>Feature sequence01 273 28 gene locus_tag LOCUS_00010 273 28 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 protein_id gnl|my_center|LOCUS_00010 372 3845 gene locus_tag LOCUS_00020 gene lysX 372 3845 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_00020 4278 4895 gene locus_tag LOCUS_00030 gene sigK 4278 4895 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_00030 4966 5874 gene locus_tag LOCUS_00040 4966 5874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078880017.1 protein_id gnl|my_center|LOCUS_00040 5909 6400 gene locus_tag LOCUS_00050 gene rraA 5909 6400 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 protein_id gnl|my_center|LOCUS_00050 6491 8044 gene locus_tag LOCUS_00060 6491 8044 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 protein_id gnl|my_center|LOCUS_00060 8467 9636 gene locus_tag LOCUS_00070 8467 9636 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_00070 9640 9879 gene locus_tag LOCUS_00080 9640 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9899 10801 gene locus_tag LOCUS_00090 9899 10801 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_00090 11511 10807 gene locus_tag LOCUS_00100 11511 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12303 11611 gene locus_tag LOCUS_00110 12303 11611 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897846.1 protein_id gnl|my_center|LOCUS_00110 12529 14292 gene locus_tag LOCUS_00120 12529 14292 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_00120 15228 14218 gene locus_tag LOCUS_00130 15228 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15549 16097 gene locus_tag LOCUS_00140 15549 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16222 16734 gene locus_tag LOCUS_00150 16222 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222815.1 protein_id gnl|my_center|LOCUS_00150 16747 18000 gene locus_tag LOCUS_00160 16747 18000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18847 18086 gene locus_tag LOCUS_00170 18847 18086 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222055.1 protein_id gnl|my_center|LOCUS_00170 19704 18985 gene locus_tag LOCUS_00180 19704 18985 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_00180 20352 19831 gene locus_tag LOCUS_00190 20352 19831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907504.1 protein_id gnl|my_center|LOCUS_00190 20594 22711 gene locus_tag LOCUS_00200 20594 22711 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492962.1 protein_id gnl|my_center|LOCUS_00200 22708 23460 gene locus_tag LOCUS_00210 22708 23460 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729858.1 protein_id gnl|my_center|LOCUS_00210 24491 23862 gene locus_tag LOCUS_00220 24491 23862 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_00220 24894 24712 gene locus_tag LOCUS_00230 24894 24712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25041 25751 gene locus_tag LOCUS_00240 gene msrA 25041 25751 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_00240 25806 26879 gene locus_tag LOCUS_00250 25806 26879 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223454.1 protein_id gnl|my_center|LOCUS_00250 27658 26909 gene locus_tag LOCUS_00260 27658 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 27755 28618 gene locus_tag LOCUS_00270 27755 28618 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_00270 29014 29364 gene locus_tag LOCUS_00280 29014 29364 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 protein_id gnl|my_center|LOCUS_00280 29442 30392 gene locus_tag LOCUS_00290 29442 30392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30407 31198 gene locus_tag LOCUS_00300 30407 31198 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084130.1 protein_id gnl|my_center|LOCUS_00300 31253 32176 gene locus_tag LOCUS_00310 31253 32176 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222094.1 protein_id gnl|my_center|LOCUS_00310 33000 32455 gene locus_tag LOCUS_00320 33000 32455 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065153.1 protein_id gnl|my_center|LOCUS_00320 34303 33077 gene locus_tag LOCUS_00330 34303 33077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 34592 36034 gene locus_tag LOCUS_00340 34592 36034 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898106.1 protein_id gnl|my_center|LOCUS_00340 37474 36227 gene locus_tag LOCUS_00350 37474 36227 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731551.1 protein_id gnl|my_center|LOCUS_00350 38456 37659 gene locus_tag LOCUS_00360 38456 37659 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129429.1 protein_id gnl|my_center|LOCUS_00360 39362 38529 gene locus_tag LOCUS_00370 39362 38529 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897828.1 protein_id gnl|my_center|LOCUS_00370 39439 40407 gene locus_tag LOCUS_00380 gene pheA 39439 40407 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420906.1 protein_id gnl|my_center|LOCUS_00380 40407 41066 gene locus_tag LOCUS_00390 40407 41066 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084122.1 protein_id gnl|my_center|LOCUS_00390 41717 41217 gene locus_tag LOCUS_00400 41717 41217 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226147.1 protein_id gnl|my_center|LOCUS_00400 42163 41813 gene locus_tag LOCUS_00410 42163 41813 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222136.1 protein_id gnl|my_center|LOCUS_00410 43324 42167 gene locus_tag LOCUS_00420 43324 42167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44178 43435 gene locus_tag LOCUS_00430 44178 43435 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403429.1 protein_id gnl|my_center|LOCUS_00430 44302 45951 gene locus_tag LOCUS_00440 44302 45951 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_00440 45944 46963 gene locus_tag LOCUS_00450 45944 46963 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_00450 48242 47271 gene locus_tag LOCUS_00460 48242 47271 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775844.1 protein_id gnl|my_center|LOCUS_00460 48324 48737 gene locus_tag LOCUS_00470 48324 48737 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_00470 48804 50063 gene locus_tag LOCUS_00480 gene serS 48804 50063 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_00480 50078 51013 gene locus_tag LOCUS_00490 50078 51013 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111078.1 protein_id gnl|my_center|LOCUS_00490 51674 51099 gene locus_tag LOCUS_00500 51674 51099 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 protein_id gnl|my_center|LOCUS_00500 51748 52167 gene locus_tag LOCUS_00510 51748 52167 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836423.1 protein_id gnl|my_center|LOCUS_00510 52268 53155 gene locus_tag LOCUS_00520 52268 53155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111078.1 protein_id gnl|my_center|LOCUS_00520 53232 54485 gene locus_tag LOCUS_00530 53232 54485 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407926.1 protein_id gnl|my_center|LOCUS_00530 54499 55035 gene locus_tag LOCUS_00540 54499 55035 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027260.1 protein_id gnl|my_center|LOCUS_00540 55323 55111 gene locus_tag LOCUS_00550 55323 55111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55640 57961 gene locus_tag LOCUS_00560 55640 57961 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_00560 59348 57990 gene locus_tag LOCUS_00570 59348 57990 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728889.1 protein_id gnl|my_center|LOCUS_00570 59290 59499 gene locus_tag LOCUS_00580 59290 59499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 60187 59573 gene locus_tag LOCUS_00590 60187 59573 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027327.1 protein_id gnl|my_center|LOCUS_00590 61916 60204 gene locus_tag LOCUS_00600 61916 60204 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_00600 62082 62720 gene locus_tag LOCUS_00610 62082 62720 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 protein_id gnl|my_center|LOCUS_00610 62731 63501 gene locus_tag LOCUS_00620 62731 63501 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084095.1 protein_id gnl|my_center|LOCUS_00620 63617 64396 gene locus_tag LOCUS_00630 63617 64396 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897817.1 protein_id gnl|my_center|LOCUS_00630 64396 65235 gene locus_tag LOCUS_00640 64396 65235 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084092.1 protein_id gnl|my_center|LOCUS_00640 66991 65246 gene locus_tag LOCUS_00650 66991 65246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 67501 69072 gene locus_tag LOCUS_00660 67501 69072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 69760 69077 gene locus_tag LOCUS_00670 69760 69077 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 protein_id gnl|my_center|LOCUS_00670 70568 69852 gene locus_tag LOCUS_00680 70568 69852 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268145.1 protein_id gnl|my_center|LOCUS_00680 71380 70601 gene locus_tag LOCUS_00690 71380 70601 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275383.1 protein_id gnl|my_center|LOCUS_00690 72327 71377 gene locus_tag LOCUS_00700 72327 71377 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268143.1 protein_id gnl|my_center|LOCUS_00700 73106 72324 gene locus_tag LOCUS_00710 73106 72324 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727406.1 protein_id gnl|my_center|LOCUS_00710 73242 74450 gene locus_tag LOCUS_00720 gene glf 73242 74450 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897813.1 protein_id gnl|my_center|LOCUS_00720 74451 76391 gene locus_tag LOCUS_00730 74451 76391 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 protein_id gnl|my_center|LOCUS_00730 76375 77160 gene locus_tag LOCUS_00740 76375 77160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77157 78077 gene locus_tag LOCUS_00750 77157 78077 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897810.1 protein_id gnl|my_center|LOCUS_00750 78064 80151 gene locus_tag LOCUS_00760 gene zomB 78064 80151 CDS product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496045.1 protein_id gnl|my_center|LOCUS_00760 80534 81523 gene locus_tag LOCUS_00770 80534 81523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 81927 83348 gene locus_tag LOCUS_00780 81927 83348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00780 83642 84178 gene locus_tag LOCUS_00790 83642 84178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84180 85193 gene locus_tag LOCUS_00800 84180 85193 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731258.1 protein_id gnl|my_center|LOCUS_00800 85421 86431 gene locus_tag LOCUS_00810 85421 86431 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728397.1 protein_id gnl|my_center|LOCUS_00810 86691 88592 gene locus_tag LOCUS_00820 gene fadD32 86691 88592 CDS product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112890.1 protein_id gnl|my_center|LOCUS_00820 88709 94033 gene locus_tag LOCUS_00830 gene pks13 88709 94033 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902557.1 protein_id gnl|my_center|LOCUS_00830 94063 95634 gene locus_tag LOCUS_00840 94063 95634 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 protein_id gnl|my_center|LOCUS_00840 99396 95953 gene locus_tag LOCUS_00850 99396 95953 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112894.1 protein_id gnl|my_center|LOCUS_00850 102754 99389 gene locus_tag LOCUS_00860 102754 99389 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731254.1 protein_id gnl|my_center|LOCUS_00860 104055 102847 gene locus_tag LOCUS_00870 104055 102847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 104919 104380 gene locus_tag LOCUS_00880 104919 104380 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897878.1 protein_id gnl|my_center|LOCUS_00880 108384 105085 gene locus_tag LOCUS_00890 108384 105085 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 protein_id gnl|my_center|LOCUS_00890 111649 108377 gene locus_tag LOCUS_00900 gene embA 111649 108377 CDS product arabinosyltransferase EmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899696.1 protein_id gnl|my_center|LOCUS_00900 111621 111800 gene locus_tag LOCUS_00910 111621 111800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 112027 113802 gene locus_tag LOCUS_00920 112027 113802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 117227 113886 gene locus_tag LOCUS_00930 117227 113886 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 protein_id gnl|my_center|LOCUS_00930 117449 117907 gene locus_tag LOCUS_00940 gene aroQ 117449 117907 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_00940 118605 118033 gene locus_tag LOCUS_00950 118605 118033 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876664.1 protein_id gnl|my_center|LOCUS_00950 118743 119642 gene locus_tag LOCUS_00960 118743 119642 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_00960 119763 120245 gene locus_tag LOCUS_00970 119763 120245 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029408.1 protein_id gnl|my_center|LOCUS_00970 120238 120555 gene locus_tag LOCUS_00980 120238 120555 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974904.1 protein_id gnl|my_center|LOCUS_00980 123537 120958 gene locus_tag LOCUS_00990 123537 120958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 123836 124516 gene locus_tag LOCUS_01000 123836 124516 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 protein_id gnl|my_center|LOCUS_01000 125393 124602 gene locus_tag LOCUS_01010 125393 124602 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031575.1 protein_id gnl|my_center|LOCUS_01010 127285 125399 gene locus_tag LOCUS_01020 127285 125399 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878631.1 protein_id gnl|my_center|LOCUS_01020 128323 127562 gene locus_tag LOCUS_01030 128323 127562 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 protein_id gnl|my_center|LOCUS_01030 129788 128382 gene locus_tag LOCUS_01040 129788 128382 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 protein_id gnl|my_center|LOCUS_01040 129986 130894 gene locus_tag LOCUS_01050 129986 130894 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_01050 131711 130911 gene locus_tag LOCUS_01060 gene eutC 131711 130911 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727733.1 protein_id gnl|my_center|LOCUS_01060 133117 131708 gene locus_tag LOCUS_01070 133117 131708 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892941.1 protein_id gnl|my_center|LOCUS_01070 134676 133114 gene locus_tag LOCUS_01080 gene eat 134676 133114 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727732.1 protein_id gnl|my_center|LOCUS_01080 135406 134780 gene locus_tag LOCUS_01090 135406 134780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 135895 135533 gene locus_tag LOCUS_01100 135895 135533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 135783 136526 gene locus_tag LOCUS_01110 135783 136526 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013903.1 protein_id gnl|my_center|LOCUS_01110 136526 137578 gene locus_tag LOCUS_01120 136526 137578 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013700.1 protein_id gnl|my_center|LOCUS_01120 137575 138630 gene locus_tag LOCUS_01130 137575 138630 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974571.1 protein_id gnl|my_center|LOCUS_01130 138623 139489 gene locus_tag LOCUS_01140 138623 139489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093530.1 protein_id gnl|my_center|LOCUS_01140 139486 140352 gene locus_tag LOCUS_01150 139486 140352 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013902.1 protein_id gnl|my_center|LOCUS_01150 140498 140815 gene locus_tag LOCUS_01160 140498 140815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530101.1 protein_id gnl|my_center|LOCUS_01160 141398 140838 gene locus_tag LOCUS_01170 141398 140838 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230947.1 protein_id gnl|my_center|LOCUS_01170 142601 141558 gene locus_tag LOCUS_01180 142601 141558 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 protein_id gnl|my_center|LOCUS_01180 142888 143331 gene locus_tag LOCUS_01190 142888 143331 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111658.1 protein_id gnl|my_center|LOCUS_01190 143332 146310 gene locus_tag LOCUS_01200 143332 146310 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296646.1 protein_id gnl|my_center|LOCUS_01200 148011 146314 gene locus_tag LOCUS_01210 148011 146314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_01210 147956 148813 gene locus_tag LOCUS_01220 147956 148813 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_01220 149398 148967 gene locus_tag LOCUS_01230 149398 148967 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897783.1 protein_id gnl|my_center|LOCUS_01230 152260 149648 gene locus_tag LOCUS_01240 152260 149648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 153222 152257 gene locus_tag LOCUS_01250 153222 152257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 protein_id gnl|my_center|LOCUS_01250 154834 153224 gene locus_tag LOCUS_01260 154834 153224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_01260 155880 155002 gene locus_tag LOCUS_01270 155880 155002 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404819.1 protein_id gnl|my_center|LOCUS_01270 156689 156216 gene locus_tag LOCUS_01280 156689 156216 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_01280 156744 157571 gene locus_tag LOCUS_01290 156744 157571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 157568 158980 gene locus_tag LOCUS_01300 157568 158980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_01300 159968 159012 gene locus_tag LOCUS_01310 159968 159012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731236.1 protein_id gnl|my_center|LOCUS_01310 160804 159965 gene locus_tag LOCUS_01320 160804 159965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731235.1 protein_id gnl|my_center|LOCUS_01320 161679 160816 gene locus_tag LOCUS_01330 161679 160816 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 protein_id gnl|my_center|LOCUS_01330 162378 161827 gene locus_tag LOCUS_01340 162378 161827 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_01340 162439 163635 gene locus_tag LOCUS_01350 162439 163635 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063039.1 protein_id gnl|my_center|LOCUS_01350 163707 164204 gene locus_tag LOCUS_01360 163707 164204 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_01360 165290 164319 gene locus_tag LOCUS_01370 165290 164319 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731232.1 protein_id gnl|my_center|LOCUS_01370 165368 165453 gene locus_tag LOCUS_t00010 165368 165453 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 165565 166143 gene locus_tag LOCUS_01380 165565 166143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 166246 166620 gene locus_tag LOCUS_01390 166246 166620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 166683 166877 gene locus_tag LOCUS_01400 166683 166877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 167553 167260 gene locus_tag LOCUS_01410 167553 167260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 167821 168273 gene locus_tag LOCUS_01420 167821 168273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 168586 168918 gene locus_tag LOCUS_01430 168586 168918 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_01430 169077 169949 gene locus_tag LOCUS_01440 169077 169949 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777056.1 protein_id gnl|my_center|LOCUS_01440 170881 170066 gene locus_tag LOCUS_01450 170881 170066 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 protein_id gnl|my_center|LOCUS_01450 171103 171777 gene locus_tag LOCUS_01460 171103 171777 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_01460 172594 171794 gene locus_tag LOCUS_01470 172594 171794 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804277.1 protein_id gnl|my_center|LOCUS_01470 173559 172591 gene locus_tag LOCUS_01480 173559 172591 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 protein_id gnl|my_center|LOCUS_01480 174780 173692 gene locus_tag LOCUS_01490 174780 173692 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891444.1 protein_id gnl|my_center|LOCUS_01490 174933 176180 gene locus_tag LOCUS_01500 174933 176180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 176663 176154 gene locus_tag LOCUS_01510 176663 176154 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412703.1 protein_id gnl|my_center|LOCUS_01510 176853 177830 gene locus_tag LOCUS_01520 176853 177830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 178992 177874 gene locus_tag LOCUS_01530 gene hisC 178992 177874 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112910.1 protein_id gnl|my_center|LOCUS_01530 179060 179151 gene locus_tag LOCUS_t00020 179060 179151 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 179204 179279 gene locus_tag LOCUS_t00030 179204 179279 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 181658 179490 gene locus_tag LOCUS_01540 gene helR 181658 179490 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728199.1 protein_id gnl|my_center|LOCUS_01540 182194 182979 gene locus_tag LOCUS_01550 182194 182979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 183041 183694 gene locus_tag LOCUS_01560 183041 183694 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878619.1 protein_id gnl|my_center|LOCUS_01560 184696 183722 gene locus_tag LOCUS_01570 184696 183722 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731208.1 protein_id gnl|my_center|LOCUS_01570 184775 185317 gene locus_tag LOCUS_01580 184775 185317 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_01580 185337 185801 gene locus_tag LOCUS_01590 185337 185801 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 protein_id gnl|my_center|LOCUS_01590 185924 186193 gene locus_tag LOCUS_01600 185924 186193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 186366 186575 gene locus_tag LOCUS_01610 186366 186575 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088593.1 protein_id gnl|my_center|LOCUS_01610 186772 186861 gene locus_tag LOCUS_t00040 186772 186861 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 187606 186926 gene locus_tag LOCUS_01620 187606 186926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 188322 187654 gene locus_tag LOCUS_01630 188322 187654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 188618 189412 gene locus_tag LOCUS_01640 188618 189412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 190822 189317 gene locus_tag LOCUS_01650 190822 189317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 191052 192563 gene locus_tag LOCUS_01660 191052 192563 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228885.1 protein_id gnl|my_center|LOCUS_01660 192709 194571 gene locus_tag LOCUS_01670 192709 194571 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_01670 194568 195989 gene locus_tag LOCUS_01680 194568 195989 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 protein_id gnl|my_center|LOCUS_01680 195986 197308 gene locus_tag LOCUS_01690 195986 197308 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407376.1 protein_id gnl|my_center|LOCUS_01690 199069 197333 gene locus_tag LOCUS_01700 gene sulP 199069 197333 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163161279.1 protein_id gnl|my_center|LOCUS_01700 199661 199143 gene locus_tag LOCUS_01710 199661 199143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 200317 199721 gene locus_tag LOCUS_01720 200317 199721 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 protein_id gnl|my_center|LOCUS_01720 200490 200314 gene locus_tag LOCUS_01730 200490 200314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 200411 201316 gene locus_tag LOCUS_01740 200411 201316 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030296.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01740 203398 201626 gene locus_tag LOCUS_01750 203398 201626 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730378.1 protein_id gnl|my_center|LOCUS_01750 203620 204567 gene locus_tag LOCUS_01760 203620 204567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 205312 204587 gene locus_tag LOCUS_01770 205312 204587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_01770 205691 205335 gene locus_tag LOCUS_01780 205691 205335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 206348 205830 gene locus_tag LOCUS_01790 206348 205830 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104932.1 protein_id gnl|my_center|LOCUS_01790 206907 206641 gene locus_tag LOCUS_01800 206907 206641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 207237 206950 gene locus_tag LOCUS_01810 207237 206950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 207206 208594 gene locus_tag LOCUS_01820 207206 208594 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730582.1 protein_id gnl|my_center|LOCUS_01820 210502 208664 gene locus_tag LOCUS_01830 210502 208664 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731200.1 protein_id gnl|my_center|LOCUS_01830 211463 210537 gene locus_tag LOCUS_01840 211463 210537 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029227.1 protein_id gnl|my_center|LOCUS_01840 212338 211460 gene locus_tag LOCUS_01850 212338 211460 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808657.1 protein_id gnl|my_center|LOCUS_01850 212394 213233 gene locus_tag LOCUS_01860 212394 213233 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728951.1 protein_id gnl|my_center|LOCUS_01860 214171 213584 gene locus_tag LOCUS_01870 214171 213584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_01870 214454 214164 gene locus_tag LOCUS_01880 214454 214164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 215006 214470 gene locus_tag LOCUS_01890 215006 214470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 216298 215003 gene locus_tag LOCUS_01900 216298 215003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 216741 216295 gene locus_tag LOCUS_01910 216741 216295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 218623 216836 gene locus_tag LOCUS_01920 gene nuoN 218623 216836 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900644.1 protein_id gnl|my_center|LOCUS_01920 220227 218623 gene locus_tag LOCUS_01930 220227 218623 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_01930 222137 220224 gene locus_tag LOCUS_01940 gene nuoL 222137 220224 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_01940 222447 222148 gene locus_tag LOCUS_01950 gene nuoK 222447 222148 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061219.1 protein_id gnl|my_center|LOCUS_01950 223232 222444 gene locus_tag LOCUS_01960 223232 222444 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_01960 223798 223229 gene locus_tag LOCUS_01970 gene nuoI 223798 223229 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416447.1 protein_id gnl|my_center|LOCUS_01970 225068 223791 gene locus_tag LOCUS_01980 gene nuoH 225068 223791 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_01980 227473 225065 gene locus_tag LOCUS_01990 227473 225065 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_01990 229518 227470 gene locus_tag LOCUS_02000 229518 227470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 230828 229515 gene locus_tag LOCUS_02010 gene nuoD 230828 229515 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 protein_id gnl|my_center|LOCUS_02010 231535 230828 gene locus_tag LOCUS_02020 231535 230828 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 protein_id gnl|my_center|LOCUS_02020 232086 231532 gene locus_tag LOCUS_02030 232086 231532 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061196.1 protein_id gnl|my_center|LOCUS_02030 232530 232126 gene locus_tag LOCUS_02040 232530 232126 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061193.1 protein_id gnl|my_center|LOCUS_02040 233098 232691 gene locus_tag LOCUS_02050 233098 232691 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 protein_id gnl|my_center|LOCUS_02050 234243 233182 gene locus_tag LOCUS_02060 234243 233182 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_02060 234550 234323 gene locus_tag LOCUS_02070 234550 234323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 234437 235717 gene locus_tag LOCUS_02080 234437 235717 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_02080 237231 235807 gene locus_tag LOCUS_02090 237231 235807 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_02090 238068 237277 gene locus_tag LOCUS_02100 238068 237277 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_02100 238276 239169 gene locus_tag LOCUS_02110 238276 239169 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031714.1 protein_id gnl|my_center|LOCUS_02110 239911 239228 gene locus_tag LOCUS_02120 239911 239228 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 protein_id gnl|my_center|LOCUS_02120 240135 239941 gene locus_tag LOCUS_02130 240135 239941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 240454 240164 gene locus_tag LOCUS_02140 240454 240164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 240351 240902 gene locus_tag LOCUS_02150 240351 240902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086809.1 protein_id gnl|my_center|LOCUS_02150 241081 241533 gene locus_tag LOCUS_02160 241081 241533 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 protein_id gnl|my_center|LOCUS_02160 241693 241974 gene locus_tag LOCUS_02170 241693 241974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 242013 242267 gene locus_tag LOCUS_02180 242013 242267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 242621 243055 gene locus_tag LOCUS_02190 242621 243055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 243081 243464 gene locus_tag LOCUS_02200 243081 243464 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230088.1 protein_id gnl|my_center|LOCUS_02200 243538 243852 gene locus_tag LOCUS_02210 243538 243852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 243849 245126 gene locus_tag LOCUS_02220 243849 245126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 245673 245398 gene locus_tag LOCUS_02230 245673 245398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 246367 245726 gene locus_tag LOCUS_02240 246367 245726 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 protein_id gnl|my_center|LOCUS_02240 246457 246984 gene locus_tag LOCUS_02250 246457 246984 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224794.1 protein_id gnl|my_center|LOCUS_02250 247378 247004 gene locus_tag LOCUS_02260 247378 247004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 247599 248873 gene locus_tag LOCUS_02270 gene tgt 247599 248873 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 protein_id gnl|my_center|LOCUS_02270 250468 248966 gene locus_tag LOCUS_02280 250468 248966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 251709 250792 gene locus_tag LOCUS_02290 251709 250792 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537842.1 protein_id gnl|my_center|LOCUS_02290 252716 251760 gene locus_tag LOCUS_02300 252716 251760 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225340.1 protein_id gnl|my_center|LOCUS_02300 253372 252713 gene locus_tag LOCUS_02310 253372 252713 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742240.1 protein_id gnl|my_center|LOCUS_02310 253638 255086 gene locus_tag LOCUS_02320 253638 255086 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_02320 255079 256092 gene locus_tag LOCUS_02330 255079 256092 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_02330 257084 256176 gene locus_tag LOCUS_02340 gene gluQRS 257084 256176 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897726.1 protein_id gnl|my_center|LOCUS_02340 257211 258272 gene locus_tag LOCUS_02350 257211 258272 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104330.1 protein_id gnl|my_center|LOCUS_02350 258275 259375 gene locus_tag LOCUS_02360 gene ligD 258275 259375 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878612.1 protein_id gnl|my_center|LOCUS_02360 260238 259390 gene locus_tag LOCUS_02370 260238 259390 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_02370 260317 260405 gene locus_tag LOCUS_t00050 260317 260405 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 260743 262002 gene locus_tag LOCUS_02380 260743 262002 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_02380 262157 263650 gene locus_tag LOCUS_02390 262157 263650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 263694 266195 gene locus_tag LOCUS_02400 263694 266195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 266260 267036 gene locus_tag LOCUS_02410 266260 267036 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898609.1 protein_id gnl|my_center|LOCUS_02410 268403 267081 gene locus_tag LOCUS_02420 268403 267081 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897704.1 protein_id gnl|my_center|LOCUS_02420 269782 268400 gene locus_tag LOCUS_02430 269782 268400 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731176.1 protein_id gnl|my_center|LOCUS_02430 269864 270301 gene locus_tag LOCUS_02440 269864 270301 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083660.1 protein_id gnl|my_center|LOCUS_02440 270356 271318 gene locus_tag LOCUS_02450 270356 271318 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977201.1 protein_id gnl|my_center|LOCUS_02450 271343 271672 gene locus_tag LOCUS_02460 271343 271672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 271650 272066 gene locus_tag LOCUS_02470 271650 272066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 272139 272750 gene locus_tag LOCUS_02480 gene recR 272139 272750 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420407.1 protein_id gnl|my_center|LOCUS_02480 272861 274438 gene locus_tag LOCUS_02490 272861 274438 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014178.1 protein_id gnl|my_center|LOCUS_02490 274435 274995 gene locus_tag LOCUS_02500 274435 274995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 275186 275473 gene locus_tag LOCUS_02510 275186 275473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 275494 276114 gene locus_tag LOCUS_02520 275494 276114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 276390 277112 gene locus_tag LOCUS_02530 276390 277112 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_02530 277998 277321 gene locus_tag LOCUS_02540 277998 277321 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900739.1 protein_id gnl|my_center|LOCUS_02540 279206 278040 gene locus_tag LOCUS_02550 279206 278040 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169592731.1 protein_id gnl|my_center|LOCUS_02550 279417 280508 gene locus_tag LOCUS_02560 279417 280508 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111188.1 protein_id gnl|my_center|LOCUS_02560 281492 280497 gene locus_tag LOCUS_02570 281492 280497 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113950.1 protein_id gnl|my_center|LOCUS_02570 281938 281576 gene locus_tag LOCUS_02580 gene trxA 281938 281576 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_02580 282053 282934 gene locus_tag LOCUS_02590 282053 282934 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085592.1 protein_id gnl|my_center|LOCUS_02590 284157 283006 gene locus_tag LOCUS_02600 284157 283006 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_02600 284873 284187 gene locus_tag LOCUS_02610 284873 284187 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 protein_id gnl|my_center|LOCUS_02610 286059 284866 gene locus_tag LOCUS_02620 286059 284866 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226452.1 protein_id gnl|my_center|LOCUS_02620 286560 286240 gene locus_tag LOCUS_02630 286560 286240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 287784 286765 gene locus_tag LOCUS_02640 287784 286765 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096845.1 protein_id gnl|my_center|LOCUS_02640 289751 287901 gene locus_tag LOCUS_02650 gene leuA 289751 287901 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731169.1 protein_id gnl|my_center|LOCUS_02650 290113 291516 gene locus_tag LOCUS_02660 290113 291516 CDS product MHS family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406233.1 protein_id gnl|my_center|LOCUS_02660 292517 291615 gene locus_tag LOCUS_02670 292517 291615 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_02670 293140 292559 gene locus_tag LOCUS_02680 293140 292559 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897680.1 protein_id gnl|my_center|LOCUS_02680 294748 293168 gene locus_tag LOCUS_02690 294748 293168 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111479.1 protein_id gnl|my_center|LOCUS_02690 294871 295533 gene locus_tag LOCUS_02700 294871 295533 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069122.1 protein_id gnl|my_center|LOCUS_02700 297141 295783 gene locus_tag LOCUS_02710 297141 295783 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 protein_id gnl|my_center|LOCUS_02710 297290 298555 gene locus_tag LOCUS_02720 297290 298555 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 protein_id gnl|my_center|LOCUS_02720 298558 299583 gene locus_tag LOCUS_02730 298558 299583 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087033.1 protein_id gnl|my_center|LOCUS_02730 300308 299580 gene locus_tag LOCUS_02740 300308 299580 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 protein_id gnl|my_center|LOCUS_02740 300455 300967 gene locus_tag LOCUS_02750 300455 300967 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891774.1 protein_id gnl|my_center|LOCUS_02750 300970 302364 gene locus_tag LOCUS_02760 300970 302364 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_02760 302752 302387 gene locus_tag LOCUS_02770 302752 302387 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729797.1 protein_id gnl|my_center|LOCUS_02770 303192 302746 gene locus_tag LOCUS_02780 303192 302746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 303097 303627 gene locus_tag LOCUS_02790 303097 303627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 303624 304733 gene locus_tag LOCUS_02800 303624 304733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015561.1 protein_id gnl|my_center|LOCUS_02800 304833 306254 gene locus_tag LOCUS_02810 304833 306254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 306405 307670 gene locus_tag LOCUS_02820 306405 307670 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 protein_id gnl|my_center|LOCUS_02820 307735 308424 gene locus_tag LOCUS_02830 307735 308424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 308550 308981 gene locus_tag LOCUS_02840 308550 308981 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230586.1 protein_id gnl|my_center|LOCUS_02840 309048 309524 gene locus_tag LOCUS_02850 309048 309524 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230585.1 protein_id gnl|my_center|LOCUS_02850 310211 309609 gene locus_tag LOCUS_02860 310211 309609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 310415 311887 gene locus_tag LOCUS_02870 310415 311887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776875.1 protein_id gnl|my_center|LOCUS_02870 312017 313393 gene locus_tag LOCUS_02880 312017 313393 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_02880 313448 314812 gene locus_tag LOCUS_02890 313448 314812 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285284.1 protein_id gnl|my_center|LOCUS_02890 315914 314799 gene locus_tag LOCUS_02900 315914 314799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 316079 316522 gene locus_tag LOCUS_02910 316079 316522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 317202 316588 gene locus_tag LOCUS_02920 317202 316588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 317776 317351 gene locus_tag LOCUS_02930 317776 317351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030827.1 protein_id gnl|my_center|LOCUS_02930 317976 318050 gene locus_tag LOCUS_t00060 317976 318050 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 318322 318128 gene locus_tag LOCUS_02940 318322 318128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 319044 318319 gene locus_tag LOCUS_02950 319044 318319 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106623.1 protein_id gnl|my_center|LOCUS_02950 320051 319041 gene locus_tag LOCUS_02960 320051 319041 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083536.1 protein_id gnl|my_center|LOCUS_02960 322579 320132 gene locus_tag LOCUS_02970 gene ponA2 322579 320132 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 protein_id gnl|my_center|LOCUS_02970 322893 323201 gene locus_tag LOCUS_02980 322893 323201 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731112.1 protein_id gnl|my_center|LOCUS_02980 324416 323322 gene locus_tag LOCUS_02990 324416 323322 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_02990 325513 324416 gene locus_tag LOCUS_03000 325513 324416 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050545102.1 protein_id gnl|my_center|LOCUS_03000 325557 325721 gene locus_tag LOCUS_03010 325557 325721 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897587.1 protein_id gnl|my_center|LOCUS_03010 325724 326197 gene locus_tag LOCUS_03020 325724 326197 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 protein_id gnl|my_center|LOCUS_03020 326206 326967 gene locus_tag LOCUS_03030 326206 326967 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082824.1 protein_id gnl|my_center|LOCUS_03030 327081 328655 gene locus_tag LOCUS_03040 327081 328655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_03040 328652 329887 gene locus_tag LOCUS_03050 328652 329887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015414.1 protein_id gnl|my_center|LOCUS_03050 329981 330211 gene locus_tag LOCUS_03060 329981 330211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 330390 331532 gene locus_tag LOCUS_03070 330390 331532 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228114.1 protein_id gnl|my_center|LOCUS_03070 331611 332432 gene locus_tag LOCUS_03080 331611 332432 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 protein_id gnl|my_center|LOCUS_03080 333239 332565 gene locus_tag LOCUS_03090 gene crp 333239 332565 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 protein_id gnl|my_center|LOCUS_03090 333741 333421 gene locus_tag LOCUS_03100 333741 333421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 333853 334707 gene locus_tag LOCUS_03110 gene nth 333853 334707 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 protein_id gnl|my_center|LOCUS_03110 334704 335480 gene locus_tag LOCUS_03120 334704 335480 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419721.1 protein_id gnl|my_center|LOCUS_03120 335621 336313 gene locus_tag LOCUS_03130 335621 336313 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083528.1 protein_id gnl|my_center|LOCUS_03130 336310 337503 gene locus_tag LOCUS_03140 gene marP 336310 337503 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_03140 338482 337418 gene locus_tag LOCUS_03150 338482 337418 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 protein_id gnl|my_center|LOCUS_03150 338992 338486 gene locus_tag LOCUS_03160 338992 338486 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419710.1 protein_id gnl|my_center|LOCUS_03160 341357 339417 gene locus_tag LOCUS_03170 gene acs 341357 339417 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086931.1 protein_id gnl|my_center|LOCUS_03170 341755 342510 gene locus_tag LOCUS_03180 341755 342510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296309.1 protein_id gnl|my_center|LOCUS_03180 343450 344523 gene locus_tag LOCUS_03190 343450 344523 CDS product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510600.1 protein_id gnl|my_center|LOCUS_03190 344520 345728 gene locus_tag LOCUS_03200 344520 345728 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 protein_id gnl|my_center|LOCUS_03200 345734 346579 gene locus_tag LOCUS_03210 345734 346579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 346576 347214 gene locus_tag LOCUS_03220 346576 347214 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731085.1 protein_id gnl|my_center|LOCUS_03220 347248 347622 gene locus_tag LOCUS_03230 347248 347622 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254609.1 protein_id gnl|my_center|LOCUS_03230 347771 348031 gene locus_tag LOCUS_03240 347771 348031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 348079 348423 gene locus_tag LOCUS_03250 348079 348423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 348420 348791 gene locus_tag LOCUS_03260 348420 348791 CDS product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731083.1 protein_id gnl|my_center|LOCUS_03260 349359 348808 gene locus_tag LOCUS_03270 349359 348808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 351679 349352 gene locus_tag LOCUS_03280 351679 349352 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113919.1 protein_id gnl|my_center|LOCUS_03280 352018 352221 gene locus_tag LOCUS_03290 352018 352221 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 protein_id gnl|my_center|LOCUS_03290 352424 353008 gene locus_tag LOCUS_03300 352424 353008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419642.1 protein_id gnl|my_center|LOCUS_03300 353194 356304 gene locus_tag LOCUS_03310 gene topA 353194 356304 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_03310 357862 356402 gene locus_tag LOCUS_03320 357862 356402 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419638.1 protein_id gnl|my_center|LOCUS_03320 358035 359324 gene locus_tag LOCUS_03330 358035 359324 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731078.1 protein_id gnl|my_center|LOCUS_03330 359374 359811 gene locus_tag LOCUS_03340 359374 359811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 359808 360332 gene locus_tag LOCUS_03350 359808 360332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 360419 360616 gene locus_tag LOCUS_03360 360419 360616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 361552 360710 gene locus_tag LOCUS_03370 361552 360710 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_03370 361709 362269 gene locus_tag LOCUS_03380 361709 362269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731153.1 protein_id gnl|my_center|LOCUS_03380 362381 363112 gene locus_tag LOCUS_03390 362381 363112 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_03390 364292 363126 gene locus_tag LOCUS_03400 364292 363126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 364514 364439 gene locus_tag LOCUS_t00070 364514 364439 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 365467 364616 gene locus_tag LOCUS_03410 365467 364616 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_03410 365966 365520 gene locus_tag LOCUS_03420 365966 365520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 366015 366182 gene locus_tag LOCUS_03430 366015 366182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 366319 367200 gene locus_tag LOCUS_03440 366319 367200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 367325 368449 gene locus_tag LOCUS_03450 367325 368449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 368506 368991 gene locus_tag LOCUS_03460 368506 368991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 369524 370033 gene locus_tag LOCUS_03470 369524 370033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 370040 370747 gene locus_tag LOCUS_03480 370040 370747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 370794 371465 gene locus_tag LOCUS_03490 370794 371465 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728478.1 protein_id gnl|my_center|LOCUS_03490 372762 371566 gene locus_tag LOCUS_03500 372762 371566 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074294.1 protein_id gnl|my_center|LOCUS_03500 373001 373696 gene locus_tag LOCUS_03510 373001 373696 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062703.1 protein_id gnl|my_center|LOCUS_03510 373693 374958 gene locus_tag LOCUS_03520 373693 374958 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 protein_id gnl|my_center|LOCUS_03520 375078 377159 gene locus_tag LOCUS_03530 375078 377159 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420597.