gap 54293..54327 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 54390..54887 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 55004..56284 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(56339..57529) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene tyrS CDS 57888..58727 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene cpdA CDS complement(58742..59362) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene nudF CDS complement(59355..60086) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(60091..60519) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 60706..61890 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene nhaA CDS 62052..63626 product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693345.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(63814..65265) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene mltF CDS complement(65278..66576) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 tRNA complement(66691..66767) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(66836..66912) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(66926..67020) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(67227..67652) product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(67762..68001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 68118..68633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(68748..70688) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(70685..71230) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ccmE CDS complement(71292..71486) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene ccmD CDS complement(71498..72238) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(72286..72948) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005637214.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene ccmB CDS complement(72945..73577) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene ccmA CDS complement(73693..74130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 74398..74547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 sequence02 source 1..380352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2099..3538) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene pyk CDS 3664..4152 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652786.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene sixA CDS 4344..5312 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene dusB CDS 5326..5619 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene fis CDS complement(5874..6704) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(6741..7418) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(7408..8445) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene metN CDS complement(8577..8846) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705401.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 8978..10567 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene purH CDS complement(10649..11620) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080512803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene selD CDS complement(11772..12188) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene ndk CDS 12368..13009 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene sodA CDS 13227..16085 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 tRNA complement(16269..16344) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(16451..17203) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene moeB CDS complement(17217..18461) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693918.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene moeA CDS complement(18637..20163) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene purF CDS complement(20177..20683) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 20978..21895 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 21920..22372 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(22430..22933) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687959.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene rnhA CDS complement(22977..24308) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene argG CDS 24497..25534 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 25611..26432 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693802.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 26547..26837 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 26857..28500 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene groL CDS complement(28568..29632) product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(29634..30587) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene dusC CDS complement(30629..31492) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694031.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene djlA CDS 31813..32958 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627231.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene metK CDS complement(33030..33467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 33757..36330 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112130572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene clpB CDS 36436..37038 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rdgB CDS 37035..37355 product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 37364..37816 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650678.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(37881..40229) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene lptD CDS complement(40241..41608) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene hemN CDS complement(41608..42075) product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(42100..42678) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693127.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene yihI CDS 42931..44148 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224758.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene gltS CDS complement(44249..44662) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648994.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ruvX CDS complement(44675..45238) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene ampD CDS 45291..46133 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693720.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 46273..46914 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene pyrE CDS complement(46974..47735) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(47844..49025) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene purT CDS complement(49137..51548) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693149.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene plsB CDS 51677..52306 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene lexA CDS 52328..53017 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene mutH CDS 53074..54111 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene nagZ CDS 54222..55292 product 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene rlmC CDS 55487..56797 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene eno CDS 56890..57300 product DUF2251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005636440.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(57347..58753) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene trpCF CDS 58867..59181 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 59183..59908 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene truC CDS 59930..60103 product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628875.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 60100..60576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 60978..61817 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene queF CDS complement(61888..62715) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene znuB CDS complement(62739..64076) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(64085..64573) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657800.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene mreD CDS complement(64573..65535) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene mreC CDS complement(65727..66779) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(66984..67271) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene rplY CDS complement(67459..68727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(68880..70331) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(70349..71731) product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene citG CDS complement(71792..73294) product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663293.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene citF CDS complement(73307..74194) product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene citE CDS complement(74191..74478) product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene citD CDS 74718..75596 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene metF CDS complement(75662..76201) product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene smrB CDS 76297..77241 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694243.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene prmB CDS complement(77352..77996) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene rnt CDS complement(78002..78412) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165939.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene gloA CDS 78496..79317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 79330..82059 product YdbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 82056..82253 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020688201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(82359..83750) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(83885..85081) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene metC CDS complement(85161..85700) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene dsbB CDS complement(85799..87343) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene nhaB CDS 87525..88247 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652140.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene fadR CDS 88256..89350 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490838.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(89709..90257) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene pgsA CDS 90424..91089 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649826.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 91089..91424 product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene tusE CDS complement(91510..92937) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995201.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene aspA CDS complement(93111..93506) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene msrB CDS 93735..94739 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005646416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene gap CDS complement(95065..96369) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105886347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(96353..97033) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene thiE CDS complement(97044..97853) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene thiD CDS complement(97846..98637) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene thiM CDS complement(98934..99107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(99107..99766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(100069..100716) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662665.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene tenA CDS complement(100727..101671) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(101694..102431) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693804.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(102428..103150) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(103459..104541) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene leuB CDS 104635..104877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 104969..106273 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene fadI CDS 106288..108432 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene fadJ CDS complement(108448..109137) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene modB CDS complement(109217..109975) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene modA CDS complement(110069..110830) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287492.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(110832..111740) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(111903..113975) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122008.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene dnaX CDS complement(113993..114532) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene apt CDS complement(114714..115190) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene greA CDS 115426..116727 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene hemA CDS 116892..118418 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694423.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene der CDS 118430..119860 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene hldE CDS 119928..120878 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162877157.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 120955..121827 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene rsmA CDS complement(122219..124681) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(124926..126356) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429230.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene glgA CDS complement(126463..127764) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005706553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene glgC CDS complement(127787..129766) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene glgX CDS complement(129856..132045) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene glgB CDS 132491..133678 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene lpxB CDS 133731..134783 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene sohB CDS complement(134853..137048) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 137432..137932 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene ftnA CDS 137932..138429 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene ftnA CDS 138669..139970 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 140185..141273 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693251.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene proB CDS 141282..142046 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 142046..142681 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene nth CDS 142787..144166 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(144295..145245) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654296.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene thrB CDS complement(145245..147701) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene thrA CDS 148106..148405 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene yajC CDS 148480..150327 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene secD CDS 150338..151312 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene secF CDS complement(151409..153145) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene cydD CDS complement(153175..157104) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(157106..158914) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(159071..160246) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene envC CDS 160431..161114 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(161299..161880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(161983..162828) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene nfo CDS 162911..163468 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 163500..163886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(163997..165607) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene pckA CDS 165840..166121 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene ftsB CDS 166123..166800 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene ispD CDS 166824..167300 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687916.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene ispF CDS complement(167388..167795) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene mutT CDS complement(167892..170585) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene secA CDS complement(170624..170938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(171038..171424) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene cueR CDS 171511..171708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 171723..173891 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene copA CDS 173974..174582 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene rsmD CDS 174595..174906 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 175026..175898 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene tehB CDS 176016..176243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 176261..176632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 176850..178349 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693713.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene fruB CDS 178361..179302 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene fruK CDS 179315..180973 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693715.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 181126..181434 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene yhbY CDS 181499..182227 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 182230..183147 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene nagK CDS 183236..183943 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene gloB CDS 184001..184927 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene hemC CDS 184931..185686 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene hemD CDS 185710..187023 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995370.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 187033..188253 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 188491..189360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 189367..191202 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 191261..191749 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene folA CDS complement(191823..192584) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162627419.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene tcdA CDS 192660..193715 product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene modC CDS 193778..194086 product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(194133..196607) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109063995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene torA CDS complement(196842..197960) product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025298411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(198093..199817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(199853..201784) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(201964..202236) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(202365..202955) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(203036..204100) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene hemE CDS complement(204122..204670) product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693181.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 204883..205194 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 205479..206048 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693206.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 206150..207664 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650684.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene putP CDS 207823..209055 product NCS2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694289.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(209157..209918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(209931..210197) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693493.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 210553..211122 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693492.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(211162..211362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(211368..212528) product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(212608..213420) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 213952..215502 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene leuA CDS 215675..216889 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693687.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 217030..218247 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(218337..218552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 218763..219167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 note possible pseudo, frameshifted tRNA complement(219387..219463) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(219552..220250) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069255.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 note possible pseudo, frameshifted CDS complement(220263..221672) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(221674..222411) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(222640..224187) product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080316864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 224569..225714 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 225775..226932 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene hemW CDS 227007..227486 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene bcp CDS 227476..228024 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene gmhB CDS complement(228122..229453) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rlmD CDS complement(229467..229694) product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene yoeB CDS 229831..232740 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene rapA CDS 232743..233411 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654471.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene rluA CDS complement(233774..235756) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065250839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 235905..236126 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693923.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene xseB CDS 236128..237021 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724061.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene ispA CDS complement(237082..237753) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene deoC CDS 237955..239610 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693880.