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence02 <1 730 gene locus_tag LOCUS_03540 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003906341.1:HNH endonuclease signature motif containing protein 2076 856 gene locus_tag LOCUS_03550 2076 856 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_03550 2543 2175 gene locus_tag LOCUS_03560 2543 2175 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063568.1 protein_id gnl|my_center|LOCUS_03560 3923 2601 gene locus_tag LOCUS_03570 3923 2601 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_03570 4935 3985 gene locus_tag LOCUS_03580 4935 3985 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_03580 5061 5726 gene locus_tag LOCUS_03590 5061 5726 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079953.1 protein_id gnl|my_center|LOCUS_03590 5723 6595 gene locus_tag LOCUS_03600 5723 6595 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079952.1 protein_id gnl|my_center|LOCUS_03600 6724 7119 gene locus_tag LOCUS_03610 6724 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7120 7383 gene locus_tag LOCUS_03620 7120 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7435 7704 gene locus_tag LOCUS_03630 7435 7704 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776729.1 protein_id gnl|my_center|LOCUS_03630 7737 8783 gene locus_tag LOCUS_03640 7737 8783 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898602.1 protein_id gnl|my_center|LOCUS_03640 9871 8798 gene locus_tag LOCUS_03650 9871 8798 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727579.1 protein_id gnl|my_center|LOCUS_03650 11184 9916 gene locus_tag LOCUS_03660 11184 9916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_03660 11333 11785 gene locus_tag LOCUS_03670 11333 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 12545 11811 gene locus_tag LOCUS_03680 gene pdxH 12545 11811 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730702.1 protein_id gnl|my_center|LOCUS_03680 12721 13848 gene locus_tag LOCUS_03690 12721 13848 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730703.1 protein_id gnl|my_center|LOCUS_03690 14009 14299 gene locus_tag LOCUS_03700 14009 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 14296 16680 gene locus_tag LOCUS_03710 14296 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 16681 17541 gene locus_tag LOCUS_03720 16681 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730307.1 protein_id gnl|my_center|LOCUS_03720 18059 19204 gene locus_tag LOCUS_03730 gene serC 18059 19204 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897096.1 protein_id gnl|my_center|LOCUS_03730 19438 20409 gene locus_tag LOCUS_03740 gene sepH 19438 20409 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092707.1 protein_id gnl|my_center|LOCUS_03740 20410 21177 gene locus_tag LOCUS_03750 20410 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 21474 21181 gene locus_tag LOCUS_03760 21474 21181 CDS product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730711.1 protein_id gnl|my_center|LOCUS_03760 22325 21471 gene locus_tag LOCUS_03770 22325 21471 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730712.1 protein_id gnl|my_center|LOCUS_03770 22406 23629 gene locus_tag LOCUS_03780 22406 23629 CDS product enhanced intracellular survival protein Eis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729122.1 protein_id gnl|my_center|LOCUS_03780 24305 23841 gene locus_tag LOCUS_03790 24305 23841 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063625.1 protein_id gnl|my_center|LOCUS_03790 25982 24414 gene locus_tag LOCUS_03800 25982 24414 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081351.1 protein_id gnl|my_center|LOCUS_03800 26007 26255 gene locus_tag LOCUS_03810 26007 26255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 27766 26252 gene locus_tag LOCUS_03820 27766 26252 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031371.1 protein_id gnl|my_center|LOCUS_03820 28860 27790 gene locus_tag LOCUS_03830 28860 27790 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_03830 30124 28874 gene locus_tag LOCUS_03840 30124 28874 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090631.1 protein_id gnl|my_center|LOCUS_03840 30356 30195 gene locus_tag LOCUS_03850 30356 30195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 30856 30329 gene locus_tag LOCUS_03860 30856 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 31223 32521 gene locus_tag LOCUS_03870 31223 32521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 33236 32652 gene locus_tag LOCUS_03880 33236 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 33348 34070 gene locus_tag LOCUS_03890 33348 34070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 35229 34090 gene locus_tag LOCUS_03900 35229 34090 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 protein_id gnl|my_center|LOCUS_03900 35353 35946 gene locus_tag LOCUS_03910 35353 35946 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467243.1 protein_id gnl|my_center|LOCUS_03910 38698 35906 gene locus_tag LOCUS_03920 38698 35906 CDS product molecular chaperone Hsp90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230211.1 protein_id gnl|my_center|LOCUS_03920 39521 38715 gene locus_tag LOCUS_03930 39521 38715 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 protein_id gnl|my_center|LOCUS_03930 39762 41612 gene locus_tag LOCUS_03940 39762 41612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113310.1 protein_id gnl|my_center|LOCUS_03940 41609 42121 gene locus_tag LOCUS_03950 41609 42121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 42539 42126 gene locus_tag LOCUS_03960 42539 42126 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897108.1 protein_id gnl|my_center|LOCUS_03960 42758 42976 gene locus_tag LOCUS_03970 42758 42976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 42982 43527 gene locus_tag LOCUS_03980 42982 43527 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 protein_id gnl|my_center|LOCUS_03980 43558 44646 gene locus_tag LOCUS_03990 gene moaA 43558 44646 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092699.1 protein_id gnl|my_center|LOCUS_03990 44658 44906 gene locus_tag LOCUS_04000 44658 44906 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878424.1 protein_id gnl|my_center|LOCUS_04000 45354 45974 gene locus_tag LOCUS_04010 45354 45974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 46583 46137 gene locus_tag LOCUS_04020 46583 46137 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_04020 47071 46580 gene locus_tag LOCUS_04030 47071 46580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04030 47576 47064 gene locus_tag LOCUS_04040 gene moaC 47576 47064 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230248.1 protein_id gnl|my_center|LOCUS_04040 47839 47582 gene locus_tag LOCUS_04050 47839 47582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618285.1 protein_id gnl|my_center|LOCUS_04050 47941 50073 gene locus_tag LOCUS_04060 47941 50073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 50200 52569 gene locus_tag LOCUS_04070 50200 52569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 53342 52584 gene locus_tag LOCUS_04080 gene allR 53342 52584 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_04080 53495 54769 gene locus_tag LOCUS_04090 53495 54769 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_04090 54766 55581 gene locus_tag LOCUS_04100 54766 55581 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392210.1 protein_id gnl|my_center|LOCUS_04100 55806 55594 gene locus_tag LOCUS_04110 55806 55594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 56302 55829 gene locus_tag LOCUS_04120 56302 55829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 57465 56392 gene locus_tag LOCUS_04130 57465 56392 CDS product phenylacetaldoxime dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266125.1 protein_id gnl|my_center|LOCUS_04130 58364 57528 gene locus_tag LOCUS_04140 58364 57528 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083436.1 protein_id gnl|my_center|LOCUS_04140 58615 58385 gene locus_tag LOCUS_04150 58615 58385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 59078 58662 gene locus_tag LOCUS_04160 59078 58662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 59680 59075 gene locus_tag LOCUS_04170 gene nthA 59680 59075 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_04170 60393 59680 gene locus_tag LOCUS_04180 gene nthB 60393 59680 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_04180 62035 60476 gene locus_tag LOCUS_04190 62035 60476 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726984.1 protein_id gnl|my_center|LOCUS_04190 63763 62363 gene locus_tag LOCUS_04200 63763 62363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 64171 63797 gene locus_tag LOCUS_04210 64171 63797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 65364 64243 gene locus_tag LOCUS_04220 65364 64243 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_04220 65535 66791 gene locus_tag LOCUS_04230 65535 66791 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_04230 66842 68347 gene locus_tag LOCUS_04240 66842 68347 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_04240 68422 69084 gene locus_tag LOCUS_04250 68422 69084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226773.1 protein_id gnl|my_center|LOCUS_04250 69088 70533 gene locus_tag LOCUS_04260 69088 70533 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226774.1 protein_id gnl|my_center|LOCUS_04260 70649 72040 gene locus_tag LOCUS_04270 70649 72040 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418778.1 protein_id gnl|my_center|LOCUS_04270 72050 72988 gene locus_tag LOCUS_04280 72050 72988 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226775.1 protein_id gnl|my_center|LOCUS_04280 73093 73734 gene locus_tag LOCUS_04290 73093 73734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086809.1 protein_id gnl|my_center|LOCUS_04290 74671 74273 gene locus_tag LOCUS_04300 74671 74273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 74770 75207 gene locus_tag LOCUS_04310 74770 75207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 75523 75221 gene locus_tag LOCUS_04320 75523 75221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 75736 76143 gene locus_tag LOCUS_04330 75736 76143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 76921 76157 gene locus_tag LOCUS_04340 76921 76157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535735.1 protein_id gnl|my_center|LOCUS_04340 77047 77655 gene locus_tag LOCUS_04350 77047 77655 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_04350 78936 77665 gene locus_tag LOCUS_04360 78936 77665 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055604.1 protein_id gnl|my_center|LOCUS_04360 79766 78948 gene locus_tag LOCUS_04370 79766 78948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078880017.1 protein_id gnl|my_center|LOCUS_04370 80452 79772 gene locus_tag LOCUS_04380 80452 79772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 83754 80449 gene locus_tag LOCUS_04390 gene lysX 83754 80449 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_04390 84731 83754 gene locus_tag LOCUS_04400 84731 83754 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730358.1 protein_id gnl|my_center|LOCUS_04400 84880 85554 gene locus_tag LOCUS_04410 84880 85554 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_04410 85551 86711 gene locus_tag LOCUS_04420 85551 86711 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_04420 86922 88076 gene locus_tag LOCUS_04430 86922 88076 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727365.1 protein_id gnl|my_center|LOCUS_04430 89339 88113 gene locus_tag LOCUS_04440 89339 88113 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730825.1 protein_id gnl|my_center|LOCUS_04440 91187 89442 gene locus_tag LOCUS_04450 91187 89442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_04450 91514 92119 gene locus_tag LOCUS_04460 91514 92119 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225273.1 protein_id gnl|my_center|LOCUS_04460 92869 92147 gene locus_tag LOCUS_04470 92869 92147 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971646.1 protein_id gnl|my_center|LOCUS_04470 94402 92891 gene locus_tag LOCUS_04480 94402 92891 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971645.1 protein_id gnl|my_center|LOCUS_04480 94647 96065 gene locus_tag LOCUS_04490 gene allB 94647 96065 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804441.1 protein_id gnl|my_center|LOCUS_04490 96094 98442 gene locus_tag LOCUS_04500 96094 98442 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404512.1 protein_id gnl|my_center|LOCUS_04500 99115 98462 gene locus_tag LOCUS_04510 99115 98462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 99452 100384 gene locus_tag LOCUS_04520 99452 100384 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731490.1 protein_id gnl|my_center|LOCUS_04520 100451 102130 gene locus_tag LOCUS_04530 100451 102130 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_04530 103826 102171 gene locus_tag LOCUS_04540 103826 102171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 103924 105090 gene locus_tag LOCUS_04550 103924 105090 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086678.1 protein_id gnl|my_center|LOCUS_04550 106501 105518 gene locus_tag LOCUS_04560 106501 105518 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223508.1 protein_id gnl|my_center|LOCUS_04560 107202 106534 gene locus_tag LOCUS_04570 107202 106534 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090537.1 protein_id gnl|my_center|LOCUS_04570 108282 107296 gene locus_tag LOCUS_04580 108282 107296 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098398.1 protein_id gnl|my_center|LOCUS_04580 109180 108284 gene locus_tag LOCUS_04590 109180 108284 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935658.1 protein_id gnl|my_center|LOCUS_04590 110571 109177 gene locus_tag LOCUS_04600 110571 109177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727272.1 protein_id gnl|my_center|LOCUS_04600 110741 111619 gene locus_tag LOCUS_04610 110741 111619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 111616 112386 gene locus_tag LOCUS_04620 111616 112386 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728425.1 protein_id gnl|my_center|LOCUS_04620 112507 113088 gene locus_tag LOCUS_04630 112507 113088 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224350.1 protein_id gnl|my_center|LOCUS_04630 113081 114649 gene locus_tag LOCUS_04640 113081 114649 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729844.1 protein_id gnl|my_center|LOCUS_04640 114646 116364 gene locus_tag LOCUS_04650 114646 116364 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_04650 116407 117036 gene locus_tag LOCUS_04660 116407 117036 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_04660 117175 117693 gene locus_tag LOCUS_04670 117175 117693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 118585 117695 gene locus_tag LOCUS_04680 118585 117695 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730529.1 protein_id gnl|my_center|LOCUS_04680 120422 118707 gene locus_tag LOCUS_04690 120422 118707 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225256.1 protein_id gnl|my_center|LOCUS_04690 121073 120522 gene locus_tag LOCUS_04700 121073 120522 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_04700 121788 121207 gene locus_tag LOCUS_04710 121788 121207 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062378.1 protein_id gnl|my_center|LOCUS_04710 122849 121806 gene locus_tag LOCUS_04720 122849 121806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728696.1 protein_id gnl|my_center|LOCUS_04720 123301 124893 gene locus_tag LOCUS_04730 123301 124893 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912345.1 protein_id gnl|my_center|LOCUS_04730 125190 126836 gene locus_tag LOCUS_04740 125190 126836 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 protein_id gnl|my_center|LOCUS_04740 129455 126963 gene locus_tag LOCUS_04750 129455 126963 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_04750 130861 129452 gene locus_tag LOCUS_04760 130861 129452 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_04760 132299 130980 gene locus_tag LOCUS_04770 132299 130980 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104544.1 protein_id gnl|my_center|LOCUS_04770 133908 132376 gene locus_tag LOCUS_04780 133908 132376 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_04780 135160 133982 gene locus_tag LOCUS_04790 135160 133982 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728069.1 protein_id gnl|my_center|LOCUS_04790 135716 135192 gene locus_tag LOCUS_04800 135716 135192 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390600.1 protein_id gnl|my_center|LOCUS_04800 135790 136200 gene locus_tag LOCUS_04810 135790 136200 CDS product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 protein_id gnl|my_center|LOCUS_04810 137049 136213 gene locus_tag LOCUS_04820 137049 136213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_04820 138391 137078 gene locus_tag LOCUS_04830 138391 137078 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729334.1 protein_id gnl|my_center|LOCUS_04830 138830 140437 gene locus_tag LOCUS_04840 138830 140437 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_04840 141102 140434 gene locus_tag LOCUS_04850 141102 140434 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_04850 141352 143349 gene locus_tag LOCUS_04860 141352 143349 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_04860 143558 143965 gene locus_tag LOCUS_04870 143558 143965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 144551 143982 gene locus_tag LOCUS_04880 144551 143982 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_04880 144675 145808 gene locus_tag LOCUS_04890 144675 145808 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090104.1 protein_id gnl|my_center|LOCUS_04890 145834 146271 gene locus_tag LOCUS_04900 145834 146271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 146309 147823 gene locus_tag LOCUS_04910 146309 147823 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013525.1 protein_id gnl|my_center|LOCUS_04910 147820 148488 gene locus_tag LOCUS_04920 147820 148488 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_04920 149642 148485 gene locus_tag LOCUS_04930 149642 148485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_04930 150780 149647 gene locus_tag LOCUS_04940 150780 149647 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 protein_id gnl|my_center|LOCUS_04940 150913 151500 gene locus_tag LOCUS_04950 150913 151500 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_04950 151529 151954 gene locus_tag LOCUS_04960 151529 151954 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 protein_id gnl|my_center|LOCUS_04960 151970 152752 gene locus_tag LOCUS_04970 151970 152752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111012.1 protein_id gnl|my_center|LOCUS_04970 152769 153317 gene locus_tag LOCUS_04980 152769 153317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 154354 153476 gene locus_tag LOCUS_04990 154354 153476 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_04990 154448 154816 gene locus_tag LOCUS_05000 154448 154816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 154921 156345 gene locus_tag LOCUS_05010 154921 156345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 156383 157654 gene locus_tag LOCUS_05020 156383 157654 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080787.1 protein_id gnl|my_center|LOCUS_05020 157668 158144 gene locus_tag LOCUS_05030 157668 158144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 158952 158425 gene locus_tag LOCUS_05040 158952 158425 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391304.1 protein_id gnl|my_center|LOCUS_05040 160250 158949 gene locus_tag LOCUS_05050 160250 158949 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729765.1 protein_id gnl|my_center|LOCUS_05050 161185 160418 gene locus_tag LOCUS_05060 161185 160418 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775747.1 protein_id gnl|my_center|LOCUS_05060 161371 161739 gene locus_tag LOCUS_05070 161371 161739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 161736 162647 gene locus_tag LOCUS_05080 161736 162647 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861134.1 protein_id gnl|my_center|LOCUS_05080 162724 163515 gene locus_tag LOCUS_05090 162724 163515 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878395.1 protein_id gnl|my_center|LOCUS_05090 164229 163531 gene locus_tag LOCUS_05100 164229 163531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 164276 164845 gene locus_tag LOCUS_05110 164276 164845 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_05110 165118 166131 gene locus_tag LOCUS_05120 165118 166131 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228314.1 protein_id gnl|my_center|LOCUS_05120 166128 166958 gene locus_tag LOCUS_05130 166128 166958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_05130 166955 168028 gene locus_tag LOCUS_05140 166955 168028 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_05140 168025 168717 gene locus_tag LOCUS_05150 168025 168717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 170818 168899 gene locus_tag LOCUS_05160 170818 168899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_05160 172548 170815 gene locus_tag LOCUS_05170 172548 170815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227095.1 protein_id gnl|my_center|LOCUS_05170 173490 172681 gene locus_tag LOCUS_05180 173490 172681 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897233.1 protein_id gnl|my_center|LOCUS_05180 174534 173530 gene locus_tag LOCUS_05190 174534 173530 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 protein_id gnl|my_center|LOCUS_05190 176317 174641 gene locus_tag LOCUS_05200 176317 174641 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225738.1 protein_id gnl|my_center|LOCUS_05200 177877 176393 gene locus_tag LOCUS_05210 177877 176393 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092361.1 protein_id gnl|my_center|LOCUS_05210 178309 179274 gene locus_tag LOCUS_05220 178309 179274 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence03 223 1611 gene locus_tag LOCUS_05230 223 1611 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894408.1 protein_id gnl|my_center|LOCUS_05230 1608 2495 gene locus_tag LOCUS_05240 1608 2495 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114425.1 protein_id gnl|my_center|LOCUS_05240 2584 2988 gene locus_tag LOCUS_05250 2584 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3040 4248 gene locus_tag LOCUS_05260 gene aroC 3040 4248 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093578.1 protein_id gnl|my_center|LOCUS_05260 4245 4802 gene locus_tag LOCUS_05270 gene aroK 4245 4802 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413021.1 protein_id gnl|my_center|LOCUS_05270 4814 5929 gene locus_tag LOCUS_05280 gene aroB 4814 5929 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894414.1 protein_id gnl|my_center|LOCUS_05280 6624 6127 gene locus_tag LOCUS_05290 6624 6127 CDS product B-4DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296602.1 protein_id gnl|my_center|LOCUS_05290 6742 7860 gene locus_tag LOCUS_05300 6742 7860 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 protein_id gnl|my_center|LOCUS_05300 7882 8445 gene locus_tag LOCUS_05310 gene efp 7882 8445 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412989.1 protein_id gnl|my_center|LOCUS_05310 8449 8925 gene locus_tag LOCUS_05320 gene nusB 8449 8925 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412985.1 protein_id gnl|my_center|LOCUS_05320 9044 9628 gene locus_tag LOCUS_05330 gene pyrR 9044 9628 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093570.1 protein_id gnl|my_center|LOCUS_05330 9628 10578 gene locus_tag LOCUS_05340 9628 10578 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894427.1 protein_id gnl|my_center|LOCUS_05340 10628 11953 gene locus_tag LOCUS_05350 10628 11953 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728776.1 protein_id gnl|my_center|LOCUS_05350 11950 12585 gene locus_tag LOCUS_05360 11950 12585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12582 13751 gene locus_tag LOCUS_05370 gene carA 12582 13751 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728778.1 protein_id gnl|my_center|LOCUS_05370 13751 17086 gene locus_tag LOCUS_05380 gene carB 13751 17086 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111366.1 protein_id gnl|my_center|LOCUS_05380 17083 17913 gene locus_tag LOCUS_05390 gene pyrF 17083 17913 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111363.1 protein_id gnl|my_center|LOCUS_05390 18324 18734 gene locus_tag LOCUS_05400 18324 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 18775 19404 gene locus_tag LOCUS_05410 gene gmk 18775 19404 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025239507.1 protein_id gnl|my_center|LOCUS_05410 19446 19745 gene locus_tag LOCUS_05420 gene rpoZ 19446 19745 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728783.1 protein_id gnl|my_center|LOCUS_05420 19759 21030 gene locus_tag LOCUS_05430 gene coaBC 19759 21030 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898859.1 protein_id gnl|my_center|LOCUS_05430 21036 22328 gene locus_tag LOCUS_05440 gene metK 21036 22328 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894439.1 protein_id gnl|my_center|LOCUS_05440 22393 24372 gene locus_tag LOCUS_05450 22393 24372 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728789.1 protein_id gnl|my_center|LOCUS_05450 24373 25335 gene locus_tag LOCUS_05460 gene fmt 24373 25335 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728792.1 protein_id gnl|my_center|LOCUS_05460 25332 26705 gene locus_tag LOCUS_05470 25332 26705 CDS product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728793.1 protein_id gnl|my_center|LOCUS_05470 27177 27374 gene locus_tag LOCUS_05480 27177 27374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 27371 28168 gene locus_tag LOCUS_05490 27371 28168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 28699 28220 gene locus_tag LOCUS_05500 28699 28220 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267556.1 protein_id gnl|my_center|LOCUS_05500 29061 28696 gene locus_tag LOCUS_05510 29061 28696 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311814.1 protein_id gnl|my_center|LOCUS_05510 29120 30487 gene locus_tag LOCUS_05520 29120 30487 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 protein_id gnl|my_center|LOCUS_05520 30585 30893 gene locus_tag LOCUS_05530 30585 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 30893 33403 gene locus_tag LOCUS_05540 30893 33403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 33555 34196 gene locus_tag LOCUS_05550 33555 34196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730307.1 protein_id gnl|my_center|LOCUS_05550 34250 34954 gene locus_tag LOCUS_05560 gene rpe 34250 34954 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057721.1 protein_id gnl|my_center|LOCUS_05560 34958 35983 gene locus_tag LOCUS_05570 gene ribD 34958 35983 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082329.1 protein_id gnl|my_center|LOCUS_05570 35993 36904 gene locus_tag LOCUS_05580 35993 36904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 36925 38250 gene locus_tag LOCUS_05590 36925 38250 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057753.1 protein_id gnl|my_center|LOCUS_05590 38247 38759 gene locus_tag LOCUS_05600 gene ribH 38247 38759 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728796.1 protein_id gnl|my_center|LOCUS_05600 38756 39250 gene locus_tag LOCUS_05610 38756 39250 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139538.1 protein_id gnl|my_center|LOCUS_05610 39261 41312 gene locus_tag LOCUS_05620 gene uvrC 39261 41312 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082304.1 protein_id gnl|my_center|LOCUS_05620 41305 42237 gene locus_tag LOCUS_05630 gene rapZ 41305 42237 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894466.1 protein_id gnl|my_center|LOCUS_05630 42234 43259 gene locus_tag LOCUS_05640 gene yvcK 42234 43259 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057786.1 protein_id gnl|my_center|LOCUS_05640 43324 44307 gene locus_tag LOCUS_05650 gene whiA 43324 44307 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057788.1 protein_id gnl|my_center|LOCUS_05650 44500 45519 gene locus_tag LOCUS_05660 gene gap 44500 45519 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057792.1 protein_id gnl|my_center|LOCUS_05660 45554 46765 gene locus_tag LOCUS_05670 45554 46765 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894473.1 protein_id gnl|my_center|LOCUS_05670 46769 47557 gene locus_tag LOCUS_05680 gene tpiA 46769 47557 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728805.1 protein_id gnl|my_center|LOCUS_05680 47664 47915 gene locus_tag LOCUS_05690 gene secG 47664 47915 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076011.1 protein_id gnl|my_center|LOCUS_05690 47925 50792 gene locus_tag LOCUS_05700 gene ppc 47925 50792 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728811.1 protein_id gnl|my_center|LOCUS_05700 51536 50799 gene locus_tag LOCUS_05710 gene pgl 51536 50799 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894486.1 protein_id gnl|my_center|LOCUS_05710 52465 51533 gene locus_tag LOCUS_05720 gene opcA 52465 51533 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894487.1 protein_id gnl|my_center|LOCUS_05720 54086 52515 gene locus_tag LOCUS_05730 gene zwf 54086 52515 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082283.1 protein_id gnl|my_center|LOCUS_05730 55215 54094 gene locus_tag LOCUS_05740 gene tal 55215 54094 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_05740 57320 55242 gene locus_tag LOCUS_05750 gene tkt 57320 55242 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728815.1 protein_id gnl|my_center|LOCUS_05750 57647 58642 gene locus_tag LOCUS_05760 57647 58642 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894492.1 protein_id gnl|my_center|LOCUS_05760 59624 58650 gene locus_tag LOCUS_05770 59624 58650 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877580.1 protein_id gnl|my_center|LOCUS_05770 59657 60043 gene locus_tag LOCUS_05780 59657 60043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005130196.1 protein_id gnl|my_center|LOCUS_05780 61130 60057 gene locus_tag LOCUS_05790 61130 60057 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_05790 61942 61127 gene locus_tag LOCUS_05800 61942 61127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407475.1 protein_id gnl|my_center|LOCUS_05800 62928 61939 gene locus_tag LOCUS_05810 62928 61939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728828.1 protein_id gnl|my_center|LOCUS_05810 64893 63037 gene locus_tag LOCUS_05820 gene mptB 64893 63037 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877585.1 protein_id gnl|my_center|LOCUS_05820 65221 64973 gene locus_tag LOCUS_05830 65221 64973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 65132 65866 gene locus_tag LOCUS_05840 65132 65866 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074362944.1 protein_id gnl|my_center|LOCUS_05840 65863 67311 gene locus_tag LOCUS_05850 gene sufB 65863 67311 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894509.1 protein_id gnl|my_center|LOCUS_05850 67311 68498 gene locus_tag LOCUS_05860 gene sufD 67311 68498 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728831.1 protein_id gnl|my_center|LOCUS_05860 68565 69338 gene locus_tag LOCUS_05870 gene sufC 68565 69338 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057836.1 protein_id gnl|my_center|LOCUS_05870 69383 70672 gene locus_tag LOCUS_05880 69383 70672 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111284.1 protein_id gnl|my_center|LOCUS_05880 70676 71143 gene locus_tag LOCUS_05890 70676 71143 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_05890 71140 71529 gene locus_tag LOCUS_05900 71140 71529 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_05900 71630 72022 gene locus_tag LOCUS_05910 71630 72022 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446554.1 protein_id gnl|my_center|LOCUS_05910 73150 72023 gene locus_tag LOCUS_05920 73150 72023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 74021 73209 gene locus_tag LOCUS_05930 74021 73209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_05930 74122 75750 gene locus_tag LOCUS_05940 74122 75750 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894527.1 protein_id gnl|my_center|LOCUS_05940 76792 75734 gene locus_tag LOCUS_05950 76792 75734 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110702.1 protein_id gnl|my_center|LOCUS_05950 77820 76789 gene locus_tag LOCUS_05960 77820 76789 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110699.1 protein_id gnl|my_center|LOCUS_05960 78482 77817 gene locus_tag LOCUS_05970 78482 77817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892876.1 protein_id gnl|my_center|LOCUS_05970 80116 78479 gene locus_tag LOCUS_05980 80116 78479 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098174.1 protein_id gnl|my_center|LOCUS_05980 81834 80290 gene locus_tag LOCUS_05990 81834 80290 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_05990 83558 81948 gene locus_tag LOCUS_06000 83558 81948 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_06000 83708 84580 gene locus_tag LOCUS_06010 83708 84580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 85150 84584 gene locus_tag LOCUS_06020 85150 84584 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075960.1 protein_id gnl|my_center|LOCUS_06020 87967 85166 gene locus_tag LOCUS_06030 87967 85166 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728843.1 protein_id gnl|my_center|LOCUS_06030 88362 88973 gene locus_tag LOCUS_06040 88362 88973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 89348 90859 gene locus_tag LOCUS_06050 89348 90859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 91239 91030 gene locus_tag LOCUS_06060 91239 91030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 91120 92250 gene locus_tag LOCUS_06070 91120 92250 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024571137.1 protein_id gnl|my_center|LOCUS_06070 92240 93178 gene locus_tag LOCUS_06080 92240 93178 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057859.1 protein_id gnl|my_center|LOCUS_06080 93183 94151 gene locus_tag LOCUS_06090 93183 94151 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_06090 94227 94961 gene locus_tag LOCUS_06100 94227 94961 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908549.1 protein_id gnl|my_center|LOCUS_06100 95038 95877 gene locus_tag LOCUS_06110 gene inhA 95038 95877 CDS product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087822.1 protein_id gnl|my_center|LOCUS_06110 95874 96992 gene locus_tag LOCUS_06120 95874 96992 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 protein_id gnl|my_center|LOCUS_06120 97339 97959 gene locus_tag LOCUS_06130 97339 97959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 98854 97985 gene locus_tag LOCUS_06140 98854 97985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082254.1 protein_id gnl|my_center|LOCUS_06140 98996 99823 gene locus_tag LOCUS_06150 98996 99823 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226503.1 protein_id gnl|my_center|LOCUS_06150 99906 100334 gene locus_tag LOCUS_06160 99906 100334 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407562.1 protein_id gnl|my_center|LOCUS_06160 100385 101608 gene locus_tag LOCUS_06170 100385 101608 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407571.1 protein_id gnl|my_center|LOCUS_06170 103703 102930 gene locus_tag LOCUS_06180 103703 102930 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082248.1 protein_id gnl|my_center|LOCUS_06180 103849 105795 gene locus_tag LOCUS_06190 gene mutA 103849 105795 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111265.1 protein_id gnl|my_center|LOCUS_06190 105792 108080 gene locus_tag LOCUS_06200 gene scpA 105792 108080 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728858.1 protein_id gnl|my_center|LOCUS_06200 108080 109078 gene locus_tag LOCUS_06210 gene meaB 108080 109078 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005102543.1 protein_id gnl|my_center|LOCUS_06210 110123 109173 gene locus_tag LOCUS_06220 110123 109173 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110924.1 protein_id gnl|my_center|LOCUS_06220 111240 110128 gene locus_tag LOCUS_06230 111240 110128 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094425.1 protein_id gnl|my_center|LOCUS_06230 111311 112573 gene locus_tag LOCUS_06240 111311 112573 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525221.1 protein_id gnl|my_center|LOCUS_06240 112646 113596 gene locus_tag LOCUS_06250 112646 113596 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727594.1 protein_id gnl|my_center|LOCUS_06250 113759 113671 gene locus_tag LOCUS_t00080 113759 113671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 113868 115202 gene locus_tag LOCUS_06260 113868 115202 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115891.1 protein_id gnl|my_center|LOCUS_06260 115308 115853 gene locus_tag LOCUS_06270 115308 115853 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 protein_id gnl|my_center|LOCUS_06270 117028 115892 gene locus_tag LOCUS_06280 117028 115892 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411116.1 protein_id gnl|my_center|LOCUS_06280 117366 117022 gene locus_tag LOCUS_06290 117366 117022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 118391 117363 gene locus_tag LOCUS_06300 118391 117363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 118540 119382 gene locus_tag LOCUS_06310 118540 119382 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 protein_id gnl|my_center|LOCUS_06310 119451 120212 gene locus_tag LOCUS_06320 119451 120212 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729631.1 protein_id gnl|my_center|LOCUS_06320 120238 120972 gene locus_tag LOCUS_06330 120238 120972 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908254.1 protein_id gnl|my_center|LOCUS_06330 120965 121798 gene locus_tag LOCUS_06340 120965 121798 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729629.1 protein_id gnl|my_center|LOCUS_06340 121883 123133 gene locus_tag LOCUS_06350 gene mshC 121883 123133 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 protein_id gnl|my_center|LOCUS_06350 123191 123499 gene locus_tag LOCUS_06360 123191 123499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 124394 123516 gene locus_tag LOCUS_06370 124394 123516 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729625.1 protein_id gnl|my_center|LOCUS_06370 124446 128036 gene locus_tag LOCUS_06380 gene metH 124446 128036 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900472.1 protein_id gnl|my_center|LOCUS_06380 128075 128842 gene locus_tag LOCUS_06390 128075 128842 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742161.1 protein_id gnl|my_center|LOCUS_06390 129762 128839 gene locus_tag LOCUS_06400 129762 128839 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289263.1 protein_id gnl|my_center|LOCUS_06400 129889 130341 gene locus_tag LOCUS_06410 129889 130341 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730697.1 protein_id gnl|my_center|LOCUS_06410 130338 131813 gene locus_tag LOCUS_06420 130338 131813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 protein_id gnl|my_center|LOCUS_06420 132635 131817 gene locus_tag LOCUS_06430 132635 131817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 132755 133225 gene locus_tag LOCUS_06440 132755 133225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 133321 134100 gene locus_tag LOCUS_06450 133321 134100 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_06450 134097 134870 gene locus_tag LOCUS_06460 134097 134870 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 protein_id gnl|my_center|LOCUS_06460 134867 135130 gene locus_tag LOCUS_06470 134867 135130 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061184.1 protein_id gnl|my_center|LOCUS_06470 135225 136070 gene locus_tag LOCUS_06480 gene hisG 135225 136070 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411047.1 protein_id gnl|my_center|LOCUS_06480 137312 136461 gene locus_tag LOCUS_06490 137312 136461 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_06490 138272 137382 gene locus_tag LOCUS_06500 138272 137382 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296515.1 protein_id gnl|my_center|LOCUS_06500 138472 139302 gene locus_tag LOCUS_06510 138472 139302 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080122.1 protein_id gnl|my_center|LOCUS_06510 139482 141299 gene locus_tag LOCUS_06520 gene arc 139482 141299 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895355.1 protein_id gnl|my_center|LOCUS_06520 141417 143963 gene locus_tag LOCUS_06530 141417 143963 CDS product ATP transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408545.1 protein_id gnl|my_center|LOCUS_06530 144429 144004 gene locus_tag LOCUS_06540 144429 144004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 147200 144516 gene locus_tag LOCUS_06550 147200 144516 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730188.1 protein_id gnl|my_center|LOCUS_06550 147214 148713 gene locus_tag LOCUS_06560 gene dop 147214 148713 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895348.1 protein_id gnl|my_center|LOCUS_06560 148964 149155 gene locus_tag LOCUS_06570 148964 149155 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061283.1 protein_id gnl|my_center|LOCUS_06570 149152 150033 gene locus_tag LOCUS_06580 gene prcB 149152 150033 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411023.1 protein_id gnl|my_center|LOCUS_06580 150030 150836 gene locus_tag LOCUS_06590 gene prcA 150030 150836 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075070.1 protein_id gnl|my_center|LOCUS_06590 150912 152270 gene locus_tag LOCUS_06600 gene pafA 150912 152270 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061320.1 protein_id gnl|my_center|LOCUS_06600 152339 153331 gene locus_tag LOCUS_06610 152339 153331 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_06610 153331 154302 gene locus_tag LOCUS_06620 153331 154302 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080095.1 protein_id gnl|my_center|LOCUS_06620 154412 154684 gene locus_tag LOCUS_06630 gene tatA 154412 154684 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 protein_id gnl|my_center|LOCUS_06630 154706 155698 gene locus_tag LOCUS_06640 gene tatC 154706 155698 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 protein_id gnl|my_center|LOCUS_06640 155695 158505 gene locus_tag LOCUS_06650 155695 158505 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086507.1 protein_id gnl|my_center|LOCUS_06650 158617 159657 gene locus_tag LOCUS_06660 158617 159657 CDS product DUF4333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895335.1 protein_id gnl|my_center|LOCUS_06660 160670 159714 gene locus_tag LOCUS_06670 160670 159714 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935270.1 protein_id gnl|my_center|LOCUS_06670 160797 161885 gene locus_tag LOCUS_06680 160797 161885 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729390.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence04 <1 529 gene locus_tag LOCUS_06690 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731392.1:IS481-like element ISMsm9 family transposase 606 1100 gene locus_tag LOCUS_06700 606 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1754 1263 gene locus_tag LOCUS_06710 gene greA 1754 1263 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059312.1 protein_id gnl|my_center|LOCUS_06710 2660 1884 gene locus_tag LOCUS_06720 2660 1884 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 protein_id gnl|my_center|LOCUS_06720 3154 2657 gene locus_tag LOCUS_06730 3154 2657 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896663.1 protein_id gnl|my_center|LOCUS_06730 3203 4099 gene locus_tag LOCUS_06740 gene mca 3203 4099 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405746.1 protein_id gnl|my_center|LOCUS_06740 4099 4422 gene locus_tag LOCUS_06750 4099 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4445 4948 gene locus_tag LOCUS_06760 4445 4948 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892495.1 protein_id gnl|my_center|LOCUS_06760 6193 4931 gene locus_tag LOCUS_06770 gene rocD 6193 4931 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_06770 6291 6737 gene locus_tag LOCUS_06780 6291 6737 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055607.1 protein_id gnl|my_center|LOCUS_06780 6985 8073 gene locus_tag LOCUS_06790 6985 8073 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728590.1 protein_id gnl|my_center|LOCUS_06790 9861 8293 gene locus_tag LOCUS_06800 9861 8293 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978031.1 protein_id gnl|my_center|LOCUS_06800 11460 9973 gene locus_tag LOCUS_06810 11460 9973 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190163775.1 protein_id gnl|my_center|LOCUS_06810 12108 11569 gene locus_tag LOCUS_06820 12108 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 12848 12180 gene locus_tag LOCUS_06830 12848 12180 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191314885.1 protein_id gnl|my_center|LOCUS_06830 12982 13764 gene locus_tag LOCUS_06840 12982 13764 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059325.1 protein_id gnl|my_center|LOCUS_06840 15259 13793 gene locus_tag LOCUS_06850 15259 13793 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229297.1 protein_id gnl|my_center|LOCUS_06850 15343 16122 gene locus_tag LOCUS_06860 15343 16122 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065139.1 protein_id gnl|my_center|LOCUS_06860 16119 16628 gene locus_tag LOCUS_06870 16119 16628 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229298.1 protein_id gnl|my_center|LOCUS_06870 17541 16600 gene locus_tag LOCUS_06880 gene coaA 17541 16600 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059370.1 protein_id gnl|my_center|LOCUS_06880 17639 18871 gene locus_tag LOCUS_06890 17639 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_06890 18959 20266 gene locus_tag LOCUS_06900 gene glyA 18959 20266 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_06900 20242 21177 gene locus_tag LOCUS_06910 20242 21177 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 protein_id gnl|my_center|LOCUS_06910 21547 21296 gene locus_tag LOCUS_06920 21547 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 21534 22826 gene locus_tag LOCUS_06930 21534 22826 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730413.1 protein_id gnl|my_center|LOCUS_06930 23370 24347 gene locus_tag LOCUS_06940 23370 24347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 24666 24367 gene locus_tag LOCUS_06950 24666 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 25634 24729 gene locus_tag LOCUS_06960 25634 24729 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410150.1 protein_id gnl|my_center|LOCUS_06960 26418 25771 gene locus_tag LOCUS_06970 gene devR 26418 25771 CDS product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896645.1 protein_id gnl|my_center|LOCUS_06970 26449 28299 gene locus_tag LOCUS_06980 gene dosT 26449 28299 CDS product two-component system sensor histidine kinase DosT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899138.1 protein_id gnl|my_center|LOCUS_06980 28404 28285 gene locus_tag LOCUS_06990 28404 28285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 29324 28623 gene locus_tag LOCUS_07000 29324 28623 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728114.1 protein_id gnl|my_center|LOCUS_07000 30736 29330 gene locus_tag LOCUS_07010 30736 29330 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405805.1 protein_id gnl|my_center|LOCUS_07010 32440 30743 gene locus_tag LOCUS_07020 32440 30743 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_07020 33553 32558 gene locus_tag LOCUS_07030 gene glpX 33553 32558 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_07030 33552 34262 gene locus_tag LOCUS_07040 33552 34262 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110031.1 protein_id gnl|my_center|LOCUS_07040 34320 34640 gene locus_tag LOCUS_07050 34320 34640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 34886 34641 gene locus_tag LOCUS_07060 34886 34641 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074080.1 protein_id gnl|my_center|LOCUS_07060 36220 34883 gene locus_tag LOCUS_07070 gene xseA 36220 34883 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110032.1 protein_id gnl|my_center|LOCUS_07070 36936 36217 gene locus_tag LOCUS_07080 36936 36217 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110033.1 protein_id gnl|my_center|LOCUS_07080 36989 37936 gene locus_tag LOCUS_07090 36989 37936 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 protein_id gnl|my_center|LOCUS_07090 39377 37980 gene locus_tag LOCUS_07100 gene mycP 39377 37980 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111995.1 protein_id gnl|my_center|LOCUS_07100 40930 39377 gene locus_tag LOCUS_07110 gene eccD 40930 39377 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055988.1 protein_id gnl|my_center|LOCUS_07110 41130 45107 gene locus_tag LOCUS_07120 41130 45107 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055990.1 protein_id gnl|my_center|LOCUS_07120 45121 46494 gene locus_tag LOCUS_07130 45121 46494 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111994.1 protein_id gnl|my_center|LOCUS_07130 46732 47175 gene locus_tag LOCUS_07140 gene rplM 46732 47175 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056000.1 protein_id gnl|my_center|LOCUS_07140 47172 47708 gene locus_tag LOCUS_07150 gene rpsI 47172 47708 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892945.1 protein_id gnl|my_center|LOCUS_07150 47711 49057 gene locus_tag LOCUS_07160 gene glmM 47711 49057 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892947.1 protein_id gnl|my_center|LOCUS_07160 49054 49758 gene locus_tag LOCUS_07170 49054 49758 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230405.1 protein_id gnl|my_center|LOCUS_07170 49980 50357 gene locus_tag LOCUS_07180 49980 50357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 50354 51574 gene locus_tag LOCUS_07190 50354 51574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 51571 51831 gene locus_tag LOCUS_07200 51571 51831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 51842 52831 gene locus_tag LOCUS_07210 51842 52831 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418298.1 protein_id gnl|my_center|LOCUS_07210 52932 54794 gene locus_tag LOCUS_07220 gene glmS 52932 54794 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466588.1 protein_id gnl|my_center|LOCUS_07220 54804 56279 gene locus_tag LOCUS_07230 54804 56279 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727745.1 protein_id gnl|my_center|LOCUS_07230 56745 56227 gene locus_tag LOCUS_07240 56745 56227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 56872 58056 gene locus_tag LOCUS_07250 gene alr 56872 58056 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727747.1 protein_id gnl|my_center|LOCUS_07250 58053 59192 gene locus_tag LOCUS_07260 58053 59192 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_07260 59189 59665 gene locus_tag LOCUS_07270 gene tsaE 59189 59665 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418042.1 protein_id gnl|my_center|LOCUS_07270 59662 60372 gene locus_tag LOCUS_07280 gene tsaB 59662 60372 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 protein_id gnl|my_center|LOCUS_07280 60369 60878 gene locus_tag LOCUS_07290 gene rimI 60369 60878 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222663.1 protein_id gnl|my_center|LOCUS_07290 60875 61921 gene locus_tag LOCUS_07300 gene tsaD 60875 61921 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727752.1 protein_id gnl|my_center|LOCUS_07300 62117 62416 gene locus_tag LOCUS_07310 gene groES 62117 62416 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 protein_id gnl|my_center|LOCUS_07310 62536 64152 gene locus_tag LOCUS_07320 gene groL 62536 64152 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727753.1 protein_id gnl|my_center|LOCUS_07320 64551 64255 gene locus_tag LOCUS_07330 64551 64255 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893002.1 protein_id gnl|my_center|LOCUS_07330 64967 65908 gene locus_tag LOCUS_07340 64967 65908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 66105 66671 gene locus_tag LOCUS_07350 66105 66671 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296687.1 protein_id gnl|my_center|LOCUS_07350 66655 67740 gene locus_tag LOCUS_07360 66655 67740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 68245 67853 gene locus_tag LOCUS_07370 68245 67853 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907700.1 protein_id gnl|my_center|LOCUS_07370 68390 69901 gene locus_tag LOCUS_07380 gene guaB 68390 69901 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727766.1 protein_id gnl|my_center|LOCUS_07380 69986 71146 gene locus_tag LOCUS_07390 69986 71146 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727767.1 protein_id gnl|my_center|LOCUS_07390 71209 71322 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgtacgccgccaccgctccctg 71404 73182 gene locus_tag LOCUS_07400 gene choD 71404 73182 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418002.1 protein_id gnl|my_center|LOCUS_07400 73278 74213 gene locus_tag LOCUS_07410 73278 74213 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_07410 74842 74240 gene locus_tag LOCUS_07420 74842 74240 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391434.1 protein_id gnl|my_center|LOCUS_07420 75513 74839 gene locus_tag LOCUS_07430 75513 74839 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 protein_id gnl|my_center|LOCUS_07430 76226 75537 gene locus_tag LOCUS_07440 76226 75537 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971119.1 protein_id gnl|my_center|LOCUS_07440 76372 77919 gene locus_tag LOCUS_07450 gene guaA 76372 77919 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_07450 78241 77996 gene locus_tag LOCUS_07460 78241 77996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 79851 78238 gene locus_tag LOCUS_07470 79851 78238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 80032 81321 gene locus_tag LOCUS_07480 80032 81321 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080659.1 protein_id gnl|my_center|LOCUS_07480 81318 82022 gene locus_tag LOCUS_07490 81318 82022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296686.1 protein_id gnl|my_center|LOCUS_07490 83309 82044 gene locus_tag LOCUS_07500 83309 82044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 83387 84412 gene locus_tag LOCUS_07510 83387 84412 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728742.1 protein_id gnl|my_center|LOCUS_07510 84754 85503 gene locus_tag LOCUS_07520 84754 85503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900043.1 protein_id gnl|my_center|LOCUS_07520 85503 87185 gene locus_tag LOCUS_07530 85503 87185 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_07530 87396 88625 gene locus_tag LOCUS_07540 87396 88625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 89709 88627 gene locus_tag LOCUS_07550 89709 88627 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092926.1 protein_id gnl|my_center|LOCUS_07550 91646 89706 gene locus_tag LOCUS_07560 91646 89706 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727780.1 protein_id gnl|my_center|LOCUS_07560 93813 91804 gene locus_tag LOCUS_07570 93813 91804 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030938.1 protein_id gnl|my_center|LOCUS_07570 93907 94269 gene locus_tag LOCUS_07580 gene nmtR 93907 94269 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901716.1 protein_id gnl|my_center|LOCUS_07580 94376 95176 gene locus_tag LOCUS_07590 94376 95176 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894024.1 protein_id gnl|my_center|LOCUS_07590 95271 98522 gene locus_tag LOCUS_07600 95271 98522 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 protein_id gnl|my_center|LOCUS_07600 98563 98820 gene locus_tag LOCUS_07610 98563 98820 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409980.1 protein_id gnl|my_center|LOCUS_07610 99383 98877 gene locus_tag LOCUS_07620 99383 98877 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080688.1 protein_id gnl|my_center|LOCUS_07620 100338 99397 gene locus_tag LOCUS_07630 100338 99397 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014022.1 protein_id gnl|my_center|LOCUS_07630 100405 101289 gene locus_tag LOCUS_07640 100405 101289 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893053.1 protein_id gnl|my_center|LOCUS_07640 101286 101663 gene locus_tag LOCUS_07650 101286 101663 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080708.1 protein_id gnl|my_center|LOCUS_07650 101831 103396 gene locus_tag LOCUS_07660 101831 103396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 104601 103447 gene locus_tag LOCUS_07670 104601 103447 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727801.1 protein_id gnl|my_center|LOCUS_07670 105955 104618 gene locus_tag LOCUS_07680 105955 104618 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_07680 106407 108122 gene locus_tag LOCUS_07690 106407 108122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 108333 109517 gene locus_tag LOCUS_07700 108333 109517 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084599.1 protein_id gnl|my_center|LOCUS_07700 110076 109591 gene locus_tag LOCUS_07710 gene bfr 110076 109591 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895015.1 protein_id gnl|my_center|LOCUS_07710 110504 111355 gene locus_tag LOCUS_07720 110504 111355 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080720.1 protein_id gnl|my_center|LOCUS_07720 111352 112434 gene locus_tag LOCUS_07730 gene trpS 111352 112434 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_07730 112577 113611 gene locus_tag LOCUS_07740 gene yhjD 112577 113611 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 protein_id gnl|my_center|LOCUS_07740 114955 113648 gene locus_tag LOCUS_07750 114955 113648 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056119.1 protein_id gnl|my_center|LOCUS_07750 115844 114966 gene locus_tag LOCUS_07760 115844 114966 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_07760 116227 115829 gene locus_tag LOCUS_07770 116227 115829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 117728 116343 gene locus_tag LOCUS_07780 gene cyp144 117728 116343 CDS product cytochrome P450 Cyp144 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408772.1 protein_id gnl|my_center|LOCUS_07780 117801 118403 gene locus_tag LOCUS_07790 117801 118403 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876835.1 protein_id gnl|my_center|LOCUS_07790 119235 118447 gene locus_tag LOCUS_07800 119235 118447 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056123.1 protein_id gnl|my_center|LOCUS_07800 120989 119235 gene locus_tag LOCUS_07810 gene sdhA 120989 119235 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056124.1 protein_id gnl|my_center|LOCUS_07810 121459 121004 gene locus_tag LOCUS_07820 121459 121004 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417269.1 protein_id gnl|my_center|LOCUS_07820 121876 121472 gene locus_tag LOCUS_07830 gene sdhC 121876 121472 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727812.1 protein_id gnl|my_center|LOCUS_07830 122101 122505 gene locus_tag LOCUS_07840 122101 122505 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_07840 122502 123842 gene locus_tag LOCUS_07850 122502 123842 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776139.1 protein_id gnl|my_center|LOCUS_07850 123839 124969 gene locus_tag LOCUS_07860 123839 124969 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080733.1 protein_id gnl|my_center|LOCUS_07860 126308 125013 gene locus_tag LOCUS_07870 126308 125013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111962.1 protein_id gnl|my_center|LOCUS_07870 127390 126434 gene locus_tag LOCUS_07880 127390 126434 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727826.1 protein_id gnl|my_center|LOCUS_07880 127695 127387 gene locus_tag LOCUS_07890 127695 127387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 127873 128508 gene locus_tag LOCUS_07900 gene upp 127873 128508 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893093.1 protein_id gnl|my_center|LOCUS_07900 129287 128637 gene locus_tag LOCUS_07910 129287 128637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 130131 129328 gene locus_tag LOCUS_07920 130131 129328 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_07920 130234 130932 gene locus_tag LOCUS_07930 130234 130932 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063534.1 protein_id gnl|my_center|LOCUS_07930 130932 132131 gene locus_tag LOCUS_07940 130932 132131 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417220.1 protein_id gnl|my_center|LOCUS_07940 132622 132143 gene locus_tag LOCUS_07950 132622 132143 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_07950 132870 134273 gene locus_tag LOCUS_07960 132870 134273 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080749.1 protein_id gnl|my_center|LOCUS_07960 134385 135827 gene locus_tag LOCUS_07970 134385 135827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 135883 136302 gene locus_tag LOCUS_07980 135883 136302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 137803 136316 gene locus_tag LOCUS_07990 gene glpK 137803 136316 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222837.1 protein_id gnl|my_center|LOCUS_07990 137880 139622 gene locus_tag LOCUS_08000 137880 139622 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727860.1 protein_id gnl|my_center|LOCUS_08000 139710 140132 gene locus_tag LOCUS_08010 139710 140132 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 protein_id gnl|my_center|LOCUS_08010 140940 140149 gene locus_tag LOCUS_08020 gene nei2 140940 140149 CDS product endonuclease VIII Nei2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095691.1 protein_id gnl|my_center|LOCUS_08020 145562 140949 gene locus_tag LOCUS_08030 145562 140949 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727880.1 protein_id gnl|my_center|LOCUS_08030 145787 146023 gene locus_tag LOCUS_08040 145787 146023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 146064 146894 gene locus_tag LOCUS_08050 146064 146894 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083436.1 protein_id gnl|my_center|LOCUS_08050 146909 147403 gene locus_tag LOCUS_08060 146909 147403 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 protein_id gnl|my_center|LOCUS_08060 147520 148746 gene locus_tag LOCUS_08070 147520 148746 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 protein_id gnl|my_center|LOCUS_08070 150105 148768 gene locus_tag LOCUS_08080 150105 148768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 151589 150102 gene locus_tag LOCUS_08090 151589 150102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 152046 151618 gene locus_tag LOCUS_08100 152046 151618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030827.1 protein_id gnl|my_center|LOCUS_08100 <154500 152222 gene locus_tag LOCUS_08110 <154500 152222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727571.1:molybdopterin-dependent oxidoreductase >Feature sequence05 951 301 gene locus_tag LOCUS_08120 951 301 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082403.1 protein_id gnl|my_center|LOCUS_08120 1303 986 gene locus_tag LOCUS_08130 1303 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1420 2412 gene locus_tag LOCUS_08140 1420 2412 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 protein_id gnl|my_center|LOCUS_08140 4287 2527 gene locus_tag LOCUS_08150 4287 2527 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_08150 4907 4284 gene locus_tag LOCUS_08160 4907 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 16918 4904 gene locus_tag LOCUS_08170 16918 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08170 21703 20639 gene locus_tag LOCUS_08180 21703 20639 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224840.1 protein_id gnl|my_center|LOCUS_08180 21859 23142 gene locus_tag LOCUS_08190 21859 23142 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727384.1 protein_id gnl|my_center|LOCUS_08190 23146 23427 gene locus_tag LOCUS_08200 23146 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077815.1 protein_id gnl|my_center|LOCUS_08200 23457 23855 gene locus_tag LOCUS_08210 23457 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 24002 25018 gene locus_tag LOCUS_08220 gene menE 24002 25018 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098433.1 protein_id gnl|my_center|LOCUS_08220 25495 25112 gene locus_tag LOCUS_08230 25495 25112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 26054 26923 gene locus_tag LOCUS_08240 26054 26923 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094666.1 protein_id gnl|my_center|LOCUS_08240 27823 26942 gene locus_tag LOCUS_08250 27823 26942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 28097 27816 gene locus_tag LOCUS_08260 28097 27816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 30789 28192 gene locus_tag LOCUS_08270 30789 28192 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_08270 31514 30789 gene locus_tag LOCUS_08280 31514 30789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897077.1 protein_id gnl|my_center|LOCUS_08280 32699 31536 gene locus_tag LOCUS_08290 32699 31536 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 protein_id gnl|my_center|LOCUS_08290 33073 32696 gene locus_tag LOCUS_08300 33073 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 33200 33487 gene locus_tag LOCUS_08310 33200 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 33584 33802 gene locus_tag LOCUS_08320 33584 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 33926 34402 gene locus_tag LOCUS_08330 33926 34402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 35434 34415 gene locus_tag LOCUS_08340 gene ccsB 35434 34415 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892400.1 protein_id gnl|my_center|LOCUS_08340 37197 35455 gene locus_tag LOCUS_08350 37197 35455 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088832.1 protein_id gnl|my_center|LOCUS_08350 38051 37209 gene locus_tag LOCUS_08360 38051 37209 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 protein_id gnl|my_center|LOCUS_08360 38644 38051 gene locus_tag LOCUS_08370 38644 38051 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 protein_id gnl|my_center|LOCUS_08370 39339 38713 gene locus_tag LOCUS_08380 39339 38713 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222430.1 protein_id gnl|my_center|LOCUS_08380 40688 39339 gene locus_tag LOCUS_08390 gene hemL 40688 39339 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222429.1 protein_id gnl|my_center|LOCUS_08390 41756 40773 gene locus_tag LOCUS_08400 41756 40773 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031714.1 protein_id gnl|my_center|LOCUS_08400 41886 43361 gene locus_tag LOCUS_08410 41886 43361 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086406.1 protein_id gnl|my_center|LOCUS_08410 43444 44046 gene locus_tag LOCUS_08420 43444 44046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 45098 44217 gene locus_tag LOCUS_08430 45098 44217 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419327.1 protein_id gnl|my_center|LOCUS_08430 46473 45310 gene locus_tag LOCUS_08440 46473 45310 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080817.1 protein_id gnl|my_center|LOCUS_08440 47339 46644 gene locus_tag LOCUS_08450 47339 46644 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027318.1 protein_id gnl|my_center|LOCUS_08450 47498 49591 gene locus_tag LOCUS_08460 47498 49591 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088450.1 protein_id gnl|my_center|LOCUS_08460 49830 50744 gene locus_tag LOCUS_08470 49830 50744 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224926.1 protein_id gnl|my_center|LOCUS_08470 50840 51544 gene locus_tag LOCUS_08480 50840 51544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104597.1 protein_id gnl|my_center|LOCUS_08480 52200 51526 gene locus_tag LOCUS_08490 52200 51526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 52631 52197 gene locus_tag LOCUS_08500 52631 52197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 53470 52628 gene locus_tag LOCUS_08510 53470 52628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 54495 53518 gene locus_tag LOCUS_08520 gene hemB 54495 53518 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727312.1 protein_id gnl|my_center|LOCUS_08520 56197 54512 gene locus_tag LOCUS_08530 56197 54512 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080286.1 protein_id gnl|my_center|LOCUS_08530 57191 56247 gene locus_tag LOCUS_08540 gene hemC 57191 56247 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727310.1 protein_id gnl|my_center|LOCUS_08540 58606 57188 gene locus_tag LOCUS_08550 58606 57188 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727309.1 protein_id gnl|my_center|LOCUS_08550 59391 58603 gene locus_tag LOCUS_08560 59391 58603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 59797 59543 gene locus_tag LOCUS_08570 59797 59543 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061885.1 protein_id gnl|my_center|LOCUS_08570 59959 61086 gene locus_tag LOCUS_08580 59959 61086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 61640 61110 gene locus_tag LOCUS_08590 61640 61110 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728364.1 protein_id gnl|my_center|LOCUS_08590 61749 64115 gene locus_tag LOCUS_08600 61749 64115 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510635.1 protein_id gnl|my_center|LOCUS_08600 65321 64167 gene locus_tag LOCUS_08610 65321 64167 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003909986.1 protein_id gnl|my_center|LOCUS_08610 66576 65404 gene locus_tag LOCUS_08620 66576 65404 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080281.1 protein_id gnl|my_center|LOCUS_08620 67818 66766 gene locus_tag LOCUS_08630 67818 66766 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876916.1 protein_id gnl|my_center|LOCUS_08630 68578 68345 gene locus_tag LOCUS_08640 68578 68345 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402437.1 protein_id gnl|my_center|LOCUS_08640 69627 68767 gene locus_tag LOCUS_08650 gene proC 69627 68767 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727304.1 protein_id gnl|my_center|LOCUS_08650 70491 69634 gene locus_tag LOCUS_08660 70491 69634 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098444.1 protein_id gnl|my_center|LOCUS_08660 71459 70530 gene locus_tag LOCUS_08670 71459 70530 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727302.1 protein_id gnl|my_center|LOCUS_08670 73267 71456 gene locus_tag LOCUS_08680 73267 71456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 74275 73319 gene locus_tag LOCUS_08690 gene ppx1 74275 73319 CDS product exopolyphosphatase Ppx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402419.1 protein_id gnl|my_center|LOCUS_08690 74352 75212 gene locus_tag LOCUS_08700 74352 75212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077870.1 protein_id gnl|my_center|LOCUS_08700 75925 75239 gene locus_tag LOCUS_08710 gene regX 75925 75239 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_08710 77337 75922 gene locus_tag LOCUS_08720 77337 75922 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112166.1 protein_id gnl|my_center|LOCUS_08720 77776 77456 gene locus_tag LOCUS_08730 77776 77456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 78605 77859 gene locus_tag LOCUS_08740 78605 77859 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071158.1 protein_id gnl|my_center|LOCUS_08740 78757 80202 gene locus_tag LOCUS_08750 78757 80202 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 protein_id gnl|my_center|LOCUS_08750 81894 80287 gene locus_tag LOCUS_08760 81894 80287 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 protein_id gnl|my_center|LOCUS_08760 82590 81976 gene locus_tag LOCUS_08770 82590 81976 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 protein_id gnl|my_center|LOCUS_08770 83979 82612 gene locus_tag LOCUS_08780 gene mshA 83979 82612 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727296.1 protein_id gnl|my_center|LOCUS_08780 84096 85085 gene locus_tag LOCUS_08790 84096 85085 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907680.1 protein_id gnl|my_center|LOCUS_08790 85082 85984 gene locus_tag LOCUS_08800 85082 85984 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230419.1 protein_id gnl|my_center|LOCUS_08800 85981 86850 gene locus_tag LOCUS_08810 85981 86850 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072717.1 protein_id gnl|my_center|LOCUS_08810 87531 86986 gene locus_tag LOCUS_08820 87531 86986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 87545 88693 gene locus_tag LOCUS_08830 87545 88693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 90361 88706 gene locus_tag LOCUS_08840 90361 88706 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013414.1 protein_id gnl|my_center|LOCUS_08840 91956 90358 gene locus_tag LOCUS_08850 91956 90358 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543833.1 protein_id gnl|my_center|LOCUS_08850 93563 91953 gene locus_tag LOCUS_08860 93563 91953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 95452 93569 gene locus_tag LOCUS_08870 95452 93569 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013411.1 protein_id gnl|my_center|LOCUS_08870 95791 96594 gene locus_tag LOCUS_08880 95791 96594 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975902.1 protein_id gnl|my_center|LOCUS_08880 98439 96892 gene locus_tag LOCUS_08890 98439 96892 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081131.1 protein_id gnl|my_center|LOCUS_08890 98541 99299 gene locus_tag LOCUS_08900 98541 99299 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907677.1 protein_id gnl|my_center|LOCUS_08900 100265 99315 gene locus_tag LOCUS_08910 gene rlmB 100265 99315 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731016.1 protein_id gnl|my_center|LOCUS_08910 101656 100265 gene locus_tag LOCUS_08920 gene cysS 101656 100265 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731017.1 protein_id gnl|my_center|LOCUS_08920 103066 101720 gene locus_tag LOCUS_08930 103066 101720 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_08930 104517 103063 gene locus_tag LOCUS_08940 104517 103063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 106025 104517 gene locus_tag LOCUS_08950 106025 104517 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_08950 107093 106113 gene locus_tag LOCUS_08960 107093 106113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 107521 108876 gene locus_tag LOCUS_08970 107521 108876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 108873 110105 gene locus_tag LOCUS_08980 108873 110105 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407671.1 protein_id gnl|my_center|LOCUS_08980 110569 110102 gene locus_tag LOCUS_08990 gene ispF 110569 110102 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064989.1 protein_id gnl|my_center|LOCUS_08990 111258 110569 gene locus_tag LOCUS_09000 gene ispD 111258 110569 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074324290.1 protein_id gnl|my_center|LOCUS_09000 111777 111289 gene locus_tag LOCUS_09010 gene carD 111777 111289 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731020.1 protein_id gnl|my_center|LOCUS_09010 112224 112895 gene locus_tag LOCUS_09020 112224 112895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731021.1 protein_id gnl|my_center|LOCUS_09020 112983 114362 gene locus_tag LOCUS_09030 gene radA 112983 114362 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064995.1 protein_id gnl|my_center|LOCUS_09030 114905 114375 gene locus_tag LOCUS_09040 114905 114375 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_09040 115010 116095 gene locus_tag LOCUS_09050 gene disA 115010 116095 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296331.1 protein_id gnl|my_center|LOCUS_09050 116910 116122 gene locus_tag LOCUS_09060 116910 116122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 117638 117045 gene locus_tag LOCUS_09070 117638 117045 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085383.1 protein_id gnl|my_center|LOCUS_09070 117664 118590 gene locus_tag LOCUS_09080 117664 118590 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113145.1 protein_id gnl|my_center|LOCUS_09080 118758 119729 gene locus_tag LOCUS_09090 118758 119729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 120237 120150 gene locus_tag LOCUS_t00090 120237 120150 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 120718 121026 gene locus_tag LOCUS_09100 gene mhuD 120718 121026 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_09100 121081 121716 gene locus_tag LOCUS_09110 121081 121716 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_09110 121845 123344 gene locus_tag LOCUS_09120 121845 123344 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899865.1 protein_id gnl|my_center|LOCUS_09120 125216 123504 gene locus_tag LOCUS_09130 gene cydC 125216 123504 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908715.1 protein_id gnl|my_center|LOCUS_09130 126930 125206 gene locus_tag LOCUS_09140 gene cydD 126930 125206 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114396.1 protein_id gnl|my_center|LOCUS_09140 128009 126927 gene locus_tag LOCUS_09150 gene cydB 128009 126927 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111154.1 protein_id gnl|my_center|LOCUS_09150 129605 128022 gene locus_tag LOCUS_09160 129605 128022 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111152.1 protein_id gnl|my_center|LOCUS_09160 130700 129831 gene locus_tag LOCUS_09170 130700 129831 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087166.1 protein_id gnl|my_center|LOCUS_09170 130759 131943 gene locus_tag LOCUS_09180 130759 131943 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730797.1 protein_id gnl|my_center|LOCUS_09180 131952 132617 gene locus_tag LOCUS_09190 131952 132617 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894928.1 protein_id gnl|my_center|LOCUS_09190 132712 132891 gene locus_tag LOCUS_09200 132712 132891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 134273 133167 gene locus_tag LOCUS_09210 gene purM 134273 133167 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897216.1 protein_id gnl|my_center|LOCUS_09210 135982 134372 gene locus_tag LOCUS_09220 gene purF 135982 134372 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730800.1 protein_id gnl|my_center|LOCUS_09220 136507 136148 gene locus_tag LOCUS_09230 136507 136148 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087146.1 protein_id gnl|my_center|LOCUS_09230 136608 138116 gene locus_tag LOCUS_09240 136608 138116 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261568.1 protein_id gnl|my_center|LOCUS_09240 138184 138306 gene locus_tag LOCUS_09250 gene ykgO 138184 138306 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 protein_id gnl|my_center|LOCUS_09250 138535 140145 gene locus_tag LOCUS_09260 138535 140145 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_09260 141266 140187 gene locus_tag LOCUS_09270 141266 140187 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 protein_id gnl|my_center|LOCUS_09270 141337 142272 gene locus_tag LOCUS_09280 141337 142272 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385609.1 protein_id gnl|my_center|LOCUS_09280 142632 142258 gene locus_tag LOCUS_09290 142632 142258 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228393.1 protein_id gnl|my_center|LOCUS_09290 143074 142703 gene locus_tag LOCUS_09300 143074 142703 CDS product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228394.1 protein_id gnl|my_center|LOCUS_09300 145515 143209 gene locus_tag LOCUS_09310 gene purL 145515 143209 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064180.1 protein_id gnl|my_center|LOCUS_09310 145701 147482 gene locus_tag LOCUS_09320 gene eccA1 145701 147482 CDS product type VII secretion system ESX-1 AAA family ATPase EccA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891386.1 protein_id gnl|my_center|LOCUS_09320 147795 147499 gene locus_tag LOCUS_09330 147795 147499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 147785 147955 gene locus_tag LOCUS_09340 147785 147955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 148126 148509 gene locus_tag LOCUS_09350 148126 148509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 149301 148522 gene locus_tag LOCUS_09360 149301 148522 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_09360 151227 149365 gene locus_tag LOCUS_09370 gene cysC 151227 149365 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224712.1 protein_id gnl|my_center|LOCUS_09370 152210 151227 gene locus_tag LOCUS_09380 gene cysD 152210 151227 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086386.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence06 1464 4 gene locus_tag LOCUS_09390 1464 4 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892896.1 protein_id gnl|my_center|LOCUS_09390 1608 2192 gene locus_tag LOCUS_09400 1608 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3680 2199 gene locus_tag LOCUS_09410 3680 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3882 5057 gene locus_tag LOCUS_09420 3882 5057 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497789.1 protein_id gnl|my_center|LOCUS_09420 5120 5482 gene locus_tag LOCUS_09430 5120 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387554.1 protein_id gnl|my_center|LOCUS_09430 5568 6845 gene locus_tag LOCUS_09440 5568 6845 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074154.1 protein_id gnl|my_center|LOCUS_09440 6838 7335 gene locus_tag LOCUS_09450 6838 7335 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206909.1 protein_id gnl|my_center|LOCUS_09450 7350 8111 gene locus_tag LOCUS_09460 7350 8111 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703348.1 protein_id gnl|my_center|LOCUS_09460 8152 9102 gene locus_tag LOCUS_09470 8152 9102 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112295.1 protein_id gnl|my_center|LOCUS_09470 9749 9108 gene locus_tag LOCUS_09480 gene bfiR 9749 9108 CDS product two-component system response regulator BfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_09480 10018 9740 gene locus_tag LOCUS_09490 10018 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 11341 10046 gene locus_tag LOCUS_09500 11341 10046 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931611.1 protein_id gnl|my_center|LOCUS_09500 11499 12956 gene locus_tag LOCUS_09510 11499 12956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083823.1 protein_id gnl|my_center|LOCUS_09510 12996 14168 gene locus_tag LOCUS_09520 12996 14168 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385236.1 protein_id gnl|my_center|LOCUS_09520 14165 14728 gene locus_tag LOCUS_09530 14165 14728 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206910.1 protein_id gnl|my_center|LOCUS_09530 15111 14749 gene locus_tag LOCUS_09540 15111 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 15307 16098 gene locus_tag LOCUS_09550 15307 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 17605 16109 gene locus_tag LOCUS_09560 17605 16109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 18683 18219 gene locus_tag LOCUS_09570 18683 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 18898 19272 gene locus_tag LOCUS_09580 18898 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 20330 19209 gene locus_tag LOCUS_09590 20330 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 21525 21202 gene locus_tag LOCUS_09600 21525 21202 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892430.1 protein_id gnl|my_center|LOCUS_09600 21814 21533 gene locus_tag LOCUS_09610 21814 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077815.1 protein_id gnl|my_center|LOCUS_09610 23062 21851 gene locus_tag LOCUS_09620 23062 21851 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098430.1 protein_id gnl|my_center|LOCUS_09620 23661 23212 gene locus_tag LOCUS_09630 23661 23212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 25610 23808 gene locus_tag LOCUS_09640 25610 23808 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893197.1 protein_id gnl|my_center|LOCUS_09640 27414 25819 gene locus_tag LOCUS_09650 27414 25819 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_09650 27848 27411 gene locus_tag LOCUS_09660 27848 27411 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727923.1 protein_id gnl|my_center|LOCUS_09660 28800 27862 gene locus_tag LOCUS_09670 28800 27862 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893199.1 protein_id gnl|my_center|LOCUS_09670 28912 29916 gene locus_tag LOCUS_09680 28912 29916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 30709 30041 gene locus_tag LOCUS_09690 30709 30041 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727924.1 protein_id gnl|my_center|LOCUS_09690 30930 30712 gene locus_tag LOCUS_09700 30930 30712 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013832.1 protein_id gnl|my_center|LOCUS_09700 32591 30963 gene locus_tag LOCUS_09710 32591 30963 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056191.1 protein_id gnl|my_center|LOCUS_09710 32750 33556 gene locus_tag LOCUS_09720 32750 33556 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080805.1 protein_id gnl|my_center|LOCUS_09720 34185 33577 gene locus_tag LOCUS_09730 34185 33577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 34387 35004 gene locus_tag LOCUS_09740 34387 35004 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056202.1 protein_id gnl|my_center|LOCUS_09740 35001 35675 gene locus_tag LOCUS_09750 35001 35675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222890.1 protein_id gnl|my_center|LOCUS_09750 35682 37079 gene locus_tag LOCUS_09760 35682 37079 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222891.1 protein_id gnl|my_center|LOCUS_09760 37593 37051 gene locus_tag LOCUS_09770 37593 37051 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893209.1 protein_id gnl|my_center|LOCUS_09770 37689 38990 gene locus_tag LOCUS_09780 37689 38990 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056211.1 protein_id gnl|my_center|LOCUS_09780 38987 39499 gene locus_tag LOCUS_09790 gene purE 38987 39499 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 protein_id gnl|my_center|LOCUS_09790 40344 39514 gene locus_tag LOCUS_09800 40344 39514 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_09800 40723 40349 gene locus_tag LOCUS_09810 40723 40349 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061864.1 protein_id gnl|my_center|LOCUS_09810 41482 40763 gene locus_tag LOCUS_09820 41482 40763 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 protein_id gnl|my_center|LOCUS_09820 43416 41470 gene locus_tag LOCUS_09830 43416 41470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 43735 44676 gene locus_tag LOCUS_09840 gene rfbD 43735 44676 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_09840 44700 45560 gene locus_tag LOCUS_09850 44700 45560 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094336.1 protein_id gnl|my_center|LOCUS_09850 45642 46775 gene locus_tag LOCUS_09860 45642 46775 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_09860 47441 46794 gene locus_tag LOCUS_09870 47441 46794 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896481.1 protein_id gnl|my_center|LOCUS_09870 47732 48343 gene locus_tag LOCUS_09880 47732 48343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 48595 49119 gene locus_tag LOCUS_09890 gene rseA 48595 49119 CDS product anti-sigma E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896479.1 protein_id gnl|my_center|LOCUS_09890 49116 50648 gene locus_tag LOCUS_09900 49116 50648 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110085.1 protein_id gnl|my_center|LOCUS_09900 50680 51159 gene locus_tag LOCUS_09910 gene tatB 50680 51159 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059662.1 protein_id gnl|my_center|LOCUS_09910 52314 51169 gene locus_tag LOCUS_09920 52314 51169 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074275.1 protein_id gnl|my_center|LOCUS_09920 53494 52373 gene locus_tag LOCUS_09930 53494 52373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 54321 53797 gene locus_tag LOCUS_09940 54321 53797 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060011.1 protein_id gnl|my_center|LOCUS_09940 55610 54318 gene locus_tag LOCUS_09950 55610 54318 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084763.1 protein_id gnl|my_center|LOCUS_09950 55743 56231 gene locus_tag LOCUS_09960 55743 56231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_09960 56436 57848 gene locus_tag LOCUS_09970 56436 57848 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730290.1 protein_id gnl|my_center|LOCUS_09970 57845 59041 gene locus_tag LOCUS_09980 57845 59041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 59046 59876 gene locus_tag LOCUS_09990 59046 59876 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730289.1 protein_id gnl|my_center|LOCUS_09990 59880 61055 gene locus_tag LOCUS_10000 gene ugpC 59880 61055 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222991.1 protein_id gnl|my_center|LOCUS_10000 61941 61084 gene locus_tag LOCUS_10010 61941 61084 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223001.1 protein_id gnl|my_center|LOCUS_10010 62620 61931 gene locus_tag LOCUS_10020 62620 61931 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223002.1 protein_id gnl|my_center|LOCUS_10020 62679 63263 gene locus_tag LOCUS_10030 62679 63263 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730287.1 protein_id gnl|my_center|LOCUS_10030 63388 64161 gene locus_tag LOCUS_10040 63388 64161 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727889.1 protein_id gnl|my_center|LOCUS_10040 64158 64361 gene locus_tag LOCUS_10050 64158 64361 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727890.1 protein_id gnl|my_center|LOCUS_10050 65438 64401 gene locus_tag LOCUS_10060 65438 64401 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727891.1 protein_id gnl|my_center|LOCUS_10060 66221 65580 gene locus_tag LOCUS_10070 66221 65580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804164.1 protein_id gnl|my_center|LOCUS_10070 67467 66286 gene locus_tag LOCUS_10080 gene corA 67467 66286 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_10080 67412 68032 gene locus_tag LOCUS_10090 67412 68032 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223009.1 protein_id gnl|my_center|LOCUS_10090 68102 69079 gene locus_tag LOCUS_10100 68102 69079 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093006.1 protein_id gnl|my_center|LOCUS_10100 69986 69156 gene locus_tag LOCUS_10110 69986 69156 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088102.1 protein_id gnl|my_center|LOCUS_10110 71578 70016 gene locus_tag LOCUS_10120 71578 70016 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_10120 71679 72350 gene locus_tag LOCUS_10130 71679 72350 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_10130 72845 72366 gene locus_tag LOCUS_10140 72845 72366 CDS product DUF4383 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727892.1 protein_id gnl|my_center|LOCUS_10140 74380 72971 gene locus_tag LOCUS_10150 74380 72971 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_10150 75883 74387 gene locus_tag LOCUS_10160 75883 74387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 77357 75900 gene locus_tag LOCUS_10170 77357 75900 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029681.1 protein_id gnl|my_center|LOCUS_10170 77923 78924 gene locus_tag LOCUS_10180 77923 78924 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_10180 78921 79748 gene locus_tag LOCUS_10190 78921 79748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_10190 79794 80672 gene locus_tag LOCUS_10200 79794 80672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 82026 80698 gene locus_tag LOCUS_10210 82026 80698 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730052.1 protein_id gnl|my_center|LOCUS_10210 82131 83516 gene locus_tag LOCUS_10220 82131 83516 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726906.1 protein_id gnl|my_center|LOCUS_10220 83513 84991 gene locus_tag LOCUS_10230 83513 84991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 85024 86400 gene locus_tag LOCUS_10240 85024 86400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462713.1 protein_id gnl|my_center|LOCUS_10240 86397 87695 gene locus_tag LOCUS_10250 86397 87695 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407671.1 protein_id gnl|my_center|LOCUS_10250 91116 87757 gene locus_tag LOCUS_10260 91116 87757 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296425.1 protein_id gnl|my_center|LOCUS_10260 91010 91324 gene locus_tag LOCUS_10270 91010 91324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 91358 91504 gene locus_tag LOCUS_10280 91358 91504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 95562 91753 gene locus_tag LOCUS_10290 95562 91753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229685.1 protein_id gnl|my_center|LOCUS_10290 96422 95664 gene locus_tag LOCUS_10300 96422 95664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896454.1 protein_id gnl|my_center|LOCUS_10300 97474 96419 gene locus_tag LOCUS_10310 97474 96419 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 protein_id gnl|my_center|LOCUS_10310 97594 99120 gene locus_tag LOCUS_10320 97594 99120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406326.1 protein_id gnl|my_center|LOCUS_10320 99202 100392 gene locus_tag LOCUS_10330 99202 100392 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284170.1 protein_id gnl|my_center|LOCUS_10330 100404 103373 gene locus_tag LOCUS_10340 100404 103373 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229784.1 protein_id gnl|my_center|LOCUS_10340 103430 103505 gene locus_tag LOCUS_t00100 103430 103505 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 103994 103626 gene locus_tag LOCUS_10350 103994 103626 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057988.1 protein_id gnl|my_center|LOCUS_10350 104136 105026 gene locus_tag LOCUS_10360 104136 105026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401227.1 protein_id gnl|my_center|LOCUS_10360 105470 105039 gene locus_tag LOCUS_10370 105470 105039 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967274.1 protein_id gnl|my_center|LOCUS_10370 106352 105483 gene locus_tag LOCUS_10380 106352 105483 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_10380 107253 106429 gene locus_tag LOCUS_10390 107253 106429 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229545.1 protein_id gnl|my_center|LOCUS_10390 107404 109056 gene locus_tag LOCUS_10400 gene argS 107404 109056 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_10400 109053 110474 gene locus_tag LOCUS_10410 gene lysA 109053 110474 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296430.1 protein_id gnl|my_center|LOCUS_10410 110483 111811 gene locus_tag LOCUS_10420 110483 111811 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730212.1 protein_id gnl|my_center|LOCUS_10420 111828 112889 gene locus_tag LOCUS_10430 gene thrC 111828 112889 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730211.1 protein_id gnl|my_center|LOCUS_10430 112870 113880 gene locus_tag LOCUS_10440 gene thrB 112870 113880 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110130.1 protein_id gnl|my_center|LOCUS_10440 114220 116277 gene locus_tag LOCUS_10450 gene rho 114220 116277 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730209.1 protein_id gnl|my_center|LOCUS_10450 117722 116859 gene locus_tag LOCUS_10460 117722 116859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093331.1 protein_id gnl|my_center|LOCUS_10460 119016 117808 gene locus_tag LOCUS_10470 119016 117808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 119320 119532 gene locus_tag LOCUS_10480 gene rpmE 119320 119532 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908151.1 protein_id gnl|my_center|LOCUS_10480 119668 120744 gene locus_tag LOCUS_10490 gene prfA 119668 120744 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059825.1 protein_id gnl|my_center|LOCUS_10490 120750 121625 gene locus_tag LOCUS_10500 gene prmC 120750 121625 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 protein_id gnl|my_center|LOCUS_10500 121663 122322 gene locus_tag LOCUS_10510 121663 122322 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730205.1 protein_id gnl|my_center|LOCUS_10510 122319 123578 gene locus_tag LOCUS_10520 122319 123578 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 protein_id gnl|my_center|LOCUS_10520 123630 124826 gene locus_tag LOCUS_10530 gene rfe 123630 124826 CDS product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898816.1 protein_id gnl|my_center|LOCUS_10530 125111 125524 gene locus_tag LOCUS_10540 125111 125524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 125521 126270 gene locus_tag LOCUS_10550 gene atpB 125521 126270 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878188.1 protein_id gnl|my_center|LOCUS_10550 126405 126656 gene locus_tag LOCUS_10560 126405 126656 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406686.1 protein_id gnl|my_center|LOCUS_10560 126704 127192 gene locus_tag LOCUS_10570 126704 127192 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059844.1 protein_id gnl|my_center|LOCUS_10570 127195 128619 gene locus_tag LOCUS_10580 127195 128619 CDS product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110133.1 protein_id gnl|my_center|LOCUS_10580 128709 130337 gene locus_tag LOCUS_10590 gene atpA 128709 130337 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_10590 130383 131306 gene locus_tag LOCUS_10600 130383 131306 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 protein_id gnl|my_center|LOCUS_10600 131379 132827 gene locus_tag LOCUS_10610 gene atpD 131379 132827 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 protein_id gnl|my_center|LOCUS_10610 132837 133217 gene locus_tag LOCUS_10620 132837 133217 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229521.1 protein_id gnl|my_center|LOCUS_10620 133436 133876 gene locus_tag LOCUS_10630 133436 133876 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908165.1 protein_id gnl|my_center|LOCUS_10630 134517 133873 gene locus_tag LOCUS_10640 134517 133873 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_10640 134628 135884 gene locus_tag LOCUS_10650 gene murA 134628 135884 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_10650 136024 137295 gene locus_tag LOCUS_10660 gene mdo 136024 137295 CDS product NDMA-dependent methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731151.1 protein_id gnl|my_center|LOCUS_10660 137372 138487 gene locus_tag LOCUS_10670 137372 138487 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731150.1 protein_id gnl|my_center|LOCUS_10670 138484 140049 gene locus_tag LOCUS_10680 138484 140049 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731149.1 protein_id gnl|my_center|LOCUS_10680 140124 141299 gene locus_tag LOCUS_10690 140124 141299 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_10690 141299 142678 gene locus_tag LOCUS_10700 gene mnoS 141299 142678 CDS product two-component system sensor histidine kinase MnoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731147.1 protein_id gnl|my_center|LOCUS_10700 142675 143331 gene locus_tag LOCUS_10710 gene mnoR 142675 143331 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_10710 144213 143350 gene locus_tag LOCUS_10720 gene mftM 144213 143350 CDS product mycofactocin oligosaccharide methyltransferase MftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731146.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence07 <1 695 gene locus_tag LOCUS_10730 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412790.1:TetR/AcrR family transcriptional regulator 715 3318 gene locus_tag LOCUS_10740 gene pepN 715 3318 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730013.1 protein_id gnl|my_center|LOCUS_10740 4012 3332 gene locus_tag LOCUS_10750 4012 3332 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730458.1 protein_id gnl|my_center|LOCUS_10750 5571 4009 gene locus_tag LOCUS_10760 5571 4009 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730457.1 protein_id gnl|my_center|LOCUS_10760 5687 7123 gene locus_tag LOCUS_10770 5687 7123 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896702.1 protein_id gnl|my_center|LOCUS_10770 7664 7200 gene locus_tag LOCUS_10780 7664 7200 CDS product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896073.1 protein_id gnl|my_center|LOCUS_10780 7935 7681 gene locus_tag LOCUS_10790 7935 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8320 8766 gene locus_tag LOCUS_10800 gene glbO 8320 8766 CDS product group 2 truncated hemoglobin GlbO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412688.1 protein_id gnl|my_center|LOCUS_10800 8844 10649 gene locus_tag LOCUS_10810 8844 10649 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084851.1 protein_id gnl|my_center|LOCUS_10810 11352 10663 gene locus_tag LOCUS_10820 11352 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412698.1 protein_id gnl|my_center|LOCUS_10820 11843 11352 gene locus_tag LOCUS_10830 11843 11352 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060104.1 protein_id gnl|my_center|LOCUS_10830 14178 11917 gene locus_tag LOCUS_10840 14178 11917 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_10840 18979 14261 gene locus_tag LOCUS_10850 18979 14261 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730019.1 protein_id gnl|my_center|LOCUS_10850 20705 19032 gene locus_tag LOCUS_10860 gene ettA 20705 19032 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896081.1 protein_id gnl|my_center|LOCUS_10860 20979 21971 gene locus_tag LOCUS_10870 20979 21971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 21968 23200 gene locus_tag LOCUS_10880 21968 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 23197 25173 gene locus_tag LOCUS_10890 23197 25173 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257823.1 protein_id gnl|my_center|LOCUS_10890 25173 25511 gene locus_tag LOCUS_10900 25173 25511 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_10900 25552 25965 gene locus_tag LOCUS_10910 25552 25965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 26990 26226 gene locus_tag LOCUS_10920 26990 26226 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_10920 28791 27004 gene locus_tag LOCUS_10930 28791 27004 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_10930 29551 28820 gene locus_tag LOCUS_10940 gene fabG 29551 28820 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_10940 29733 30362 gene locus_tag LOCUS_10950 29733 30362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_10950 31144 30401 gene locus_tag LOCUS_10960 31144 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 32694 31156 gene locus_tag LOCUS_10970 32694 31156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 34379 32691 gene locus_tag LOCUS_10980 34379 32691 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031826.1 protein_id gnl|my_center|LOCUS_10980 36717 34396 gene locus_tag LOCUS_10990 36717 34396 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_10990 38848 36740 gene locus_tag LOCUS_11000 38848 36740 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_11000 39034 39786 gene locus_tag LOCUS_11010 39034 39786 CDS product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064689.1 protein_id gnl|my_center|LOCUS_11010 39801 40460 gene locus_tag LOCUS_11020 39801 40460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 40457 40702 gene locus_tag LOCUS_11030 40457 40702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 40699 41940 gene locus_tag LOCUS_11040 40699 41940 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_11040 41937 43160 gene locus_tag LOCUS_11050 41937 43160 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992349.1 protein_id gnl|my_center|LOCUS_11050 43386 44576 gene locus_tag LOCUS_11060 43386 44576 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966145.1 protein_id gnl|my_center|LOCUS_11060 45300 44608 gene locus_tag LOCUS_11070 45300 44608 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729009.1 protein_id gnl|my_center|LOCUS_11070 45223 45402 gene locus_tag LOCUS_11080 45223 45402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 45565 46131 gene locus_tag LOCUS_11090 45565 46131 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095569.1 protein_id gnl|my_center|LOCUS_11090 46795 46160 gene locus_tag LOCUS_11100 46795 46160 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675038.1 protein_id gnl|my_center|LOCUS_11100 48073 46823 gene locus_tag LOCUS_11110 48073 46823 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 protein_id gnl|my_center|LOCUS_11110 48640 48095 gene locus_tag LOCUS_11120 48640 48095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11120 49893 48619 gene locus_tag LOCUS_11130 49893 48619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11130 51432 50194 gene locus_tag LOCUS_11140 51432 50194 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876815.1 protein_id gnl|my_center|LOCUS_11140 51728 51429 gene locus_tag LOCUS_11150 51728 51429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 52333 51692 gene locus_tag LOCUS_11160 52333 51692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 53112 52348 gene locus_tag LOCUS_11170 53112 52348 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929891.1 protein_id gnl|my_center|LOCUS_11170 54848 53109 gene locus_tag LOCUS_11180 54848 53109 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031826.1 protein_id gnl|my_center|LOCUS_11180 56408 54861 gene locus_tag LOCUS_11190 56408 54861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 56609 57319 gene locus_tag LOCUS_11200 56609 57319 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040397.1 protein_id gnl|my_center|LOCUS_11200 57431 58651 gene locus_tag LOCUS_11210 57431 58651 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227167.1 protein_id gnl|my_center|LOCUS_11210 58744 60087 gene locus_tag LOCUS_11220 58744 60087 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113881.1 protein_id gnl|my_center|LOCUS_11220 60252 60980 gene locus_tag LOCUS_11230 gene fabG 60252 60980 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_11230 61667 61239 gene locus_tag LOCUS_11240 gene ssb 61667 61239 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110156.1 protein_id gnl|my_center|LOCUS_11240 61825 62409 gene locus_tag LOCUS_11250 61825 62409 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223076.1 protein_id gnl|my_center|LOCUS_11250 64447 62423 gene locus_tag LOCUS_11260 64447 62423 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_11260 64581 64655 gene locus_tag LOCUS_t00110 64581 64655 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 64834 65196 gene locus_tag LOCUS_11270 64834 65196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 65196 66932 gene locus_tag LOCUS_11280 65196 66932 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083769.1 protein_id gnl|my_center|LOCUS_11280 68234 66915 gene locus_tag LOCUS_11290 68234 66915 CDS product pyrimidine permease RutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729472.1 protein_id gnl|my_center|LOCUS_11290 68373 68921 gene locus_tag LOCUS_11300 68373 68921 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_11300 68993 71056 gene locus_tag LOCUS_11310 68993 71056 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088026.1 protein_id gnl|my_center|LOCUS_11310 71098 71904 gene locus_tag LOCUS_11320 gene cmrA 71098 71904 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084785.1 protein_id gnl|my_center|LOCUS_11320 73515 71923 gene locus_tag LOCUS_11330 73515 71923 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_11330 73560 74159 gene locus_tag LOCUS_11340 gene orn 73560 74159 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096508.1 protein_id gnl|my_center|LOCUS_11340 74262 74336 gene locus_tag LOCUS_t00120 74262 74336 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 74509 74853 gene locus_tag LOCUS_11350 74509 74853 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228199.1 protein_id gnl|my_center|LOCUS_11350 74857 76164 gene locus_tag LOCUS_11360 74857 76164 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223908.1 protein_id gnl|my_center|LOCUS_11360 76216 76401 gene locus_tag LOCUS_11370 76216 76401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 76510 78564 gene locus_tag LOCUS_11380 gene cerN 76510 78564 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_11380 79758 78568 gene locus_tag LOCUS_11390 gene ldtMt2 79758 78568 CDS product L,D-transpeptidase LdtMt2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412938.1 protein_id gnl|my_center|LOCUS_11390 80151 80078 gene locus_tag LOCUS_t00130 80151 80078 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 80503 80279 gene locus_tag LOCUS_11400 80503 80279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 80656 81132 gene locus_tag LOCUS_11410 gene bcp 80656 81132 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_11410 81143 81769 gene locus_tag LOCUS_11420 81143 81769 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857691.1 protein_id gnl|my_center|LOCUS_11420 82217 81783 gene locus_tag LOCUS_11430 82217 81783 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084743.1 protein_id gnl|my_center|LOCUS_11430 91498 82214 gene locus_tag LOCUS_11440 91498 82214 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730064.1 protein_id gnl|my_center|LOCUS_11440 92076 92501 gene locus_tag LOCUS_11450 92076 92501 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090019.1 protein_id gnl|my_center|LOCUS_11450 92498 93310 gene locus_tag LOCUS_11460 92498 93310 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112491.1 protein_id gnl|my_center|LOCUS_11460 97583 93345 gene locus_tag LOCUS_11470 97583 93345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 97983 97687 gene locus_tag LOCUS_11480 97983 97687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 100004 98232 gene locus_tag LOCUS_11490 100004 98232 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 protein_id gnl|my_center|LOCUS_11490 100241 102028 gene locus_tag LOCUS_11500 100241 102028 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080244.1 protein_id gnl|my_center|LOCUS_11500 102099 103376 gene locus_tag LOCUS_11510 102099 103376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 103373 104557 gene locus_tag LOCUS_11520 103373 104557 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_11520 106167 104581 gene locus_tag LOCUS_11530 106167 104581 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727985.1 protein_id gnl|my_center|LOCUS_11530 106902 106177 gene locus_tag LOCUS_11540 106902 106177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 107201 108808 gene locus_tag LOCUS_11550 107201 108808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 108876 109271 gene locus_tag LOCUS_11560 108876 109271 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731033.1 protein_id gnl|my_center|LOCUS_11560 109585 109869 gene locus_tag LOCUS_11570 109585 109869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 111259 109871 gene locus_tag LOCUS_11580 111259 109871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 112609 111263 gene locus_tag LOCUS_11590 112609 111263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 112748 112666 gene locus_tag LOCUS_t00140 112748 112666 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 112848 113285 gene locus_tag LOCUS_11600 112848 113285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730174.1 protein_id gnl|my_center|LOCUS_11600 113282 113632 gene locus_tag LOCUS_11610 113282 113632 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084697.1 protein_id gnl|my_center|LOCUS_11610 113682 114788 gene locus_tag LOCUS_11620 113682 114788 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_11620 114988 115605 gene locus_tag LOCUS_11630 114988 115605 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225273.1 protein_id gnl|my_center|LOCUS_11630 115602 116240 gene locus_tag LOCUS_11640 115602 116240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 116883 116269 gene locus_tag LOCUS_11650 gene rdgB 116883 116269 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066929.1 protein_id gnl|my_center|LOCUS_11650 117638 116883 gene locus_tag LOCUS_11660 gene rph 117638 116883 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730177.1 protein_id gnl|my_center|LOCUS_11660 118438 117674 gene locus_tag LOCUS_11670 118438 117674 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059917.1 