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(239670..241451) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene nrdD CDS complement(241536..242000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 242448..242945 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rsxA CDS 242945..243556 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene rsxB CDS 243549..245795 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869271.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene rsxC CDS 245825..246895 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rsxD CDS 246895..247527 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene rsxG CDS 247527..248216 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 248216..249172 product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene lpxM CDS 249188..251857 product PqiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694394.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 251883..252392 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene luxS CDS complement(252476..254323) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(254450..255805) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(255878..256672) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene lpxA CDS complement(256698..257162) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene fabZ CDS complement(257200..258225) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene lpxD CDS complement(258225..259007) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(259083..261494) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693264.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene bamA CDS complement(261548..262879) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene rseP CDS complement(262892..263761) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(263787..264506) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene uppS CDS complement(264674..266605) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene thrS CDS complement(266793..267620) product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(267642..268730) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene aroB CDS complement(268760..269281) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene aroK CDS complement(269502..272099) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118806713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 272240..272914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 272905..273426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 273428..273949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 273951..274361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 274379..275674 product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 275742..276176 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene nusB CDS 276250..277212 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene thiL CDS 277228..277704 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694464.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 277706..278338 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650349.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(278373..279371) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(279394..280026) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 280114..280716 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693879.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 280767..282065 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 282358..282963 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694351.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene ruvA CDS 282985..283992 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene ruvB CDS complement(284034..286052) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817357.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene malQ CDS complement(286170..286730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 286812..287663 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481388.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 287783..289252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 289285..289941 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632750.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene ftsE CDS 289957..290892 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ftsX CDS complement(290979..291113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(291183..291728) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 291947..292363 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 292388..293020 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene yihA CDS 293031..293468 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995269.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rraB CDS 293666..294535 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 294547..294927 product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(295024..296613) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(296690..297769) product heme ABC transporter ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene fbpC CDS complement(297756..299276) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(299393..300388) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667903.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 300590..302779 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647471.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene uvrD CDS 302855..303655 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 303761..304216 product DUF3290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 304216..304851 product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(304861..305415) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694486.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(305408..305962) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(305964..307982) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869028.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene rep CDS complement(308013..308807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(308804..309430) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693139.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene lpxH CDS 309782..310894 product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene potA CDS 310884..311744 product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene potB CDS 311744..312511 product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene potC CDS 312566..312877 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 tRNA 312981..313070 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 313264..313572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(313635..314225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(314248..314427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(314424..314780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(314835..315116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 315217..315573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 315691..317361 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ettA CDS 317588..318904 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 318974..319789 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene aroE tRNA 319964..320040 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 320044..320128 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 320152..320226 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 320285..320359 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 320502..322142 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869249.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene pgi CDS 322217..322795 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694350.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene ruvC CDS 322808..322984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 323225..325345 product TonB-dependent siderophore receptor FetA/FrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene fetA CDS 325475..327373 product heme lyase NrfEFG subunit NrfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene nrfE CDS 327528..328061 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 328085..328498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 328499..329242 product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene nrfG CDS 329390..331225 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693142.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene ilvD CDS 331357..331920 product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(331935..332291) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene folB CDS 332378..332965 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene plsY CDS complement(333009..333611) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene leuD CDS complement(333625..335034) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene leuC CDS complement(335340..336317) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene lpxK CDS complement(336375..336596) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene ilvM CDS complement(336598..338247) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012613.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene ilvG CDS 338596..340113 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005690769.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene nrfA CDS 340133..340786 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene nrfB CDS 340786..341463 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene nrfC CDS 341463..342428 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene nrfD CDS 342621..344258 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene pyrG CDS 344460..346412 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(346487..347227) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649034.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(347335..347709) product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene nudB CDS complement(347885..349261) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene argH CDS complement(349423..350052) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(350082..350771) product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene pnuC CDS complement(350889..351512) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(351526..352797) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene hisS CDS complement(352831..353946) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene ispG CDS complement(353962..354945) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 355169..356734 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(356775..357122) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(357200..358237) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene ilvE CDS 358562..359722 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172454032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 359780..360319 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene pilW CDS 360336..362663 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 tRNA 362766..362842 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 362891..362967 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(363065..363439) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 363558..364151 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene clpP CDS 364151..365395 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene clpX CDS 365475..365825 product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene ychN CDS 365825..367012 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(366999..367271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(367280..367804) product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(367813..368601) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116972861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(368669..369169) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669389.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene rraA CDS 369402..369629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 repeat_region 369752..369931 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcaatccctttggaacagggcaatgtctttcaac CDS complement(370349..370516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(370792..371511) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 371675..372007 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 assembly_gap 372345..372663 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 372726..373985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 374040..374312 product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(374245..374715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 374749..375666 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005708986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 375678..375995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005708988.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 376013..376522 product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 376639..376851 product ANR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 376861..377034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 377037..377357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 377513..378061 product DUF1018 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005708981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 378048..378602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 378799..379170 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 379277..379666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 379746..380294 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064082132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 sequence03 source 1..225569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2212 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158580290.1:YadA-like family protein locus_tag LOCUS_04410 CDS 2783..5521 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 5767..7437 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161803513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 7478..7741 product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 7886..8743 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(8793..9500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(9549..10286) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693665.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene tsaA CDS 10347..11255 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649448.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene menA CDS complement(11329..12093) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(12241..14316) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(14787..14969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(14997..16184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 16295..16705 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene hslR CDS 16783..17670 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene hslO CDS complement(17722..18264) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216968.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 18449..19564 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene asd CDS 19652..20461 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 20632..22266 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(22350..22892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(22940..24022) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032803489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene prfA CDS 24189..25520 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693336.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene dnaA CDS 25542..26645 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene dnaN CDS 26783..27865 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693333.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene recF CDS 27967..28299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(28367..29920) product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088244.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(29988..30419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(30643..31113) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(31155..31796) product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(31808..32866) product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene msrAB CDS complement(33219..33407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(33417..33962) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 34073..34351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(34421..34939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(35026..35763) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002887843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene arcA CDS complement(35891..36583) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(36580..37866) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene nadR CDS 38112..39077 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828335.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene ribF CDS 39172..41988 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815539.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene ileS CDS 42228..42881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 42986..44344 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693739.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene pssA CDS 44432..45172 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene rlmB CDS complement(45244..46197) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene corA CDS 46549..46773 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene tatA CDS 46777..47394 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene tatB CDS 47381..48133 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene tatC CDS 48290..49309 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene hemB CDS 49466..51046 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene prfC CDS complement(51112..51453) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene erpA CDS 51619..52746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 52750..54042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 54036..54974 product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196337679.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 55048..56220 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039851544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 56228..57343 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808446.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 57360..58460 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437003.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene wecB CDS 58460..59458 product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 59460..60341 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 60546..61688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 61754..63064 product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 63087..64148 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene rffG CDS 64225..65097 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rfbA CDS 65099..65977 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651858.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene rfbD CDS 65980..66543 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene rfbC CDS complement(66555..66956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(67073..67369) product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene yggU CDS complement(67369..67905) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651676.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(68002..68343) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(68446..69195) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene trmB CDS complement(69345..70295) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691510.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(70405..71430) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086557245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene plsX CDS complement(71449..71619) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rpmF CDS complement(71636..72160) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868949.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene yceD CDS complement(72260..72622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 72723..73724 product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 73730..74098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 74108..74746 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 74765..75400 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 75409..76446 product TerY-C metal binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253656.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 76449..77999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 77999..79498 product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 79535..80113 product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene terD CDS 80126..80773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 note possible pseudo, internal stop codon CDS 80994..81785 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 81878..83149 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(83260..84852) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261775.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(85063..85653) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657657.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene dolP CDS complement(85664..86245) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(86256..86630) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(86605..88347) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694381.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 88427..89278 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene rsmI CDS complement(89341..90705) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene mpl CDS complement(90830..91567) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 91691..92569 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene oxyR CDS 92600..93214 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene fabR CDS complement(93241..94227) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693888.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rsmC CDS 94308..94718 product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene holD CDS 94801..95727 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene znuA CDS 95943..96560 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 96599..97639 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene rluB CDS 97763..98401 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(98461..99417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 99838..102810 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rne CDS complement(102897..105257) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene rnr CDS 105595..106536 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rsmH CDS 106546..106866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 106875..108923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 108932..110404 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene murE CDS 110622..112016 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996536.