protein_id gnl|my_center|LOCUS_11670 119260 118517 gene locus_tag LOCUS_11680 gene murI 119260 118517 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406919.1 protein_id gnl|my_center|LOCUS_11680 119955 119323 gene locus_tag LOCUS_11690 119955 119323 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084689.1 protein_id gnl|my_center|LOCUS_11690 120953 119982 gene locus_tag LOCUS_11700 120953 119982 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896302.1 protein_id gnl|my_center|LOCUS_11700 121243 120956 gene locus_tag LOCUS_11710 121243 120956 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059911.1 protein_id gnl|my_center|LOCUS_11710 121653 121246 gene locus_tag LOCUS_11720 121653 121246 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_11720 121952 122782 gene locus_tag LOCUS_11730 121952 122782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 122825 123232 gene locus_tag LOCUS_11740 122825 123232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 124360 123260 gene locus_tag LOCUS_11750 124360 123260 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730182.1 protein_id gnl|my_center|LOCUS_11750 124993 124418 gene locus_tag LOCUS_11760 124993 124418 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059906.1 protein_id gnl|my_center|LOCUS_11760 125374 125024 gene locus_tag LOCUS_11770 gene clpS 125374 125024 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406906.1 protein_id gnl|my_center|LOCUS_11770 125367 126671 gene locus_tag LOCUS_11780 125367 126671 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093052.1 protein_id gnl|my_center|LOCUS_11780 126722 127333 gene locus_tag LOCUS_11790 126722 127333 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_11790 127470 129548 gene locus_tag LOCUS_11800 127470 129548 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_11800 129713 131713 gene locus_tag LOCUS_11810 129713 131713 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110136.1 protein_id gnl|my_center|LOCUS_11810 131721 133943 gene locus_tag LOCUS_11820 gene glgB 131721 133943 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093048.1 protein_id gnl|my_center|LOCUS_11820 134920 133973 gene locus_tag LOCUS_11830 134920 133973 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_11830 136179 135016 gene locus_tag LOCUS_11840 136179 135016 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227636.1 protein_id gnl|my_center|LOCUS_11840 136667 136272 gene locus_tag LOCUS_11850 136667 136272 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223497.1 protein_id gnl|my_center|LOCUS_11850 137931 136729 gene locus_tag LOCUS_11860 137931 136729 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878184.1 protein_id gnl|my_center|LOCUS_11860 138017 138487 gene locus_tag LOCUS_11870 gene mce 138017 138487 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730193.1 protein_id gnl|my_center|LOCUS_11870 138640 139608 gene locus_tag LOCUS_11880 138640 139608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 140305 139622 gene locus_tag LOCUS_11890 gene nucS 140305 139622 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059861.1 protein_id gnl|my_center|LOCUS_11890 141785 140352 gene locus_tag LOCUS_11900 141785 140352 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206043.1 protein_id gnl|my_center|LOCUS_11900 141873 142751 gene locus_tag LOCUS_11910 141873 142751 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078060.1 protein_id gnl|my_center|LOCUS_11910 142927 142826 gene locus_tag LOCUS_r00010 142927 142826 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence08 335 715 gene locus_tag LOCUS_11920 335 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 736 1296 gene locus_tag LOCUS_11930 gene sigM 736 1296 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_11930 3282 1315 gene locus_tag LOCUS_11940 3282 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3820 3320 gene locus_tag LOCUS_11950 3820 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4093 4569 gene locus_tag LOCUS_11960 4093 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4884 5549 gene locus_tag LOCUS_11970 4884 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6037 5720 gene locus_tag LOCUS_11980 6037 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6173 6499 gene locus_tag LOCUS_11990 6173 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 6496 6708 gene locus_tag LOCUS_12000 6496 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 7750 6806 gene locus_tag LOCUS_12010 7750 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 7808 8116 gene locus_tag LOCUS_12020 7808 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 8537 8331 gene locus_tag LOCUS_12030 8537 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 9651 8665 gene locus_tag LOCUS_12040 9651 8665 CDS product DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390253.1 protein_id gnl|my_center|LOCUS_12040 10657 9956 gene locus_tag LOCUS_12050 10657 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 11300 10662 gene locus_tag LOCUS_12060 11300 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 12157 11405 gene locus_tag LOCUS_12070 12157 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 12546 12154 gene locus_tag LOCUS_12080 12546 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112674.1 protein_id gnl|my_center|LOCUS_12080 12695 13330 gene locus_tag LOCUS_12090 12695 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 13918 13358 gene locus_tag LOCUS_12100 13918 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 14429 14112 gene locus_tag LOCUS_12110 14429 14112 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_12110 14537 15175 gene locus_tag LOCUS_12120 14537 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 16131 15229 gene locus_tag LOCUS_12130 16131 15229 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079691.1 protein_id gnl|my_center|LOCUS_12130 16189 16986 gene locus_tag LOCUS_12140 16189 16986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729739.1 protein_id gnl|my_center|LOCUS_12140 17016 17327 gene locus_tag LOCUS_12150 17016 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 17878 17363 gene locus_tag LOCUS_12160 17878 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 18401 18057 gene locus_tag LOCUS_12170 18401 18057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 19306 18683 gene locus_tag LOCUS_12180 19306 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 19496 20797 gene locus_tag LOCUS_12190 19496 20797 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228237.1 protein_id gnl|my_center|LOCUS_12190 20892 21302 gene locus_tag LOCUS_12200 20892 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 21299 22300 gene locus_tag LOCUS_12210 21299 22300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 22345 22596 gene locus_tag LOCUS_12220 22345 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 23071 22616 gene locus_tag LOCUS_12230 23071 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 23821 23150 gene locus_tag LOCUS_12240 23821 23150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 24090 24827 gene locus_tag LOCUS_12250 24090 24827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727489.1 protein_id gnl|my_center|LOCUS_12250 25682 24828 gene locus_tag LOCUS_12260 25682 24828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_12260 26803 25679 gene locus_tag LOCUS_12270 26803 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12270 28101 26803 gene locus_tag LOCUS_12280 28101 26803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 29315 28098 gene locus_tag LOCUS_12290 29315 28098 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_12290 30424 29312 gene locus_tag LOCUS_12300 30424 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_12300 30672 31292 gene locus_tag LOCUS_12310 30672 31292 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_12310 31309 32019 gene locus_tag LOCUS_12320 31309 32019 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_12320 32016 32780 gene locus_tag LOCUS_12330 32016 32780 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_12330 34073 32907 gene locus_tag LOCUS_12340 34073 32907 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 protein_id gnl|my_center|LOCUS_12340 34794 34219 gene locus_tag LOCUS_12350 34794 34219 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_12350 35401 34976 gene locus_tag LOCUS_12360 35401 34976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 36706 35615 gene locus_tag LOCUS_12370 36706 35615 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112786.1 protein_id gnl|my_center|LOCUS_12370 37460 36699 gene locus_tag LOCUS_12380 37460 36699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 37747 38139 gene locus_tag LOCUS_12390 37747 38139 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_12390 38266 40611 gene locus_tag LOCUS_12400 38266 40611 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731616.1 protein_id gnl|my_center|LOCUS_12400 40556 42214 gene locus_tag LOCUS_12410 40556 42214 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112782.1 protein_id gnl|my_center|LOCUS_12410 42331 42738 gene locus_tag LOCUS_12420 42331 42738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 protein_id gnl|my_center|LOCUS_12420 43288 42746 gene locus_tag LOCUS_12430 43288 42746 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854745.1 protein_id gnl|my_center|LOCUS_12430 44799 43315 gene locus_tag LOCUS_12440 44799 43315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 44967 45248 gene locus_tag LOCUS_12450 gene rpsF 44967 45248 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_12450 45374 45889 gene locus_tag LOCUS_12460 45374 45889 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064618.1 protein_id gnl|my_center|LOCUS_12460 45973 46230 gene locus_tag LOCUS_12470 gene rpsR 45973 46230 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400540.1 protein_id gnl|my_center|LOCUS_12470 46250 46705 gene locus_tag LOCUS_12480 gene rplI 46250 46705 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079044.1 protein_id gnl|my_center|LOCUS_12480 47575 46961 gene locus_tag LOCUS_12490 47575 46961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 48320 50428 gene locus_tag LOCUS_12500 48320 50428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 50613 51626 gene locus_tag LOCUS_12510 50613 51626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 51772 53052 gene locus_tag LOCUS_12520 51772 53052 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_12520 53921 53049 gene locus_tag LOCUS_12530 53921 53049 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 protein_id gnl|my_center|LOCUS_12530 54604 54053 gene locus_tag LOCUS_12540 54604 54053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 54705 55748 gene locus_tag LOCUS_12550 54705 55748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 55939 57327 gene locus_tag LOCUS_12560 55939 57327 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877503.1 protein_id gnl|my_center|LOCUS_12560 57356 58552 gene locus_tag LOCUS_12570 57356 58552 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539126.1 protein_id gnl|my_center|LOCUS_12570 58549 60489 gene locus_tag LOCUS_12580 58549 60489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965650.1 protein_id gnl|my_center|LOCUS_12580 60476 61267 gene locus_tag LOCUS_12590 60476 61267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 61264 61986 gene locus_tag LOCUS_12600 61264 61986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_12600 62036 63229 gene locus_tag LOCUS_12610 62036 63229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 63533 63327 gene locus_tag LOCUS_12620 63533 63327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 65105 63711 gene locus_tag LOCUS_12630 65105 63711 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 protein_id gnl|my_center|LOCUS_12630 65407 65102 gene locus_tag LOCUS_12640 65407 65102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 66263 65517 gene locus_tag LOCUS_12650 66263 65517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 67185 66334 gene locus_tag LOCUS_12660 67185 66334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 67277 67984 gene locus_tag LOCUS_12670 67277 67984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 68071 68796 gene locus_tag LOCUS_12680 68071 68796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 68857 69618 gene locus_tag LOCUS_12690 68857 69618 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_12690 69620 71020 gene locus_tag LOCUS_12700 gene lpdA 69620 71020 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224051.1 protein_id gnl|my_center|LOCUS_12700 71038 71910 gene locus_tag LOCUS_12710 71038 71910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 73159 72383 gene locus_tag LOCUS_12720 73159 72383 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396047.1 protein_id gnl|my_center|LOCUS_12720 73319 75061 gene locus_tag LOCUS_12730 73319 75061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 75058 76071 gene locus_tag LOCUS_12740 75058 76071 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_12740 76934 76137 gene locus_tag LOCUS_12750 76934 76137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 77688 77023 gene locus_tag LOCUS_12760 77688 77023 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_12760 78335 77685 gene locus_tag LOCUS_12770 78335 77685 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_12770 79913 78354 gene locus_tag LOCUS_12780 79913 78354 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_12780 80179 81210 gene locus_tag LOCUS_12790 80179 81210 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_12790 81229 82284 gene locus_tag LOCUS_12800 81229 82284 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_12800 82287 83723 gene locus_tag LOCUS_12810 82287 83723 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_12810 83726 84118 gene locus_tag LOCUS_12820 83726 84118 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 protein_id gnl|my_center|LOCUS_12820 84115 85266 gene locus_tag LOCUS_12830 84115 85266 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 protein_id gnl|my_center|LOCUS_12830 85278 86540 gene locus_tag LOCUS_12840 85278 86540 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_12840 88205 87135 gene locus_tag LOCUS_12850 88205 87135 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462348.1 protein_id gnl|my_center|LOCUS_12850 90648 88216 gene locus_tag LOCUS_12860 gene ppdK 90648 88216 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_12860 91382 90756 gene locus_tag LOCUS_12870 91382 90756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_12870 91669 93138 gene locus_tag LOCUS_12880 91669 93138 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_12880 93169 93648 gene locus_tag LOCUS_12890 93169 93648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 94163 93645 gene locus_tag LOCUS_12900 94163 93645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 94262 95149 gene locus_tag LOCUS_12910 94262 95149 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_12910 95146 96123 gene locus_tag LOCUS_12920 95146 96123 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_12920 96131 97177 gene locus_tag LOCUS_12930 96131 97177 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_12930 98412 97621 gene locus_tag LOCUS_12940 98412 97621 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612341.1 protein_id gnl|my_center|LOCUS_12940 99512 98409 gene locus_tag LOCUS_12950 99512 98409 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_12950 100513 99509 gene locus_tag LOCUS_12960 100513 99509 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977372.1 protein_id gnl|my_center|LOCUS_12960 102267 100513 gene locus_tag LOCUS_12970 102267 100513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 102518 105907 gene locus_tag LOCUS_12980 102518 105907 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081500.1 protein_id gnl|my_center|LOCUS_12980 106726 105953 gene locus_tag LOCUS_12990 106726 105953 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919681.1 protein_id gnl|my_center|LOCUS_12990 106964 107713 gene locus_tag LOCUS_13000 106964 107713 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920654.1 protein_id gnl|my_center|LOCUS_13000 109175 107721 gene locus_tag LOCUS_13010 109175 107721 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412717.1 protein_id gnl|my_center|LOCUS_13010 110683 109172 gene locus_tag LOCUS_13020 110683 109172 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412713.1 protein_id gnl|my_center|LOCUS_13020 112980 110662 gene locus_tag LOCUS_13030 112980 110662 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407762.1 protein_id gnl|my_center|LOCUS_13030 113361 113158 gene locus_tag LOCUS_13040 113361 113158 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_13040 113581 117012 gene locus_tag LOCUS_13050 113581 117012 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727014.1 protein_id gnl|my_center|LOCUS_13050 117009 117992 gene locus_tag LOCUS_13060 117009 117992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_13060 119036 118263 gene locus_tag LOCUS_13070 119036 118263 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_13070 120516 119110 gene locus_tag LOCUS_13080 gene xylB 120516 119110 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_13080 121988 120513 gene locus_tag LOCUS_13090 121988 120513 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 protein_id gnl|my_center|LOCUS_13090 123049 121985 gene locus_tag LOCUS_13100 123049 121985 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_13100 123321 124241 gene locus_tag LOCUS_13110 123321 124241 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896980.1 protein_id gnl|my_center|LOCUS_13110 124238 125596 gene locus_tag LOCUS_13120 124238 125596 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896979.1 protein_id gnl|my_center|LOCUS_13120 125599 126552 gene locus_tag LOCUS_13130 125599 126552 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896978.1 protein_id gnl|my_center|LOCUS_13130 126552 127439 gene locus_tag LOCUS_13140 126552 127439 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 protein_id gnl|my_center|LOCUS_13140 127597 128703 gene locus_tag LOCUS_13150 gene ugpC 127597 128703 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730626.1 protein_id gnl|my_center|LOCUS_13150 128936 129718 gene locus_tag LOCUS_13160 128936 129718 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_13160 130802 129849 gene locus_tag LOCUS_13170 130802 129849 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_13170 130099 130012 gene locus_tag LOCUS_t00150 130099 130012 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 132254 130935 gene locus_tag LOCUS_13180 gene proP 132254 130935 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028291.1 protein_id gnl|my_center|LOCUS_13180 132372 134045 gene locus_tag LOCUS_13190 132372 134045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 134110 135315 gene locus_tag LOCUS_13200 134110 135315 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_13200 135324 136400 gene locus_tag LOCUS_13210 135324 136400 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_13210 137965 136466 gene locus_tag LOCUS_13220 137965 136466 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111414.1 protein_id gnl|my_center|LOCUS_13220 138201 138629 gene locus_tag LOCUS_13230 138201 138629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence09 616 540 gene locus_tag LOCUS_t00160 616 540 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 727 651 gene locus_tag LOCUS_t00170 727 651 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 847 774 gene locus_tag LOCUS_t00180 847 774 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1031 1106 gene locus_tag LOCUS_t00190 1031 1106 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1269 2108 gene locus_tag LOCUS_13240 1269 2108 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_13240 2891 4411 gene locus_tag LOCUS_13250 2891 4411 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_13250 4474 5505 gene locus_tag LOCUS_13260 gene gmd 4474 5505 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_13260 5502 6521 gene locus_tag LOCUS_13270 5502 6521 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407642.1 protein_id gnl|my_center|LOCUS_13270 6932 6489 gene locus_tag LOCUS_13280 6932 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6992 8299 gene locus_tag LOCUS_13290 6992 8299 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139561.1 protein_id gnl|my_center|LOCUS_13290 8296 8874 gene locus_tag LOCUS_13300 8296 8874 CDS product putative colanic acid biosynthesis acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118863.1 protein_id gnl|my_center|LOCUS_13300 8871 10004 gene locus_tag LOCUS_13310 8871 10004 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730916.1 protein_id gnl|my_center|LOCUS_13310 9991 10839 gene locus_tag LOCUS_13320 9991 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10823 12823 gene locus_tag LOCUS_13330 10823 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 12820 13476 gene locus_tag LOCUS_13340 12820 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 13473 14162 gene locus_tag LOCUS_13350 13473 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 14162 14884 gene locus_tag LOCUS_13360 14162 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 14881 16185 gene locus_tag LOCUS_13370 14881 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 16182 17045 gene locus_tag LOCUS_13380 16182 17045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 17403 17188 gene locus_tag LOCUS_13390 17403 17188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 18514 17774 gene locus_tag LOCUS_13400 18514 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21031 18950 gene locus_tag LOCUS_13410 21031 18950 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_13410 22607 21105 gene locus_tag LOCUS_13420 22607 21105 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_13420 24073 22730 gene locus_tag LOCUS_13430 24073 22730 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973131.1 protein_id gnl|my_center|LOCUS_13430 25332 24067 gene locus_tag LOCUS_13440 25332 24067 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222495.1 protein_id gnl|my_center|LOCUS_13440 26708 25329 gene locus_tag LOCUS_13450 26708 25329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 27709 26705 gene locus_tag LOCUS_13460 27709 26705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 28164 27706 gene locus_tag LOCUS_13470 28164 27706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 29270 28692 gene locus_tag LOCUS_13480 29270 28692 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257362.1 protein_id gnl|my_center|LOCUS_13480 30190 29267 gene locus_tag LOCUS_13490 30190 29267 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 protein_id gnl|my_center|LOCUS_13490 31666 30365 gene locus_tag LOCUS_13500 31666 30365 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730947.1 protein_id gnl|my_center|LOCUS_13500 33177 31666 gene locus_tag LOCUS_13510 33177 31666 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744721.1 protein_id gnl|my_center|LOCUS_13510 33880 34149 gene locus_tag LOCUS_13520 33880 34149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 36147 34159 gene locus_tag LOCUS_13530 36147 34159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 38108 36144 gene locus_tag LOCUS_13540 38108 36144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 39546 38095 gene locus_tag LOCUS_13550 39546 38095 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543833.1 protein_id gnl|my_center|LOCUS_13550 41096 39543 gene locus_tag LOCUS_13560 41096 39543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 42469 41567 gene locus_tag LOCUS_13570 42469 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 42500 43423 gene locus_tag LOCUS_13580 42500 43423 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_13580 44345 43446 gene locus_tag LOCUS_13590 44345 43446 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878646.1 protein_id gnl|my_center|LOCUS_13590 44900 44352 gene locus_tag LOCUS_13600 44900 44352 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897849.1 protein_id gnl|my_center|LOCUS_13600 45654 44893 gene locus_tag LOCUS_13610 45654 44893 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222045.1 protein_id gnl|my_center|LOCUS_13610 46253 45738 gene locus_tag LOCUS_13620 46253 45738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 46324 47148 gene locus_tag LOCUS_13630 46324 47148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_13630 47145 48446 gene locus_tag LOCUS_13640 47145 48446 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_13640 49673 48525 gene locus_tag LOCUS_13650 49673 48525 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727354.1 protein_id gnl|my_center|LOCUS_13650 50372 49677 gene locus_tag LOCUS_13660 50372 49677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 50643 51230 gene locus_tag LOCUS_13670 50643 51230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 51452 51243 gene locus_tag LOCUS_13680 51452 51243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 51758 52639 gene locus_tag LOCUS_13690 51758 52639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 52739 53632 gene locus_tag LOCUS_13700 52739 53632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 53694 54065 gene locus_tag LOCUS_13710 53694 54065 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971972.1 protein_id gnl|my_center|LOCUS_13710 54141 55355 gene locus_tag LOCUS_13720 54141 55355 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 protein_id gnl|my_center|LOCUS_13720 56371 55286 gene locus_tag LOCUS_13730 56371 55286 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080285.1 protein_id gnl|my_center|LOCUS_13730 56485 57939 gene locus_tag LOCUS_13740 56485 57939 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228616.1 protein_id gnl|my_center|LOCUS_13740 58008 58805 gene locus_tag LOCUS_13750 58008 58805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 58849 59685 gene locus_tag LOCUS_13760 58849 59685 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970694.1 protein_id gnl|my_center|LOCUS_13760 59717 61231 gene locus_tag LOCUS_13770 59717 61231 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_13770 61479 62480 gene locus_tag LOCUS_13780 61479 62480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 63938 62484 gene locus_tag LOCUS_13790 63938 62484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466576.1 protein_id gnl|my_center|LOCUS_13790 64050 64760 gene locus_tag LOCUS_13800 64050 64760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 68774 64818 gene locus_tag LOCUS_13810 68774 64818 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077661.1 protein_id gnl|my_center|LOCUS_13810 72326 68838 gene locus_tag LOCUS_13820 72326 68838 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727628.1 protein_id gnl|my_center|LOCUS_13820 73695 72688 gene locus_tag LOCUS_13830 73695 72688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 74342 73695 gene locus_tag LOCUS_13840 74342 73695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 75676 74435 gene locus_tag LOCUS_13850 75676 74435 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 protein_id gnl|my_center|LOCUS_13850 76989 75673 gene locus_tag LOCUS_13860 76989 75673 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222538.1 protein_id gnl|my_center|LOCUS_13860 78365 77004 gene locus_tag LOCUS_13870 78365 77004 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222537.1 protein_id gnl|my_center|LOCUS_13870 79486 78365 gene locus_tag LOCUS_13880 79486 78365 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229369.1 protein_id gnl|my_center|LOCUS_13880 80574 79492 gene locus_tag LOCUS_13890 80574 79492 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223672.1 protein_id gnl|my_center|LOCUS_13890 81941 80571 gene locus_tag LOCUS_13900 81941 80571 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224301.1 protein_id gnl|my_center|LOCUS_13900 82824 81943 gene locus_tag LOCUS_13910 82824 81943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222533.1 protein_id gnl|my_center|LOCUS_13910 83633 82827 gene locus_tag LOCUS_13920 83633 82827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223675.1 protein_id gnl|my_center|LOCUS_13920 84862 83636 gene locus_tag LOCUS_13930 84862 83636 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055457.1 protein_id gnl|my_center|LOCUS_13930 85706 85317 gene locus_tag LOCUS_13940 gene rplL 85706 85317 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_13940 86323 85793 gene locus_tag LOCUS_13950 gene rplJ 86323 85793 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055400.1 protein_id gnl|my_center|LOCUS_13950 86603 87790 gene locus_tag LOCUS_13960 86603 87790 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727158.1 protein_id gnl|my_center|LOCUS_13960 88005 90032 gene locus_tag LOCUS_13970 88005 90032 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080127.1 protein_id gnl|my_center|LOCUS_13970 90128 91246 gene locus_tag LOCUS_13980 gene urtA 90128 91246 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_13980 92719 91187 gene locus_tag LOCUS_13990 92719 91187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 93028 95079 gene locus_tag LOCUS_14000 93028 95079 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533168.1 protein_id gnl|my_center|LOCUS_14000 95117 97129 gene locus_tag LOCUS_14010 95117 97129 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_14010 97250 98863 gene locus_tag LOCUS_14020 97250 98863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531509.1 protein_id gnl|my_center|LOCUS_14020 99499 98981 gene locus_tag LOCUS_14030 99499 98981 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_14030 99581 100522 gene locus_tag LOCUS_14040 99581 100522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 101349 100519 gene locus_tag LOCUS_14050 101349 100519 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726753.1 protein_id gnl|my_center|LOCUS_14050 102061 101360 gene locus_tag LOCUS_14060 102061 101360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 102408 102136 gene locus_tag LOCUS_14070 102408 102136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 102630 103514 gene locus_tag LOCUS_14080 102630 103514 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_14080 104481 103528 gene locus_tag LOCUS_14090 104481 103528 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_14090 104633 105907 gene locus_tag LOCUS_14100 104633 105907 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_14100 105982 106734 gene locus_tag LOCUS_14110 105982 106734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_14110 106746 107825 gene locus_tag LOCUS_14120 106746 107825 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092172.1 protein_id gnl|my_center|LOCUS_14120 108052 109740 gene locus_tag LOCUS_14130 108052 109740 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_14130 110529 109813 gene locus_tag LOCUS_14140 gene rplA 110529 109813 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892735.1 protein_id gnl|my_center|LOCUS_14140 111049 110615 gene locus_tag LOCUS_14150 gene rplK 111049 110615 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 protein_id gnl|my_center|LOCUS_14150 112003 111143 gene locus_tag LOCUS_14160 gene nusG 112003 111143 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 protein_id gnl|my_center|LOCUS_14160 112547 112074 gene locus_tag LOCUS_14170 112547 112074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 112659 112585 gene locus_tag LOCUS_t00200 112659 112585 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 114073 112976 gene locus_tag LOCUS_14180 114073 112976 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731510.1 protein_id gnl|my_center|LOCUS_14180 114338 114171 gene locus_tag LOCUS_14190 gene rpmG 114338 114171 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898538.1 protein_id gnl|my_center|LOCUS_14190 114505 114431 gene locus_tag LOCUS_t00210 114505 114431 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 114599 114526 gene locus_tag LOCUS_t00220 114599 114526 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 114797 114716 gene locus_tag LOCUS_t00230 114797 114716 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 114925 115416 gene locus_tag LOCUS_14200 114925 115416 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077736.1 protein_id gnl|my_center|LOCUS_14200 115576 116442 gene locus_tag LOCUS_14210 gene htpX 115576 116442 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094627.1 protein_id gnl|my_center|LOCUS_14210 117515 116499 gene locus_tag LOCUS_14220 117515 116499 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094629.1 protein_id gnl|my_center|LOCUS_14220 117633 118892 gene locus_tag LOCUS_14230 117633 118892 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112101.1 protein_id gnl|my_center|LOCUS_14230 119027 119986 gene locus_tag LOCUS_14240 119027 119986 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_14240 120666 119983 gene locus_tag LOCUS_14250 120666 119983 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061581.1 protein_id gnl|my_center|LOCUS_14250 121944 120790 gene locus_tag LOCUS_14260 121944 120790 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727419.1 protein_id gnl|my_center|LOCUS_14260 122054 122674 gene locus_tag LOCUS_14270 122054 122674 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887713.1 protein_id gnl|my_center|LOCUS_14270 123242 122655 gene locus_tag LOCUS_14280 123242 122655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 125000 123297 gene locus_tag LOCUS_14290 gene menD 125000 123297 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402927.1 protein_id gnl|my_center|LOCUS_14290 125089 125706 gene locus_tag LOCUS_14300 125089 125706 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_14300 125825 126928 gene locus_tag LOCUS_14310 125825 126928 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 protein_id gnl|my_center|LOCUS_14310 127064 128308 gene locus_tag LOCUS_14320 127064 128308 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 protein_id gnl|my_center|LOCUS_14320 128617 129063 gene locus_tag LOCUS_14330 128617 129063 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730654.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence10 1137 382 gene locus_tag LOCUS_14340 1137 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2189 1236 gene locus_tag LOCUS_14350 2189 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3202 2186 gene locus_tag LOCUS_14360 3202 2186 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071126.1 protein_id gnl|my_center|LOCUS_14360 4260 3199 gene locus_tag LOCUS_14370 4260 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5252 4260 gene locus_tag LOCUS_14380 5252 4260 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077892.1 protein_id gnl|my_center|LOCUS_14380 6247 5240 gene locus_tag LOCUS_14390 6247 5240 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085985.1 protein_id gnl|my_center|LOCUS_14390 7331 6249 gene locus_tag LOCUS_14400 7331 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 8196 7333 gene locus_tag LOCUS_14410 8196 7333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085987.1 protein_id gnl|my_center|LOCUS_14410 8986 8201 gene locus_tag LOCUS_14420 8986 8201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077888.1 protein_id gnl|my_center|LOCUS_14420 10826 9435 gene locus_tag LOCUS_14430 10826 9435 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400974.1 protein_id gnl|my_center|LOCUS_14430 10993 11790 gene locus_tag LOCUS_14440 10993 11790 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_14440 13081 11804 gene locus_tag LOCUS_14450 13081 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 13973 13149 gene locus_tag LOCUS_14460 13973 13149 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_14460 16165 13970 gene locus_tag LOCUS_14470 16165 13970 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_14470 17436 16222 gene locus_tag LOCUS_14480 17436 16222 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 protein_id gnl|my_center|LOCUS_14480 18270 17542 gene locus_tag LOCUS_14490 18270 17542 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925888.1 protein_id gnl|my_center|LOCUS_14490 18456 19778 gene locus_tag LOCUS_14500 18456 19778 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731551.1 protein_id gnl|my_center|LOCUS_14500 20298 20936 gene locus_tag LOCUS_14510 20298 20936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14510 22146 21007 gene locus_tag LOCUS_14520 22146 21007 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225699.1 protein_id gnl|my_center|LOCUS_14520 23344 22169 gene locus_tag LOCUS_14530 23344 22169 CDS product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 protein_id gnl|my_center|LOCUS_14530 23451 25472 gene locus_tag LOCUS_14540 23451 25472 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_14540 25522 27366 gene locus_tag LOCUS_14550 25522 27366 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110404.1 protein_id gnl|my_center|LOCUS_14550 27399 27728 gene locus_tag LOCUS_14560 27399 27728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 27746 28021 gene locus_tag LOCUS_14570 27746 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 28371 28114 gene locus_tag LOCUS_14580 28371 28114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 29614 28547 gene locus_tag LOCUS_14590 29614 28547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 30548 29712 gene locus_tag LOCUS_14600 30548 29712 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_14600 31354 30545 gene locus_tag LOCUS_14610 31354 30545 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_14610 31503 32294 gene locus_tag LOCUS_14620 31503 32294 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731410.1 protein_id gnl|my_center|LOCUS_14620 32370 33527 gene locus_tag LOCUS_14630 32370 33527 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_14630 34247 33612 gene locus_tag LOCUS_14640 34247 33612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086621.1 protein_id gnl|my_center|LOCUS_14640 35934 34414 gene locus_tag LOCUS_14650 gene fadD13 35934 34414 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_14650 37245 36061 gene locus_tag LOCUS_14660 37245 36061 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_14660 38661 37432 gene locus_tag LOCUS_14670 38661 37432 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_14670 38897 38664 gene locus_tag LOCUS_14680 38897 38664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 39979 38900 gene locus_tag LOCUS_14690 39979 38900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 41582 40086 gene locus_tag LOCUS_14700 41582 40086 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328003.1 protein_id gnl|my_center|LOCUS_14700 42353 41796 gene locus_tag LOCUS_14710 42353 41796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 42298 45243 gene locus_tag LOCUS_14720 42298 45243 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 protein_id gnl|my_center|LOCUS_14720 45240 46055 gene locus_tag LOCUS_14730 45240 46055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 46052 47668 gene locus_tag LOCUS_14740 46052 47668 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092260.1 protein_id gnl|my_center|LOCUS_14740 47967 48052 gene locus_tag LOCUS_t00240 47967 48052 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 48519 48782 gene locus_tag LOCUS_14750 48519 48782 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892270.1 protein_id gnl|my_center|LOCUS_14750 48779 49111 gene locus_tag LOCUS_14760 gene mnhG 48779 49111 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_14760 49708 49094 gene locus_tag LOCUS_14770 49708 49094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 49805 50194 gene locus_tag LOCUS_14780 49805 50194 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 protein_id gnl|my_center|LOCUS_14780 51359 50232 gene locus_tag LOCUS_14790 51359 50232 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900145.1 protein_id gnl|my_center|LOCUS_14790 52071 51391 gene locus_tag LOCUS_14800 52071 51391 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085840.1 protein_id gnl|my_center|LOCUS_14800 52461 52189 gene locus_tag LOCUS_14810 52461 52189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 52454 52726 gene locus_tag LOCUS_14820 52454 52726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 53090 52719 gene locus_tag LOCUS_14830 53090 52719 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062316.1 protein_id gnl|my_center|LOCUS_14830 53395 54201 gene locus_tag LOCUS_14840 53395 54201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 54222 54824 gene locus_tag LOCUS_14850 54222 54824 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727226.1 protein_id gnl|my_center|LOCUS_14850 54850 55833 gene locus_tag LOCUS_14860 54850 55833 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892260.1 protein_id gnl|my_center|LOCUS_14860 55830 56618 gene locus_tag LOCUS_14870 55830 56618 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078040.1 protein_id gnl|my_center|LOCUS_14870 57383 56637 gene locus_tag LOCUS_14880 57383 56637 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110745.1 protein_id gnl|my_center|LOCUS_14880 59138 57489 gene locus_tag LOCUS_14890 gene mbtM 59138 57489 CDS product long-chain-fatty acid--ACP ligase MbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406950.1 protein_id gnl|my_center|LOCUS_14890 59410 63240 gene locus_tag LOCUS_14900 59410 63240 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110650.1 protein_id gnl|my_center|LOCUS_14900 63299 63907 gene locus_tag LOCUS_14910 63299 63907 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976016.1 protein_id gnl|my_center|LOCUS_14910 63912 65729 gene locus_tag LOCUS_14920 gene desD 63912 65729 CDS product desferrioxamine E synthetase DesD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028585.1 protein_id gnl|my_center|LOCUS_14920 65726 68173 gene locus_tag LOCUS_14930 65726 68173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 68161 69687 gene locus_tag LOCUS_14940 68161 69687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 69738 71282 gene locus_tag LOCUS_14950 69738 71282 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_14950 71279 72598 gene locus_tag LOCUS_14960 71279 72598 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224562.1 protein_id gnl|my_center|LOCUS_14960 73742 72768 gene locus_tag LOCUS_14970 73742 72768 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_14970 74643 73807 gene locus_tag LOCUS_14980 74643 73807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 76058 74751 gene locus_tag LOCUS_14990 76058 74751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 77280 76099 gene locus_tag LOCUS_15000 gene mbtN 77280 76099 CDS product mycobactin biosynthesis acyl-ACP dehydrogenase MbtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104518.1 protein_id gnl|my_center|LOCUS_15000 77432 77298 gene locus_tag LOCUS_15010 77432 77298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 78933 77593 gene locus_tag LOCUS_15020 gene mbtI 78933 77593 CDS product mycobactin biosynthesis salicylate synthase MbtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729893.1 protein_id gnl|my_center|LOCUS_15020 79091 80752 gene locus_tag LOCUS_15030 79091 80752 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104139.1 protein_id gnl|my_center|LOCUS_15030 81480 81133 gene locus_tag LOCUS_15040 81480 81133 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223228.1 protein_id gnl|my_center|LOCUS_15040 81801 83489 gene locus_tag LOCUS_15050 gene thiC 81801 83489 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078051.1 protein_id gnl|my_center|LOCUS_15050 83579 84430 gene locus_tag LOCUS_15060 gene thiD 83579 84430 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727221.1 protein_id gnl|my_center|LOCUS_15060 86107 84452 gene locus_tag LOCUS_15070 86107 84452 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947105.1 protein_id gnl|my_center|LOCUS_15070 88335 86104 gene locus_tag LOCUS_15080 88335 86104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 protein_id gnl|my_center|LOCUS_15080 89300 88332 gene locus_tag LOCUS_15090 89300 88332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 protein_id gnl|my_center|LOCUS_15090 90342 89359 gene locus_tag LOCUS_15100 90342 89359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 protein_id gnl|my_center|LOCUS_15100 90747 90358 gene locus_tag LOCUS_15110 90747 90358 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897694.1 protein_id gnl|my_center|LOCUS_15110 90936 91997 gene locus_tag LOCUS_15120 90936 91997 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088246.1 protein_id gnl|my_center|LOCUS_15120 92952 91978 gene locus_tag LOCUS_15130 gene egtD 92952 91978 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_15130 94286 92949 gene locus_tag LOCUS_15140 gene egtB 94286 92949 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_15140 94461 95213 gene locus_tag LOCUS_15150 94461 95213 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894179.1 protein_id gnl|my_center|LOCUS_15150 95850 95353 gene locus_tag LOCUS_15160 95850 95353 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_15160 96003 96563 gene locus_tag LOCUS_15170 96003 96563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 96993 96568 gene locus_tag LOCUS_15180 96993 96568 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_15180 97215 98582 gene locus_tag LOCUS_15190 97215 98582 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086878.1 protein_id gnl|my_center|LOCUS_15190 98591 99868 gene locus_tag LOCUS_15200 98591 99868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419582.1 protein_id gnl|my_center|LOCUS_15200 100827 99973 gene locus_tag LOCUS_15210 100827 99973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 100919 101620 gene locus_tag LOCUS_15220 100919 101620 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113115.1 protein_id gnl|my_center|LOCUS_15220 101628 101978 gene locus_tag LOCUS_15230 101628 101978 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419590.1 protein_id gnl|my_center|LOCUS_15230 102727 101975 gene locus_tag LOCUS_15240 102727 101975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 102832 103374 gene locus_tag LOCUS_15250 102832 103374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 103729 104667 gene locus_tag LOCUS_15260 103729 104667 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_15260 104677 105471 gene locus_tag LOCUS_15270 104677 105471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_15270 106158 105541 gene locus_tag LOCUS_15280 106158 105541 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_15280 107073 106174 gene locus_tag LOCUS_15290 gene rfbA 107073 106174 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062166.1 protein_id gnl|my_center|LOCUS_15290 107182 108186 gene locus_tag LOCUS_15300 gene rfbB 107182 108186 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 protein_id gnl|my_center|LOCUS_15300 108234 109253 gene locus_tag LOCUS_15310 gene galE 108234 109253 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 protein_id gnl|my_center|LOCUS_15310 110106 109270 gene locus_tag LOCUS_15320 110106 109270 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223525.1 protein_id gnl|my_center|LOCUS_15320 110253 110471 gene locus_tag LOCUS_15330 110253 110471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence11 308 1417 gene locus_tag LOCUS_15340 308 1417 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112910.1 protein_id gnl|my_center|LOCUS_15340 1432 1749 gene locus_tag LOCUS_15350 1432 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112908.1 protein_id gnl|my_center|LOCUS_15350 1746 2150 gene locus_tag LOCUS_15360 1746 2150 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112911.1 protein_id gnl|my_center|LOCUS_15360 2202 3560 gene locus_tag LOCUS_15370 2202 3560 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194222.1 protein_id gnl|my_center|LOCUS_15370 3831 3658 gene locus_tag LOCUS_15380 3831 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4181 3828 gene locus_tag LOCUS_15390 4181 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4235 4636 gene locus_tag LOCUS_15400 4235 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6976 4775 gene locus_tag LOCUS_15410 6976 4775 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229635.1 protein_id gnl|my_center|LOCUS_15410 8299 7088 gene locus_tag LOCUS_15420 8299 7088 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229636.1 protein_id gnl|my_center|LOCUS_15420 8378 9601 gene locus_tag LOCUS_15430 8378 9601 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229637.1 protein_id gnl|my_center|LOCUS_15430 9757 10908 gene locus_tag LOCUS_15440 9757 10908 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_15440 10963 11589 gene locus_tag LOCUS_15450 gene kstR2 10963 11589 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_15450 12382 11597 gene locus_tag LOCUS_15460 12382 11597 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_15460 14351 12408 gene locus_tag LOCUS_15470 14351 12408 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_15470 15382 14348 gene locus_tag LOCUS_15480 15382 14348 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567469.1 protein_id gnl|my_center|LOCUS_15480 16137 15373 gene locus_tag LOCUS_15490 16137 15373 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_15490 17871 16156 gene locus_tag LOCUS_15500 17871 16156 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030534.1 protein_id gnl|my_center|LOCUS_15500 19076 17868 gene locus_tag LOCUS_15510 19076 17868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030533.1 protein_id gnl|my_center|LOCUS_15510 19855 19073 gene locus_tag LOCUS_15520 19855 19073 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 protein_id gnl|my_center|LOCUS_15520 20892 19852 gene locus_tag LOCUS_15530 20892 19852 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567469.1 protein_id gnl|my_center|LOCUS_15530 21642 20896 gene locus_tag LOCUS_15540 21642 20896 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228255.1 protein_id gnl|my_center|LOCUS_15540 22184 21813 gene locus_tag LOCUS_15550 22184 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 22564 22181 gene locus_tag LOCUS_15560 22564 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 22680 23468 gene locus_tag LOCUS_15570 22680 23468 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_15570 23515 23907 gene locus_tag LOCUS_15580 23515 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 23904 25052 gene locus_tag LOCUS_15590 23904 25052 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728242.1 protein_id gnl|my_center|LOCUS_15590 25080 26282 gene locus_tag LOCUS_15600 25080 26282 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225726.1 protein_id gnl|my_center|LOCUS_15600 26279 27253 gene locus_tag LOCUS_15610 26279 27253 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228932.1 protein_id gnl|my_center|LOCUS_15610 27346 28548 gene locus_tag LOCUS_15620 27346 28548 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_15620 28545 29297 gene locus_tag LOCUS_15630 28545 29297 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228934.1 protein_id gnl|my_center|LOCUS_15630 29308 30090 gene locus_tag LOCUS_15640 29308 30090 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066682.1 protein_id gnl|my_center|LOCUS_15640 30164 31657 gene locus_tag LOCUS_15650 30164 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 31677 32012 gene locus_tag LOCUS_15660 31677 32012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 32009 33076 gene locus_tag LOCUS_15670 32009 33076 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_15670 33129 34166 gene locus_tag LOCUS_15680 33129 34166 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_15680 34169 35218 gene locus_tag LOCUS_15690 34169 35218 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_15690 36584 35262 gene locus_tag LOCUS_15700 36584 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 36701 38107 gene locus_tag LOCUS_15710 36701 38107 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114663985.1 protein_id gnl|my_center|LOCUS_15710 38173 39096 gene locus_tag LOCUS_15720 38173 39096 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082701.1 protein_id gnl|my_center|LOCUS_15720 40464 39160 gene locus_tag LOCUS_15730 40464 39160 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_15730 40832 40464 gene locus_tag LOCUS_15740 40832 40464 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230611.1 protein_id gnl|my_center|LOCUS_15740 41543 40839 gene locus_tag LOCUS_15750 41543 40839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 41762 42235 gene locus_tag LOCUS_15760 41762 42235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 42857 42681 gene locus_tag LOCUS_15770 42857 42681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 44108 43062 gene locus_tag LOCUS_15780 44108 43062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 45139 44105 gene locus_tag LOCUS_15790 45139 44105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 45801 45136 gene locus_tag LOCUS_15800 45801 45136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 47297 45885 gene locus_tag LOCUS_15810 47297 45885 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_15810 49344 47380 gene locus_tag LOCUS_15820 49344 47380 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878409.1 protein_id gnl|my_center|LOCUS_15820 50113 49346 gene locus_tag LOCUS_15830 50113 49346 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897054.1 protein_id gnl|my_center|LOCUS_15830 50887 51864 gene locus_tag LOCUS_15840 50887 51864 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763035.1 protein_id gnl|my_center|LOCUS_15840 51963 53780 gene locus_tag LOCUS_15850 51963 53780 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031470.1 protein_id gnl|my_center|LOCUS_15850 53893 54189 gene locus_tag LOCUS_15860 53893 54189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 55082 54282 gene locus_tag LOCUS_15870 55082 54282 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_15870 55993 55079 gene locus_tag LOCUS_15880 55993 55079 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 protein_id gnl|my_center|LOCUS_15880 56089 56640 gene locus_tag LOCUS_15890 56089 56640 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878038.1 protein_id gnl|my_center|LOCUS_15890 57754 56666 gene locus_tag LOCUS_15900 57754 56666 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728088.1 protein_id gnl|my_center|LOCUS_15900 58572 57751 gene locus_tag LOCUS_15910 58572 57751 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409329.1 protein_id gnl|my_center|LOCUS_15910 59327 58569 gene locus_tag LOCUS_15920 gene modA 59327 58569 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_15920 59725 59324 gene locus_tag LOCUS_15930 59725 59324 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_15930 60007 61041 gene locus_tag LOCUS_15940 60007 61041 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_15940 61041 61886 gene locus_tag LOCUS_15950 61041 61886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_15950 63287 61923 gene locus_tag LOCUS_15960 63287 61923 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876912.1 protein_id gnl|my_center|LOCUS_15960 63853 63521 gene locus_tag LOCUS_15970 63853 63521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 63765 64841 gene locus_tag LOCUS_15980 63765 64841 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_15980 65289 64873 gene locus_tag LOCUS_15990 65289 64873 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095485.1 protein_id gnl|my_center|LOCUS_15990 65375 66085 gene locus_tag LOCUS_16000 65375 66085 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729554.1 protein_id gnl|my_center|LOCUS_16000 67014 66268 gene locus_tag LOCUS_16010 gene fabG 67014 66268 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_16010 68093 67077 gene locus_tag LOCUS_16020 68093 67077 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731214.1 protein_id gnl|my_center|LOCUS_16020 69322 68090 gene locus_tag LOCUS_16030 69322 68090 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_16030 70100 69453 gene locus_tag LOCUS_16040 70100 69453 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031179.1 protein_id gnl|my_center|LOCUS_16040 70830 70129 gene locus_tag LOCUS_16050 70830 70129 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899886.1 protein_id gnl|my_center|LOCUS_16050 70917 71870 gene locus_tag LOCUS_16060 70917 71870 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104249.1 protein_id gnl|my_center|LOCUS_16060 73206 71926 gene locus_tag LOCUS_16070 73206 71926 CDS product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728393.1 protein_id gnl|my_center|LOCUS_16070 73540 73265 gene locus_tag LOCUS_16080 73540 73265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 74074 76098 gene locus_tag LOCUS_16090 74074 76098 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228529.1 protein_id gnl|my_center|LOCUS_16090 76394 76173 gene locus_tag LOCUS_16100 76394 76173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 76315 77457 gene locus_tag LOCUS_16110 76315 77457 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_16110 77454 78170 gene locus_tag LOCUS_16120 77454 78170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16120 78167 79048 gene locus_tag LOCUS_16130 78167 79048 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225926.1 protein_id gnl|my_center|LOCUS_16130 79035 80168 gene locus_tag LOCUS_16140 79035 80168 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225927.1 protein_id gnl|my_center|LOCUS_16140 80165 81661 gene locus_tag LOCUS_16150 gene crtI 80165 81661 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_16150 82173 81688 gene locus_tag LOCUS_16160 82173 81688 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892444.1 protein_id gnl|my_center|LOCUS_16160 82398 82219 gene locus_tag LOCUS_16170 82398 82219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 84095 82488 gene locus_tag LOCUS_16180 gene crtI 84095 82488 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_16180 85090 84149 gene locus_tag LOCUS_16190 85090 84149 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930127.1 protein_id gnl|my_center|LOCUS_16190 85704 85135 gene locus_tag LOCUS_16200 gene idi 85704 85135 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 protein_id gnl|my_center|LOCUS_16200 86668 85850 gene locus_tag LOCUS_16210 86668 85850 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191313375.1 protein_id gnl|my_center|LOCUS_16210 87518 86652 gene locus_tag LOCUS_16220 87518 86652 CDS product YhjD/YihY/BrkB family envelope integrity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191095.1 protein_id gnl|my_center|LOCUS_16220 88271 87636 gene locus_tag LOCUS_16230 gene lysE 88271 87636 CDS product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 protein_id gnl|my_center|LOCUS_16230 88963 88340 gene locus_tag LOCUS_16240 88963 88340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 89174 90130 gene locus_tag LOCUS_16250 89174 90130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 protein_id gnl|my_center|LOCUS_16250 90189 91094 gene locus_tag LOCUS_16260 90189 91094 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_16260 92469 91138 gene locus_tag LOCUS_16270 gene tet(V) 92469 91138 CDS product tetracycline efflux MFS transporter Tet(V) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896589.1 protein_id gnl|my_center|LOCUS_16270 93528 92542 gene locus_tag LOCUS_16280 93528 92542 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066336.1 protein_id gnl|my_center|LOCUS_16280 93611 95989 gene locus_tag LOCUS_16290 93611 95989 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898655.1 protein_id gnl|my_center|LOCUS_16290 96036 96800 gene locus_tag LOCUS_16300 96036 96800 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_16300 97513 96752 gene locus_tag LOCUS_16310 97513 96752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 99231 97510 gene locus_tag LOCUS_16320 99231 97510 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_16320 99739 99254 gene locus_tag LOCUS_16330 99739 99254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 100086 100838 gene locus_tag LOCUS_16340 100086 100838 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668774.1 protein_id gnl|my_center|LOCUS_16340 103106 100854 gene locus_tag LOCUS_16350 103106 100854 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057131.1 protein_id gnl|my_center|LOCUS_16350 104281 103283 gene locus_tag LOCUS_16360 104281 103283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 104865 104401 gene locus_tag LOCUS_16370 104865 104401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 <106423 105018 gene locus_tag LOCUS_16380 <106423 105018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929823.1:HNH endonuclease signature motif containing protein >Feature sequence12 623 1096 gene locus_tag LOCUS_16390 623 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1326 1772 gene locus_tag LOCUS_16400 1326 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1832 2755 gene locus_tag LOCUS_16410 1832 2755 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_16410 2757 3923 gene locus_tag LOCUS_16420 2757 3923 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_16420 3920 4897 gene locus_tag LOCUS_16430 3920 4897 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 protein_id gnl|my_center|LOCUS_16430 4894 6000 gene locus_tag LOCUS_16440 4894 6000 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742091.1 protein_id gnl|my_center|LOCUS_16440 6636 6007 gene locus_tag LOCUS_16450 6636 6007 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225289.1 protein_id gnl|my_center|LOCUS_16450 7817 6675 gene locus_tag LOCUS_16460 7817 6675 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 protein_id gnl|my_center|LOCUS_16460 8601 7810 gene locus_tag LOCUS_16470 8601 7810 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_16470 9899 8598 gene locus_tag LOCUS_16480 9899 8598 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085850.1 protein_id gnl|my_center|LOCUS_16480 10489 9872 gene locus_tag LOCUS_16490 gene hsaB 10489 9872 CDS product flavin-dependent monooxygenase reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419374.1 protein_id gnl|my_center|LOCUS_16490 11402 10491 gene locus_tag LOCUS_16500 11402 10491 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 protein_id gnl|my_center|LOCUS_16500 12800 11616 gene locus_tag LOCUS_16510 gene hsaA 12800 11616 CDS product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419383.1 protein_id gnl|my_center|LOCUS_16510 13027 14265 gene locus_tag LOCUS_16520 13027 14265 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078023.1 protein_id gnl|my_center|LOCUS_16520 14292 14675 gene locus_tag LOCUS_16530 14292 14675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14811 15338 gene locus_tag LOCUS_16540 14811 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 15906 15313 gene locus_tag LOCUS_16550 15906 15313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 16062 16856 gene locus_tag LOCUS_16560 16062 16856 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 protein_id gnl|my_center|LOCUS_16560 18359 17289 gene locus_tag LOCUS_16570 18359 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 19679 18540 gene locus_tag LOCUS_16580 19679 18540 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_16580 19782 20699 gene locus_tag LOCUS_16590 19782 20699 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727027.1 protein_id gnl|my_center|LOCUS_16590 21213 20722 gene locus_tag LOCUS_16600 21213 20722 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728669.1 protein_id gnl|my_center|LOCUS_16600 22100 21210 gene locus_tag LOCUS_16610 22100 21210 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 protein_id gnl|my_center|LOCUS_16610 22954 22100 gene locus_tag LOCUS_16620 22954 22100 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728664.1 protein_id gnl|my_center|LOCUS_16620 23780 22998 gene locus_tag LOCUS_16630 23780 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 25323 23857 gene locus_tag LOCUS_16640 25323 23857 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_16640 26579 25485 gene locus_tag LOCUS_16650 gene dmpG 26579 25485 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419250.1 protein_id gnl|my_center|LOCUS_16650 27481 26576 gene locus_tag LOCUS_16660 27481 26576 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064835.1 protein_id gnl|my_center|LOCUS_16660 28332 27544 gene locus_tag LOCUS_16670 28332 27544 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897336.1 protein_id gnl|my_center|LOCUS_16670 29259 28531 gene locus_tag LOCUS_16680 29259 28531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_16680 32072 29256 gene locus_tag LOCUS_16690 32072 29256 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_16690 33354 32098 gene locus_tag LOCUS_16700 33354 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 34447 33629 gene locus_tag LOCUS_16710 34447 33629 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_16710 34652 35221 gene locus_tag LOCUS_16720 34652 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 35354 36562 gene locus_tag LOCUS_16730 35354 36562 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080704.1 protein_id gnl|my_center|LOCUS_16730 36695 37471 gene locus_tag LOCUS_16740 36695 37471 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087450.1 protein_id gnl|my_center|LOCUS_16740 38177 37500 gene locus_tag LOCUS_16750 38177 37500 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087452.1 protein_id gnl|my_center|LOCUS_16750 38321 38668 gene locus_tag LOCUS_16760 38321 38668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104574.1 protein_id gnl|my_center|LOCUS_16760 38661 39359 gene locus_tag LOCUS_16770 38661 39359 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728656.1 protein_id gnl|my_center|LOCUS_16770 40338 39427 gene locus_tag LOCUS_16780 40338 39427 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728670.1 protein_id gnl|my_center|LOCUS_16780 40709 40443 gene locus_tag LOCUS_16790 40709 40443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 41279 40731 gene locus_tag LOCUS_16800 41279 40731 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_16800 41573 42388 gene locus_tag LOCUS_16810 41573 42388 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081811.1 protein_id gnl|my_center|LOCUS_16810 44151 42454 gene locus_tag LOCUS_16820 44151 42454 CDS product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728641.1 protein_id gnl|my_center|LOCUS_16820 46157 44148 gene locus_tag LOCUS_16830 46157 44148 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728654.1 protein_id gnl|my_center|LOCUS_16830 47038 46154 gene locus_tag LOCUS_16840 47038 46154 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 protein_id gnl|my_center|LOCUS_16840 47957 47058 gene locus_tag LOCUS_16850 47957 47058 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_16850 49024 48062 gene locus_tag LOCUS_16860 49024 48062 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086138.1 protein_id gnl|my_center|LOCUS_16860 50644 49043 gene locus_tag LOCUS_16870 50644 49043 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086135.1 protein_id gnl|my_center|LOCUS_16870 51606 50641 gene locus_tag LOCUS_16880 gene bphC 51606 50641 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894252.1 protein_id gnl|my_center|LOCUS_16880 52819 51635 gene locus_tag LOCUS_16890 52819 51635 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112840.1 protein_id gnl|my_center|LOCUS_16890 54049 52859 gene locus_tag LOCUS_16900 54049 52859 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224390.1 protein_id gnl|my_center|LOCUS_16900 55282 54197 gene locus_tag LOCUS_16910 55282 54197 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088985.1 protein_id gnl|my_center|LOCUS_16910 55533 56333 gene locus_tag LOCUS_16920 55533 56333 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087450.1 protein_id gnl|my_center|LOCUS_16920 56462 57259 gene locus_tag LOCUS_16930 56462 57259 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326803.1 protein_id gnl|my_center|LOCUS_16930 58953 57382 gene locus_tag LOCUS_16940 58953 57382 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728639.1 protein_id gnl|my_center|LOCUS_16940 59505 59104 gene locus_tag LOCUS_16950 gene gloA 59505 59104 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688980.1 protein_id gnl|my_center|LOCUS_16950 60383 59502 gene locus_tag LOCUS_16960 60383 59502 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_16960 60459 61265 gene locus_tag LOCUS_16970 60459 61265 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412728.1 protein_id gnl|my_center|LOCUS_16970 61292 62419 gene locus_tag LOCUS_16980 61292 62419 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729030.1 protein_id gnl|my_center|LOCUS_16980 62416 63513 gene locus_tag LOCUS_16990 62416 63513 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728648.1 protein_id gnl|my_center|LOCUS_16990 63510 64793 gene locus_tag LOCUS_17000 63510 64793 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854092.1 protein_id gnl|my_center|LOCUS_17000 64805 65500 gene locus_tag LOCUS_17010 64805 65500 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 protein_id gnl|my_center|LOCUS_17010 65586 66557 gene locus_tag LOCUS_17020 65586 66557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728646.1 protein_id gnl|my_center|LOCUS_17020 67894 66608 gene locus_tag LOCUS_17030 67894 66608 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013721.1 protein_id gnl|my_center|LOCUS_17030 68216 67896 gene locus_tag LOCUS_17040 68216 67896 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013722.1 protein_id gnl|my_center|LOCUS_17040 69476 68226 gene locus_tag LOCUS_17050 69476 68226 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_17050 70419 69511 gene locus_tag LOCUS_17060 70419 69511 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 protein_id gnl|my_center|LOCUS_17060 71436 70489 gene locus_tag LOCUS_17070 71436 70489 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_17070 72238 71723 gene locus_tag LOCUS_17080 72238 71723 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060706.1 protein_id gnl|my_center|LOCUS_17080 72597 73946 gene locus_tag LOCUS_17090 72597 73946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728978.1 protein_id gnl|my_center|LOCUS_17090 74046 74849 gene locus_tag LOCUS_17100 74046 74849 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224387.1 protein_id gnl|my_center|LOCUS_17100 77058 74908 gene locus_tag LOCUS_17110 77058 74908 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 protein_id gnl|my_center|LOCUS_17110 77896 77222 gene locus_tag LOCUS_17120 77896 77222 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_17120 79128 77896 gene locus_tag LOCUS_17130 79128 77896 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027103.1 protein_id gnl|my_center|LOCUS_17130 80188 79307 gene locus_tag LOCUS_17140 80188 79307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 80668 80288 gene locus_tag LOCUS_17150 80668 80288 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730423.1 protein_id gnl|my_center|LOCUS_17150 80974 82698 gene locus_tag LOCUS_17160 gene kstD 80974 82698 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730906.1 protein_id gnl|my_center|LOCUS_17160 82704 83567 gene locus_tag LOCUS_17170 82704 83567 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085500.1 protein_id gnl|my_center|LOCUS_17170 83690 84121 gene locus_tag LOCUS_17180 83690 84121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221985.1 protein_id gnl|my_center|LOCUS_17180 84452 84255 gene locus_tag LOCUS_17190 84452 84255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 84666 86327 gene locus_tag LOCUS_17200 84666 86327 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_17200 86346 87641 gene locus_tag LOCUS_17210 86346 87641 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_17210 88501 87674 gene locus_tag LOCUS_17220 88501 87674 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728944.1 protein_id gnl|my_center|LOCUS_17220 88623 88967 gene locus_tag LOCUS_17230 88623 88967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877697.1 protein_id gnl|my_center|LOCUS_17230 88964 89809 gene locus_tag LOCUS_17240 88964 89809 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967176.1 protein_id gnl|my_center|LOCUS_17240 89872 90516 gene locus_tag LOCUS_17250 89872 90516 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_17250 92151 90517 gene locus_tag LOCUS_17260 92151 90517 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086372.1 protein_id gnl|my_center|LOCUS_17260 93484 92312 gene locus_tag LOCUS_17270 93484 92312 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_17270 93957 93484 gene locus_tag LOCUS_17280 93957 93484 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 protein_id gnl|my_center|LOCUS_17280 95009 93954 gene locus_tag LOCUS_17290 gene chsH2 95009 93954 CDS product 3-oxo-23,24-bisnorchol-4,17(20)-dien-22-oyl-CoA hydratase subunit alpha ChsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419293.1 protein_id gnl|my_center|LOCUS_17290 96169 95006 gene locus_tag LOCUS_17300 96169 95006 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 protein_id gnl|my_center|LOCUS_17300 97310 96159 gene locus_tag LOCUS_17310 97310 96159 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085495.1 protein_id gnl|my_center|LOCUS_17310 99620 97431 gene locus_tag LOCUS_17320 99620 97431 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419394.1 protein_id gnl|my_center|LOCUS_17320 99787 100437 gene locus_tag LOCUS_17330 gene kstR 99787 100437 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419397.1 protein_id gnl|my_center|LOCUS_17330 100564 101574 gene locus_tag LOCUS_17340 100564 101574 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_17340 101571 102038 gene locus_tag LOCUS_17350 101571 102038 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186182.1 protein_id gnl|my_center|LOCUS_17350 102864 102172 gene locus_tag LOCUS_17360 102864 102172 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_17360 102929 104215 gene locus_tag LOCUS_17370 102929 104215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_17370 105078 104212 gene locus_tag LOCUS_17380 105078 104212 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104249.1 protein_id gnl|my_center|LOCUS_17380 106075 105230 gene locus_tag LOCUS_17390 106075 105230 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230733.1 protein_id gnl|my_center|LOCUS_17390 106256 107839 gene locus_tag LOCUS_17400 106256 107839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 107836 108519 gene locus_tag LOCUS_17410 107836 108519 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_17410 109054 108557 gene locus_tag LOCUS_17420 109054 108557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 110293 109391 gene locus_tag LOCUS_17430 110293 109391 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_17430 112970 110430 gene locus_tag LOCUS_17440 gene clpC1 112970 110430 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731031.1 protein_id gnl|my_center|LOCUS_17440 113266 114177 gene locus_tag LOCUS_17450 113266 114177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 114206 114862 gene locus_tag LOCUS_17460 114206 114862 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_17460 115088 116458 gene locus_tag LOCUS_17470 115088 116458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225849.1 protein_id gnl|my_center|LOCUS_17470 117389 116535 gene locus_tag LOCUS_17480 117389 116535 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284345.1 protein_id gnl|my_center|LOCUS_17480 117812 119266 gene locus_tag LOCUS_17490 117812 119266 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_17490 119263 120021 gene locus_tag LOCUS_17500 119263 120021 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_17500 120095 122236 gene locus_tag LOCUS_17510 gene betT 120095 122236 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131041.1 protein_id gnl|my_center|LOCUS_17510 122233 123756 gene locus_tag LOCUS_17520 122233 123756 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 protein_id gnl|my_center|LOCUS_17520 123753 125318 gene locus_tag LOCUS_17530 123753 125318 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_17530 125923 125321 gene locus_tag LOCUS_17540 125923 125321 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085162530.1 protein_id gnl|my_center|LOCUS_17540 126050 126892 gene locus_tag LOCUS_17550 126050 126892 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227697.1 protein_id gnl|my_center|LOCUS_17550 126979 127518 gene locus_tag LOCUS_17560 126979 127518 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 protein_id gnl|my_center|LOCUS_17560 127683 128846 gene locus_tag LOCUS_17570 127683 128846 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892803.1 protein_id gnl|my_center|LOCUS_17570 129506 129033 gene locus_tag LOCUS_17580 129506 129033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 129623 130933 gene locus_tag LOCUS_17590 129623 130933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 131193 131915 gene locus_tag LOCUS_17600 131193 131915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 133484 132192 gene locus_tag LOCUS_17610 133484 132192 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404103.1 protein_id gnl|my_center|LOCUS_17610 134179 133499 gene locus_tag LOCUS_17620 gene purQ 134179 133499 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113206.1 protein_id gnl|my_center|LOCUS_17620 134429 134190 gene locus_tag LOCUS_17630 gene purS 134429 134190 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 protein_id gnl|my_center|LOCUS_17630 135007 134525 gene locus_tag LOCUS_17640 135007 134525 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_17640 135176 135640 gene locus_tag LOCUS_17650 135176 135640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 135780 137327 gene locus_tag LOCUS_17660 135780 137327 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_17660 139669 137510 gene locus_tag LOCUS_17670 139669 137510 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_17670 140565 139669 gene locus_tag LOCUS_17680 140565 139669 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897243.1 protein_id gnl|my_center|LOCUS_17680 140655 140933 gene locus_tag LOCUS_17690 140655 140933 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703275.1 protein_id gnl|my_center|LOCUS_17690 142699 141272 gene locus_tag LOCUS_17700 gene purB 142699 141272 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085600.1 protein_id gnl|my_center|LOCUS_17700 143189 142788 gene locus_tag LOCUS_17710 143189 142788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 143823 143275 gene locus_tag LOCUS_17720 143823 143275 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085599.1 protein_id gnl|my_center|LOCUS_17720 144092 144847 gene locus_tag LOCUS_17730 144092 144847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 144908 145390 gene locus_tag LOCUS_17740 144908 145390 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510078.1 protein_id gnl|my_center|LOCUS_17740 145472 146434 gene locus_tag LOCUS_17750 145472 146434 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730845.1 protein_id gnl|my_center|LOCUS_17750 147773 146514 gene locus_tag LOCUS_17760 gene purD 147773 146514 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878472.1 protein_id gnl|my_center|LOCUS_17760 150020 147945 gene locus_tag LOCUS_17770 150020 147945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 151282 150017 gene locus_tag LOCUS_17780 151282 150017 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092724.1 protein_id gnl|my_center|LOCUS_17780 151430 153550 gene locus_tag LOCUS_17790 151430 153550 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_17790 153994 153569 gene locus_tag LOCUS_17800 153994 153569 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087112.1 protein_id gnl|my_center|LOCUS_17800 154189 155187 gene locus_tag LOCUS_17810 154189 155187 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_17810 155222 156061 gene locus_tag LOCUS_17820 155222 156061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 157542 156058 gene locus_tag LOCUS_17830 157542 156058 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 protein_id gnl|my_center|LOCUS_17830 158248 157526 gene locus_tag LOCUS_17840 158248 157526 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 protein_id gnl|my_center|LOCUS_17840 159029 158343 gene locus_tag LOCUS_17850 159029 158343 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730055.1 protein_id gnl|my_center|LOCUS_17850 159347 159138 gene locus_tag LOCUS_17860 159347 159138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 159403 159681 gene locus_tag LOCUS_17870 159403 159681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 159769 160014 gene locus_tag LOCUS_17880 159769 160014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731120.1 protein_id gnl|my_center|LOCUS_17880 160115 161740 gene locus_tag LOCUS_17890 160115 161740 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900464.1 protein_id gnl|my_center|LOCUS_17890 162949 161753 gene locus_tag LOCUS_17900 162949 161753 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 protein_id gnl|my_center|LOCUS_17900 163430 167218 gene locus_tag LOCUS_17910 163430 167218 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157166402.1 protein_id gnl|my_center|LOCUS_17910 168971 167337 gene locus_tag LOCUS_17920 168971 167337 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729246.1 protein_id gnl|my_center|LOCUS_17920 169044 169397 gene locus_tag LOCUS_17930 169044 169397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897762.1 protein_id gnl|my_center|LOCUS_17930 169538 169464 gene locus_tag LOCUS_t00250 169538 169464 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 169992 169606 gene locus_tag LOCUS_17940 169992 169606 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082892.1 protein_id gnl|my_center|LOCUS_17940 170161 171657 gene locus_tag LOCUS_17950 170161 171657 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 protein_id gnl|my_center|LOCUS_17950 171714 171986 gene locus_tag LOCUS_17960 171714 171986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 171991 173520 gene locus_tag LOCUS_17970 171991 173520 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_17970 173517 174305 gene locus_tag LOCUS_17980 173517 174305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 175264 174302 gene locus_tag LOCUS_17990 175264 174302 CDS product putative zinc-binding peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104652.1 protein_id gnl|my_center|LOCUS_17990 175194 175403 gene locus_tag LOCUS_18000 175194 175403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 176268 175459 gene locus_tag LOCUS_18010 176268 175459 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078164.1 protein_id gnl|my_center|LOCUS_18010 177453 176326 gene locus_tag LOCUS_18020 177453 176326 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876912.1 protein_id gnl|my_center|LOCUS_18020 177492 178256 gene locus_tag LOCUS_18030 177492 178256 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727295.1 protein_id gnl|my_center|LOCUS_18030 179483 178260 gene locus_tag LOCUS_18040 179483 178260 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112175.1 protein_id gnl|my_center|LOCUS_18040 180193 179582 gene locus_tag LOCUS_18050 180193 179582 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_18050 180241 181137 gene locus_tag LOCUS_18060 180241 181137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 181140 182117 gene locus_tag LOCUS_18070 181140 182117 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013820.1 protein_id gnl|my_center|LOCUS_18070 182906 182145 gene locus_tag LOCUS_18080 gene deoC 182906 182145 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049234098.1 protein_id gnl|my_center|LOCUS_18080 182913 183761 gene locus_tag LOCUS_18090 gene purU 182913 183761 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 protein_id gnl|my_center|LOCUS_18090 184451 184269 gene locus_tag LOCUS_18100 184451 184269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 184638 185261 gene locus_tag LOCUS_18110 184638 185261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 186471 185287 gene locus_tag LOCUS_18120 186471 185287 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112188.1 protein_id gnl|my_center|LOCUS_18120 187352 186468 gene locus_tag LOCUS_18130 187352 186468 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402350.1 protein_id gnl|my_center|LOCUS_18130 188053 187358 gene locus_tag LOCUS_18140 188053 187358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085951.1 protein_id gnl|my_center|LOCUS_18140 188658 188146 gene locus_tag LOCUS_18150 188658 188146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 189175 188669 gene locus_tag LOCUS_18160 189175 188669 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222385.1 protein_id gnl|my_center|LOCUS_18160 189214 190308 gene locus_tag LOCUS_18170 189214 190308 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222386.1 protein_id gnl|my_center|LOCUS_18170 191433 190318 gene locus_tag LOCUS_18180 191433 190318 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_18180 192310 191492 gene locus_tag LOCUS_18190 192310 191492 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184845.1 protein_id gnl|my_center|LOCUS_18190 192640 192317 gene locus_tag LOCUS_18200 192640 192317 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908910.1 protein_id gnl|my_center|LOCUS_18200 193966 192710 gene locus_tag LOCUS_18210 193966 192710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 194497 193970 gene locus_tag LOCUS_18220 194497 193970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 195872 194655 gene locus_tag LOCUS_18230 195872 194655 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115426.1 protein_id gnl|my_center|LOCUS_18230 196037 196849 gene locus_tag LOCUS_18240 196037 196849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086261.1 protein_id gnl|my_center|LOCUS_18240 196849 197682 gene locus_tag LOCUS_18250 196849 197682 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_18250 197679 198530 gene locus_tag LOCUS_18260 197679 198530 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 protein_id gnl|my_center|LOCUS_18260 199877 198699 gene locus_tag LOCUS_18270 199877 198699 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844744.1 protein_id gnl|my_center|LOCUS_18270 199953 200477 gene locus_tag LOCUS_18280 199953 200477 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087202.1 protein_id gnl|my_center|LOCUS_18280 201422 200649 gene locus_tag LOCUS_18290 201422 200649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 202577 201711 gene locus_tag LOCUS_18300 202577 201711 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062138.1 protein_id gnl|my_center|LOCUS_18300 204037 202742 gene locus_tag LOCUS_18310 gene aceA 204037 202742 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859378.1 protein_id gnl|my_center|LOCUS_18310 205276 204506 gene locus_tag LOCUS_18320 205276 204506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 205337 206776 gene locus_tag LOCUS_18330 gene ramB 205337 206776 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296731.1 protein_id gnl|my_center|LOCUS_18330 208120 206777 gene locus_tag LOCUS_18340 208120 206777 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082572.1 protein_id gnl|my_center|LOCUS_18340 208056 208250 gene locus_tag LOCUS_18350 208056 208250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 209249 208785 gene locus_tag LOCUS_18360 209249 208785 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_18360 209275 209811 gene locus_tag LOCUS_18370 209275 209811 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085920.1 protein_id gnl|my_center|LOCUS_18370 209813 210457 gene locus_tag LOCUS_18380 209813 210457 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080268.1 protein_id gnl|my_center|LOCUS_18380 211360 210476 gene locus_tag LOCUS_18390 211360 210476 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098665.1 protein_id gnl|my_center|LOCUS_18390 212723 211365 gene locus_tag LOCUS_18400 gene lpdA 212723 211365 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085912.1 protein_id gnl|my_center|LOCUS_18400 212924 213475 gene locus_tag LOCUS_18410 212924 213475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 213497 214756 gene locus_tag LOCUS_18420 213497 214756 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727796.1 protein_id gnl|my_center|LOCUS_18420 214767 215255 gene locus_tag LOCUS_18430 214767 215255 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225071.1 protein_id gnl|my_center|LOCUS_18430 216911 215259 gene locus_tag LOCUS_18440 216911 215259 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287949.1 protein_id gnl|my_center|LOCUS_18440 217046 219103 gene locus_tag LOCUS_18450 217046 219103 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112213.1 protein_id gnl|my_center|LOCUS_18450 219660 219064 gene locus_tag LOCUS_18460 219660 219064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 219669 221345 gene locus_tag LOCUS_18470 219669 221345 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_18470 221373 223493 gene locus_tag LOCUS_18480 221373 223493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 223598 224332 gene locus_tag LOCUS_18490 223598 224332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 224347 225126 gene locus_tag LOCUS_18500 224347 225126 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_18500 225126 226796 gene locus_tag LOCUS_18510 225126 226796 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_18510 227724 226912 gene locus_tag LOCUS_18520 227724 226912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 228701 227751 gene locus_tag LOCUS_18530 gene ppk2 228701 227751 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_18530 229322 228801 gene locus_tag LOCUS_18540 229322 228801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 229872 229432 gene locus_tag LOCUS_18550 229872 229432 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 protein_id gnl|my_center|LOCUS_18550 230640 229963 gene locus_tag LOCUS_18560 230640 229963 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002653.1 protein_id gnl|my_center|LOCUS_18560 231386 230775 gene locus_tag LOCUS_18570 231386 230775 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 protein_id gnl|my_center|LOCUS_18570 231534 231995 gene locus_tag LOCUS_18580 231534 231995 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_18580 232763 232017 gene locus_tag LOCUS_18590 232763 232017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 233277 232756 gene locus_tag LOCUS_18600 233277 232756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 234132 233290 gene locus_tag LOCUS_18610 234132 233290 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_18610 234755 234129 gene locus_tag LOCUS_18620 gene ureG 234755 234129 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103989.1 protein_id gnl|my_center|LOCUS_18620 236477 234765 gene locus_tag LOCUS_18630 gene ureC 236477 234765 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267497.1 protein_id gnl|my_center|LOCUS_18630 237228 236458 gene locus_tag LOCUS_18640 237228 236458 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267498.1 protein_id gnl|my_center|LOCUS_18640 238542 237271 gene locus_tag LOCUS_18650 gene urtA 238542 237271 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_18650 238821 239798 gene locus_tag LOCUS_18660 238821 239798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 242019 239818 gene locus_tag LOCUS_18670 242019 239818 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728432.1 protein_id gnl|my_center|LOCUS_18670 242565 242050 gene locus_tag LOCUS_18680 242565 242050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 243535 242726 gene locus_tag LOCUS_18690 243535 242726 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_18690 244589 243564 gene locus_tag LOCUS_18700 244589 243564 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_18700 245874 244966 gene locus_tag LOCUS_18710 245874 244966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 246597 245959 gene locus_tag LOCUS_18720 246597 245959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 248369 246714 gene locus_tag LOCUS_18730 248369 246714 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900464.1 protein_id gnl|my_center|LOCUS_18730 248550 248431 gene locus_tag LOCUS_18740 248550 248431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 249202 248543 gene locus_tag LOCUS_18750 gene frnE 249202 248543 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18750 249655 249257 gene locus_tag LOCUS_18760 249655 249257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230629.1 protein_id gnl|my_center|LOCUS_18760 249682 250083 gene locus_tag LOCUS_18770 249682 250083 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434678.1 protein_id gnl|my_center|LOCUS_18770 251760 250135 gene locus_tag LOCUS_18780 gene groL 251760 250135 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064866.1 protein_id gnl|my_center|LOCUS_18780 252031 252888 gene locus_tag LOCUS_18790 252031 252888 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831427.1 protein_id gnl|my_center|LOCUS_18790 252971 253606 gene locus_tag LOCUS_18800 252971 253606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 253665 254213 gene locus_tag LOCUS_18810 253665 254213 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_18810 254210 254743 gene locus_tag LOCUS_18820 254210 254743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 254801 255226 gene locus_tag LOCUS_18830 254801 255226 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028363.1 protein_id gnl|my_center|LOCUS_18830 255294 256856 gene locus_tag LOCUS_18840 255294 256856 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976349.1 protein_id gnl|my_center|LOCUS_18840 256946 257557 gene locus_tag LOCUS_18850 256946 257557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227196.1 protein_id gnl|my_center|LOCUS_18850 257550 258740 gene locus_tag LOCUS_18860 257550 258740 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896558.1 protein_id gnl|my_center|LOCUS_18860 258814 259629 gene locus_tag LOCUS_18870 258814 259629 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_18870 259622 260020 gene locus_tag LOCUS_18880 259622 260020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 protein_id gnl|my_center|LOCUS_18880 260017 261783 gene locus_tag LOCUS_18890 260017 261783 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 protein_id gnl|my_center|LOCUS_18890 261941 262297 gene locus_tag LOCUS_18900 261941 262297 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 protein_id gnl|my_center|LOCUS_18900 262294 263961 gene locus_tag LOCUS_18910 262294 263961 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730355.1 protein_id gnl|my_center|LOCUS_18910 265530 264118 gene locus_tag LOCUS_18920 265530 264118 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908420.1 protein_id gnl|my_center|LOCUS_18920 266070 265540 gene locus_tag LOCUS_18930 266070 265540 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222323.1 protein_id gnl|my_center|LOCUS_18930 266242 267477 gene locus_tag LOCUS_18940 266242 267477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729017.1 protein_id gnl|my_center|LOCUS_18940 268004 267438 gene locus_tag LOCUS_18950 268004 267438 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_18950 268245 269438 gene locus_tag LOCUS_18960 268245 269438 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_18960 269481 270593 gene locus_tag LOCUS_18970 269481 270593 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_18970 270759 271244 gene locus_tag LOCUS_18980 270759 271244 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028363.1 protein_id gnl|my_center|LOCUS_18980 271346 271804 gene locus_tag LOCUS_18990 271346 271804 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_18990 272689 271883 gene locus_tag LOCUS_19000 272689 271883 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064851.1 protein_id gnl|my_center|LOCUS_19000 272784 274025 gene locus_tag LOCUS_19010 272784 274025 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113181.1 protein_id gnl|my_center|LOCUS_19010 274130 274861 gene locus_tag LOCUS_19020 274130 274861 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402216.1 protein_id gnl|my_center|LOCUS_19020 274873 275934 gene locus_tag LOCUS_19030 gene pssA 274873 275934 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064848.1 protein_id gnl|my_center|LOCUS_19030 275931 278225 gene locus_tag LOCUS_19040 275931 278225 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092266.1 protein_id gnl|my_center|LOCUS_19040 278606 280285 gene locus_tag LOCUS_19050 278606 280285 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_19050 280282 281115 gene locus_tag LOCUS_19060 280282 281115 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227302.1 protein_id gnl|my_center|LOCUS_19060 281228 281887 gene locus_tag LOCUS_19070 281228 281887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 282923 281943 gene locus_tag LOCUS_19080 282923 281943 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_19080 283957 282971 gene locus_tag LOCUS_19090 283957 282971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 286339 283970 gene locus_tag LOCUS_19100 286339 283970 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 protein_id gnl|my_center|LOCUS_19100 287841 286402 gene locus_tag LOCUS_19110 287841 286402 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457820.1 protein_id gnl|my_center|LOCUS_19110 289069 287885 gene locus_tag LOCUS_19120 289069 287885 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089076.1 protein_id gnl|my_center|LOCUS_19120 289509 289066 gene locus_tag LOCUS_19130 289509 289066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 289820 289506 gene locus_tag LOCUS_19140 289820 289506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 291388 289892 gene locus_tag LOCUS_19150 291388 289892 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_19150 <292142 291501 gene locus_tag LOCUS_19160 <292142 291501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727627.1:ABC transporter ATP-binding protein MceG >Feature sequence13 830 417 gene locus_tag LOCUS_19170 830 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1648 827 gene locus_tag LOCUS_19180 1648 827 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_19180 2438 1629 gene locus_tag LOCUS_19190 gene recO 2438 1629 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895862.1 protein_id gnl|my_center|LOCUS_19190 3924 2512 gene locus_tag LOCUS_19200 3924 2512 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 protein_id gnl|my_center|LOCUS_19200 4892 3981 gene locus_tag LOCUS_19210 gene era 4892 3981 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 protein_id gnl|my_center|LOCUS_19210 5229 4885 gene locus_tag LOCUS_19220 5229 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060350.1 protein_id gnl|my_center|LOCUS_19220 6695 5226 gene locus_tag LOCUS_19230 6695 5226 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085002.1 protein_id gnl|my_center|LOCUS_19230 7279 6692 gene locus_tag LOCUS_19240 gene ybeY 7279 6692 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899292.1 protein_id gnl|my_center|LOCUS_19240 8358 7276 gene locus_tag LOCUS_19250 8358 7276 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895868.1 protein_id gnl|my_center|LOCUS_19250 9293 8514 gene locus_tag LOCUS_19260 9293 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 10039 9290 gene locus_tag LOCUS_19270 10039 9290 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729879.1 protein_id gnl|my_center|LOCUS_19270 11269 10103 gene locus_tag LOCUS_19280 gene dnaJ 11269 10103 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074629.1 protein_id gnl|my_center|LOCUS_19280 12539 11454 gene locus_tag LOCUS_19290 gene hrcA 12539 11454 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060339.1 protein_id gnl|my_center|LOCUS_19290 12651 13109 gene locus_tag LOCUS_19300 12651 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 14327 13128 gene locus_tag LOCUS_19310 gene hemW 14327 13128 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285807.1 protein_id gnl|my_center|LOCUS_19310 14695 16470 gene locus_tag LOCUS_19320 14695 16470 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729896.1 protein_id gnl|my_center|LOCUS_19320 16467 17216 gene locus_tag LOCUS_19330 16467 17216 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_19330 17198 18187 gene locus_tag LOCUS_19340 17198 18187 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060324.1 protein_id gnl|my_center|LOCUS_19340 18187 19482 gene locus_tag LOCUS_19350 18187 19482 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110195.1 protein_id gnl|my_center|LOCUS_19350 19479 20216 gene locus_tag LOCUS_19360 19479 20216 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228436.1 protein_id gnl|my_center|LOCUS_19360 21250 20756 gene locus_tag LOCUS_19370 21250 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 21231 23123 gene locus_tag LOCUS_19380 21231 23123 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 protein_id gnl|my_center|LOCUS_19380 24140 23145 gene locus_tag LOCUS_19390 24140 23145 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729898.1 protein_id gnl|my_center|LOCUS_19390 25080 24142 gene locus_tag LOCUS_19400 gene cysW 25080 24142 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074620.1 protein_id gnl|my_center|LOCUS_19400 25958 25077 gene locus_tag LOCUS_19410 gene cysT 25958 25077 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 protein_id gnl|my_center|LOCUS_19410 27070 25955 gene locus_tag LOCUS_19420 27070 25955 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_19420 28512 27604 gene locus_tag LOCUS_19430 28512 27604 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_19430 30556 28526 gene locus_tag LOCUS_19440 30556 28526 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_19440 32573 30618 gene locus_tag LOCUS_19450 gene lepA 32573 30618 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729920.1 protein_id gnl|my_center|LOCUS_19450 32709 33389 gene locus_tag LOCUS_19460 32709 33389 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727220.1 protein_id gnl|my_center|LOCUS_19460 33386 33811 gene locus_tag LOCUS_19470 33386 33811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 34675 33827 gene locus_tag LOCUS_19480 34675 33827 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093147.1 protein_id gnl|my_center|LOCUS_19480 35649 34672 gene locus_tag LOCUS_19490 35649 34672 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895947.1 protein_id gnl|my_center|LOCUS_19490 37508 35646 gene locus_tag LOCUS_19500 37508 35646 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104123.1 protein_id gnl|my_center|LOCUS_19500 38752 37601 gene locus_tag LOCUS_19510 38752 37601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 38992 39252 gene locus_tag LOCUS_19520 gene rpsT 38992 39252 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_19520 40530 39532 gene locus_tag LOCUS_19530 gene holA 40530 39532 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729932.1 protein_id gnl|my_center|LOCUS_19530 40665 42077 gene locus_tag LOCUS_19540 40665 42077 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112071.1 protein_id gnl|my_center|LOCUS_19540 42985 42173 gene locus_tag LOCUS_19550 42985 42173 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_19550 44582 43185 gene locus_tag LOCUS_19560 44582 43185 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087550.1 protein_id gnl|my_center|LOCUS_19560 45581 44586 gene locus_tag LOCUS_19570 45581 44586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 46561 45701 gene locus_tag LOCUS_19580 46561 45701 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729937.1 protein_id gnl|my_center|LOCUS_19580 47402 46593 gene locus_tag LOCUS_19590 47402 46593 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729938.1 protein_id gnl|my_center|LOCUS_19590 48129 47416 gene locus_tag LOCUS_19600 gene gpgP 48129 47416 CDS product glucosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412388.1 protein_id gnl|my_center|LOCUS_19600 48488 48126 gene locus_tag LOCUS_19610 gene rsfS 48488 48126 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729939.1 protein_id gnl|my_center|LOCUS_19610 49278 48499 gene locus_tag LOCUS_19620 gene nadD 49278 48499 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296447.1 protein_id gnl|my_center|LOCUS_19620 50724 49327 gene locus_tag LOCUS_19630 50724 49327 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110177.1 protein_id gnl|my_center|LOCUS_19630 51668 50724 gene locus_tag LOCUS_19640 51668 50724 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084944.1 protein_id gnl|my_center|LOCUS_19640 52978 51668 gene locus_tag LOCUS_19650 52978 51668 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110175.1 protein_id gnl|my_center|LOCUS_19650 53380 53090 gene locus_tag LOCUS_19660 53380 53090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 53508 55673 gene locus_tag LOCUS_19670 53508 55673 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019547503.1 protein_id gnl|my_center|LOCUS_19670 55727 56131 gene locus_tag LOCUS_19680 55727 56131 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_19680 56167 56772 gene locus_tag LOCUS_19690 56167 56772 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_19690 57594 56809 gene locus_tag LOCUS_19700 57594 56809 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415024.1 protein_id gnl|my_center|LOCUS_19700 59963 57717 gene locus_tag LOCUS_19710 gene recG 59963 57717 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093937.1 protein_id gnl|my_center|LOCUS_19710 61609 59960 gene locus_tag LOCUS_19720 61609 59960 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081474.1 protein_id gnl|my_center|LOCUS_19720 61892 62083 gene locus_tag LOCUS_19730 gene rpmB 61892 62083 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091970.1 protein_id gnl|my_center|LOCUS_19730 62193 63041 gene locus_tag LOCUS_19740 62193 63041 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081472.1 protein_id gnl|my_center|LOCUS_19740 64109 63426 gene locus_tag LOCUS_19750 64109 63426 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056911.1 protein_id