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene murF CDS 112026..113108 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene mraY CDS 113270..114571 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693450.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene murD CDS 114571..115749 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661306.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene ftsW CDS 115888..116946 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene murG CDS 116943..118385 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693453.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene murC CDS 118512..119423 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693454.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 119423..120223 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 120250..121533 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693456.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene ftsA CDS 121582..122811 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene ftsZ CDS 122838..123758 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene lpxC CDS 123928..124524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 124538..126142 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ilvA CDS 126152..127483 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene glmM CDS complement(127546..128250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 128427..129086 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene rpiA CDS 129171..130400 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene serA CDS 130737..132245 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(132391..133197) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene map CDS complement(133451..137737) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693659.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rpoC CDS complement(138016..142044) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene rpoB CDS complement(142374..142892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 143114..143863 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661551.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 144330..146096 product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869020.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene fucI CDS 146217..147650 product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene fucK CDS 147671..148105 product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene fucU CDS 148166..148813 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene fucA CDS 148854..150140 product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 150207..151358 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene fucO CDS 151508..155197 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene metH CDS 155309..155950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 156223..156792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 157433..157912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(157986..159137) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene dnaJ CDS complement(159192..159596) product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(159829..161733) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene dnaK CDS 162028..163473 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 163498..163731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(163834..165513) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693852.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene recN CDS complement(165653..168607) product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene ptrA CDS complement(168619..171900) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene recC CDS complement(171967..172263) product DUF5374 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995601.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(172265..172912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(172909..173553) product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693287.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(173573..174094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(174191..174721) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene fabA CDS complement(174842..176479) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 176565..177014 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene matP CDS complement(177069..177302) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene acpP CDS complement(177524..178198) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rpe CDS 178424..178693 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 178704..178829 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene ykgO CDS 178852..179640 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 179811..181253 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115933.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene aldA CDS 181375..181656 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene rpoZ CDS 181686..183449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 assembly_gap 181696..181709 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 183581..184438 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene menB CDS 184519..186912 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene mrcB CDS complement(187073..188200) product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene ompA CDS 188748..191840 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694279.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 191939..192373 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 192475..194106 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene yidC CDS 194300..195682 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693343.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene mnmE CDS 195762..197027 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene tilS CDS complement(197012..197905) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694355.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene xerD CDS complement(197984..199168) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene tuf tRNA complement(199281..199356) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(199360..199434) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(199477..199561) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(199597..199672) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 199917..200867 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667563.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene coaA CDS 200936..201475 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 201546..202883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 202880..203344 product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 203348..204262 product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene ccmI CDS 204501..205085 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene mog CDS 205095..205820 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 205810..206508 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 206576..208144 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826265.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene murJ CDS 208349..208612 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651580.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene rpsT CDS 208762..209955 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(210012..210830) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene cysE CDS complement(210842..211852) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene gpsA CDS complement(211975..212493) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene secB CDS complement(212503..212946) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(213061..214362) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene tig CDS complement(214525..214968) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene lysM CDS 215084..215536 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 215742..216164 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693964.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(216227..217174) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693763.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene accA CDS complement(217419..218840) product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ftsP CDS complement(218979..219698) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689023.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 219832..220329 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene tpx CDS complement(220380..221315) product KpsF/GutQ family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012054716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(221397..222638) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694299.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene proA CDS 222882..224810 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693855.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene mutL tRNA complement(225181..225256) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(225295..225371) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 rRNA complement(225396..225492) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence04 source 1..99471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..1502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(1622..2251) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 2361..4967 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040035576.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene mutS CDS 5107..5421 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene rsfS CDS 5425..5892 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene rlmH CDS 5973..7955 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649850.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene mrdA CDS 7948..9075 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene rodA CDS 9310..9876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 9983..11161 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 11275..11571 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene ybeD CDS 11659..12333 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene lipB CDS 12333..13322 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene lipA CDS 13515..14975 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene tldD CDS complement(15008..15340) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(15337..16089) product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene azlC CDS 16227..17108 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647969.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene prmA CDS complement(17163..18131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208205.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(18281..18748) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(18828..20612) product PTS ascorbate-specific subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 21354..22100 product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene ulaR CDS complement(22262..23188) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene rfaD CDS 23293..23460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(23682..24194) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene def CDS 24297..25442 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene dprA CDS 25563..25970 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene secE CDS 25985..26551 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene nusG CDS 26751..27179 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene rplK CDS 27184..27873 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rplA CDS 28087..29754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 30115..30609 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626605.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene rplJ CDS 30664..31032 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rplL CDS 31272..31643 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005548786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene rplN CDS 31654..31965 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005635734.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene rplX CDS 31985..32524 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rplE CDS 32536..32841 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rpsN CDS 32878..33270 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene rpsH CDS 33287..33820 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655593.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene rplF CDS 33835..34188 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rplR CDS 34203..34703 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene rpsE CDS 34710..34886 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene rpmD CDS 34891..35325 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648410.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene rplO CDS 35329..36654 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene secY CDS 36924..37280 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene rpsM CDS 37296..37685 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene rpsK CDS 37714..38340 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693170.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene rpsD CDS 38405..39394 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene rpoA CDS 39431..39814 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene rplQ CDS complement(40526..42010) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene ilvC CDS complement(42179..44464) product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene gshAB CDS 44677..45057 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015948.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(45130..45747) product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene napC CDS complement(45759..46187) product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649106.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(46207..47103) product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene napH CDS complement(47103..48008) product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene napG CDS complement(48115..50616) product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene napA CDS complement(50634..50897) product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(50913..51443) product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene napF CDS 51629..52420 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 52557..53351 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene lgt CDS 53870..54526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(54594..55925) product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097432.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rimO CDS 56544..57029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 note possible pseudo, frameshifted CDS 57119..65173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 65170..67944 product YadA family autotransporter adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(68134..69366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(69463..69906) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene mioC tRNA complement(69937..70031) product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 70102..71532 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene selA CDS 71649..71822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 note possible pseudo, frameshifted CDS 71937..73304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 note possible pseudo, frameshifted CDS 73501..75159 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(75211..75360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 75497..76021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 note possible pseudo, frameshifted CDS 76439..76810 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087117.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 77985..78233 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rpsP CDS 78277..78804 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rimM CDS 78865..79620 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene trmD CDS 79646..79996 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rplS tRNA 80169..80244 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 80268..80343 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 80363..80438 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 80573..81580 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693707.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene mltG CDS 81592..82224 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene tmk CDS 82221..83216 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(83287..85368) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene recG CDS 85532..85729 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene osmB CDS complement(85804..87624) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112119346.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene glmS CDS complement(87779..88543) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(88821..89417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(89516..90148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(90205..91920) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene proS CDS 92042..93910 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene selB CDS 93957..95258 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694643.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rsmB CDS 95404..96750 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene trkA CDS complement(96807..97271) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene asnC CDS 97462..98454 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene asnA CDS 98558..99352 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene murI sequence05 source 1..91617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(26..102) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(128..203) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(233..309) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 581..2008 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene glnA CDS complement(2109..2537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(2620..3618) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 3830..4417 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(4553..5947) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene fumC CDS complement(6280..8280) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669465.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(8520..9767) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene lysA CDS complement(9945..11333) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene ffh tRNA complement(11637..11712) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(11718..11793) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(11919..13016) product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene mltC CDS complement(13027..13296) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(13299..14282) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693157.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene mutY CDS 14509..14757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 note possible pseudo, frameshifted CDS 15000..15521 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene hslV CDS 15666..16988 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868991.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene hslU CDS 17041..17595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(17632..17967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 note possible pseudo, frameshifted CDS complement(18040..18315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 note possible pseudo, frameshifted CDS complement(18312..18686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(18738..19040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 note possible pseudo, internal stop codon CDS complement(19041..20570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 note possible pseudo, internal stop codon CDS complement(20580..20789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(20868..22856) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(22858..24228) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(24267..25019) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(25019..25864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(25861..26061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 26279..27280 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene rhuM CDS complement(27332..28042) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(28046..28936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(29098..30396) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815452.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 30522..31064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(31152..34601) product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(34598..35239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 35446..36075 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(36125..36388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(36445..36669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(36679..36828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(36970..37224) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rpsQ CDS complement(37224..37415) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene rpmC CDS complement(37415..37825) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rplP CDS complement(37839..38546) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693167.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene rpsC CDS complement(38564..38896) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rplV CDS complement(38907..39182) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539416.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rpsS CDS complement(39210..40031) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene rplB CDS complement(40051..40356) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene rplW CDS complement(40353..40955) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652369.