gnl|my_center|LOCUS_19750 64654 64133 gene locus_tag LOCUS_19760 64654 64133 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_19760 65740 64700 gene locus_tag LOCUS_19770 65740 64700 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056910.1 protein_id gnl|my_center|LOCUS_19770 65902 66141 gene locus_tag LOCUS_19780 65902 66141 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_19780 66220 66828 gene locus_tag LOCUS_19790 66220 66828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 67854 66847 gene locus_tag LOCUS_19800 67854 66847 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056906.1 protein_id gnl|my_center|LOCUS_19800 67959 68765 gene locus_tag LOCUS_19810 gene cofC 67959 68765 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081461.1 protein_id gnl|my_center|LOCUS_19810 68823 71039 gene locus_tag LOCUS_19820 68823 71039 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056904.1 protein_id gnl|my_center|LOCUS_19820 71105 72007 gene locus_tag LOCUS_19830 71105 72007 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093939.1 protein_id gnl|my_center|LOCUS_19830 72173 72404 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcttggccggagccttcttcgcggc 73522 72929 gene locus_tag LOCUS_19840 gene leuD 73522 72929 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056901.1 protein_id gnl|my_center|LOCUS_19840 75038 73575 gene locus_tag LOCUS_19850 gene leuC 75038 73575 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_19850 75147 75881 gene locus_tag LOCUS_19860 75147 75881 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 protein_id gnl|my_center|LOCUS_19860 75973 76440 gene locus_tag LOCUS_19870 75973 76440 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726631.1 protein_id gnl|my_center|LOCUS_19870 76643 76570 gene locus_tag LOCUS_t00260 76643 76570 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 76769 76697 gene locus_tag LOCUS_t00270 76769 76697 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 78274 76856 gene locus_tag LOCUS_19880 gene gltX 78274 76856 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 protein_id gnl|my_center|LOCUS_19880 79205 78381 gene locus_tag LOCUS_19890 79205 78381 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975579.1 protein_id gnl|my_center|LOCUS_19890 79972 79202 gene locus_tag LOCUS_19900 79972 79202 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_19900 80121 81350 gene locus_tag LOCUS_19910 80121 81350 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077087.1 protein_id gnl|my_center|LOCUS_19910 82456 81449 gene locus_tag LOCUS_19920 82456 81449 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_19920 84048 82453 gene locus_tag LOCUS_19930 gene serA 84048 82453 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728303.1 protein_id gnl|my_center|LOCUS_19930 84391 85056 gene locus_tag LOCUS_19940 84391 85056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 86174 85152 gene locus_tag LOCUS_19950 86174 85152 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728741.1 protein_id gnl|my_center|LOCUS_19950 86421 87584 gene locus_tag LOCUS_19960 86421 87584 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973324.1 protein_id gnl|my_center|LOCUS_19960 87588 88466 gene locus_tag LOCUS_19970 87588 88466 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 protein_id gnl|my_center|LOCUS_19970 88572 89945 gene locus_tag LOCUS_19980 88572 89945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764782.1 protein_id gnl|my_center|LOCUS_19980 89942 90706 gene locus_tag LOCUS_19990 89942 90706 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764783.1 protein_id gnl|my_center|LOCUS_19990 90734 91471 gene locus_tag LOCUS_20000 90734 91471 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412971.1 protein_id gnl|my_center|LOCUS_20000 91471 91740 gene locus_tag LOCUS_20010 91471 91740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 91955 93619 gene locus_tag LOCUS_20020 91955 93619 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958129.1 protein_id gnl|my_center|LOCUS_20020 94866 93853 gene locus_tag LOCUS_20030 gene ilvC 94866 93853 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893742.1 protein_id gnl|my_center|LOCUS_20030 95488 94985 gene locus_tag LOCUS_20040 gene ilvN 95488 94985 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056841.1 protein_id gnl|my_center|LOCUS_20040 97449 95485 gene locus_tag LOCUS_20050 97449 95485 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296656.1 protein_id gnl|my_center|LOCUS_20050 97773 98255 gene locus_tag LOCUS_20060 97773 98255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 98353 99699 gene locus_tag LOCUS_20070 gene mgtE 98353 99699 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803803.1 protein_id gnl|my_center|LOCUS_20070 99971 101815 gene locus_tag LOCUS_20080 gene ilvD 99971 101815 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223580.1 protein_id gnl|my_center|LOCUS_20080 <102777 101906 gene locus_tag LOCUS_20090 <102777 101906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003415171.1:DoxX family protein >Feature sequence14 222 323 gene locus_tag LOCUS_r00020 222 323 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 472 669 gene locus_tag LOCUS_20100 472 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 651 2735 gene locus_tag LOCUS_20110 651 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2747 3037 gene locus_tag LOCUS_20120 2747 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3066 3971 gene locus_tag LOCUS_20130 3066 3971 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227822.1 protein_id gnl|my_center|LOCUS_20130 4048 5070 gene locus_tag LOCUS_20140 4048 5070 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058622.1 protein_id gnl|my_center|LOCUS_20140 5073 6827 gene locus_tag LOCUS_20150 gene recN 5073 6827 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110859.1 protein_id gnl|my_center|LOCUS_20150 6921 8117 gene locus_tag LOCUS_20160 gene steA 6921 8117 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729304.1 protein_id gnl|my_center|LOCUS_20160 8121 9056 gene locus_tag LOCUS_20170 8121 9056 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058615.1 protein_id gnl|my_center|LOCUS_20170 9200 10999 gene locus_tag LOCUS_20180 9200 10999 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091806.1 protein_id gnl|my_center|LOCUS_20180 11006 11641 gene locus_tag LOCUS_20190 11006 11641 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110861.1 protein_id gnl|my_center|LOCUS_20190 11638 12558 gene locus_tag LOCUS_20200 gene xerD 11638 12558 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_20200 12705 13652 gene locus_tag LOCUS_20210 12705 13652 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104155.1 protein_id gnl|my_center|LOCUS_20210 13649 14527 gene locus_tag LOCUS_20220 13649 14527 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729302.1 protein_id gnl|my_center|LOCUS_20220 14524 15285 gene locus_tag LOCUS_20230 14524 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 15292 16227 gene locus_tag LOCUS_20240 15292 16227 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_20240 16224 16937 gene locus_tag LOCUS_20250 gene cmk 16224 16937 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110867.1 protein_id gnl|my_center|LOCUS_20250 16934 18373 gene locus_tag LOCUS_20260 gene der 16934 18373 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898984.1 protein_id gnl|my_center|LOCUS_20260 18388 18687 gene locus_tag LOCUS_20270 18388 18687 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119905.1 protein_id gnl|my_center|LOCUS_20270 18838 18912 gene locus_tag LOCUS_t00280 18838 18912 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19527 18988 gene locus_tag LOCUS_20280 19527 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 19587 20060 gene locus_tag LOCUS_20290 19587 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 20807 20076 gene locus_tag LOCUS_20300 20807 20076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 22077 20989 gene locus_tag LOCUS_20310 22077 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 22598 22107 gene locus_tag LOCUS_20320 22598 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 23582 22641 gene locus_tag LOCUS_20330 23582 22641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 24463 23579 gene locus_tag LOCUS_20340 24463 23579 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902893.1 protein_id gnl|my_center|LOCUS_20340 26637 24460 gene locus_tag LOCUS_20350 gene pabB 26637 24460 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_20350 27058 26639 gene locus_tag LOCUS_20360 27058 26639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 27650 27348 gene locus_tag LOCUS_20370 27650 27348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 28216 27647 gene locus_tag LOCUS_20380 28216 27647 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110344.1 protein_id gnl|my_center|LOCUS_20380 28531 29442 gene locus_tag LOCUS_20390 28531 29442 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946909.1 protein_id gnl|my_center|LOCUS_20390 30058 29579 gene locus_tag LOCUS_20400 30058 29579 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_20400 30195 30620 gene locus_tag LOCUS_20410 30195 30620 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893397.1 protein_id gnl|my_center|LOCUS_20410 30700 31176 gene locus_tag LOCUS_20420 30700 31176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228771.1 protein_id gnl|my_center|LOCUS_20420 32274 31186 gene locus_tag LOCUS_20430 32274 31186 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082714.1 protein_id gnl|my_center|LOCUS_20430 33562 32303 gene locus_tag LOCUS_20440 33562 32303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 33704 34354 gene locus_tag LOCUS_20450 33704 34354 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894962.1 protein_id gnl|my_center|LOCUS_20450 36087 34351 gene locus_tag LOCUS_20460 gene poxB 36087 34351 CDS product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729435.1 protein_id gnl|my_center|LOCUS_20460 37042 36185 gene locus_tag LOCUS_20470 37042 36185 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 protein_id gnl|my_center|LOCUS_20470 37211 38077 gene locus_tag LOCUS_20480 37211 38077 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204051675.1 protein_id gnl|my_center|LOCUS_20480 38704 38084 gene locus_tag LOCUS_20490 38704 38084 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227753.1 protein_id gnl|my_center|LOCUS_20490 39518 38715 gene locus_tag LOCUS_20500 39518 38715 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221978.1 protein_id gnl|my_center|LOCUS_20500 40483 39515 gene locus_tag LOCUS_20510 40483 39515 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_20510 41000 40515 gene locus_tag LOCUS_20520 41000 40515 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731312.1 protein_id gnl|my_center|LOCUS_20520 42555 41239 gene locus_tag LOCUS_20530 42555 41239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 44250 42622 gene locus_tag LOCUS_20540 44250 42622 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 protein_id gnl|my_center|LOCUS_20540 44782 44369 gene locus_tag LOCUS_20550 44782 44369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_20550 46270 44843 gene locus_tag LOCUS_20560 46270 44843 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230084.1 protein_id gnl|my_center|LOCUS_20560 49586 46395 gene locus_tag LOCUS_20570 49586 46395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 49702 50070 gene locus_tag LOCUS_20580 49702 50070 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898592.1 protein_id gnl|my_center|LOCUS_20580 50111 50695 gene locus_tag LOCUS_20590 50111 50695 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 protein_id gnl|my_center|LOCUS_20590 50972 50676 gene locus_tag LOCUS_20600 50972 50676 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 protein_id gnl|my_center|LOCUS_20600 51814 50972 gene locus_tag LOCUS_20610 gene ppk2 51814 50972 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416928.1 protein_id gnl|my_center|LOCUS_20610 52797 51814 gene locus_tag LOCUS_20620 52797 51814 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_20620 53210 52794 gene locus_tag LOCUS_20630 53210 52794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 53375 54625 gene locus_tag LOCUS_20640 53375 54625 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728995.1 protein_id gnl|my_center|LOCUS_20640 56197 54647 gene locus_tag LOCUS_20650 56197 54647 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012834519.1 protein_id gnl|my_center|LOCUS_20650 56350 58761 gene locus_tag LOCUS_20660 gene secA2 56350 58761 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110903.1 protein_id gnl|my_center|LOCUS_20660 58758 59387 gene locus_tag LOCUS_20670 58758 59387 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079356.1 protein_id gnl|my_center|LOCUS_20670 59409 59813 gene locus_tag LOCUS_20680 gene gcvH 59409 59813 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895104.1 protein_id gnl|my_center|LOCUS_20680 60133 60582 gene locus_tag LOCUS_20690 60133 60582 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877774.1 protein_id gnl|my_center|LOCUS_20690 60624 61310 gene locus_tag LOCUS_20700 60624 61310 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058541.1 protein_id gnl|my_center|LOCUS_20700 61472 61984 gene locus_tag LOCUS_20710 61472 61984 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058539.1 protein_id gnl|my_center|LOCUS_20710 62280 62924 gene locus_tag LOCUS_20720 62280 62924 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_20720 63232 66138 gene locus_tag LOCUS_20730 gene gcvP 63232 66138 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900418.1 protein_id gnl|my_center|LOCUS_20730 67444 66221 gene locus_tag LOCUS_20740 67444 66221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 69778 67586 gene locus_tag LOCUS_20750 69778 67586 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_20750 70764 69853 gene locus_tag LOCUS_20760 70764 69853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729223.1 protein_id gnl|my_center|LOCUS_20760 71834 70761 gene locus_tag LOCUS_20770 71834 70761 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895093.1 protein_id gnl|my_center|LOCUS_20770 73269 71827 gene locus_tag LOCUS_20780 73269 71827 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079373.1 protein_id gnl|my_center|LOCUS_20780 74704 73271 gene locus_tag LOCUS_20790 74704 73271 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729218.1 protein_id gnl|my_center|LOCUS_20790 76178 74721 gene locus_tag LOCUS_20800 gene gndA 76178 74721 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091773.1 protein_id gnl|my_center|LOCUS_20800 77217 76264 gene locus_tag LOCUS_20810 77217 76264 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075506.1 protein_id gnl|my_center|LOCUS_20810 77661 77263 gene locus_tag LOCUS_20820 gene blaI 77661 77263 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409301.1 protein_id gnl|my_center|LOCUS_20820 78015 78437 gene locus_tag LOCUS_20830 78015 78437 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877767.1 protein_id gnl|my_center|LOCUS_20830 78570 78872 gene locus_tag LOCUS_20840 78570 78872 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729214.1 protein_id gnl|my_center|LOCUS_20840 78958 79335 gene locus_tag LOCUS_20850 78958 79335 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729213.1 protein_id gnl|my_center|LOCUS_20850 79339 81057 gene locus_tag LOCUS_20860 79339 81057 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_20860 81057 81713 gene locus_tag LOCUS_20870 81057 81713 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899050.1 protein_id gnl|my_center|LOCUS_20870 81795 82481 gene locus_tag LOCUS_20880 gene ureG 81795 82481 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079400.1 protein_id gnl|my_center|LOCUS_20880 82484 83212 gene locus_tag LOCUS_20890 82484 83212 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729210.1 protein_id gnl|my_center|LOCUS_20890 84774 83257 gene locus_tag LOCUS_20900 84774 83257 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_20900 85550 84945 gene locus_tag LOCUS_20910 85550 84945 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_20910 85685 86191 gene locus_tag LOCUS_20920 85685 86191 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804770.1 protein_id gnl|my_center|LOCUS_20920 86223 89672 gene locus_tag LOCUS_20930 gene recC 86223 89672 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950425.1 protein_id gnl|my_center|LOCUS_20930 89669 93046 gene locus_tag LOCUS_20940 gene recB 89669 93046 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092099.1 protein_id gnl|my_center|LOCUS_20940 93043 94914 gene locus_tag LOCUS_20950 gene recD 93043 94914 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_20950 95788 95033 gene locus_tag LOCUS_20960 95788 95033 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067360532.1 protein_id gnl|my_center|LOCUS_20960 95962 97977 gene locus_tag LOCUS_20970 gene htpG 95962 97977 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 protein_id gnl|my_center|LOCUS_20970 98009 99004 gene locus_tag LOCUS_20980 98009 99004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 99483 99016 gene locus_tag LOCUS_20990 99483 99016 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084107.1 protein_id gnl|my_center|LOCUS_20990 99593 100612 gene locus_tag LOCUS_21000 99593 100612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence15 1230 301 gene locus_tag LOCUS_21010 1230 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148043383.1 protein_id gnl|my_center|LOCUS_21010 2200 1457 gene locus_tag LOCUS_21020 2200 1457 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 protein_id gnl|my_center|LOCUS_21020 2401 2919 gene locus_tag LOCUS_21030 2401 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3008 4078 gene locus_tag LOCUS_21040 3008 4078 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_21040 4075 4908 gene locus_tag LOCUS_21050 4075 4908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_21050 8123 4890 gene locus_tag LOCUS_21060 8123 4890 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_21060 9354 8149 gene locus_tag LOCUS_21070 gene ilvA 9354 8149 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936216.1 protein_id gnl|my_center|LOCUS_21070 10543 9371 gene locus_tag LOCUS_21080 10543 9371 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084263.1 protein_id gnl|my_center|LOCUS_21080 11948 10554 gene locus_tag LOCUS_21090 11948 10554 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 protein_id gnl|my_center|LOCUS_21090 12079 12972 gene locus_tag LOCUS_21100 12079 12972 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066509.1 protein_id gnl|my_center|LOCUS_21100 13038 14261 gene locus_tag LOCUS_21110 13038 14261 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_21110 14898 14254 gene locus_tag LOCUS_21120 14898 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 15794 14952 gene locus_tag LOCUS_21130 15794 14952 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 protein_id gnl|my_center|LOCUS_21130 16649 15963 gene locus_tag LOCUS_21140 16649 15963 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730363.1 protein_id gnl|my_center|LOCUS_21140 18978 16705 gene locus_tag LOCUS_21150 18978 16705 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_21150 20278 19037 gene locus_tag LOCUS_21160 20278 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 20471 20545 gene locus_tag LOCUS_t00290 20471 20545 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21756 20581 gene locus_tag LOCUS_21170 21756 20581 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712897.1 protein_id gnl|my_center|LOCUS_21170 22436 21753 gene locus_tag LOCUS_21180 22436 21753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 22554 22742 gene locus_tag LOCUS_21190 22554 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 22739 22900 gene locus_tag LOCUS_21200 22739 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 22913 23122 gene locus_tag LOCUS_21210 22913 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 23123 23353 gene locus_tag LOCUS_21220 23123 23353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 23356 23826 gene locus_tag LOCUS_21230 23356 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 23823 24128 gene locus_tag LOCUS_21240 23823 24128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 24125 24373 gene locus_tag LOCUS_21250 24125 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 24370 24723 gene locus_tag LOCUS_21260 24370 24723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 24839 25045 gene locus_tag LOCUS_21270 24839 25045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 25042 25518 gene locus_tag LOCUS_21280 25042 25518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 25515 26753 gene locus_tag LOCUS_21290 25515 26753 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221965.1 protein_id gnl|my_center|LOCUS_21290 26750 27061 gene locus_tag LOCUS_21300 26750 27061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 27261 27665 gene locus_tag LOCUS_21310 27261 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 27686 33328 gene locus_tag LOCUS_21320 27686 33328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 33363 34007 gene locus_tag LOCUS_21330 33363 34007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 34480 34767 gene locus_tag LOCUS_21340 34480 34767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 34760 35173 gene locus_tag LOCUS_21350 34760 35173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 35582 35379 gene locus_tag LOCUS_21360 35582 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 35926 36900 gene locus_tag LOCUS_21370 35926 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 36906 37469 gene locus_tag LOCUS_21380 36906 37469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 38091 37525 gene locus_tag LOCUS_21390 38091 37525 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_21390 38267 38088 gene locus_tag LOCUS_21400 38267 38088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 38206 39639 gene locus_tag LOCUS_21410 38206 39639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_21410 39767 39985 gene locus_tag LOCUS_21420 39767 39985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 40836 39982 gene locus_tag LOCUS_21430 40836 39982 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 protein_id gnl|my_center|LOCUS_21430 41082 41429 gene locus_tag LOCUS_21440 41082 41429 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727046.1 protein_id gnl|my_center|LOCUS_21440 41555 42928 gene locus_tag LOCUS_21450 41555 42928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727047.1 protein_id gnl|my_center|LOCUS_21450 43054 44214 gene locus_tag LOCUS_21460 gene rhaI 43054 44214 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727048.1 protein_id gnl|my_center|LOCUS_21460 44264 46300 gene locus_tag LOCUS_21470 44264 46300 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876809.1 protein_id gnl|my_center|LOCUS_21470 46297 47784 gene locus_tag LOCUS_21480 46297 47784 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727050.1 protein_id gnl|my_center|LOCUS_21480 47781 49040 gene locus_tag LOCUS_21490 47781 49040 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908688.1 protein_id gnl|my_center|LOCUS_21490 50568 49096 gene locus_tag LOCUS_21500 50568 49096 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224038.1 protein_id gnl|my_center|LOCUS_21500 50687 51700 gene locus_tag LOCUS_21510 50687 51700 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104251.1 protein_id gnl|my_center|LOCUS_21510 53114 51609 gene locus_tag LOCUS_21520 53114 51609 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 protein_id gnl|my_center|LOCUS_21520 53198 54061 gene locus_tag LOCUS_21530 53198 54061 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235433858.1 protein_id gnl|my_center|LOCUS_21530 55328 54027 gene locus_tag LOCUS_21540 55328 54027 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083711.1 protein_id gnl|my_center|LOCUS_21540 56651 55611 gene locus_tag LOCUS_21550 56651 55611 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_21550 57525 56716 gene locus_tag LOCUS_21560 57525 56716 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086691.1 protein_id gnl|my_center|LOCUS_21560 57652 58479 gene locus_tag LOCUS_21570 57652 58479 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_21570 59232 58489 gene locus_tag LOCUS_21580 gene fabG 59232 58489 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_21580 60761 59238 gene locus_tag LOCUS_21590 60761 59238 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_21590 63030 60862 gene locus_tag LOCUS_21600 63030 60862 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 protein_id gnl|my_center|LOCUS_21600 64673 63027 gene locus_tag LOCUS_21610 64673 63027 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032668362.1 protein_id gnl|my_center|LOCUS_21610 66916 64673 gene locus_tag LOCUS_21620 66916 64673 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 protein_id gnl|my_center|LOCUS_21620 69045 66913 gene locus_tag LOCUS_21630 69045 66913 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_21630 70445 69042 gene locus_tag LOCUS_21640 70445 69042 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113292.1 protein_id gnl|my_center|LOCUS_21640 72017 70476 gene locus_tag LOCUS_21650 72017 70476 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_21650 73472 72219 gene locus_tag LOCUS_21660 73472 72219 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_21660 74159 73485 gene locus_tag LOCUS_21670 74159 73485 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401827.1 protein_id gnl|my_center|LOCUS_21670 74935 74156 gene locus_tag LOCUS_21680 74935 74156 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_21680 76130 74940 gene locus_tag LOCUS_21690 76130 74940 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416576.1 protein_id gnl|my_center|LOCUS_21690 76216 76812 gene locus_tag LOCUS_21700 76216 76812 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086621.1 protein_id gnl|my_center|LOCUS_21700 76976 77842 gene locus_tag LOCUS_21710 76976 77842 CDS product Rv2750 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414045.1 protein_id gnl|my_center|LOCUS_21710 78040 78699 gene locus_tag LOCUS_21720 78040 78699 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727798.1 protein_id gnl|my_center|LOCUS_21720 78701 81064 gene locus_tag LOCUS_21730 78701 81064 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013977.1 protein_id gnl|my_center|LOCUS_21730 81391 81071 gene locus_tag LOCUS_21740 81391 81071 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 protein_id gnl|my_center|LOCUS_21740 81577 83001 gene locus_tag LOCUS_21750 81577 83001 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_21750 83091 83891 gene locus_tag LOCUS_21760 83091 83891 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_21760 83967 85451 gene locus_tag LOCUS_21770 83967 85451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 85563 86009 gene locus_tag LOCUS_21780 85563 86009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016891714.1 protein_id gnl|my_center|LOCUS_21780 86861 86025 gene locus_tag LOCUS_21790 86861 86025 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_21790 87272 86883 gene locus_tag LOCUS_21800 87272 86883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728812.1 protein_id gnl|my_center|LOCUS_21800 88693 87764 gene locus_tag LOCUS_21810 88693 87764 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_21810 88822 89235 gene locus_tag LOCUS_21820 88822 89235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 90182 89694 gene locus_tag LOCUS_21830 90182 89694 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 protein_id gnl|my_center|LOCUS_21830 90255 91763 gene locus_tag LOCUS_21840 90255 91763 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081235.1 protein_id gnl|my_center|LOCUS_21840 91760 92815 gene locus_tag LOCUS_21850 91760 92815 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730807.1 protein_id gnl|my_center|LOCUS_21850 92812 93519 gene locus_tag LOCUS_21860 92812 93519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730808.1 protein_id gnl|my_center|LOCUS_21860 93682 94620 gene locus_tag LOCUS_21870 93682 94620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 94704 94955 gene locus_tag LOCUS_21880 94704 94955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 94961 96037 gene locus_tag LOCUS_21890 94961 96037 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727121.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21890 96934 96044 gene locus_tag LOCUS_21900 96934 96044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence16 457 296 gene locus_tag LOCUS_21910 457 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 717 2147 gene locus_tag LOCUS_21920 717 2147 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406218.1 protein_id gnl|my_center|LOCUS_21920 3369 2182 gene locus_tag LOCUS_21930 3369 2182 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_21930 4484 3366 gene locus_tag LOCUS_21940 4484 3366 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728132.1 protein_id gnl|my_center|LOCUS_21940 4626 5243 gene locus_tag LOCUS_21950 4626 5243 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087056.1 protein_id gnl|my_center|LOCUS_21950 5561 5367 gene locus_tag LOCUS_21960 5561 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5521 6096 gene locus_tag LOCUS_21970 5521 6096 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199702189.1 protein_id gnl|my_center|LOCUS_21970 6838 6110 gene locus_tag LOCUS_21980 6838 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 8280 6865 gene locus_tag LOCUS_21990 8280 6865 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728970.1 protein_id gnl|my_center|LOCUS_21990 9006 8341 gene locus_tag LOCUS_22000 9006 8341 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855418.1 protein_id gnl|my_center|LOCUS_22000 10736 9003 gene locus_tag LOCUS_22010 10736 9003 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222206.1 protein_id gnl|my_center|LOCUS_22010 12548 10899 gene locus_tag LOCUS_22020 12548 10899 CDS product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027933.1 protein_id gnl|my_center|LOCUS_22020 13810 12563 gene locus_tag LOCUS_22030 gene dinB 13810 12563 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731284.1 protein_id gnl|my_center|LOCUS_22030 14302 13874 gene locus_tag LOCUS_22040 14302 13874 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895166.1 protein_id gnl|my_center|LOCUS_22040 14383 15219 gene locus_tag LOCUS_22050 14383 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 16621 15281 gene locus_tag LOCUS_22060 16621 15281 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878613.1 protein_id gnl|my_center|LOCUS_22060 18839 16614 gene locus_tag LOCUS_22070 gene ctpC 18839 16614 CDS product manganese-exporting P-type ATPase CtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899995.1 protein_id gnl|my_center|LOCUS_22070 19130 18843 gene locus_tag LOCUS_22080 19130 18843 CDS product DUF1490 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417115.1 protein_id gnl|my_center|LOCUS_22080 22295 19560 gene locus_tag LOCUS_22090 22295 19560 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110750.1 protein_id gnl|my_center|LOCUS_22090 23076 22303 gene locus_tag LOCUS_22100 23076 22303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086062.1 protein_id gnl|my_center|LOCUS_22100 23930 23073 gene locus_tag LOCUS_22110 23930 23073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086063.1 protein_id gnl|my_center|LOCUS_22110 25405 23927 gene locus_tag LOCUS_22120 25405 23927 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296526.1 protein_id gnl|my_center|LOCUS_22120 25677 25450 gene locus_tag LOCUS_22130 25677 25450 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_22130 26366 25674 gene locus_tag LOCUS_22140 26366 25674 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091866.1 protein_id gnl|my_center|LOCUS_22140 26674 28389 gene locus_tag LOCUS_22150 gene ilvD 26674 28389 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 protein_id gnl|my_center|LOCUS_22150 28489 28755 gene locus_tag LOCUS_22160 28489 28755 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729752.1 protein_id gnl|my_center|LOCUS_22160 30043 28793 gene locus_tag LOCUS_22170 30043 28793 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_22170 31024 30098 gene locus_tag LOCUS_22180 31024 30098 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012654999.1 protein_id gnl|my_center|LOCUS_22180 32214 31021 gene locus_tag LOCUS_22190 32214 31021 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729535.1 protein_id gnl|my_center|LOCUS_22190 32753 32211 gene locus_tag LOCUS_22200 32753 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 33496 32750 gene locus_tag LOCUS_22210 33496 32750 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_22210 34673 33498 gene locus_tag LOCUS_22220 34673 33498 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974857.1 protein_id gnl|my_center|LOCUS_22220 34748 35665 gene locus_tag LOCUS_22230 34748 35665 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113598.1 protein_id gnl|my_center|LOCUS_22230 37008 35605 gene locus_tag LOCUS_22240 37008 35605 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_22240 37604 37005 gene locus_tag LOCUS_22250 37604 37005 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877730.1 protein_id gnl|my_center|LOCUS_22250 38226 37639 gene locus_tag LOCUS_22260 38226 37639 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974856.1 protein_id gnl|my_center|LOCUS_22260 39090 38446 gene locus_tag LOCUS_22270 39090 38446 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223230.1 protein_id gnl|my_center|LOCUS_22270 39244 40035 gene locus_tag LOCUS_22280 39244 40035 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878800.1 protein_id gnl|my_center|LOCUS_22280 40145 42175 gene locus_tag LOCUS_22290 40145 42175 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 protein_id gnl|my_center|LOCUS_22290 42397 44487 gene locus_tag LOCUS_22300 42397 44487 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_22300 43468 43381 gene locus_tag LOCUS_t00300 43468 43381 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44761 45564 gene locus_tag LOCUS_22310 44761 45564 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_22310 45635 46762 gene locus_tag LOCUS_22320 45635 46762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 46770 48299 gene locus_tag LOCUS_22330 46770 48299 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225352.1 protein_id gnl|my_center|LOCUS_22330 48413 49042 gene locus_tag LOCUS_22340 48413 49042 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225351.1 protein_id gnl|my_center|LOCUS_22340 49133 49606 gene locus_tag LOCUS_22350 49133 49606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 49656 50942 gene locus_tag LOCUS_22360 49656 50942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230985.1 protein_id gnl|my_center|LOCUS_22360 51506 52192 gene locus_tag LOCUS_22370 51506 52192 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_22370 52834 52202 gene locus_tag LOCUS_22380 52834 52202 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_22380 54135 52945 gene locus_tag LOCUS_22390 54135 52945 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_22390 55463 54132 gene locus_tag LOCUS_22400 55463 54132 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_22400 56498 55740 gene locus_tag LOCUS_22410 56498 55740 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731166.1 protein_id gnl|my_center|LOCUS_22410 57382 56486 gene locus_tag LOCUS_22420 57382 56486 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897683.1 protein_id gnl|my_center|LOCUS_22420 58803 57448 gene locus_tag LOCUS_22430 gene glnT 58803 57448 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 protein_id gnl|my_center|LOCUS_22430 60404 59034 gene locus_tag LOCUS_22440 60404 59034 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014463.1 protein_id gnl|my_center|LOCUS_22440 61470 60469 gene locus_tag LOCUS_22450 61470 60469 CDS product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728067.1 protein_id gnl|my_center|LOCUS_22450 62465 61467 gene locus_tag LOCUS_22460 62465 61467 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728066.1 protein_id gnl|my_center|LOCUS_22460 63994 62462 gene locus_tag LOCUS_22470 63994 62462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 64992 63991 gene locus_tag LOCUS_22480 64992 63991 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729977.1 protein_id gnl|my_center|LOCUS_22480 65558 64989 gene locus_tag LOCUS_22490 65558 64989 CDS product dimethylamine monooxygenase subunit DmmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729978.1 protein_id gnl|my_center|LOCUS_22490 65951 65568 gene locus_tag LOCUS_22500 65951 65568 CDS product ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728064.1 protein_id gnl|my_center|LOCUS_22500 66509 66799 gene locus_tag LOCUS_22510 66509 66799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 66939 67271 gene locus_tag LOCUS_22520 66939 67271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409512.1 protein_id gnl|my_center|LOCUS_22520 69013 67256 gene locus_tag LOCUS_22530 gene leuA 69013 67256 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285511.1 protein_id gnl|my_center|LOCUS_22530 69248 69916 gene locus_tag LOCUS_22540 69248 69916 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 protein_id gnl|my_center|LOCUS_22540 71417 69942 gene locus_tag LOCUS_22550 71417 69942 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_22550 71540 72163 gene locus_tag LOCUS_22560 71540 72163 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031480854.1 protein_id gnl|my_center|LOCUS_22560 72622 72173 gene locus_tag LOCUS_22570 72622 72173 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224943.1 protein_id gnl|my_center|LOCUS_22570 72726 73751 gene locus_tag LOCUS_22580 72726 73751 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_22580 74198 73800 gene locus_tag LOCUS_22590 74198 73800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 75664 74324 gene locus_tag LOCUS_22600 75664 74324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 protein_id gnl|my_center|LOCUS_22600 75750 76430 gene locus_tag LOCUS_22610 75750 76430 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731625.1 protein_id gnl|my_center|LOCUS_22610 77907 76459 gene locus_tag LOCUS_22620 77907 76459 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969475.1 protein_id gnl|my_center|LOCUS_22620 78391 78002 gene locus_tag LOCUS_22630 78391 78002 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084268.1 protein_id gnl|my_center|LOCUS_22630 78807 79670 gene locus_tag LOCUS_22640 78807 79670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 79667 80347 gene locus_tag LOCUS_22650 79667 80347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 80443 81639 gene locus_tag LOCUS_22660 80443 81639 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223046.1 protein_id gnl|my_center|LOCUS_22660 81636 82718 gene locus_tag LOCUS_22670 81636 82718 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_22670 82718 84010 gene locus_tag LOCUS_22680 82718 84010 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223048.1 protein_id gnl|my_center|LOCUS_22680 85019 84381 gene locus_tag LOCUS_22690 85019 84381 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730269.1 protein_id gnl|my_center|LOCUS_22690 85499 85990 gene locus_tag LOCUS_22700 85499 85990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22700 86414 87160 gene locus_tag LOCUS_22710 86414 87160 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495987.1 protein_id gnl|my_center|LOCUS_22710 87735 87376 gene locus_tag LOCUS_22720 87735 87376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 88592 87921 gene locus_tag LOCUS_22730 88592 87921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912342.1 protein_id gnl|my_center|LOCUS_22730 88985 89260 gene locus_tag LOCUS_22740 88985 89260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22740 89363 89926 gene locus_tag LOCUS_22750 89363 89926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22750 89941 90480 gene locus_tag LOCUS_22760 89941 90480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 91027 90539 gene locus_tag LOCUS_22770 91027 90539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 91419 91078 gene locus_tag LOCUS_22780 91419 91078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 92265 91750 gene locus_tag LOCUS_22790 92265 91750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 92382 92975 gene locus_tag LOCUS_22800 92382 92975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 93795 93337 gene locus_tag LOCUS_22810 93795 93337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 94021 94635 gene locus_tag LOCUS_22820 94021 94635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 94672 94974 gene locus_tag LOCUS_22830 94672 94974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence17 <1 1908 gene locus_tag LOCUS_22840 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167454980.1:ribonuclease J 1955 2587 gene locus_tag LOCUS_22850 1955 2587 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 protein_id gnl|my_center|LOCUS_22850 2912 2655 gene locus_tag LOCUS_22860 2912 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2983 5661 gene locus_tag LOCUS_22870 2983 5661 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296633.1 protein_id gnl|my_center|LOCUS_22870 5881 6927 gene locus_tag LOCUS_22880 5881 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 7249 6965 gene locus_tag LOCUS_22890 7249 6965 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803874.1 protein_id gnl|my_center|LOCUS_22890 7767 7252 gene locus_tag LOCUS_22900 7767 7252 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057157.1 protein_id gnl|my_center|LOCUS_22900 7929 8630 gene locus_tag LOCUS_22910 gene pgsA 7929 8630 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093751.1 protein_id gnl|my_center|LOCUS_22910 8790 9167 gene locus_tag LOCUS_22920 8790 9167 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081829.1 protein_id gnl|my_center|LOCUS_22920 9311 10126 gene locus_tag LOCUS_22930 gene pspA 9311 10126 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414030.1 protein_id gnl|my_center|LOCUS_22930 10170 11372 gene locus_tag LOCUS_22940 10170 11372 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728535.1 protein_id gnl|my_center|LOCUS_22940 11363 11557 gene locus_tag LOCUS_22950 11363 11557 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057168.1 protein_id gnl|my_center|LOCUS_22950 11756 12799 gene locus_tag LOCUS_22960 gene recA 11756 12799 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 protein_id gnl|my_center|LOCUS_22960 12811 13359 gene locus_tag LOCUS_22970 gene recX 12811 13359 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 protein_id gnl|my_center|LOCUS_22970 14265 13375 gene locus_tag LOCUS_22980 14265 13375 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090302.1 protein_id gnl|my_center|LOCUS_22980 14939 14262 gene locus_tag LOCUS_22990 14939 14262 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057178.1 protein_id gnl|my_center|LOCUS_22990 15947 14955 gene locus_tag LOCUS_23000 15947 14955 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111551.1 protein_id gnl|my_center|LOCUS_23000 16722 15949 gene locus_tag LOCUS_23010 gene gluA 16722 15949 CDS product glutamate ABC transporter ATP-binding protein GluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081846.1 protein_id gnl|my_center|LOCUS_23010 16812 18344 gene locus_tag LOCUS_23020 gene miaB 16812 18344 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728547.1 protein_id gnl|my_center|LOCUS_23020 18366 19022 gene locus_tag LOCUS_23030 18366 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081855.1 protein_id gnl|my_center|LOCUS_23030 20505 19102 gene locus_tag LOCUS_23040 20505 19102 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296629.1 protein_id gnl|my_center|LOCUS_23040 20802 21593 gene locus_tag LOCUS_23050 20802 21593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728550.1 protein_id gnl|my_center|LOCUS_23050 21590 22525 gene locus_tag LOCUS_23060 gene miaA 21590 22525 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894118.1 protein_id gnl|my_center|LOCUS_23060 22536 23477 gene locus_tag LOCUS_23070 gene dapF 22536 23477 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728551.1 protein_id gnl|my_center|LOCUS_23070 23554 25002 gene locus_tag LOCUS_23080 gene hflX 23554 25002 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894120.1 protein_id gnl|my_center|LOCUS_23080 25282 25022 gene locus_tag LOCUS_23090 25282 25022 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_23090 27507 25393 gene locus_tag LOCUS_23100 27507 25393 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_23100 28544 27579 gene locus_tag LOCUS_23110 28544 27579 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_23110 29311 28541 gene locus_tag LOCUS_23120 29311 28541 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_23120 29461 31170 gene locus_tag LOCUS_23130 29461 31170 CDS product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 protein_id gnl|my_center|LOCUS_23130 31852 31148 gene locus_tag LOCUS_23140 gene lexA 31852 31148 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899448.1 protein_id gnl|my_center|LOCUS_23140 31888 32643 gene locus_tag LOCUS_23150 31888 32643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 32662 33252 gene locus_tag LOCUS_23160 gene nrdR 32662 33252 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057199.1 protein_id gnl|my_center|LOCUS_23160 37215 33226 gene locus_tag LOCUS_23170 gene hrpA 37215 33226 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_23170 37260 38552 gene locus_tag LOCUS_23180 37260 38552 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229595.1 protein_id gnl|my_center|LOCUS_23180 39207 38674 gene locus_tag LOCUS_23190 39207 38674 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412536.1 protein_id gnl|my_center|LOCUS_23190 39806 39219 gene locus_tag LOCUS_23200 39806 39219 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064030.1 protein_id gnl|my_center|LOCUS_23200 39909 40865 gene locus_tag LOCUS_23210 39909 40865 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112364.1 protein_id gnl|my_center|LOCUS_23210 42853 40862 gene locus_tag LOCUS_23220 42853 40862 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_23220 43983 43012 gene locus_tag LOCUS_23230 43983 43012 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057202.1 protein_id gnl|my_center|LOCUS_23230 44162 44842 gene locus_tag LOCUS_23240 44162 44842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090276.1 protein_id gnl|my_center|LOCUS_23240 44935 46059 gene locus_tag LOCUS_23250 44935 46059 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 protein_id gnl|my_center|LOCUS_23250 46768 46073 gene locus_tag LOCUS_23260 46768 46073 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894134.1 protein_id gnl|my_center|LOCUS_23260 46954 48198 gene locus_tag LOCUS_23270 46954 48198 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224291.1 protein_id gnl|my_center|LOCUS_23270 48191 51040 gene locus_tag LOCUS_23280 48191 51040 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_23280 52112 51096 gene locus_tag LOCUS_23290 52112 51096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057210.1 protein_id gnl|my_center|LOCUS_23290 52772 52320 gene locus_tag LOCUS_23300 52772 52320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 53070 53342 gene locus_tag LOCUS_23310 53070 53342 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894138.1 protein_id gnl|my_center|LOCUS_23310 54600 53395 gene locus_tag LOCUS_23320 54600 53395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 54884 56647 gene locus_tag LOCUS_23330 54884 56647 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089243049.1 protein_id gnl|my_center|LOCUS_23330 56980 56774 gene locus_tag LOCUS_23340 56980 56774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 protein_id gnl|my_center|LOCUS_23340 58288 57239 gene locus_tag LOCUS_23350 58288 57239 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_23350 60103 58682 gene locus_tag LOCUS_23360 60103 58682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 61086 60283 gene locus_tag LOCUS_23370 61086 60283 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413941.1 protein_id gnl|my_center|LOCUS_23370 61245 62189 gene locus_tag LOCUS_23380 61245 62189 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093703.1 protein_id gnl|my_center|LOCUS_23380 62948 62256 gene locus_tag LOCUS_23390 62948 62256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 63359 63658 gene locus_tag LOCUS_23400 63359 63658 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 protein_id gnl|my_center|LOCUS_23400 64311 63739 gene locus_tag LOCUS_23410 64311 63739 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728565.1 protein_id gnl|my_center|LOCUS_23410 64355 64819 gene locus_tag LOCUS_23420 gene dut 64355 64819 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 protein_id gnl|my_center|LOCUS_23420 64904 65800 gene locus_tag LOCUS_23430 64904 65800 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111521.1 protein_id gnl|my_center|LOCUS_23430 66539 65808 gene locus_tag LOCUS_23440 66539 65808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090213.1 protein_id gnl|my_center|LOCUS_23440 66754 67128 gene locus_tag LOCUS_23450 66754 67128 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057265.1 protein_id gnl|my_center|LOCUS_23450 67125 67835 gene locus_tag LOCUS_23460 67125 67835 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 protein_id gnl|my_center|LOCUS_23460 68478 67816 gene locus_tag LOCUS_23470 68478 67816 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894154.1 protein_id gnl|my_center|LOCUS_23470 69169 68501 gene locus_tag LOCUS_23480 gene trkA 69169 68501 CDS product potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728570.1 protein_id gnl|my_center|LOCUS_23480 69248 71263 gene locus_tag LOCUS_23490 69248 71263 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093687.1 protein_id gnl|my_center|LOCUS_23490 71260 72561 gene locus_tag LOCUS_23500 71260 72561 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728572.1 protein_id gnl|my_center|LOCUS_23500 72713 74671 gene locus_tag LOCUS_23510 gene dxs 72713 74671 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081956.1 protein_id gnl|my_center|LOCUS_23510 74726 75865 gene locus_tag LOCUS_23520 74726 75865 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115262.1 protein_id gnl|my_center|LOCUS_23520 76306 75878 gene locus_tag LOCUS_23530 76306 75878 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729050.1 protein_id gnl|my_center|LOCUS_23530 77687 76425 gene locus_tag LOCUS_23540 77687 76425 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728577.1 protein_id gnl|my_center|LOCUS_23540 78499 77684 gene locus_tag LOCUS_23550 78499 77684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 78498 79466 gene locus_tag LOCUS_23560 gene hemE 78498 79466 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050546855.1 protein_id gnl|my_center|LOCUS_23560 79466 80872 gene locus_tag LOCUS_23570 79466 80872 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413871.1 protein_id gnl|my_center|LOCUS_23570 80930 81625 gene locus_tag LOCUS_23580 80930 81625 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894166.1 protein_id gnl|my_center|LOCUS_23580 82073 81627 gene locus_tag LOCUS_23590 gene msrB 82073 81627 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 protein_id gnl|my_center|LOCUS_23590 83415 82117 gene locus_tag LOCUS_23600 gene aftC 83415 82117 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413860.1 protein_id gnl|my_center|LOCUS_23600 85007 83475 gene locus_tag LOCUS_23610 85007 83475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413857.1 protein_id gnl|my_center|LOCUS_23610 85953 85153 gene locus_tag LOCUS_23620 gene ribD 85953 85153 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413854.1 protein_id gnl|my_center|LOCUS_23620 85989 87002 gene locus_tag LOCUS_23630 gene zapE 85989 87002 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728584.1 protein_id gnl|my_center|LOCUS_23630 88175 87162 gene locus_tag LOCUS_23640 gene zapE 88175 87162 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895676.1 protein_id gnl|my_center|LOCUS_23640 88850 88275 gene locus_tag LOCUS_23650 88850 88275 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 protein_id gnl|my_center|LOCUS_23650 89674 88847 gene locus_tag LOCUS_23660 89674 88847 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385042.1 protein_id gnl|my_center|LOCUS_23660 91632 89689 gene locus_tag LOCUS_23670 91632 89689 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509311.1 protein_id gnl|my_center|LOCUS_23670 91771 92409 gene locus_tag LOCUS_23680 91771 92409 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 protein_id gnl|my_center|LOCUS_23680 92406 94031 gene locus_tag LOCUS_23690 92406 94031 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878190.1 protein_id gnl|my_center|LOCUS_23690 94012 94656 gene locus_tag LOCUS_23700 94012 94656 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_23700 94653 95771 gene locus_tag LOCUS_23710 gene mcr 94653 95771 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898740.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence18 197 631 gene locus_tag LOCUS_23720 197 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2032 830 gene locus_tag LOCUS_23730 2032 830 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110117.1 protein_id gnl|my_center|LOCUS_23730 3399 2029 gene locus_tag LOCUS_23740 3399 2029 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729533.1 protein_id gnl|my_center|LOCUS_23740 3616 5298 gene locus_tag LOCUS_23750 3616 5298 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084417.1 protein_id gnl|my_center|LOCUS_23750 5295 6290 gene locus_tag LOCUS_23760 5295 6290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729787.1 protein_id gnl|my_center|LOCUS_23760 6287 7198 gene locus_tag LOCUS_23770 6287 7198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729788.1 protein_id gnl|my_center|LOCUS_23770 7195 8880 gene locus_tag LOCUS_23780 7195 8880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 protein_id gnl|my_center|LOCUS_23780 10490 9006 gene locus_tag LOCUS_23790 10490 9006 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027644.1 protein_id gnl|my_center|LOCUS_23790 10569 10820 gene locus_tag LOCUS_23800 10569 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 10810 11658 gene locus_tag LOCUS_23810 10810 11658 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_23810 11746 12465 gene locus_tag LOCUS_23820 11746 12465 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_23820 13029 12766 gene locus_tag LOCUS_23830 gene rpsR 13029 12766 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897466.1 protein_id gnl|my_center|LOCUS_23830 13363 13058 gene locus_tag LOCUS_23840 gene rpsN 13363 13058 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_23840 13527 13363 gene locus_tag LOCUS_23850 gene rpmG 13527 13363 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_23850 13763 13527 gene locus_tag LOCUS_23860 gene rpmB 13763 13527 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 protein_id gnl|my_center|LOCUS_23860 14124 13846 gene locus_tag LOCUS_23870 14124 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 14194 15222 gene locus_tag LOCUS_23880 14194 15222 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072487.1 protein_id gnl|my_center|LOCUS_23880 15253 15513 gene locus_tag LOCUS_23890 15253 15513 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_23890 16125 15538 gene locus_tag LOCUS_23900 16125 15538 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_23900 16181 16747 gene locus_tag LOCUS_23910 16181 16747 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297192.1 protein_id gnl|my_center|LOCUS_23910 17778 16756 gene locus_tag LOCUS_23920 17778 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 17789 18367 gene locus_tag LOCUS_23930 17789 18367 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093863.1 protein_id gnl|my_center|LOCUS_23930 18565 18490 gene locus_tag LOCUS_t00310 18565 18490 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18700 18626 gene locus_tag LOCUS_t00320 18700 18626 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 19687 18767 gene locus_tag LOCUS_23940 19687 18767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 22288 19799 gene locus_tag LOCUS_23950 gene gyrA 22288 19799 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891334.1 protein_id gnl|my_center|LOCUS_23950 24490 22427 gene locus_tag LOCUS_23960 gene gyrB 24490 22427 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082841.1 protein_id gnl|my_center|LOCUS_23960 25405 24821 gene locus_tag LOCUS_23970 25405 24821 CDS product DUF721 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087667.1 protein_id gnl|my_center|LOCUS_23970 26663 25398 gene locus_tag LOCUS_23980 gene recF 26663 25398 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112812.1 protein_id gnl|my_center|LOCUS_23980 27875 26706 gene locus_tag LOCUS_23990 gene dnaN 27875 26706 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064525.1 protein_id gnl|my_center|LOCUS_23990 30156 28561 gene locus_tag LOCUS_24000 gene dnaA 30156 28561 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400253.1 protein_id gnl|my_center|LOCUS_24000 30565 30708 gene locus_tag LOCUS_24010 gene rpmH 30565 30708 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 protein_id gnl|my_center|LOCUS_24010 30908 31186 gene locus_tag LOCUS_24020 30908 31186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 31183 31611 gene locus_tag LOCUS_24030 31183 31611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 31639 32835 gene locus_tag LOCUS_24040 gene yidC 31639 32835 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112810.1 protein_id gnl|my_center|LOCUS_24040 32872 33585 gene locus_tag LOCUS_24050 32872 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 34451 35233 gene locus_tag LOCUS_24060 gene rsmG 34451 35233 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 protein_id gnl|my_center|LOCUS_24060 35403 36356 gene locus_tag LOCUS_24070 gene parA 35403 36356 CDS product chromosome partitioning ATPase ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731642.1 protein_id gnl|my_center|LOCUS_24070 36421 37473 gene locus_tag LOCUS_24080 36421 37473 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731641.1 protein_id gnl|my_center|LOCUS_24080 37622 38458 gene locus_tag LOCUS_24090 37622 38458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112809.1 protein_id gnl|my_center|LOCUS_24090 39607 38429 gene locus_tag LOCUS_24100 39607 38429 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_24100 40216 39878 gene locus_tag LOCUS_24110 gene trxA 40216 39878 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731639.1 protein_id gnl|my_center|LOCUS_24110 41292 40276 gene locus_tag LOCUS_24120 gene trxB 41292 40276 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 protein_id gnl|my_center|LOCUS_24120 42264 41437 gene locus_tag LOCUS_24130 42264 41437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 42976 42410 gene locus_tag LOCUS_24140 gene sigM 42976 42410 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_24140 43442 43074 gene locus_tag LOCUS_24150 43442 43074 CDS product thiocyanate hydrolase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897690.1 protein_id gnl|my_center|LOCUS_24150 44169 43447 gene locus_tag LOCUS_24160 gene scnC 44169 43447 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_24160 45023 44166 gene locus_tag LOCUS_24170 45023 44166 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104591.1 protein_id gnl|my_center|LOCUS_24170 45899 45189 gene locus_tag LOCUS_24180 45899 45189 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226843.1 protein_id gnl|my_center|LOCUS_24180 46001 46996 gene locus_tag LOCUS_24190 46001 46996 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_24190 50599 47027 gene locus_tag LOCUS_24200 50599 47027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 50526 50714 gene locus_tag LOCUS_24210 50526 50714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 53691 51067 gene locus_tag LOCUS_24220 53691 51067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878804.1 protein_id gnl|my_center|LOCUS_24220 55045 53786 gene locus_tag LOCUS_24230 55045 53786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 55285 56751 gene locus_tag LOCUS_24240 55285 56751 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731631.1 protein_id gnl|my_center|LOCUS_24240 57688 56780 gene locus_tag LOCUS_24250 57688 56780 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_24250 57726 58325 gene locus_tag LOCUS_24260 57726 58325 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895728.1 protein_id gnl|my_center|LOCUS_24260 58362 59891 gene locus_tag LOCUS_24270 58362 59891 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 protein_id gnl|my_center|LOCUS_24270 61014 59923 gene locus_tag LOCUS_24280 gene egtE 61014 59923 CDS product ergothioneine biosynthesis PLP-dependent enzyme EgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731155.1 protein_id gnl|my_center|LOCUS_24280 61159 61749 gene locus_tag LOCUS_24290 61159 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 61810 62367 gene locus_tag LOCUS_24300 61810 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898345.1 protein_id gnl|my_center|LOCUS_24300 63640 62348 gene locus_tag LOCUS_24310 63640 62348 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400431.1 protein_id gnl|my_center|LOCUS_24310 63828 64421 gene locus_tag LOCUS_24320 63828 64421 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400460.1 protein_id gnl|my_center|LOCUS_24320 64571 66622 gene locus_tag LOCUS_24330 64571 66622 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080127.1 protein_id gnl|my_center|LOCUS_24330 68008 66992 gene locus_tag LOCUS_24340 68008 66992 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 protein_id gnl|my_center|LOCUS_24340 68561 68052 gene locus_tag LOCUS_24350 68561 68052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 68670 71552 gene locus_tag LOCUS_24360 gene leuS 68670 71552 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112800.1 protein_id gnl|my_center|LOCUS_24360 72067 71735 gene locus_tag LOCUS_24370 72067 71735 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 protein_id gnl|my_center|LOCUS_24370 72140 73333 gene locus_tag LOCUS_24380 72140 73333 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728136.1 protein_id gnl|my_center|LOCUS_24380 73464 74711 gene locus_tag LOCUS_24390 73464 74711 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029435.1 protein_id gnl|my_center|LOCUS_24390 75897 74734 gene locus_tag LOCUS_24400 75897 74734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 76911 76027 gene locus_tag LOCUS_24410 76911 76027 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776089.1 protein_id gnl|my_center|LOCUS_24410 77023 78018 gene locus_tag LOCUS_24420 77023 78018 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_24420 78098 78373 gene locus_tag LOCUS_24430 78098 78373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 78599 78387 gene locus_tag LOCUS_24440 78599 78387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 79420 78749 gene locus_tag LOCUS_24450 79420 78749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 80980 79475 gene locus_tag LOCUS_24460 gene tctA 80980 79475 CDS product tripartite tricarboxylate transporter permease TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015409.1 protein_id gnl|my_center|LOCUS_24460 81543 80980 gene locus_tag LOCUS_24470 gene tctB 81543 80980 CDS product tripartite tricarboxylate transporter TctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015410.1 protein_id gnl|my_center|LOCUS_24470 81931 81533 gene locus_tag LOCUS_24480 81931 81533 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_24480 83037 81994 gene locus_tag LOCUS_24490 gene tctC 83037 81994 CDS product tripartite tricarboxylate transporter substrate binding protein TctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015411.1 protein_id gnl|my_center|LOCUS_24490 84079 83375 gene locus_tag LOCUS_24500 84079 83375 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_24500 84202 86760 gene locus_tag LOCUS_24510 gene acnA 84202 86760 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252830.1 protein_id gnl|my_center|LOCUS_24510 86853 87146 gene locus_tag LOCUS_24520 86853 87146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 87434 87207 gene locus_tag LOCUS_24530 87434 87207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 88415 87804 gene locus_tag LOCUS_24540 88415 87804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 89087 88632 gene locus_tag LOCUS_24550 89087 88632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 90203 89667 gene locus_tag LOCUS_24560 90203 89667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence19 794 1414 gene locus_tag LOCUS_24570 794 1414 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_24570 2494 1448 gene locus_tag LOCUS_24580 2494 1448 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110164.1 protein_id gnl|my_center|LOCUS_24580 2376 2999 gene locus_tag LOCUS_24590 2376 2999 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899332.1 protein_id gnl|my_center|LOCUS_24590 3015 3818 gene locus_tag LOCUS_24600 3015 3818 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 protein_id gnl|my_center|LOCUS_24600 3924 4361 gene locus_tag LOCUS_24610 3924 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 4442 5359 gene locus_tag LOCUS_24620 4442 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 6051 5437 gene locus_tag LOCUS_24630 6051 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 6884 7150 gene locus_tag LOCUS_24640 6884 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 7263 7190 gene locus_tag LOCUS_t00330 7263 7190 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7496 7570 gene locus_tag LOCUS_t00340 7496 7570 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7658 9025 gene locus_tag LOCUS_24650 gene tig 7658 9025 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 protein_id gnl|my_center|LOCUS_24650 9303 9902 gene locus_tag LOCUS_24660 9303 9902 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060147.1 protein_id gnl|my_center|LOCUS_24660 9968 10663 gene locus_tag LOCUS_24670 9968 10663 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896046.1 protein_id gnl|my_center|LOCUS_24670 10872 12152 gene locus_tag LOCUS_24680 gene clpX 10872 12152 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060151.1 protein_id gnl|my_center|LOCUS_24680 14600 12225 gene locus_tag LOCUS_24690 14600 12225 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110168.1 protein_id gnl|my_center|LOCUS_24690 14632 15249 gene locus_tag LOCUS_24700 14632 15249 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084901.1 protein_id gnl|my_center|LOCUS_24700 15318 18008 gene locus_tag LOCUS_24710 15318 18008 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896007.1 protein_id gnl|my_center|LOCUS_24710 18005 19537 gene locus_tag LOCUS_24720 18005 19537 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110172.1 protein_id gnl|my_center|LOCUS_24720 19534 19926 gene locus_tag LOCUS_24730 19534 19926 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074540.1 protein_id gnl|my_center|LOCUS_24730 20149 20610 gene locus_tag LOCUS_24740 20149 20610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 20649 21065 gene locus_tag LOCUS_24750 gene ndk 20649 21065 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_24750 21491 24982 gene locus_tag LOCUS_24760 21491 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 25265 25576 gene locus_tag LOCUS_24770 gene rplU 25265 25576 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 protein_id gnl|my_center|LOCUS_24770 25615 25878 gene locus_tag LOCUS_24780 gene rpmA 25615 25878 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228479.1 protein_id gnl|my_center|LOCUS_24780 25974 27443 gene locus_tag LOCUS_24790 gene obgE 25974 27443 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729970.1 protein_id gnl|my_center|LOCUS_24790 27440 28591 gene locus_tag LOCUS_24800 gene proB 27440 28591 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906819.1 protein_id gnl|my_center|LOCUS_24800 29477 28599 gene locus_tag LOCUS_24810 29477 28599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_24810 29957 29526 gene locus_tag LOCUS_24820 29957 29526 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895350.1 protein_id gnl|my_center|LOCUS_24820 31225 29954 gene locus_tag LOCUS_24830 gene ectB 31225 29954 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 protein_id gnl|my_center|LOCUS_24830 31989 31462 gene locus_tag LOCUS_24840 gene ectA 31989 31462 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_24840 32154 32705 gene locus_tag LOCUS_24850 gene rsmD 32154 32705 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466716.1 protein_id gnl|my_center|LOCUS_24850 32722 33210 gene locus_tag LOCUS_24860 gene coaD 32722 33210 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056942.1 protein_id gnl|my_center|LOCUS_24860 33536 33279 gene locus_tag LOCUS_24870 33536 33279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 33429 34181 gene locus_tag LOCUS_24880 33429 34181 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893781.1 protein_id gnl|my_center|LOCUS_24880 34275 34922 gene locus_tag LOCUS_24890 34275 34922 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414824.1 protein_id gnl|my_center|LOCUS_24890 34915 35640 gene locus_tag LOCUS_24900 gene rnc 34915 35640 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908461.1 protein_id gnl|my_center|LOCUS_24900 35677 36594 gene locus_tag LOCUS_24910 gene mutM 35677 36594 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 protein_id gnl|my_center|LOCUS_24910 36709 37167 gene locus_tag LOCUS_24920 36709 37167 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893786.1 protein_id gnl|my_center|LOCUS_24920 37172 37477 gene locus_tag LOCUS_24930 37172 37477 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_24930 37522 41130 gene locus_tag LOCUS_24940 gene smc 37522 41130 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111689.1 protein_id gnl|my_center|LOCUS_24940 41127 42743 gene locus_tag LOCUS_24950 41127 42743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 42995 44347 gene locus_tag LOCUS_24960 42995 44347 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893791.1 protein_id gnl|my_center|LOCUS_24960 44399 44737 gene locus_tag LOCUS_24970 44399 44737 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_24970 44849 47389 gene locus_tag LOCUS_24980 44849 47389 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081546.1 protein_id gnl|my_center|LOCUS_24980 47427 48989 gene locus_tag LOCUS_24990 gene ffh 47427 48989 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069602.1 protein_id gnl|my_center|LOCUS_24990 48994 50091 gene locus_tag LOCUS_25000 48994 50091 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223846.1 protein_id gnl|my_center|LOCUS_25000 50562 50999 gene locus_tag LOCUS_25010 50562 50999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 50996 51238 gene locus_tag LOCUS_25020 50996 51238 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081564.1 protein_id gnl|my_center|LOCUS_25020 51265 51798 gene locus_tag LOCUS_25030 gene rimM 51265 51798 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_25030 51798 52517 gene locus_tag LOCUS_25040 gene trmD 51798 52517 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893804.1 protein_id gnl|my_center|LOCUS_25040 52558 52902 gene locus_tag LOCUS_25050 52558 52902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 52889 53242 gene locus_tag LOCUS_25060 52889 53242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 53239 54204 gene locus_tag LOCUS_25070 53239 54204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 54412 54753 gene locus_tag LOCUS_25080 gene rplS 54412 54753 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893806.1 protein_id gnl|my_center|LOCUS_25080 54772 55626 gene locus_tag LOCUS_25090 gene lepB 54772 55626 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414715.1 protein_id gnl|my_center|LOCUS_25090 55637 56326 gene locus_tag LOCUS_25100 55637 56326 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087713.1 protein_id gnl|my_center|LOCUS_25100 56323 56634 gene locus_tag LOCUS_25110 56323 56634 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414710.1 protein_id gnl|my_center|LOCUS_25110 56750 57154 gene locus_tag LOCUS_25120 56750 57154 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_25120 58524 57166 gene locus_tag LOCUS_25130 58524 57166 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729765.1 protein_id gnl|my_center|LOCUS_25130 59262 58624 gene locus_tag LOCUS_25140 gene bluB 59262 58624 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391283.1 protein_id gnl|my_center|LOCUS_25140 59385 60893 gene locus_tag LOCUS_25150 59385 60893 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111670.1 protein_id gnl|my_center|LOCUS_25150 60890 62035 gene locus_tag LOCUS_25160 gene dprA 60890 62035 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081583.1 protein_id gnl|my_center|LOCUS_25160 62616 62038 gene locus_tag LOCUS_25170 62616 62038 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731182.1 protein_id gnl|my_center|LOCUS_25170 62791 63657 gene locus_tag LOCUS_25180 62791 63657 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728392.1 protein_id gnl|my_center|LOCUS_25180 63748 64632 gene locus_tag LOCUS_25190 63748 64632 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414689.1 protein_id gnl|my_center|LOCUS_25190 65135 64647 gene locus_tag LOCUS_25200 65135 64647 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104211.1 protein_id gnl|my_center|LOCUS_25200 65638 66462 gene locus_tag LOCUS_25210 gene rpsB 65638 66462 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_25210 66519 67343 gene locus_tag LOCUS_25220 gene tsf 66519 67343 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893881.1 protein_id gnl|my_center|LOCUS_25220 69083 67398 gene locus_tag LOCUS_25230 69083 67398 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_25230 70501 69080 gene locus_tag LOCUS_25240 70501 69080 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083311.1 protein_id gnl|my_center|LOCUS_25240 70805 71836 gene locus_tag LOCUS_25250 70805 71836 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_25250 71937 72671 gene locus_tag LOCUS_25260 gene pyrH 71937 72671 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893896.1 protein_id gnl|my_center|LOCUS_25260 72730 73287 gene locus_tag LOCUS_25270 gene frr 72730 73287 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 protein_id gnl|my_center|LOCUS_25270 73284 74138 gene locus_tag LOCUS_25280 73284 74138 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728419.1 protein_id gnl|my_center|LOCUS_25280 74585 74178 gene locus_tag LOCUS_25290 74585 74178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 74634 75722 gene locus_tag LOCUS_25300 gene rlmN 74634 75722 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 protein_id gnl|my_center|LOCUS_25300 76099 75797 gene locus_tag LOCUS_25310 76099 75797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 76317 76123 gene locus_tag LOCUS_25320 76317 76123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 76243 77418 gene locus_tag LOCUS_25330 gene dxr 76243 77418 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728448.1 protein_id gnl|my_center|LOCUS_25330 77471 78697 gene locus_tag LOCUS_25340 gene rip 77471 78697 CDS product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 protein_id gnl|my_center|LOCUS_25340 78784 79971 gene locus_tag LOCUS_25350 gene ispG 78784 79971 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081652.1 protein_id gnl|my_center|LOCUS_25350 80004 80840 gene locus_tag LOCUS_25360 80004 80840 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899516.1 protein_id gnl|my_center|LOCUS_25360 80932 82740 gene locus_tag LOCUS_25370 80932 82740 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414596.1 protein_id gnl|my_center|LOCUS_25370 83524 82682 gene locus_tag LOCUS_25380 83524 82682 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_25380 84654 83518 gene locus_tag LOCUS_25390 84654 83518 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_25390 85709 84651 gene locus_tag LOCUS_25400 85709 84651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 protein_id gnl|my_center|LOCUS_25400 85794 86657 gene locus_tag LOCUS_25410 gene map 85794 86657 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728452.1 protein_id gnl|my_center|LOCUS_25410 87672 86722 gene locus_tag LOCUS_25420 87672 86722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence20 188 973 gene locus_tag LOCUS_25430 188 973 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085480.1 protein_id gnl|my_center|LOCUS_25430 975 1868 gene locus_tag LOCUS_25440 975 1868 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089071.1 protein_id gnl|my_center|LOCUS_25440 1865 2656 gene locus_tag LOCUS_25450 1865 2656 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085471.1 protein_id gnl|my_center|LOCUS_25450 2653 3765 gene locus_tag LOCUS_25460 2653 3765 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_25460 3904 4704 gene locus_tag LOCUS_25470 3904 4704 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775985.1 protein_id gnl|my_center|LOCUS_25470 4909 6153 gene locus_tag LOCUS_25480 4909 6153 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_25480 8106 6370 gene locus_tag LOCUS_25490 8106 6370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 protein_id gnl|my_center|LOCUS_25490 10013 8103 gene locus_tag LOCUS_25500 10013 8103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390093.1 protein_id gnl|my_center|LOCUS_25500 10955 10272 gene locus_tag LOCUS_25510 10955 10272 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064806.1 protein_id gnl|my_center|LOCUS_25510 12569 11043 gene locus_tag LOCUS_25520 12569 11043 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728247.1 protein_id gnl|my_center|LOCUS_25520 14125 12968 gene locus_tag LOCUS_25530 14125 12968 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_25530 15002 14163 gene locus_tag LOCUS_25540 15002 14163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089068.1 protein_id gnl|my_center|LOCUS_25540 16323 15004 gene locus_tag LOCUS_25550 16323 15004 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_25550 16355 17938 gene locus_tag LOCUS_25560 gene fadD3 16355 17938 CDS product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 protein_id gnl|my_center|LOCUS_25560 19507 17966 gene locus_tag LOCUS_25570 gene lysS 19507 17966 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065019.1 protein_id gnl|my_center|LOCUS_25570 20074 19595 gene locus_tag LOCUS_25580 20074 19595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 21440 20271 gene locus_tag LOCUS_25590 21440 20271 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_25590 21460 21963 gene locus_tag LOCUS_25600 21460 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 22806 21979 gene locus_tag LOCUS_25610 22806 21979 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878681.1 protein_id gnl|my_center|LOCUS_25610 23206 24120 gene locus_tag LOCUS_25620 23206 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 24160 24744 gene locus_tag LOCUS_25630 24160 24744 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731339.1 protein_id gnl|my_center|LOCUS_25630 25585 24782 gene locus_tag LOCUS_25640 25585 24782 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897496.1 protein_id gnl|my_center|LOCUS_25640 26049 25603 gene locus_tag LOCUS_25650 26049 25603 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 protein_id gnl|my_center|LOCUS_25650 26993 26046 gene locus_tag LOCUS_25660 gene panC 26993 26046 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_25660 28081 27017 gene locus_tag LOCUS_25670 28081 27017 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113142.1 protein_id gnl|my_center|LOCUS_25670 28375 29787 gene locus_tag LOCUS_25680 28375 29787 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729255.1 protein_id gnl|my_center|LOCUS_25680 30606 29818 gene locus_tag LOCUS_25690 30606 29818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 32024 30753 gene locus_tag LOCUS_25700 32024 30753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 32718 32203 gene locus_tag LOCUS_25710 32718 32203 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230462.1 protein_id gnl|my_center|LOCUS_25710 33233 32715 gene locus_tag LOCUS_25720 gene folK 33233 32715 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113139.1 protein_id gnl|my_center|LOCUS_25720 33601 33230 gene locus_tag LOCUS_25730 gene folB 33601 33230 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_25730 34502 33594 gene locus_tag LOCUS_25740 gene folP 34502 33594 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048402.1 protein_id gnl|my_center|LOCUS_25740 35110 34499 gene locus_tag LOCUS_25750 gene folE 35110 34499 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_25750 37510 35120 gene locus_tag LOCUS_25760 gene ftsH 37510 35120 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897506.1 protein_id gnl|my_center|LOCUS_25760 38235 37672 gene locus_tag LOCUS_25770 gene hpt 38235 37672 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878560.1 protein_id gnl|my_center|LOCUS_25770 38568 39272 gene locus_tag LOCUS_25780 38568 39272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 40235 39300 gene locus_tag LOCUS_25790 gene tilS 40235 39300 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731045.1 protein_id gnl|my_center|LOCUS_25790 41362 40232 gene locus_tag LOCUS_25800 41362 40232 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092152.1 protein_id gnl|my_center|LOCUS_25800 42762 41359 gene locus_tag LOCUS_25810 gene dacB 42762 41359 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113125.1 protein_id gnl|my_center|LOCUS_25810 42928 43440 gene locus_tag LOCUS_25820 42928 43440 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 protein_id gnl|my_center|LOCUS_25820 45054 43546 gene locus_tag LOCUS_25830 45054 43546 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529702.1 protein_id gnl|my_center|LOCUS_25830 46219 45101 gene locus_tag LOCUS_25840 46219 45101 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_25840 47243 46242 gene locus_tag LOCUS_25850 47243 46242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612367.1 protein_id gnl|my_center|LOCUS_25850 48744 47245 gene locus_tag LOCUS_25860 48744 47245 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 protein_id gnl|my_center|LOCUS_25860 49778 48741 gene locus_tag LOCUS_25870 49778 48741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613875.1 protein_id gnl|my_center|LOCUS_25870 50894 49785 gene locus_tag LOCUS_25880 50894 49785 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612363.1 protein_id gnl|my_center|LOCUS_25880 52292 51114 gene locus_tag LOCUS_25890 52292 51114 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 protein_id gnl|my_center|LOCUS_25890 53867 52332 gene locus_tag LOCUS_25900 53867 52332 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 protein_id gnl|my_center|LOCUS_25900 55025 54000 gene locus_tag LOCUS_25910 55025 54000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 55928 55101 gene locus_tag LOCUS_25920 55928 55101 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_25920 57086 55932 gene locus_tag LOCUS_25930 57086 55932 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729605.1 protein_id gnl|my_center|LOCUS_25930 57240 57998 gene locus_tag LOCUS_25940 57240 57998 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027914.1 protein_id gnl|my_center|LOCUS_25940 57995 59170 gene locus_tag LOCUS_25950 57995 59170 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_25950 59235 59693 gene locus_tag LOCUS_25960 59235 59693 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_25960 59741 61357 gene locus_tag LOCUS_25970 59741 61357 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173052.1 protein_id gnl|my_center|LOCUS_25970 61883 61383 gene locus_tag LOCUS_25980 61883 61383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 63222 61888 gene locus_tag LOCUS_25990 63222 61888 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296326.1 protein_id gnl|my_center|LOCUS_25990 63462 64553 gene locus_tag LOCUS_26000 63462 64553 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_26000 65790 64573 gene locus_tag LOCUS_26010 65790 64573 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727178.1 protein_id gnl|my_center|LOCUS_26010 66218 65787 gene locus_tag LOCUS_26020 66218 65787 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_26020 66667 66197 gene locus_tag LOCUS_26030 66667 66197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066165394.1 protein_id gnl|my_center|LOCUS_26030 66839 67864 gene locus_tag LOCUS_26040 66839 67864 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 protein_id gnl|my_center|LOCUS_26040 68043 69440 gene locus_tag LOCUS_26050 68043 69440 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978182.1 protein_id gnl|my_center|LOCUS_26050 70138 69629 gene locus_tag LOCUS_26060 70138 69629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 70481 71452 gene locus_tag LOCUS_26070 70481 71452 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978367.1 protein_id gnl|my_center|LOCUS_26070 71449 72597 gene locus_tag LOCUS_26080 71449 72597 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_26080 72594 73424 gene locus_tag LOCUS_26090 72594 73424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_26090 74989 73661 gene locus_tag LOCUS_26100 gene clcA 74989 73661 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 protein_id gnl|my_center|LOCUS_26100 76035 75016 gene locus_tag LOCUS_26110 76035 75016 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_26110 76256 76068 gene locus_tag LOCUS_26120 76256 76068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 76255 77748 gene locus_tag LOCUS_26130 76255 77748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088606.1 protein_id gnl|my_center|LOCUS_26130 78679 77765 gene locus_tag LOCUS_26140 78679 77765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 78792 80507 gene locus_tag LOCUS_26150 78792 80507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 80504 81331 gene locus_tag LOCUS_26160 80504 81331 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_26160 81328 82872 gene locus_tag LOCUS_26170 81328 82872 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_26170 83785 82892 gene locus_tag LOCUS_26180 83785 82892 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896372.1 protein_id gnl|my_center|LOCUS_26180 85166 83883 gene locus_tag LOCUS_26190 gene desA3 85166 83883 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_26190 86287 85175 gene locus_tag LOCUS_26200 86287 85175 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_26200 86911 86432 gene locus_tag LOCUS_26210 86911 86432 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776701.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence21 435 91 gene locus_tag LOCUS_26220 435 91 CDS product MmoB/DmpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893349.1 protein_id gnl|my_center|LOCUS_26220 1550 432 gene locus_tag LOCUS_26230 1550 432 CDS product toluene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226171.1 protein_id gnl|my_center|LOCUS_26230 2639 1599 gene locus_tag LOCUS_26240 2639 1599 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728054.1 protein_id gnl|my_center|LOCUS_26240 4637 3000 gene locus_tag LOCUS_26250 4637 3000 CDS product methane monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893346.1 protein_id gnl|my_center|LOCUS_26250 6010 4799 gene locus_tag LOCUS_26260 6010 4799 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227111.1 protein_id gnl|my_center|LOCUS_26260 7425 6043 gene locus_tag LOCUS_26270 7425 6043 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728048.1 protein_id gnl|my_center|LOCUS_26270 8039 9280 gene locus_tag LOCUS_26280 8039 9280 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227654.1 protein_id gnl|my_center|LOCUS_26280 10923 9718 gene locus_tag LOCUS_26290 10923 9718 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 protein_id gnl|my_center|LOCUS_26290 12134 10938 gene locus_tag LOCUS_26300 12134 10938 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783085.1 protein_id gnl|my_center|LOCUS_26300 12218 12691 gene locus_tag LOCUS_26310 12218 12691 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_26310 12793 12990 gene locus_tag LOCUS_26320 12793 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 14356 13007 gene locus_tag LOCUS_26330 14356 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_26330 14591 14331 gene locus_tag LOCUS_26340 14591 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 16399 14588 gene locus_tag LOCUS_26350 16399 14588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731322.1 protein_id gnl|my_center|LOCUS_26350 17344 16703 gene locus_tag LOCUS_26360 17344 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 17720 18613 gene locus_tag LOCUS_26370 17720 18613 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351200.1 protein_id gnl|my_center|LOCUS_26370 18697 19140 gene locus_tag LOCUS_26380 18697 19140 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088888.1 protein_id gnl|my_center|LOCUS_26380 19321 19596 gene locus_tag LOCUS_26390 19321 19596 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056989.1 protein_id gnl|my_center|LOCUS_26390 19759 20412 gene locus_tag LOCUS_26400 19759 20412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 protein_id gnl|my_center|LOCUS_26400 20393 21835 gene locus_tag LOCUS_26410 20393 21835 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_26410 21864 24047 gene locus_tag LOCUS_26420 gene malQ 21864 24047 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804935.1 protein_id gnl|my_center|LOCUS_26420 25236 24019 gene locus_tag LOCUS_26430 25236 24019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_26430 25356 26837 gene locus_tag LOCUS_26440 25356 26837 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079636.1 protein_id gnl|my_center|LOCUS_26440 27659 26880 gene locus_tag LOCUS_26450 27659 26880 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877238.1 protein_id gnl|my_center|LOCUS_26450 28197 27700 gene locus_tag LOCUS_26460 gene ybaK 28197 27700 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728005.1 protein_id gnl|my_center|LOCUS_26460 28373 29179 gene locus_tag LOCUS_26470 28373 29179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 29176 29463 gene locus_tag LOCUS_26480 gene rsrA 29176 29463 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056340.1 protein_id gnl|my_center|LOCUS_26480 29867 30067 gene locus_tag LOCUS_26490 29867 30067 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056341.1 protein_id gnl|my_center|LOCUS_26490 30110 31615 gene locus_tag LOCUS_26500 30110 31615 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229710.1 protein_id gnl|my_center|LOCUS_26500 31992 31738 gene locus_tag LOCUS_26510 gene whiB1 31992 31738 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 protein_id gnl|my_center|LOCUS_26510 32406 33686 gene locus_tag LOCUS_26520 32406 33686 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_26520 34573 33623 gene locus_tag LOCUS_26530 34573 33623 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080966.1 protein_id gnl|my_center|LOCUS_26530 34681 35112 gene locus_tag LOCUS_26540 34681 35112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877244.1 protein_id gnl|my_center|LOCUS_26540 35243 36031 gene locus_tag LOCUS_26550 35243 36031 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098387.1 protein_id gnl|my_center|LOCUS_26550 37355 36081 gene locus_tag LOCUS_26560 37355 36081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080978.1 protein_id gnl|my_center|LOCUS_26560 39003 37366 gene locus_tag LOCUS_26570 39003 37366 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728020.1 protein_id gnl|my_center|LOCUS_26570 39292 40005 gene locus_tag LOCUS_26580 39292 40005 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728021.1 protein_id gnl|my_center|LOCUS_26580 40130 40360 gene locus_tag LOCUS_26590 40130 40360 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_26590 41146 40448 gene locus_tag LOCUS_26600 41146 40448 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056360.1 protein_id gnl|my_center|LOCUS_26600 41282 42325 gene locus_tag LOCUS_26610 41282 42325 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728024.1 protein_id gnl|my_center|LOCUS_26610 42385 43593 gene locus_tag LOCUS_26620 gene moeZ 42385 43593 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111867.1 protein_id gnl|my_center|LOCUS_26620 43679 44533 gene locus_tag LOCUS_26630 43679 44533 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 protein_id gnl|my_center|LOCUS_26630 44771 46276 gene locus_tag LOCUS_26640 44771 46276 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077324.1 protein_id gnl|my_center|LOCUS_26640 46314 48899 gene locus_tag LOCUS_26650 gene nirB 46314 48899 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111865.1 protein_id gnl|my_center|LOCUS_26650 48896 49336 gene locus_tag LOCUS_26660 gene nirD 48896 49336 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005100148.1 protein_id gnl|my_center|LOCUS_26660 49342 50526 gene locus_tag LOCUS_26670 49342 50526 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080996.1 protein_id gnl|my_center|LOCUS_26670 50544 51287 gene locus_tag LOCUS_26680 50544 51287 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080998.1 protein_id gnl|my_center|LOCUS_26680 51597 51247 gene locus_tag LOCUS_26690 51597 51247 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728026.1 protein_id gnl|my_center|LOCUS_26690 52251 51661 gene locus_tag LOCUS_26700 52251 51661 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416843.1 protein_id gnl|my_center|LOCUS_26700 52294 52539 gene locus_tag LOCUS_26710 52294 52539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 52552 56016 gene locus_tag LOCUS_26720 52552 56016 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_26720 56009 59398 gene locus_tag LOCUS_26730 gene adnB 56009 59398 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416833.1 protein_id gnl|my_center|LOCUS_26730 59501 60571 gene locus_tag LOCUS_26740 59501 60571 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416831.1 protein_id gnl|my_center|LOCUS_26740 60607 61536 gene locus_tag LOCUS_26750 gene nudC 60607 61536 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056376.1 protein_id gnl|my_center|LOCUS_26750 62141 61857 gene locus_tag LOCUS_26760 gene mrx1 62141 61857 CDS product mycoredoxin Mrx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728032.1 protein_id gnl|my_center|LOCUS_26760 62226 64379 gene locus_tag LOCUS_26770 62226 64379 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111856.1 protein_id gnl|my_center|LOCUS_26770 64519 64827 gene locus_tag LOCUS_26780 64519 64827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 64990 65280 gene locus_tag LOCUS_26790 64990 65280 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098383.1 protein_id gnl|my_center|LOCUS_26790 66660 65344 gene locus_tag LOCUS_26800 66660 65344 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111848.1 protein_id gnl|my_center|LOCUS_26800 67626 66676 gene locus_tag LOCUS_26810 67626 66676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 protein_id gnl|my_center|LOCUS_26810 69205 67715 gene locus_tag LOCUS_26820 69205 67715 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081023.1 protein_id gnl|my_center|LOCUS_26820 69404 70417 gene locus_tag LOCUS_26830 69404 70417 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081025.1 protein_id gnl|my_center|LOCUS_26830 70981 70436 gene locus_tag LOCUS_26840 70981 70436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 71169 74156 gene locus_tag LOCUS_26850 71169 74156 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728043.1 protein_id gnl|my_center|LOCUS_26850 74486 74202 gene locus_tag LOCUS_26860 74486 74202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 74706 74782 gene locus_tag LOCUS_t00350 74706 74782 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence22 1784 714 gene locus_tag LOCUS_26870 1784 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2060 2716 gene locus_tag LOCUS_26880 2060 2716 CDS product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060617.1 protein_id gnl|my_center|LOCUS_26880 2881 3078 gene locus_tag LOCUS_26890 2881 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3475 3146 gene locus_tag LOCUS_26900 3475 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3850 4497 gene locus_tag LOCUS_26910 3850 4497 CDS product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060617.1 protein_id gnl|my_center|LOCUS_26910 4501 5454 gene locus_tag LOCUS_26920 4501 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 5568 6041 gene locus_tag LOCUS_26930 5568 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 6148 7041 gene locus_tag LOCUS_26940 6148 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113786.1 protein_id gnl|my_center|LOCUS_26940 7358 7056 gene locus_tag LOCUS_26950 7358 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 9241 7409 gene locus_tag LOCUS_26960 9241 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 10697 9273 gene locus_tag LOCUS_26970 gene iniC 10697 9273 CDS product isoniazid-induced dynamin-like GTPase IniC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401747.1 protein_id gnl|my_center|LOCUS_26970 12520 10694 gene locus_tag LOCUS_26980 12520 10694 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230961.1 protein_id gnl|my_center|LOCUS_26980 12566 14152 gene locus_tag LOCUS_26990 12566 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 14171 15382 gene locus_tag LOCUS_27000 14171 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 15745 15473 gene locus_tag LOCUS_27010 15745 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 16720 16187 gene locus_tag LOCUS_27020 16720 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 17920 17006 gene locus_tag LOCUS_27030 17920 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 19651 19499 gene locus_tag LOCUS_27040 19651 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 21713 20037 gene locus_tag LOCUS_27050 21713 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 25140 26144 gene locus_tag LOCUS_27060 25140 26144 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 protein_id gnl|my_center|LOCUS_27060 26372 26722 gene locus_tag LOCUS_27070 26372 26722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 27843 27205 gene locus_tag LOCUS_27080 27843 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 28644 30290 gene locus_tag LOCUS_27090 28644 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 30436 30960 gene locus_tag LOCUS_27100 30436 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 30957 31805 gene locus_tag LOCUS_27110 30957 31805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 31823 33190 gene locus_tag LOCUS_27120 31823 33190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 33648 33304 gene locus_tag LOCUS_27130 33648 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 33541 33825 gene locus_tag LOCUS_27140 33541 33825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 33870 34163 gene locus_tag LOCUS_27150 33870 34163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 34189 34458 gene locus_tag LOCUS_27160 34189 34458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 34404 35078 gene locus_tag LOCUS_27170 34404 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 35084 35980 gene locus_tag LOCUS_27180 35084 35980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 35974 37482 gene locus_tag LOCUS_27190 35974 37482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 37522 39018 gene locus_tag LOCUS_27200 37522 39018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_27200 39044 40123 gene locus_tag LOCUS_27210 39044 40123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 40145 42106 gene locus_tag LOCUS_27220 40145 42106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 42103 42501 gene locus_tag LOCUS_27230 42103 42501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 42494 44518 gene locus_tag LOCUS_27240 42494 44518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 44515 45063 gene locus_tag LOCUS_27250 44515 45063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 45106 45807 gene locus_tag LOCUS_27260 45106 45807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 45846 47735 gene locus_tag LOCUS_27270 45846 47735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 47732 48139 gene locus_tag LOCUS_27280 47732 48139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 48786 49367 gene locus_tag LOCUS_27290 48786 49367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 49478 55150 gene locus_tag LOCUS_27300 49478 55150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 55526 55317 gene locus_tag LOCUS_27310 55526 55317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 55483 55899 gene locus_tag LOCUS_27320 55483 55899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 56094 56525 gene locus_tag LOCUS_27330 56094 56525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 56545 56937 gene locus_tag LOCUS_27340 56545 56937 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230088.1 protein_id gnl|my_center|LOCUS_27340 57082 58800 gene locus_tag LOCUS_27350 57082 58800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 58960 59418 gene locus_tag LOCUS_27360 58960 59418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 59560 60654 gene locus_tag LOCUS_27370 59560 60654 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_27370 60885 60601 gene locus_tag LOCUS_27380 60885 60601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 61088 60882 gene locus_tag LOCUS_27390 61088 60882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 61543 61145 gene locus_tag LOCUS_27400 61543 61145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 61467 61871 gene locus_tag LOCUS_27410 61467 61871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 62779 61868 gene locus_tag LOCUS_27420 62779 61868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 69104 62904 gene locus_tag LOCUS_27430 69104 62904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 69288 69112 gene locus_tag LOCUS_27440 69288 69112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 69650 70189 gene locus_tag LOCUS_27450 69650 70189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 70207 70782 gene locus_tag LOCUS_27460 70207 70782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 70881 71765 gene locus_tag LOCUS_27470 70881 71765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 72366 71773 gene locus_tag LOCUS_27480 72366 71773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 72613 72404 gene locus_tag LOCUS_27490 72613 72404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 73201 72635 gene locus_tag LOCUS_27500 73201 72635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 73627 73205 gene locus_tag LOCUS_27510 73627 73205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 74037 73624 gene locus_tag LOCUS_27520 74037 73624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence23 1206 1493 gene locus_tag LOCUS_27530 1206 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1639 1890 gene locus_tag LOCUS_27540 1639 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1901 3493 gene locus_tag LOCUS_27550 1901 3493 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892189.1 protein_id gnl|my_center|LOCUS_27550 3565 3963 gene locus_tag LOCUS_27560 3565 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 5526 3973 gene locus_tag LOCUS_27570 5526 3973 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074376.1 protein_id gnl|my_center|LOCUS_27570 6898 5612 gene locus_tag LOCUS_27580 6898 5612 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085742.1 protein_id gnl|my_center|LOCUS_27580 6980 7636 gene locus_tag LOCUS_27590 6980 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401831.1 protein_id gnl|my_center|LOCUS_27590 9101 7695 gene locus_tag LOCUS_27600 9101 7695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730280.1 protein_id gnl|my_center|LOCUS_27600 10088 9162 gene locus_tag LOCUS_27610 10088 9162 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727169.1 protein_id gnl|my_center|LOCUS_27610 11249 10125 gene locus_tag LOCUS_27620 11249 10125 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_27620 11744 11292 gene locus_tag LOCUS_27630 11744 11292 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898414.1 protein_id gnl|my_center|LOCUS_27630 11971 13791 gene locus_tag LOCUS_27640 11971 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 14209 14940 gene locus_tag LOCUS_27650 14209 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 16037 15000 gene locus_tag LOCUS_27660 gene fbaA 16037 15000 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401856.1 protein_id gnl|my_center|LOCUS_27660 16264 16980 gene locus_tag LOCUS_27670 16264 16980 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727167.1 protein_id gnl|my_center|LOCUS_27670 17709 17017 gene locus_tag LOCUS_27680 17709 17017 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085726.1 protein_id gnl|my_center|LOCUS_27680 18280 17702 gene locus_tag LOCUS_27690 gene pyrE 18280 17702 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 protein_id gnl|my_center|LOCUS_27690 19246 18347 gene locus_tag LOCUS_27700 19246 18347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 20285 19284 gene locus_tag LOCUS_27710 20285 19284 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_27710 20959 20282 gene locus_tag LOCUS_27720 20959 20282 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053776210.1 protein_id gnl|my_center|LOCUS_27720 21947 20961 gene locus_tag LOCUS_27730 21947 20961 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227165.1 protein_id gnl|my_center|LOCUS_27730 22082 23200 gene locus_tag LOCUS_27740 22082 23200 