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene rplD CDS complement(40971..41597) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene rplC CDS complement(41623..41934) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene rpsJ CDS 42420..43070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(43164..43340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 note possible pseudo, internal stop codon, frameshifted CDS 44000..45793 product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene frdA CDS 45803..46528 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005639269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 46537..46929 product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene frdC CDS 46939..47295 product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene frdD CDS complement(47387..48340) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene fmt CDS 48451..49059 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828482.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 49070..50548 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 50551..51081 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215920.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene hemG CDS 51176..51574 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174607.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene mscL CDS complement(51637..51903) product DsrH/TusB family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(51923..52291) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene tusC CDS complement(52293..52646) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene tusD CDS complement(52646..53320) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(53413..54129) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene fkpA CDS 54178..54435 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 54508..55512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 55515..55880 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene crcB CDS complement(55982..57304) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 57444..58268 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene dapF CDS 58282..58851 product DUF5358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(59437..62457) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(62552..63844) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(63896..64900) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(64893..67274) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(67584..67958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(68064..69797) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(70028..70393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 note possible pseudo, internal stop codon, frameshifted CDS complement(70901..71557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 note possible pseudo, frameshifted CDS 71734..72531 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694515.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(72693..72959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 note possible pseudo, internal stop codon, frameshifted CDS complement(72965..73171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 note possible pseudo, internal stop codon, frameshifted CDS complement(73342..74766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(74984..76084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 76218..76631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(76688..77482) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 77706..79382 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077417416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 79483..80754 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 80681..80926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 note possible pseudo, frameshifted CDS 80941..81525 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 81534..82646 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 82725..83519 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(83705..84688) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648321.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene epmA CDS complement(84809..85036) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(85209..86042) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(86046..87323) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(87320..89392) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(89448..90083) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene ureG CDS complement(90168..90875) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(90860..91417) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene ureE sequence06 source 1..139910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..1213) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene bioB CDS complement(1327..2151) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene dapD CDS complement(2247..2681) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene dtd CDS complement(2678..3508) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656225.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 3677..4009 product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 4077..5186 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene trmA tRNA 5268..5357 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 5442..6002 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(6239..6931) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene crp CDS complement(7074..7292) product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(7302..7910) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648000.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene slmA CDS complement(7954..8409) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene dut CDS complement(8409..9620) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693302.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene coaBC CDS complement(9877..11412) product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene ddc CDS complement(11432..11830) product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene vapC CDS complement(11830..12063) product type II toxin-antitoxin system antitoxin VapB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648011.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene vapB2 CDS complement(12210..13574) product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(13928..14098) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene rpmG CDS complement(14110..14346) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene rpmB CDS complement(14516..14776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 15105..15311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 15453..15956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(16028..18712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(19083..19376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 note possible pseudo, internal stop codon CDS complement(19360..19686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(19787..20374) product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595416.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene torD CDS complement(20374..22857) product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534849.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene torA CDS complement(22866..23378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(23800..24465) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene radC CDS complement(24670..25563) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene asd CDS complement(25727..26095) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015701999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 26353..27687 product opacity-associated protein OapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694343.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene oapA CDS 27742..28155 product opacity-associated protein OapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 28189..29229 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene waaF CDS 29288..30190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 30284..31207 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene rfaC CDS complement(31255..31566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(31584..31952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 32080..32352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 note possible pseudo, internal stop codon CDS 32583..32957 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene rpsL CDS 33097..33567 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rpsG CDS 33669..35774 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869011.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene fusA CDS 35845..37029 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene tuf CDS 37265..37732 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693317.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene accB CDS 37783..39126 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655956.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene accC CDS 39284..40036 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(40120..41061) product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649454.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene tehA CDS complement(41131..41700) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(41745..42491) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037586615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 42579..43286 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 43294..44406 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 44671..45582 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene murQ CDS complement(45622..45789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(45786..46160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(46225..46992) product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene fecE CDS complement(46992..47975) product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene fecD CDS complement(47975..48964) product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene fecC CDS complement(48964..49854) product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene fecB CDS complement(50014..50304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 note possible pseudo, frameshifted CDS complement(50425..50751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(50887..52242) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(52251..52523) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(52646..54073) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene miaB CDS complement(54218..54466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(54485..55429) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene ispH CDS complement(55430..55993) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene lspA CDS complement(55997..56335) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene glnB CDS 56505..56996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 57104..57433 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 57683..58222 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 tRNA complement(58282..58371) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 58670..58745 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(58841..60871) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene prlC CDS complement(60931..61404) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene folK CDS complement(61404..62837) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene pcnB CDS complement(63006..63584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(63616..64611) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene thiB CDS 65028..66014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(66141..66731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 note possible pseudo, internal stop codon, frameshifted CDS complement(67177..68910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(69003..70277) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene thrC CDS 70564..71025 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050848554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene mgsA CDS 71044..73284 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665016.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene yccS CDS 73544..73957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 74091..74375 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693756.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene hfq CDS 74509..75771 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene hflX CDS 75806..76783 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 76908..77459 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene nudE CDS 77478..78308 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694155.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene cysQ CDS 78380..79864 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694154.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene zwf CDS 80028..80726 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132500362.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene pgl CDS 80760..81152 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 81213..81545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 81609..82916 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015083.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 83099..84553 product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene gnd CDS complement(84670..86412) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene dnaG CDS complement(86514..86729) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene rpsU CDS 86993..88234 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(88294..88608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(88627..88785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(88806..89825) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(89846..91252) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(91360..92283) product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 92420..93505 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene nirK CDS complement(93570..94232) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176012.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(94306..94464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(94730..95365) product YkgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658466.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(95569..96432) product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(96559..96885) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene grxD CDS complement(96954..97559) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene recR CDS complement(97603..97932) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(98046..99332) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene purD CDS complement(99310..99501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 99577..99942 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627620.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene rpsF CDS 99945..100292 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001768658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene priB CDS 100267..100494 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005598105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene rpsR CDS 100511..100960 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rplI CDS complement(101120..101629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(101725..104589) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene valS CDS complement(104637..105203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(105297..105611) product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608390.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene yqfB CDS complement(106019..106588) product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(106767..107807) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(107719..107922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(108561..110462) product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098700.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene gss CDS complement(110612..112072) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 112247..112564 product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 112632..113138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(113259..114794) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 115018..115665 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(115745..117001) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667179.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(117065..118489) product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(118610..119242) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene thiQ CDS complement(119247..120815) product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene thiP CDS 121063..121323 product phosphocarrier protein Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487600.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene ptsH CDS 121398..123119 product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene ptsI CDS 123199..123699 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene crr CDS complement(123765..124724) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene rpoH tmRNA 124805..125171 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 125646..126695 product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071660.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(127163..127450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 127583..128101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 129002..129583 product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 129585..130016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 130130..130798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 130808..131524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 131730..131981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 131995..132339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 132345..132995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 133101..133610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 133600..134052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 134164..134445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 134670..135095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 assembly_gap 135263..135303 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 135919..136092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 136086..136520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 136510..136923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 136916..137128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 137125..137301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 137304..137564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 137561..139303 product primase-like DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 sequence07 source 1..28987 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..1250) product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene lldD CDS complement(1539..1958) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(2010..3383) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene atpD CDS complement(3401..4267) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene atpG CDS complement(4291..5832) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688698.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene atpA CDS complement(5845..6378) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005642563.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene atpH CDS complement(6392..6862) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene atpF CDS complement(6921..7175) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene atpE CDS complement(7300..8097) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene atpB CDS complement(8125..8505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(8776..9063) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005636074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(9172..9921) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(9931..10647) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 11069..12265 product adenine-specific methyltransferase EcoRI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196835716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 12310..13476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(13601..13900) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(13900..14262) product mercuric transporter MerT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(14234..15343) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(15531..16313) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(16400..16765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 17338..19230 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694554.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene mnmG CDS complement(19321..19722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 19903..20226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(20264..20875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 21026..21640 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene rsmG CDS 21799..22503 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005689200.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 22517..22981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693634.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 22981..23586 product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene cbiM CDS 23579..24187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 24195..24821 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989290.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 24898..25773 product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 25884..26186 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene ureA CDS 26209..26514 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687041.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene ureB CDS 26526..28244 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene ureC CDS 28282..28902 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837317.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence08 source 1..63097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..2123) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene recD CDS 2248..3378 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693598.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene alr CDS complement(3596..5443) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene typA CDS complement(5639..7552) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene parE CDS complement(7648..8946) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162628661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(9019..10035) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene galE CDS 10142..12007 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693566.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene sppA CDS complement(12085..14214) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene rlmKL CDS 14427..15053 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 15090..15350 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 15444..16208 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 16283..17224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 17287..17874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 17958..18239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(18272..18565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(18570..18935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 tRNA complement(19255..19340) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(19581..21053) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene xseA tRNA complement(21189..21265) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 21469..22593 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112089645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene mltA CDS complement(22900..24117) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene fabB CDS 24396..26879 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(26888..27751) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694659.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene dusA CDS 28238..29218 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 29205..30869 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(30923..31750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(31814..33184) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene gorA CDS complement(33273..33752) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene trmL CDS complement(33772..34926) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100066294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene mnmA CDS complement(35021..35242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(35533..35781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(35863..36903) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(36903..37232) product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(37225..37662) product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(37736..38965) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648666.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene nqrF CDS complement(38976..39572) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene nqrE CDS complement(39574..40197) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene nqrD CDS complement(40197..40970) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(40970..42223) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(42226..43554) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 44003..44602 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene nfuA CDS complement(44685..44858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(44941..45432) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651674.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(45434..46309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(46355..46912) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170957.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(47070..48653) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(48735..50753) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509453.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene prc CDS complement(50829..51383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 51707..51919 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012542460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene cspE CDS complement(52004..53860) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 53977..54435 product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(54535..55956) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694316.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 56217..57020 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693412.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene mlaF CDS 57013..57789 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene mlaE CDS 57814..58341 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene mlaD CDS 58422..59063 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693408.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene mlaC CDS 59068..59403 product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 59405..59698 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 59854..61131 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693405.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene murA CDS complement(61181..61798) product glucose-6-phosphate 1-dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(61856..63034) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693230.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene cgtA sequence09 source 1..576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence10 source 1..617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence11 source 1..11260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(312..387) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(445..1884) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668173.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene gltX tRNA 2073..2148 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 2194..2269 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 2324..2399 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 2438..2513 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(2774..3616) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(3708..4031) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(4136..5443) product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(5557..7374) product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150450.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene oadA CDS complement(7396..7653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(7842..9116) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(9251..10096) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(10212..11048) product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 sequence12 source 1..518914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 643..1038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1035..1850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1866..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 2479..2940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 2974..3267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 3347..6292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 6338..6670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 6670..6831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 6828..7154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 7154..7813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 8101..9318 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 9572..10378 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene rarD CDS 10378..11250 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene rarD CDS 11247..11867 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 11998..12702 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260996.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 12798..13007 product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(13102..14481) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene cysS CDS complement(14675..16063) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(16167..16790) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693898.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene gmk CDS complement(16872..17345) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650775.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene gpt CDS 17536..18981 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 19085..19669 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 19743..20192 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 20189..20992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 21055..21612 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(21676..22410) product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 22617..24884 product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene glgP CDS 24891..25682 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 25692..27356 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922665.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 27551..28831 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694491.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene waaA CDS 28834..29319 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene coaD CDS 29322..29870 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene orn tRNA 29985..30060 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 30127..30627 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene tsaE CDS 30668..31786 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(31835..32920) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694057.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene queA CDS complement(33064..34116) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420484.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(34120..34875) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 35764..36081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 36095..36958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 37118..38137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 38198..38764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105965.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(38868..39533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(39626..40117) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene ilvN CDS complement(40110..41831) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005671546.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 42225..44129 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 44231..44752 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132914.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 44893..46305 product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 46305..47663 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 47650..48816 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 48902..49567 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 49569..50045 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 50052..50360 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755879.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(50376..51179) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene xthA CDS complement(51267..52640) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(52682..53620) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene ttcA CDS complement(53697..54140) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene yfbV CDS 54265..54975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 54989..55534 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 55538..56005 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene yciA CDS 56032..56313 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 56520..58748 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693861.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(58753..60093) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene gdhA CDS complement(60419..60778) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693190.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene bamE CDS complement(60840..61844) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene yejK CDS complement(61879..62169) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(62287..62451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 62592..62981 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 63037..63771 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene pgeF tRNA 63851..63927 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(64059..64412) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596075.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene rplT CDS complement(64477..64674) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene rpmI CDS complement(64969..65448) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869182.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene infC CDS 65721..67112 product sodium-coupled multidrug efflux MATE transporter HmrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene hmrM CDS 67116..70754 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene recB CDS complement(70796..72301) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694362.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene lnt CDS complement(72383..73285) product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694364.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene corC CDS 73421..74026 product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 74135..75067 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(75131..75715) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene lpcA CDS 75903..76874 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 76887..78569 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 78582..79544 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693647.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 79541..80449 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693648.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 80470..81501 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(81589..82893) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118232.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 83048..84922 product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059358191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 85032..85781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 85865..86962 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene apbC CDS 87050..89263 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene priA CDS complement(89312..90052) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene pflA CDS complement(90209..92521) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653814.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene pflB CDS complement(92649..93473) product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene focA CDS 93710..94207 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693683.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 94286..96121 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene uvrC CDS 96169..97134 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene menC CDS 97177..97869 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene rsuA CDS 97869..99065 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 99288..101942 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694321.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene gyrA CDS complement(101992..102168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 102084..103376 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 103508..103825 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene trxA CDS complement(103895..106168) product TonB-dependent hemoglobin receptor HmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene hmbR CDS 106312..107586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 107608..108102 product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene hutX CDS 108126..108644 product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene hutZ CDS complement(108708..109517) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene fdhD CDS 109777..112854 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904702.1 transl_table 11 codon_start 1 transl_except (pos:110362..110364,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_11960 gene fdnG CDS 112854..113777 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene fdxH CDS 113770..114450 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663315.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 114602..115513 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693890.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene fdhE CDS complement(115590..119543) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene hrpA CDS complement(119808..120287) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694166.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene greB CDS complement(120296..121597) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene pepB CDS 121755..122921 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694249.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene sucC CDS 122946..123815 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene sucD CDS 123920..125290 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene purB CDS complement(125350..126660) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene argA CDS complement(126729..128036) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene aroA CDS complement(128163..128933) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649665.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 128932..129195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 note possible pseudo, internal stop codon, frameshifted CDS complement(129336..131048) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(131052..131273) product DUF1414 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 131425..132012 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693244.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 132066..133271 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769341.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 133284..136409 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 136617..137984 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694502.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene glmU CDS 138043..138831 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 138919..140910 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rnb CDS complement(140959..141702) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 141843..142814 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 142861..143994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 143996..144766 product lipooligosaccharide biosynthesis galactosyltransferase LsgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene lsgD CDS 144766..145968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 145961..146842 product lipooligosaccharide biosynthesis N-acetyl-glucosamine transferase LsgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene lsgE CDS 146842..147642 product lipooligosaccharide biosynthesis galactosyltransferase LsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene lsgF CDS 147861..149534 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649895.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 149809..150861 product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene galT CDS 150873..152030 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene galK CDS 152281..153249 product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene galM CDS 153341..156418 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 156498..157259 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene udp CDS complement(157339..158706) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(159207..160502) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(160517..161503) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693928.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 161571..162047 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631703.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene ybaK CDS 162136..163293 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene pheA CDS 163411..166884 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene dnaE CDS complement(166920..167804) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene ilvY CDS complement(167804..168835) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(169237..170148) product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(170228..170440) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene rpmE CDS 170737..172734 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene tkt CDS complement(172831..174684) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene dxs CDS complement(174745..175554) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene suhB CDS complement(175691..176581) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525505.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene dapA CDS complement(176687..177628) product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693550.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene htrB CDS 177799..178083 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene raiA CDS complement(178154..178939) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693653.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene truA CDS complement(178946..179620) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666869.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene folE CDS complement(179762..180397) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene hflD CDS complement(180423..182036) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene cydC CDS complement(182175..182786) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(182796..183806) product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene purR CDS complement(183907..184977) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 185168..185872 product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(185910..186887) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene rluD CDS 187049..187828 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694110.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 187896..188924 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene tsaD CDS 188963..189751 product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 189761..190072 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655473.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene cyaY CDS 190121..191926 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene recQ CDS 192026..193111 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(193257..193739) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650692.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 194045..194923 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650690.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene cdd CDS 195031..195981 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693427.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene cysK CDS 196179..197441 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene rho CDS complement(197502..197963) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223915.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene ribH CDS complement(198110..199309) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(199336..199878) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(199888..200538) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(200535..201620) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene ribD CDS 202072..204474 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693703.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene lon CDS complement(204591..207419) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene uvrA CDS 207569..208108 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(208150..208731) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649599.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene dcd CDS complement(208733..209386) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene udk CDS 209485..210111 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 210244..211044 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 211094..211777 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693620.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene lolB CDS 211791..212618 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene ispE CDS 212646..213596 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647284.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 213650..214657 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693962.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene pyrD CDS 214961..217618 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene aceE CDS 217699..219594 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815580.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene aceF CDS 219686..221110 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663527.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene lpdA CDS complement(221069..221302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(221457..222905) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693997.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene pntB CDS complement(222917..224455) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene pntA CDS 224670..225428 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene trmJ CDS 225539..226882 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869195.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene mukF CDS 226904..227611 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene mukE CDS 227611..227832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 227840..228547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 228561..233033 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene mukB CDS 233249..233962 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene pyrH CDS 234002..234559 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene frr CDS 234628..235521 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815283.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene fieF CDS 235521..236282 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 236420..237247 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694094.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene mepA CDS complement(237322..237822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 238305..239468 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(239548..240270) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene cmoA CDS complement(240288..241073) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 241188..241772 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648714.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene seqA CDS 242082..243230 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene menE CDS 243227..246547 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene mscK CDS 246555..249866 product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044509288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene mscK CDS 249899..250981 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene aroC CDS complement(251206..251346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 251645..252073 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650450.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene rplM CDS 252089..252484 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene rpsI CDS 252569..253342 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene yaaA CDS 253342..253896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 253994..255793 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene lepA CDS 255884..256762 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene lepB CDS 256844..257512 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene rnc CDS 257619..258524 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene era CDS 258684..259310 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene recO CDS 259438..261618 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 261714..262889 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973595.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(262928..263554) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene upp CDS complement(263579..265267) product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693780.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene fadD CDS complement(265274..265723) product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670174.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(265734..266678) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene rseB CDS complement(266853..267440) product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(267496..268071) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene rpoE CDS 268311..269339 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 269456..270739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 270851..272422 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144273.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 272520..273155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 273523..273654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 273794..274168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 274165..274356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 274439..274645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 note possible pseudo, internal stop codon, frameshifted CDS 274667..274846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 note possible pseudo, internal stop codon CDS 274927..275094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 tRNA complement(275198..275273) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(275294..275380) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(275548..279006) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694314.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene mfd CDS 279612..280472 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 280475..281272 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 281359..283290 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(283352..283933) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649496.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(283998..284216) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene zapB CDS 284410..285405 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694623.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene glpX CDS complement(285457..287379) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(287489..288898) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene cpxA CDS complement(288949..289686) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164706.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene cpxR CDS complement(289765..290571) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene mazG CDS 290748..291638 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene accD CDS 291697..292989 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene folC CDS complement(293051..294157) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693629.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene purK CDS complement(294179..295144) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(295144..295641) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene purE CDS 295844..296488 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene sspA CDS 296488..296904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 297057..297866 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694461.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene dapB CDS 298043..299179 product methionine biosynthesis PLP-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 299330..300211 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 300230..301006 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 301010..301894 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 301891..302721 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 303089..304165 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 304360..305130 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 305132..305596 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(305832..307502) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene glnS tRNA 307682..307758 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 307947..308408 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene rimP CDS 308438..309934 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691699.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene nusA CDS 309956..312508 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene infB CDS 313029..315611 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 315884..319171 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 319161..321158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 321165..322022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 322120..322500 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rbfA CDS 322504..323421 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene truB CDS 323432..324529 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 324676..326862 product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene zorA CDS 326862..327653 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 327655..329178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 329180..332179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(332224..333918) product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene dld CDS complement(334097..336235) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene pta CDS complement(336293..337501) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694241.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 337854..338645 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721480.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(338694..339584) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191773039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 339713..339979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 340004..340231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(340503..342329) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 342510..343001 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663323.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene ybeY CDS 343014..344939 product tRNA cytosine(34) acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829314.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene tmcA CDS 345020..346216 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(346267..348444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(348536..349078) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693468.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene hpt CDS complement(349162..350448) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693180.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene pepP CDS complement(350468..350917) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene nrdR CDS complement(351186..351701) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(351757..352050) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene ihfA CDS complement(352069..354456) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene pheT CDS complement(354584..355567) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694457.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene pheS CDS complement(355775..356434) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(356540..356821) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(356815..358338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(358348..360063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(360072..360497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(360515..361324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(361357..362247) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 362594..363247 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(363291..364379) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene rlmM CDS complement(364379..364777) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 365070..366107 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene moaA CDS 366175..366651 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene moaC CDS 366661..366906 product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene moaD CDS 366908..367363 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene moaE CDS complement(367534..368355) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(368355..368957) product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(369296..370645) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693467.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene pmbA CDS 370745..371275 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene yjgA CDS 371275..371649 product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(371691..373265) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene sbcB CDS complement(373479..374876) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 375055..376458 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene asnS CDS complement(376609..377460) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693261.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene tsf CDS complement(377566..378282) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rpsB CDS complement(378543..380321) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693484.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(380467..382398) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene ftsH CDS complement(382449..383075) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rlmE CDS 383347..384813 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene guaB CDS 384930..385847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 385882..386145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 386170..386550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 note possible pseudo, internal stop codon CDS 386641..388212 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene guaA CDS 388283..388471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 388511..388645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(388796..393313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(393358..395964) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene pepN CDS 396223..396585 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694471.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 396594..397280 product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(397354..398049) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene tsaB CDS complement(398155..399237) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165590136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene aroG CDS complement(399432..402434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(402446..402928) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene lrp CDS complement(402944..404062) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013526513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene rnd CDS 404216..405418 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 405522..406241 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene bioD CDS complement(406310..406783) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene nanQ CDS complement(406843..407988) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694427.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene nagA CDS complement(408125..408937) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene nagB CDS complement(409065..409943) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene nanA CDS complement(409962..410828) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(410845..411744) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(411756..412445) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005687966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(412660..414702) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665886.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene ligA CDS complement(414782..415720) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene zipA CDS 415826..416674 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene cysZ CDS complement(416696..416887) product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703639.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(417005..419605) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429232.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene topA CDS 419856..420449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(420517..421374) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(421448..421717) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652821.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene rpsO CDS 421918..424779 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693853.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene glnE CDS 424839..425216 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(425294..426076) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662331.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene fnr CDS 426297..426722 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene uspA CDS 427007..429568 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene alaS CDS 429651..429833 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632782.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene csrA CDS 430147..431592 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648689.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(431663..432475) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664434.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene apaH CDS complement(432477..433010) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene tadA CDS complement(433194..435137) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694061.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(435217..436149) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene nlpI CDS complement(436251..438374) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139988996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene pnp CDS 438694..440937 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene parC CDS complement(440981..441868) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene galU CDS 442099..444528 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene gyrB CDS complement(444986..445291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(445467..445817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(445900..446085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(446129..446296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 tRNA complement(446395..446480) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(446493..446822) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene secG CDS complement(446928..448865) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(448879..449190) product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(449192..450655) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(450674..451681) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene epmB CDS complement(451741..452331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 452479..453045 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544066.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene efp CDS 453233..454141 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 454141..455088 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 455085..456029 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 456026..456784 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(457394..462826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 463317..463997 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 464008..465273 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 465388..465993 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668333.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(466085..466948) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene pdxY CDS complement(467108..469126) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694308.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene uvrB CDS 469276..469422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005634891.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(469500..471248) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene msbA CDS complement(471559..474726) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694526.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(474742..476880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(477417..479084) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene nadB CDS complement(479231..480040) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(480042..482027) product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(482027..482980) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(483129..484727) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 485122..486588 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene nagE CDS complement(486659..487759) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene hisC CDS complement(487878..488966) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene serC CDS complement(489071..490588) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene ppx CDS 490814..491143 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 491614..492963 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene lysC CDS complement(493032..493343) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene yciH CDS complement(493420..494112) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667227.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene pyrF CDS complement(494124..495320) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene lapB CDS complement(495320..495607) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(495626..495907) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(496041..497705) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene rpsA CDS complement(497802..498473) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042611231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene cmk CDS complement(498501..499574) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene degS CDS complement(499639..500262) product DUF1919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694305.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(500344..501300) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(501446..503461) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene mnmC CDS complement(503454..506000) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694204.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene glnD CDS complement(506004..506675) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene ung CDS 506876..507262 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene grcA CDS complement(507330..507725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(507787..509181) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene yegQ CDS 509324..509707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(509778..510290) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(510338..512050) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene narQ CDS complement(512071..512889) product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(512979..513827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(513972..515687) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694232.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene recJ CDS complement(515691..516404) product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647404.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene dsbC CDS complement(516423..517811) product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene mepM CDS 518021..518833 product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666536.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene znuC sequence13 source 1..63266 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..1231 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene tal CDS 1599..1928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1925..2587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(2727..3257) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(3337..4026) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 4093..4629 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 4765..5790 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694036.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene murB CDS 6014..7330 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 7425..8186 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704003.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene birA CDS 8201..9139 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693854.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene miaA CDS complement(9234..9665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 10238..14134 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene purL CDS complement(14222..15127) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rdgC CDS complement(15227..16231) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene trpD CDS complement(16350..16928) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693974.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(16955..18502) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693976.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene trpE CDS complement(18623..19267) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(19277..20260) product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene cysB CDS 20462..21421 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene rsgA CDS 21425..22021 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene rnhB CDS 22034..22399 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene hinT CDS 22401..22757 product DUF1425 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647993.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 23150..23827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 23852..24244 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(24331..26304) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene cpdB CDS complement(26396..27103) product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630577.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene aphA CDS complement(27183..31556) product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212081.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(31716..33314) product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228189.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(33389..35263) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene rpoD CDS complement(35384..35803) product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene psiE CDS complement(35897..36925) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene trpS CDS 37110..38816 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115587756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene menD CDS 38816..39595 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene menH CDS 39745..41520 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene aspS CDS complement(41898..42689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(42763..44703) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931557.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 44902..45810 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene glyQ CDS 45864..46514 product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 46514..46771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693272.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 46776..47153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 47199..47837 product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002258733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 47847..49112 product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene agp CDS 49118..49483 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 49840..50310 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205986.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 50357..52423 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene glyS CDS 52484..52771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 52933..53844 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene xerC CDS 53924..55795 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082012.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(55891..57411) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693274.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 57801..60071 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene metE CDS complement(60796..61014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 sequence14 source 1..39505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(328..498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(754..951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(981..1592) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1592..2053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(2050..2484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(2481..2771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(2761..3561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(3611..4225) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926408.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(4226..4984) product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene bet CDS complement(5084..5644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(5672..5977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(6140..6286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(6400..7260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 7646..7969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(7993..8187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(8278..8847) product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388649.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 9586..9735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(9770..10261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(10248..10595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(10597..11544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(11683..12351) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 12480..12683 product YdaS family helix-turn-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649480.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(12741..13148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 13263..14015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 14012..14791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 14788..15630 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 15627..16184 product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 16177..16485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 16886..17512 product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 17607..18191 product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267993.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 18181..18639 product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 18773..18979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(18957..19436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 19542..19886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 19876..20322 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 20309..20647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 20959..21474 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 21484..22002 product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 21983..23344 product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 23354..24742 product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 24708..26288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 26289..26567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 26633..27172 product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 27289..28023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705697.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 28089..29039 product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566292.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 29123..29278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 29288..29725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 29725..30084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 30077..30475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 30484..30882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 30939..31625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 31707..32720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 32776..33177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 33186..33518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 33518..33844 product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 33841..34554 product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 34558..35289 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194763.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 35299..35892 product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 sequence15 source 1..11498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..1806 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028045.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1960..2964 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 2979..3869 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 3878..4855 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene dppD CDS 4872..5852 product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691143.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 5950..6993 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115608061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 7057..7380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 note possible pseudo, frameshifted CDS 7557..8174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 note possible pseudo, frameshifted CDS complement(8236..8511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(8534..8998) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(8995..9585) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365978.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 9658..11385 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693602.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene argS sequence16 source 1..1257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..43181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 76..186 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 355..1125 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene tpiA CDS 1405..2796 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038439489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(2875..3699) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693293.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene mutM CDS complement(3716..4675) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693475.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene hemH CDS 4882..5016 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene rpmH CDS 5088..5423 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647913.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene rnpA CDS 5399..5722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(5862..6779) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360332.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(6776..7708) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(7779..8036) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene rpmA CDS complement(8057..8368) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rplU CDS 8602..9585 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene ispB CDS 9606..10352 product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651413.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 10470..11405 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694437.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene fabD CDS 11491..12216 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694436.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene fabG CDS 12337..13629 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene brnQ CDS complement(13676..14041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(14070..15512) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene panF CDS complement(15516..15752) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647974.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(15812..16129) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene metJ CDS 16287..17030 product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694634.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(17092..17880) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995557.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(18048..18812) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693198.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(18812..19504) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(19642..20775) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene dapE CDS complement(20779..21126) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(21136..21981) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene folP CDS complement(22003..22965) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene rluC CDS 23052..23945 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(23998..24138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 24272..25327 product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene citC CDS 25345..26019 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694158.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 tRNA 26189..26275 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA 26294..26369 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 26381..26467 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 26488..26563 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 26733..27026 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005636074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(27082..28284) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(28368..29138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(29214..30287) product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694200.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene wecA CDS 30455..31735 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene hemL CDS complement(31788..33515) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(33517..34473) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(34600..35478) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(35478..35930) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene argR CDS 36156..37112 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene mdh CDS 37186..37518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 37679..38413 product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene artP CDS 38443..39165 product lysine/arginine/ornithine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 39169..39840 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene artQ CDS 39840..40505 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene artM CDS 40634..41299 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(41808..42590) product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(42664..43101) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene aroQ sequence18 source 1..29157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 317..3130 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869267.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene sucA CDS 3161..4390 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694387.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene odhB CDS 4597..7182 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene leuS CDS 7276..7782 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene lptE CDS 7854..8876 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene holA CDS complement(8918..9961) product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429501.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene fbpC CDS complement(9963..11837) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168769364.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(12047..13096) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 tRNA 13327..13402 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 13418..13491 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(13631..14275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(14340..14963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(15080..15937) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene rapZ CDS complement(15952..16491) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693461.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene ptsN CDS complement(16507..17232) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene lptB CDS complement(17240..17743) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693464.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene lptA CDS complement(17740..18342) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647563.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene lptC CDS complement(18502..21138) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693644.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene ppc CDS 21338..21847 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 21938..23176 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693619.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(23250..25187) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694483.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 25410..25997 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 26169..26846 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene rsmE CDS 26859..27422 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 misc_feature complement(27539..>29157) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869283.1:YadA family autotransporter adhesin locus_tag LOCUS_17260 sequence19 source 1..93403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..1238 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1333..1815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 note possible pseudo, frameshifted CDS complement(2121..2342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 note possible pseudo, internal stop codon, frameshifted CDS complement(2453..2815) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 3046..4263 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene sstT CDS complement(4427..5080) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene purN CDS complement(5227..6261) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene purM CDS 6441..7202 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 7195..7632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 7650..8843 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693932.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene trpB CDS 8843..9652 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene trpA CDS 9789..12641 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene polA CDS 12721..13347 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene lolA CDS 13416..13724 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629736.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene trpR CDS 13711..14517 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene mtgA CDS complement(14706..15710) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene fbp CDS complement(16103..17371) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(17667..18008) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 18135..19022 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005665936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(19045..19596) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(19774..20658) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(20684..21547) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 21630..22346 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene rph CDS 22437..24044 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 24157..25020 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene prmC CDS 25049..25915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 25938..26792 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene kdsA CDS complement(26845..27708) product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206472.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(27692..28456) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130360.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(28459..29124) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418066.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(29114..29773) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(29935..30159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(30209..30715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(30727..31239) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648824.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(31338..32477) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005645731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene tgt CDS complement(32556..32690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 32794..33369 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 33391..34137 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene can CDS complement(34268..35575) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene serS CDS complement(35600..36079) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene smpB CDS complement(36116..37519) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 37577..38419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(38492..39535) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111697003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene prfB CDS complement(39791..40765) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene pfkA CDS complement(40861..42057) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(42069..42770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(42774..43907) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene argE CDS complement(43894..44691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(44706..46100) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(46286..46747) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene pal CDS complement(46768..48048) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693786.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene tolB CDS complement(48067..49365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(49382..49819) product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649190.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene tolR CDS complement(49928..50611) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene tolQ CDS complement(50637..51029) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene ybgC CDS complement(51180..51461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(51573..52709) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene cydB CDS complement(52720..54273) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 54693..55022 product DUF5339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694353.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(55097..55921) product lipoprotein e(P4) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061724415.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene hel CDS complement(56169..56780) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146104764.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene grpE CDS 57013..58092 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(58132..59040) product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(59040..60419) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene radA CDS 60611..61078 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 61147..62532 product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 62525..63721 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 64388..65014 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869082.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene coaE CDS 65002..65190 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene yacG CDS complement(65254..65514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(65618..66259) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(66249..66704) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene queD CDS complement(66697..67371) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene queC CDS complement(67510..68487) product zinc transporter permease subunit ZevB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene zevB CDS complement(68469..68972) product zinc transporter binding subunit ZevA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene zevA CDS 69785..71005 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene rhlB CDS 71008..71430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 71449..72939 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(72980..74170) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene ispC CDS complement(74218..74478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(74702..76240) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996423.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 76701..77096 product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(77390..77944) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(78016..79464) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene fadL CDS 79804..80256 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene iscR CDS 80312..81538 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868979.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 81594..81977 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene iscU CDS 82145..82468 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301571.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene iscA CDS 82480..83001 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693789.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene hscB CDS 83080..83712 product DUF2625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693791.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 83748..85601 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene hscA CDS 85613..85954 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene fdx CDS 85954..86148 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene iscX CDS complement(86275..87777) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050838325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene lysS CDS complement(87912..89387) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene rng CDS complement(89509..90369) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654480.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene folD tRNA 90545..90621 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA 90670..90746 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(90821..91828) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(91738..92028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(92274..93134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 sequence20 source 1..42313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..633) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene pth CDS complement(756..1313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1356..1664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1661..2008) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(2115..3452) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693742.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene srmB CDS complement(3690..4550) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene tesB repeat_region 4650..4974 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatccctttggaacagggcaatgtctttcgac CDS complement(5351..6139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039851149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(6277..6957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(6957..7283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(7280..7462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(7467..7826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(7816..8301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047947.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(8294..9049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(9060..9935) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002046.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(9953..10531) product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(10524..11624) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(11621..11980) product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093498.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(12035..12541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(12528..13592) product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(13585..13818) product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269712.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(13799..14734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(14747..17326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 17364..17633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(17792..18046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(18135..18653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(18666..20051) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(20062..20529) product Gp37 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(20540..20974) product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271668.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(20974..21234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(21308..22234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(22246..23205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273072.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(23443..23901) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(23904..24155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(24284..25552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(25566..27035) product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(27158..28654) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(28654..29196) product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(29206..29508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(29505..29813) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(29803..30006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(29930..30187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(30184..30408) product DUF2644 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(30611..31153) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064082132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(31225..31584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(31577..31819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(31856..32743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(32765..32986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(32996..33361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(33365..33874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(33874..34320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 34412..34603 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200153.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 34688..34840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 34837..35136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 35146..36072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 36083..37903 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 37965..39137 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 39147..39347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 39325..39558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 39551..40075 product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 40072..40293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 40290..40448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 40499..40978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 40954..41328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 41325..41711 product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170114.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 41711..42088 product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 sequence21 source 1..3387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 451..732 product endoribonuclease VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(910..1806) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2366..3352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 sequence22 source 1..35169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3612..4199) product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090877.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(4142..4876) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(4879..5592) product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152490.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(5668..6189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(6272..6616) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(6621..8996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(8983..9243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(9306..9695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(9698..10201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(10194..10598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(10595..11140) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(11140..11445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(11426..11749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(11828..13513) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(13806..15329) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(15333..15551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(15548..17671) product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(17671..18132) product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020884621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(18575..18907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(18880..19437) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211730.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(19421..19675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 19779..20258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(20236..20442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(20573..20938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(20938..21300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(21297..21911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(21905..22198) product DUF1364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002252.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 22274..22579 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 22589..22918 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650217.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 23225..23860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(23889..24359) product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402092.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(24359..25201) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(25198..25974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(25971..26663) product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211727.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(26710..26985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(27001..27210) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033078.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 27342..28010 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250470.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 28077..28781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 28778..29593 product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(29879..30376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 30748..30912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 30919..31140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 31143..31316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 31323..31928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 31929..32600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 32604..33077 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 33146..33526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 33557..34327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 34311..34616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 34683..34853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 sequence23 source 1..3146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 211..3104 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 sequence24 source 1..35069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..1349 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668135.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene hflK CDS 1349..2236 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005660876.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene hflC CDS 2324..3622 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene purA CDS 3734..5185 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene thiI CDS 5271..5981 product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(6011..7078) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694337.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(7199..8734) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene pepA CDS 8878..9984 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene lptF CDS 9981..11063 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694193.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene lptG CDS 11068..11955 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995695.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 12150..13415 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(13484..13939) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene fur CDS complement(13980..14504) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene fldA CDS complement(14521..14808) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene ybfE CDS complement(14958..15587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 note possible pseudo, frameshifted CDS complement(15584..15724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(15739..16440) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116956690.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(16440..16910) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene fxsA CDS 16994..17239 product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869042.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene tusA CDS 17249..17896 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 17971..18189 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene infA CDS 18301..19230 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694223.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(19227..19985) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene kdsB CDS complement(20004..20957) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693473.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene trxB CDS complement(21033..21914) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075985340.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(21924..22247) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene glpE CDS 22403..22852 product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene exbB CDS 22883..23269 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694050.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene exbD CDS 23276..24157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 24263..24769 product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(24817..25779) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene cmoB CDS complement(25974..26690) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693614.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(26680..27600) product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(27677..27964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(27999..28454) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(28660..30423) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(30865..31524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(31524..31850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(31847..32008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(32008..32340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(32403..32696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(32849..33727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(33737..34126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 34206..34484 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 34493..34765 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 sequence25 source 1..16407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..1037) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene argB CDS complement(1051..1992) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391008.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene argC CDS complement(2138..2854) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene deoD CDS complement(2980..4242) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649475.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 4472..5116 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692076.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(5171..6079) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 6189..7268 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene dinB CDS 7349..8218 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene htpX CDS 8464..9294 product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 9304..10518 product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836940.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene efeB CDS 10481..12193 product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(12265..13527) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061720832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(13749..14801) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268031.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(14810..15034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(15077..15202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(15278..16138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 sequence26 source 1..1435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..1889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 311..1846 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 sequence28 source 1..1558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..1410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 sequence29 source 1..893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@