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966697.1 protein_id gnl|my_center|LOCUS_27740 23197 24186 gene locus_tag LOCUS_27750 23197 24186 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088828.1 protein_id gnl|my_center|LOCUS_27750 24388 25749 gene locus_tag LOCUS_27760 24388 25749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227747.1 protein_id gnl|my_center|LOCUS_27760 25824 26429 gene locus_tag LOCUS_27770 25824 26429 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_27770 26426 26872 gene locus_tag LOCUS_27780 26426 26872 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066940.1 protein_id gnl|my_center|LOCUS_27780 26918 28231 gene locus_tag LOCUS_27790 26918 28231 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_27790 28246 31299 gene locus_tag LOCUS_27800 28246 31299 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228786.1 protein_id gnl|my_center|LOCUS_27800 31296 32828 gene locus_tag LOCUS_27810 31296 32828 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031393.1 protein_id gnl|my_center|LOCUS_27810 32875 34068 gene locus_tag LOCUS_27820 32875 34068 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728381.1 protein_id gnl|my_center|LOCUS_27820 34093 35331 gene locus_tag LOCUS_27830 34093 35331 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893854.1 protein_id gnl|my_center|LOCUS_27830 35328 36569 gene locus_tag LOCUS_27840 35328 36569 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_27840 37923 36535 gene locus_tag LOCUS_27850 37923 36535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091851.1 protein_id gnl|my_center|LOCUS_27850 38858 38040 gene locus_tag LOCUS_27860 38858 38040 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728378.1 protein_id gnl|my_center|LOCUS_27860 39321 38839 gene locus_tag LOCUS_27870 39321 38839 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893859.1 protein_id gnl|my_center|LOCUS_27870 40766 39360 gene locus_tag LOCUS_27880 40766 39360 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_27880 40823 41560 gene locus_tag LOCUS_27890 40823 41560 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877404.1 protein_id gnl|my_center|LOCUS_27890 42984 42055 gene locus_tag LOCUS_27900 42984 42055 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_27900 43667 42981 gene locus_tag LOCUS_27910 43667 42981 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223789.1 protein_id gnl|my_center|LOCUS_27910 46234 43685 gene locus_tag LOCUS_27920 gene kdpD 46234 43685 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915886.1 protein_id gnl|my_center|LOCUS_27920 46889 46254 gene locus_tag LOCUS_27930 46889 46254 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087732.1 protein_id gnl|my_center|LOCUS_27930 49056 46894 gene locus_tag LOCUS_27940 gene kdpB 49056 46894 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296651.1 protein_id gnl|my_center|LOCUS_27940 50870 49053 gene locus_tag LOCUS_27950 gene kdpA 50870 49053 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111699.1 protein_id gnl|my_center|LOCUS_27950 51654 52895 gene locus_tag LOCUS_27960 51654 52895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_27960 53355 54149 gene locus_tag LOCUS_27970 gene menB 53355 54149 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_27970 54150 55286 gene locus_tag LOCUS_27980 54150 55286 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173212.1 protein_id gnl|my_center|LOCUS_27980 55327 56229 gene locus_tag LOCUS_27990 55327 56229 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_27990 57328 56303 gene locus_tag LOCUS_28000 57328 56303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 58416 57394 gene locus_tag LOCUS_28010 58416 57394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 59234 58422 gene locus_tag LOCUS_28020 59234 58422 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_28020 60080 59271 gene locus_tag LOCUS_28030 60080 59271 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_28030 60953 60135 gene locus_tag LOCUS_28040 60953 60135 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002069758.1 protein_id gnl|my_center|LOCUS_28040 61117 61890 gene locus_tag LOCUS_28050 61117 61890 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_28050 62948 61902 gene locus_tag LOCUS_28060 62948 61902 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086613.1 protein_id gnl|my_center|LOCUS_28060 63814 62972 gene locus_tag LOCUS_28070 gene menB 63814 62972 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 protein_id gnl|my_center|LOCUS_28070 64577 63819 gene locus_tag LOCUS_28080 64577 63819 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_28080 65853 64621 gene locus_tag LOCUS_28090 65853 64621 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807983.1 protein_id gnl|my_center|LOCUS_28090 67049 65853 gene locus_tag LOCUS_28100 67049 65853 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_28100 67854 67051 gene locus_tag LOCUS_28110 67854 67051 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730124.1 protein_id gnl|my_center|LOCUS_28110 69020 67854 gene locus_tag LOCUS_28120 69020 67854 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 protein_id gnl|my_center|LOCUS_28120 70148 69087 gene locus_tag LOCUS_28130 70148 69087 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462348.1 protein_id gnl|my_center|LOCUS_28130 72117 70159 gene locus_tag LOCUS_28140 72117 70159 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_28140 73312 72131 gene locus_tag LOCUS_28150 73312 72131 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090524.1 protein_id gnl|my_center|LOCUS_28150 73381 73830 gene locus_tag LOCUS_28160 73381 73830 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086612.1 protein_id gnl|my_center|LOCUS_28160 73834 74250 gene locus_tag LOCUS_28170 73834 74250 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_28170 75143 74349 gene locus_tag LOCUS_28180 75143 74349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 76840 75146 gene locus_tag LOCUS_28190 gene fadK 76840 75146 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_28190 77132 78586 gene locus_tag LOCUS_28200 77132 78586 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457820.1 protein_id gnl|my_center|LOCUS_28200 78620 79540 gene locus_tag LOCUS_28210 78620 79540 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234814527.1 protein_id gnl|my_center|LOCUS_28210 79537 80184 gene locus_tag LOCUS_28220 79537 80184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 80511 80194 gene locus_tag LOCUS_28230 80511 80194 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_28230 80765 82096 gene locus_tag LOCUS_28240 80765 82096 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_28240 82093 83334 gene locus_tag LOCUS_28250 82093 83334 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_28250 83367 84476 gene locus_tag LOCUS_28260 83367 84476 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031178.1 protein_id gnl|my_center|LOCUS_28260 84752 85552 gene locus_tag LOCUS_28270 84752 85552 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484679.1 protein_id gnl|my_center|LOCUS_28270 85731 86966 gene locus_tag LOCUS_28280 85731 86966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 86979 87596 gene locus_tag LOCUS_28290 86979 87596 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_28290 89378 87654 gene locus_tag LOCUS_28300 89378 87654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 89486 90487 gene locus_tag LOCUS_28310 89486 90487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 91551 90604 gene locus_tag LOCUS_28320 91551 90604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 92479 91541 gene locus_tag LOCUS_28330 92479 91541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 93857 92544 gene locus_tag LOCUS_28340 93857 92544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 94180 95457 gene locus_tag LOCUS_28350 94180 95457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 95454 96041 gene locus_tag LOCUS_28360 95454 96041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 97349 95979 gene locus_tag LOCUS_28370 97349 95979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 98202 97399 gene locus_tag LOCUS_28380 98202 97399 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531489.1 protein_id gnl|my_center|LOCUS_28380 98453 98199 gene locus_tag LOCUS_28390 98453 98199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 98737 98546 gene locus_tag LOCUS_28400 98737 98546 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_28400 99937 98741 gene locus_tag LOCUS_28410 99937 98741 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918830.1 protein_id gnl|my_center|LOCUS_28410 101270 99951 gene locus_tag LOCUS_28420 101270 99951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 101701 101285 gene locus_tag LOCUS_28430 101701 101285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 101982 103592 gene locus_tag LOCUS_28440 101982 103592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 103589 104818 gene locus_tag LOCUS_28450 103589 104818 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229319.1 protein_id gnl|my_center|LOCUS_28450 104843 106276 gene locus_tag LOCUS_28460 104843 106276 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013720.1 protein_id gnl|my_center|LOCUS_28460 106315 107382 gene locus_tag LOCUS_28470 106315 107382 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083072.1 protein_id gnl|my_center|LOCUS_28470 107516 108109 gene locus_tag LOCUS_28480 107516 108109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 109192 108215 gene locus_tag LOCUS_28490 109192 108215 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_28490 110112 109225 gene locus_tag LOCUS_28500 110112 109225 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965686.1 protein_id gnl|my_center|LOCUS_28500 110561 110109 gene locus_tag LOCUS_28510 110561 110109 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_28510 111063 110668 gene locus_tag LOCUS_28520 111063 110668 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978131.1 protein_id gnl|my_center|LOCUS_28520 111806 111060 gene locus_tag LOCUS_28530 111806 111060 CDS product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893856.1 protein_id gnl|my_center|LOCUS_28530 112441 111836 gene locus_tag LOCUS_28540 112441 111836 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 protein_id gnl|my_center|LOCUS_28540 112696 113250 gene locus_tag LOCUS_28550 gene sigK 112696 113250 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_28550 113577 115814 gene locus_tag LOCUS_28560 113577 115814 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_28560 116805 115873 gene locus_tag LOCUS_28570 116805 115873 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877054.1 protein_id gnl|my_center|LOCUS_28570 118278 116860 gene locus_tag LOCUS_28580 118278 116860 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_28580 119781 118324 gene locus_tag LOCUS_28590 119781 118324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 120027 121529 gene locus_tag LOCUS_28600 120027 121529 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_28600 121543 122706 gene locus_tag LOCUS_28610 121543 122706 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727646.1 protein_id gnl|my_center|LOCUS_28610 123076 124230 gene locus_tag LOCUS_28620 123076 124230 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_28620 124376 125098 gene locus_tag LOCUS_28630 124376 125098 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_28630 125926 125111 gene locus_tag LOCUS_28640 125926 125111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918022.1 protein_id gnl|my_center|LOCUS_28640 127181 126030 gene locus_tag LOCUS_28650 127181 126030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 127295 127891 gene locus_tag LOCUS_28660 127295 127891 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416005.1 protein_id gnl|my_center|LOCUS_28660 127888 129444 gene locus_tag LOCUS_28670 gene qac 127888 129444 CDS product quaternary ammonium compound efflux MFS transporter QacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622776.1 protein_id gnl|my_center|LOCUS_28670 130428 129505 gene locus_tag LOCUS_28680 130428 129505 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113357.1 protein_id gnl|my_center|LOCUS_28680 131199 130483 gene locus_tag LOCUS_28690 131199 130483 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209266.1 protein_id gnl|my_center|LOCUS_28690 132440 131268 gene locus_tag LOCUS_28700 132440 131268 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206759.1 protein_id gnl|my_center|LOCUS_28700 133578 132487 gene locus_tag LOCUS_28710 133578 132487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 134678 133578 gene locus_tag LOCUS_28720 134678 133578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060708.1 protein_id gnl|my_center|LOCUS_28720 135484 134687 gene locus_tag LOCUS_28730 135484 134687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767689.1 protein_id gnl|my_center|LOCUS_28730 136350 135481 gene locus_tag LOCUS_28740 136350 135481 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268531.1 protein_id gnl|my_center|LOCUS_28740 137384 136347 gene locus_tag LOCUS_28750 137384 136347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 141244 137492 gene locus_tag LOCUS_28760 141244 137492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_28760 141409 142158 gene locus_tag LOCUS_28770 141409 142158 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227770.1 protein_id gnl|my_center|LOCUS_28770 142183 145506 gene locus_tag LOCUS_28780 gene fdh 142183 145506 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:142747..142749,aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_28780 145507 146541 gene locus_tag LOCUS_28790 145507 146541 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804586.1 protein_id gnl|my_center|LOCUS_28790 146538 147650 gene locus_tag LOCUS_28800 gene nrfD 146538 147650 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804587.1 protein_id gnl|my_center|LOCUS_28800 149096 148101 gene locus_tag LOCUS_28810 gene selD 149096 148101 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804588.1 protein_id gnl|my_center|LOCUS_28810 149162 149452 gene locus_tag LOCUS_28820 149162 149452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 149484 149578 gene locus_tag LOCUS_t00360 149484 149578 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 149676 150992 gene locus_tag LOCUS_28830 gene selA 149676 150992 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804589.1 protein_id gnl|my_center|LOCUS_28830 151031 152827 gene locus_tag LOCUS_28840 gene selB 151031 152827 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804590.1 protein_id gnl|my_center|LOCUS_28840 153488 152865 gene locus_tag LOCUS_28850 gene mftR 153488 152865 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727658.1 protein_id gnl|my_center|LOCUS_28850 153593 154447 gene locus_tag LOCUS_28860 153593 154447 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 protein_id gnl|my_center|LOCUS_28860 154461 155315 gene locus_tag LOCUS_28870 154461 155315 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 protein_id gnl|my_center|LOCUS_28870 155330 156262 gene locus_tag LOCUS_28880 155330 156262 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 protein_id gnl|my_center|LOCUS_28880 156302 157243 gene locus_tag LOCUS_28890 156302 157243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 157444 159051 gene locus_tag LOCUS_28900 157444 159051 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_28900 161664 159112 gene locus_tag LOCUS_28910 gene clpB 161664 159112 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085713.1 protein_id gnl|my_center|LOCUS_28910 161860 163287 gene locus_tag LOCUS_28920 gene zwf 161860 163287 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_28920 165189 163303 gene locus_tag LOCUS_28930 165189 163303 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_28930 165396 165211 gene locus_tag LOCUS_28940 165396 165211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 165359 166597 gene locus_tag LOCUS_28950 165359 166597 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727666.1 protein_id gnl|my_center|LOCUS_28950 167398 166622 gene locus_tag LOCUS_28960 167398 166622 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731321.1 protein_id gnl|my_center|LOCUS_28960 167800 168354 gene locus_tag LOCUS_28970 167800 168354 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079520.1 protein_id gnl|my_center|LOCUS_28970 168387 169283 gene locus_tag LOCUS_28980 168387 169283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 169369 170850 gene locus_tag LOCUS_28990 169369 170850 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_28990 172378 170861 gene locus_tag LOCUS_29000 172378 170861 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_29000 172658 173674 gene locus_tag LOCUS_29010 172658 173674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729051.1 protein_id gnl|my_center|LOCUS_29010 173764 174231 gene locus_tag LOCUS_29020 173764 174231 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_29020 174280 176505 gene locus_tag LOCUS_29030 gene katG 174280 176505 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083865574.1 protein_id gnl|my_center|LOCUS_29030 176604 177083 gene locus_tag LOCUS_29040 176604 177083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_29040 177141 177830 gene locus_tag LOCUS_29050 177141 177830 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_29050 179227 177791 gene locus_tag LOCUS_29060 179227 177791 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086851586.1 protein_id gnl|my_center|LOCUS_29060 183465 179209 gene locus_tag LOCUS_29070 183465 179209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 184731 183610 gene locus_tag LOCUS_29080 184731 183610 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_29080 185002 184745 gene locus_tag LOCUS_29090 185002 184745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 184932 185339 gene locus_tag LOCUS_29100 184932 185339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 186924 185602 gene locus_tag LOCUS_29110 186924 185602 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223889.1 protein_id gnl|my_center|LOCUS_29110 187886 186921 gene locus_tag LOCUS_29120 187886 186921 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225962.1 protein_id gnl|my_center|LOCUS_29120 188562 187957 gene locus_tag LOCUS_29130 188562 187957 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661070.1 protein_id gnl|my_center|LOCUS_29130 188781 190115 gene locus_tag LOCUS_29140 188781 190115 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223886.1 protein_id gnl|my_center|LOCUS_29140 190115 190885 gene locus_tag LOCUS_29150 190115 190885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_29150 190882 191787 gene locus_tag LOCUS_29160 190882 191787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223884.1 protein_id gnl|my_center|LOCUS_29160 191879 193057 gene locus_tag LOCUS_29170 191879 193057 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_29170 193054 194385 gene locus_tag LOCUS_29180 193054 194385 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223882.1 protein_id gnl|my_center|LOCUS_29180 194382 195182 gene locus_tag LOCUS_29190 194382 195182 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_29190 195179 195790 gene locus_tag LOCUS_29200 195179 195790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 195787 197202 gene locus_tag LOCUS_29210 195787 197202 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296611.1 protein_id gnl|my_center|LOCUS_29210 197648 197163 gene locus_tag LOCUS_29220 197648 197163 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728592.1 protein_id gnl|my_center|LOCUS_29220 198458 197808 gene locus_tag LOCUS_29230 198458 197808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 198950 200242 gene locus_tag LOCUS_29240 198950 200242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 200717 200388 gene locus_tag LOCUS_29250 200717 200388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 201105 200767 gene locus_tag LOCUS_29260 201105 200767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 202341 201226 gene locus_tag LOCUS_29270 202341 201226 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 protein_id gnl|my_center|LOCUS_29270 202459 203463 gene locus_tag LOCUS_29280 202459 203463 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_29280 203549 203872 gene locus_tag LOCUS_29290 203549 203872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 206158 204002 gene locus_tag LOCUS_29300 206158 204002 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_29300 207893 206232 gene locus_tag LOCUS_29310 207893 206232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092467.1 protein_id gnl|my_center|LOCUS_29310 208828 207890 gene locus_tag LOCUS_29320 208828 207890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_29320 209745 208831 gene locus_tag LOCUS_29330 209745 208831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384298.1 protein_id gnl|my_center|LOCUS_29330 211361 209790 gene locus_tag LOCUS_29340 211361 209790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 211620 213965 gene locus_tag LOCUS_29350 211620 213965 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_29350 214068 215051 gene locus_tag LOCUS_29360 214068 215051 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095055.1 protein_id gnl|my_center|LOCUS_29360 216257 215415 gene locus_tag LOCUS_29370 216257 215415 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114312.1 protein_id gnl|my_center|LOCUS_29370 216365 217534 gene locus_tag LOCUS_29380 216365 217534 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 protein_id gnl|my_center|LOCUS_29380 218119 217826 gene locus_tag LOCUS_29390 gene catC 218119 217826 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 protein_id gnl|my_center|LOCUS_29390 218985 218119 gene locus_tag LOCUS_29400 gene catA 218985 218119 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728003.1 protein_id gnl|my_center|LOCUS_29400 220152 219049 gene locus_tag LOCUS_29410 220152 219049 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728002.1 protein_id gnl|my_center|LOCUS_29410 221141 220149 gene locus_tag LOCUS_29420 221141 220149 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728001.1 protein_id gnl|my_center|LOCUS_29420 221361 222743 gene locus_tag LOCUS_29430 gene benA 221361 222743 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728000.1 protein_id gnl|my_center|LOCUS_29430 222755 223312 gene locus_tag LOCUS_29440 gene benB 222755 223312 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727999.1 protein_id gnl|my_center|LOCUS_29440 223355 226189 gene locus_tag LOCUS_29450 gene benC 223355 226189 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727998.1 protein_id gnl|my_center|LOCUS_29450 226211 228943 gene locus_tag LOCUS_29460 226211 228943 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727994.1 protein_id gnl|my_center|LOCUS_29460 229718 229059 gene locus_tag LOCUS_29470 229718 229059 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727992.1 protein_id gnl|my_center|LOCUS_29470 230562 229729 gene locus_tag LOCUS_29480 230562 229729 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727991.1 protein_id gnl|my_center|LOCUS_29480 231326 230559 gene locus_tag LOCUS_29490 gene pcaD 231326 230559 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_29490 232561 231323 gene locus_tag LOCUS_29500 232561 231323 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727989.1 protein_id gnl|my_center|LOCUS_29500 232651 233538 gene locus_tag LOCUS_29510 232651 233538 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727988.1 protein_id gnl|my_center|LOCUS_29510 234403 233627 gene locus_tag LOCUS_29520 234403 233627 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066501.1 protein_id gnl|my_center|LOCUS_29520 235600 234539 gene locus_tag LOCUS_29530 235600 234539 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405716.1 protein_id gnl|my_center|LOCUS_29530 235690 236562 gene locus_tag LOCUS_29540 235690 236562 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726607.1 protein_id gnl|my_center|LOCUS_29540 236988 236698 gene locus_tag LOCUS_29550 236988 236698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29550 237476 236985 gene locus_tag LOCUS_29560 237476 236985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 237570 239051 gene locus_tag LOCUS_29570 237570 239051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_29570 239014 239283 gene locus_tag LOCUS_29580 239014 239283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 239928 239182 gene locus_tag LOCUS_29590 239928 239182 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064989.1 protein_id gnl|my_center|LOCUS_29590 241123 239972 gene locus_tag LOCUS_29600 241123 239972 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902894.1 protein_id gnl|my_center|LOCUS_29600 241275 242108 gene locus_tag LOCUS_29610 241275 242108 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_29610 242210 243130 gene locus_tag LOCUS_29620 242210 243130 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 protein_id gnl|my_center|LOCUS_29620 243175 244314 gene locus_tag LOCUS_29630 243175 244314 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728360.1 protein_id gnl|my_center|LOCUS_29630 245506 244544 gene locus_tag LOCUS_29640 gene thpD 245506 244544 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804195.1 protein_id gnl|my_center|LOCUS_29640 247090 245735 gene locus_tag LOCUS_29650 gene hpnE 247090 245735 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_29650 248362 247175 gene locus_tag LOCUS_29660 248362 247175 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420258.1 protein_id gnl|my_center|LOCUS_29660 248979 248359 gene locus_tag LOCUS_29670 248979 248359 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223939.1 protein_id gnl|my_center|LOCUS_29670 249751 249098 gene locus_tag LOCUS_29680 249751 249098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 249873 250862 gene locus_tag LOCUS_29690 249873 250862 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978370.1 protein_id gnl|my_center|LOCUS_29690 250934 252220 gene locus_tag LOCUS_29700 250934 252220 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407926.1 protein_id gnl|my_center|LOCUS_29700 252950 252222 gene locus_tag LOCUS_29710 252950 252222 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_29710 253936 253076 gene locus_tag LOCUS_29720 253936 253076 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727900.1 protein_id gnl|my_center|LOCUS_29720 254247 253999 gene locus_tag LOCUS_29730 254247 253999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 254473 255147 gene locus_tag LOCUS_29740 254473 255147 CDS product PAS and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088224.1 protein_id gnl|my_center|LOCUS_29740 255395 256516 gene locus_tag LOCUS_29750 255395 256516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 256509 257618 gene locus_tag LOCUS_29760 256509 257618 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 protein_id gnl|my_center|LOCUS_29760 257615 258595 gene locus_tag LOCUS_29770 257615 258595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 258592 259452 gene locus_tag LOCUS_29780 258592 259452 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119848.1 protein_id gnl|my_center|LOCUS_29780 259849 259424 gene locus_tag LOCUS_29790 259849 259424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 260170 260634 gene locus_tag LOCUS_29800 260170 260634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 260638 261816 gene locus_tag LOCUS_29810 260638 261816 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731403.1 protein_id gnl|my_center|LOCUS_29810 262678 261818 gene locus_tag LOCUS_29820 262678 261818 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624325.1 protein_id gnl|my_center|LOCUS_29820 263119 263565 gene locus_tag LOCUS_29830 263119 263565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 264391 263708 gene locus_tag LOCUS_29840 264391 263708 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_29840 265718 264531 gene locus_tag LOCUS_29850 265718 264531 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730427.1 protein_id gnl|my_center|LOCUS_29850 265870 266877 gene locus_tag LOCUS_29860 265870 266877 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040623.1 protein_id gnl|my_center|LOCUS_29860 267582 266908 gene locus_tag LOCUS_29870 267582 266908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 269273 267666 gene locus_tag LOCUS_29880 269273 267666 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098240.1 protein_id gnl|my_center|LOCUS_29880 269659 269270 gene locus_tag LOCUS_29890 269659 269270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 270150 269656 gene locus_tag LOCUS_29900 270150 269656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 270309 270917 gene locus_tag LOCUS_29910 270309 270917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 271041 272234 gene locus_tag LOCUS_29920 271041 272234 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256918.1 protein_id gnl|my_center|LOCUS_29920 272231 272965 gene locus_tag LOCUS_29930 272231 272965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 273177 272884 gene locus_tag LOCUS_29940 273177 272884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 273073 273834 gene locus_tag LOCUS_29950 273073 273834 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_29950 273831 275528 gene locus_tag LOCUS_29960 273831 275528 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039161.1 protein_id gnl|my_center|LOCUS_29960 275525 276766 gene locus_tag LOCUS_29970 275525 276766 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_29970 277091 276756 gene locus_tag LOCUS_29980 277091 276756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 277797 277066 gene locus_tag LOCUS_29990 277797 277066 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704829.1 protein_id gnl|my_center|LOCUS_29990 277890 278522 gene locus_tag LOCUS_30000 277890 278522 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070841.1 protein_id gnl|my_center|LOCUS_30000 279491 278544 gene locus_tag LOCUS_30010 279491 278544 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529597.1 protein_id gnl|my_center|LOCUS_30010 280186 279638 gene locus_tag LOCUS_30020 gene msrA 280186 279638 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897888.1 protein_id gnl|my_center|LOCUS_30020 280665 280183 gene locus_tag LOCUS_30030 gene msrB 280665 280183 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729815.1 protein_id gnl|my_center|LOCUS_30030 282087 280822 gene locus_tag LOCUS_30040 282087 280822 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_30040 283188 282100 gene locus_tag LOCUS_30050 283188 282100 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229059.1 protein_id gnl|my_center|LOCUS_30050 283435 284328 gene locus_tag LOCUS_30060 283435 284328 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878495.1 protein_id gnl|my_center|LOCUS_30060 284325 285380 gene locus_tag LOCUS_30070 gene dmpG 284325 285380 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_30070 285385 286881 gene locus_tag LOCUS_30080 285385 286881 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_30080 286887 287639 gene locus_tag LOCUS_30090 286887 287639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730379.1 protein_id gnl|my_center|LOCUS_30090 287683 288108 gene locus_tag LOCUS_30100 287683 288108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence24 567 25 gene locus_tag LOCUS_30110 567 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 729 1262 gene locus_tag LOCUS_30120 729 1262 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227754.1 protein_id gnl|my_center|LOCUS_30120 1255 2319 gene locus_tag LOCUS_30130 1255 2319 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 protein_id gnl|my_center|LOCUS_30130 2710 2378 gene locus_tag LOCUS_30140 2710 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2984 3421 gene locus_tag LOCUS_30150 2984 3421 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112171.1 protein_id gnl|my_center|LOCUS_30150 5067 3418 gene locus_tag LOCUS_30160 5067 3418 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_30160 5785 5120 gene locus_tag LOCUS_30170 5785 5120 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972206.1 protein_id gnl|my_center|LOCUS_30170 5936 7159 gene locus_tag LOCUS_30180 5936 7159 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972218.1 protein_id gnl|my_center|LOCUS_30180 8500 7166 gene locus_tag LOCUS_30190 8500 7166 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227809.1 protein_id gnl|my_center|LOCUS_30190 8761 8836 gene locus_tag LOCUS_t00370 8761 8836 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9843 8881 gene locus_tag LOCUS_30200 9843 8881 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 protein_id gnl|my_center|LOCUS_30200 9926 10150 gene locus_tag LOCUS_30210 9926 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 10181 10990 gene locus_tag LOCUS_30220 10181 10990 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 protein_id gnl|my_center|LOCUS_30220 10993 11754 gene locus_tag LOCUS_30230 gene cobF 10993 11754 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109722.1 protein_id gnl|my_center|LOCUS_30230 12667 11918 gene locus_tag LOCUS_30240 12667 11918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227890.1 protein_id gnl|my_center|LOCUS_30240 13469 12729 gene locus_tag LOCUS_30250 13469 12729 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 protein_id gnl|my_center|LOCUS_30250 13495 14385 gene locus_tag LOCUS_30260 13495 14385 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_30260 14496 15182 gene locus_tag LOCUS_30270 14496 15182 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896945.1 protein_id gnl|my_center|LOCUS_30270 15444 15788 gene locus_tag LOCUS_30280 15444 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 15799 16341 gene locus_tag LOCUS_30290 15799 16341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 18088 16391 gene locus_tag LOCUS_30300 gene pgi 18088 16391 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730607.1 protein_id gnl|my_center|LOCUS_30300 18588 18190 gene locus_tag LOCUS_30310 18588 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 18648 20486 gene locus_tag LOCUS_30320 18648 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 protein_id gnl|my_center|LOCUS_30320 22050 20494 gene locus_tag LOCUS_30330 22050 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 22269 24770 gene locus_tag LOCUS_30340 gene pcrA 22269 24770 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730603.1 protein_id gnl|my_center|LOCUS_30340 26304 25138 gene locus_tag LOCUS_30350 26304 25138 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404862.1 protein_id gnl|my_center|LOCUS_30350 26743 27906 gene locus_tag LOCUS_30360 gene sucC 26743 27906 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_30360 27921 28823 gene locus_tag LOCUS_30370 gene sucD 27921 28823 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_30370 28916 29623 gene locus_tag LOCUS_30380 28916 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 29620 30156 gene locus_tag LOCUS_30390 29620 30156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 30604 30140 gene locus_tag LOCUS_30400 30604 30140 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_30400 30753 32228 gene locus_tag LOCUS_30410 30753 32228 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_30410 32225 32635 gene locus_tag LOCUS_30420 32225 32635 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_30420 32719 33339 gene locus_tag LOCUS_30430 32719 33339 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222235.1 protein_id gnl|my_center|LOCUS_30430 34008 33355 gene locus_tag LOCUS_30440 34008 33355 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283977.1 protein_id gnl|my_center|LOCUS_30440 34239 34901 gene locus_tag LOCUS_30450 34239 34901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 34882 35676 gene locus_tag LOCUS_30460 34882 35676 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804576.1 protein_id gnl|my_center|LOCUS_30460 39271 35696 gene locus_tag LOCUS_30470 39271 35696 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227656.1 protein_id gnl|my_center|LOCUS_30470 39511 41088 gene locus_tag LOCUS_30480 39511 41088 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_30480 41211 43193 gene locus_tag LOCUS_30490 41211 43193 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 protein_id gnl|my_center|LOCUS_30490 43204 44349 gene locus_tag LOCUS_30500 43204 44349 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_30500 44346 44870 gene locus_tag LOCUS_30510 44346 44870 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412768.1 protein_id gnl|my_center|LOCUS_30510 44876 45811 gene locus_tag LOCUS_30520 gene citE 44876 45811 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412766.1 protein_id gnl|my_center|LOCUS_30520 45866 47509 gene locus_tag LOCUS_30530 45866 47509 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_30530 47506 49485 gene locus_tag LOCUS_30540 47506 49485 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134046.1 protein_id gnl|my_center|LOCUS_30540 49662 50867 gene locus_tag LOCUS_30550 49662 50867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 51062 52681 gene locus_tag LOCUS_30560 51062 52681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 52748 53404 gene locus_tag LOCUS_30570 gene purN 52748 53404 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_30570 53452 54975 gene locus_tag LOCUS_30580 gene purH 53452 54975 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730588.1 protein_id gnl|my_center|LOCUS_30580 55232 55705 gene locus_tag LOCUS_30590 55232 55705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 55716 56081 gene locus_tag LOCUS_30600 55716 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 55993 56772 gene locus_tag LOCUS_30610 55993 56772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726675.1 protein_id gnl|my_center|LOCUS_30610 56778 57851 gene locus_tag LOCUS_30620 56778 57851 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726676.1 protein_id gnl|my_center|LOCUS_30620 57832 58680 gene locus_tag LOCUS_30630 57832 58680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891448.1 protein_id gnl|my_center|LOCUS_30630 58932 59837 gene locus_tag LOCUS_30640 gene tauD 58932 59837 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004065.1 protein_id gnl|my_center|LOCUS_30640 60025 60420 gene locus_tag LOCUS_30650 60025 60420 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225945.1 protein_id gnl|my_center|LOCUS_30650 60417 60911 gene locus_tag LOCUS_30660 60417 60911 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 protein_id gnl|my_center|LOCUS_30660 60965 61531 gene locus_tag LOCUS_30670 60965 61531 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225943.1 protein_id gnl|my_center|LOCUS_30670 61542 62978 gene locus_tag LOCUS_30680 61542 62978 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 protein_id gnl|my_center|LOCUS_30680 63127 65130 gene locus_tag LOCUS_30690 63127 65130 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_30690 65897 65184 gene locus_tag LOCUS_30700 65897 65184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 66087 66725 gene locus_tag LOCUS_30710 66087 66725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30710 67665 66730 gene locus_tag LOCUS_30720 67665 66730 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859408.1 protein_id gnl|my_center|LOCUS_30720 67727 68491 gene locus_tag LOCUS_30730 67727 68491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 68642 69640 gene locus_tag LOCUS_30740 68642 69640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 69821 69994 gene locus_tag LOCUS_30750 gene rpmF 69821 69994 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 protein_id gnl|my_center|LOCUS_30750 70113 70721 gene locus_tag LOCUS_30760 70113 70721 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230062.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence25 2192 30 gene locus_tag LOCUS_30770 2192 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3523 2189 gene locus_tag LOCUS_30780 3523 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 4299 3520 gene locus_tag LOCUS_30790 4299 3520 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_30790 5303 4323 gene locus_tag LOCUS_30800 gene aglG 5303 4323 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_30800 6529 5369 gene locus_tag LOCUS_30810 6529 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 6894 7970 gene locus_tag LOCUS_30820 gene pstS 6894 7970 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730786.1 protein_id gnl|my_center|LOCUS_30820 8112 9140 gene locus_tag LOCUS_30830 gene pstC 8112 9140 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730785.1 protein_id gnl|my_center|LOCUS_30830 9143 10042 gene locus_tag LOCUS_30840 gene pstA 9143 10042 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 protein_id gnl|my_center|LOCUS_30840 10088 10864 gene locus_tag LOCUS_30850 gene pstB 10088 10864 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064266.1 protein_id gnl|my_center|LOCUS_30850 11123 10974 gene locus_tag LOCUS_30860 11123 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 11953 11291 gene locus_tag LOCUS_30870 gene phoU 11953 11291 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064270.1 protein_id gnl|my_center|LOCUS_30870 14318 12060 gene locus_tag LOCUS_30880 14318 12060 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115754.1 protein_id gnl|my_center|LOCUS_30880 15594 14497 gene locus_tag LOCUS_30890 gene dusB 15594 14497 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104395.1 protein_id gnl|my_center|LOCUS_30890 16820 15828 gene locus_tag LOCUS_30900 16820 15828 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 protein_id gnl|my_center|LOCUS_30900 17946 17200 gene locus_tag LOCUS_30910 17946 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 17857 19776 gene locus_tag LOCUS_30920 17857 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 19863 20609 gene locus_tag LOCUS_30930 19863 20609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 20742 22142 gene locus_tag LOCUS_30940 20742 22142 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 protein_id gnl|my_center|LOCUS_30940 22690 23904 gene locus_tag LOCUS_30950 22690 23904 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 protein_id gnl|my_center|LOCUS_30950 25875 23836 gene locus_tag LOCUS_30960 25875 23836 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_30960 26757 25915 gene locus_tag LOCUS_30970 gene nadE 26757 25915 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174904.1 protein_id gnl|my_center|LOCUS_30970 27255 26761 gene locus_tag LOCUS_30980 27255 26761 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730252.1 protein_id gnl|my_center|LOCUS_30980 27530 27252 gene locus_tag LOCUS_30990 27530 27252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 27615 28592 gene locus_tag LOCUS_31000 27615 28592 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_31000 29057 28617 gene locus_tag LOCUS_31010 29057 28617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 29160 30749 gene locus_tag LOCUS_31020 29160 30749 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727703.1 protein_id gnl|my_center|LOCUS_31020 30756 31931 gene locus_tag LOCUS_31030 30756 31931 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727702.1 protein_id gnl|my_center|LOCUS_31030 31971 32840 gene locus_tag LOCUS_31040 gene mmsB 31971 32840 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727701.1 protein_id gnl|my_center|LOCUS_31040 33818 32913 gene locus_tag LOCUS_31050 33818 32913 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 protein_id gnl|my_center|LOCUS_31050 34383 33895 gene locus_tag LOCUS_31060 34383 33895 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892879.1 protein_id gnl|my_center|LOCUS_31060 34958 34434 gene locus_tag LOCUS_31070 34958 34434 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_31070 35105 35614 gene locus_tag LOCUS_31080 35105 35614 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_31080 36167 54601 gene locus_tag LOCUS_31090 36167 54601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 54610 55659 gene locus_tag LOCUS_31100 54610 55659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 56806 56153 gene locus_tag LOCUS_31110 gene amtR 56806 56153 CDS product transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729715.1 protein_id gnl|my_center|LOCUS_31110 57056 58621 gene locus_tag LOCUS_31120 57056 58621 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728208.1 protein_id gnl|my_center|LOCUS_31120 59020 59883 gene locus_tag LOCUS_31130 59020 59883 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104257.1 protein_id gnl|my_center|LOCUS_31130 59899 60579 gene locus_tag LOCUS_31140 59899 60579 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893561.1 protein_id gnl|my_center|LOCUS_31140 60585 62699 gene locus_tag LOCUS_31150 60585 62699 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728209.1 protein_id gnl|my_center|LOCUS_31150 62696 64369 gene locus_tag LOCUS_31160 gene atzF 62696 64369 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728210.1 protein_id gnl|my_center|LOCUS_31160 64705 66297 gene locus_tag LOCUS_31170 64705 66297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 >Feature sequence26 1062 250 gene locus_tag LOCUS_31180 1062 250 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727651.1 protein_id gnl|my_center|LOCUS_31180 2336 1137 gene locus_tag LOCUS_31190 gene mftD 2336 1137 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112048.1 protein_id gnl|my_center|LOCUS_31190 3734 2439 gene locus_tag LOCUS_31200 gene mftC 3734 2439 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_31200 4229 3876 gene locus_tag LOCUS_31210 4229 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 4498 4229 gene locus_tag LOCUS_31220 4498 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 4497 5114 gene locus_tag LOCUS_31230 gene mftR 4497 5114 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112053.1 protein_id gnl|my_center|LOCUS_31230 5246 6304 gene locus_tag LOCUS_31240 5246 6304 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085433.1 protein_id gnl|my_center|LOCUS_31240 6357 6746 gene locus_tag LOCUS_31250 6357 6746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085450.1 protein_id gnl|my_center|LOCUS_31250 7575 6844 gene locus_tag LOCUS_31260 7575 6844 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113309.1 protein_id gnl|my_center|LOCUS_31260 8775 7582 gene locus_tag LOCUS_31270 8775 7582 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 protein_id gnl|my_center|LOCUS_31270 9436 8858 gene locus_tag LOCUS_31280 9436 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728637.1 protein_id gnl|my_center|LOCUS_31280 10080 9433 gene locus_tag LOCUS_31290 10080 9433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 10642 10103 gene locus_tag LOCUS_31300 10642 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 11262 10639 gene locus_tag LOCUS_31310 11262 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 12188 11259 gene locus_tag LOCUS_31320 12188 11259 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090402.1 protein_id gnl|my_center|LOCUS_31320 12897 12268 gene locus_tag LOCUS_31330 12897 12268 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079706.1 protein_id gnl|my_center|LOCUS_31330 13136 12894 gene locus_tag LOCUS_31340 13136 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 14240 13254 gene locus_tag LOCUS_31350 14240 13254 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_31350 14324 15259 gene locus_tag LOCUS_31360 14324 15259 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079707.1 protein_id gnl|my_center|LOCUS_31360 16131 15337 gene locus_tag LOCUS_31370 16131 15337 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_31370 17059 16163 gene locus_tag LOCUS_31380 17059 16163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 18175 17282 gene locus_tag LOCUS_31390 18175 17282 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727649.1 protein_id gnl|my_center|LOCUS_31390 18409 19287 gene locus_tag LOCUS_31400 18409 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 20654 19464 gene locus_tag LOCUS_31410 gene tuf 20654 19464 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892789.1 protein_id gnl|my_center|LOCUS_31410 22867 20762 gene locus_tag LOCUS_31420 gene fusA 22867 20762 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055595.1 protein_id gnl|my_center|LOCUS_31420 23426 22956 gene locus_tag LOCUS_31430 gene rpsG 23426 22956 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892787.1 protein_id gnl|my_center|LOCUS_31430 23804 23433 gene locus_tag LOCUS_31440 gene rpsL 23804 23433 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003929602.1 protein_id gnl|my_center|LOCUS_31440 25020 24247 gene locus_tag LOCUS_31450 25020 24247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 26000 25017 gene locus_tag LOCUS_31460 26000 25017 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402176.1 protein_id gnl|my_center|LOCUS_31460 26058 27617 gene locus_tag LOCUS_31470 26058 27617 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877555.1 protein_id gnl|my_center|LOCUS_31470 28760 27627 gene locus_tag LOCUS_31480 28760 27627 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338524.1 protein_id gnl|my_center|LOCUS_31480 28984 30498 gene locus_tag LOCUS_31490 gene dhaS 28984 30498 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_31490 30540 31658 gene locus_tag LOCUS_31500 30540 31658 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 protein_id gnl|my_center|LOCUS_31500 31767 32405 gene locus_tag LOCUS_31510 31767 32405 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650958.1 protein_id gnl|my_center|LOCUS_31510 33055 32402 gene locus_tag LOCUS_31520 33055 32402 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_31520 34241 33069 gene locus_tag LOCUS_31530 34241 33069 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730571.1 protein_id gnl|my_center|LOCUS_31530 35461 34301 gene locus_tag LOCUS_31540 35461 34301 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092833.1 protein_id gnl|my_center|LOCUS_31540 36326 35547 gene locus_tag LOCUS_31550 36326 35547 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_31550 37897 36986 gene locus_tag LOCUS_31560 37897 36986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 38076 38462 gene locus_tag LOCUS_31570 38076 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 38623 40212 gene locus_tag LOCUS_31580 gene fadD1 38623 40212 CDS product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730208.1 protein_id gnl|my_center|LOCUS_31580 40209 41330 gene locus_tag LOCUS_31590 40209 41330 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_31590 42207 41344 gene locus_tag LOCUS_31600 42207 41344 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228950.1 protein_id gnl|my_center|LOCUS_31600 42463 43509 gene locus_tag LOCUS_31610 42463 43509 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_31610 43513 44508 gene locus_tag LOCUS_31620 43513 44508 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400947.1 protein_id gnl|my_center|LOCUS_31620 45857 44949 gene locus_tag LOCUS_31630 45857 44949 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114066.1 protein_id gnl|my_center|LOCUS_31630 47122 45854 gene locus_tag LOCUS_31640 47122 45854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898398.1 protein_id gnl|my_center|LOCUS_31640 47674 47129 gene locus_tag LOCUS_31650 47674 47129 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084274.1 protein_id gnl|my_center|LOCUS_31650 47921 47730 gene locus_tag LOCUS_31660 47921 47730 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 protein_id gnl|my_center|LOCUS_31660 49288 47921 gene locus_tag LOCUS_31670 gene cyp51 49288 47921 CDS product lanosterol 14-alpha demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898577.1 protein_id gnl|my_center|LOCUS_31670 50097 49285 gene locus_tag LOCUS_31680 50097 49285 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730852.1 protein_id gnl|my_center|LOCUS_31680 51341 50097 gene locus_tag LOCUS_31690 51341 50097 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730851.1 protein_id gnl|my_center|LOCUS_31690 51922 51341 gene locus_tag LOCUS_31700 51922 51341 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 protein_id gnl|my_center|LOCUS_31700 51987 53453 gene locus_tag LOCUS_31710 51987 53453 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084280.1 protein_id gnl|my_center|LOCUS_31710 53527 54267 gene locus_tag LOCUS_31720 53527 54267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 protein_id gnl|my_center|LOCUS_31720 54264 55145 gene locus_tag LOCUS_31730 54264 55145 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403924.1 protein_id gnl|my_center|LOCUS_31730 55142 55531 gene locus_tag LOCUS_31740 55142 55531 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084283.1 protein_id gnl|my_center|LOCUS_31740 55540 56868 gene locus_tag LOCUS_31750 55540 56868 CDS product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 protein_id gnl|my_center|LOCUS_31750 57004 57879 gene locus_tag LOCUS_31760 gene ssuC 57004 57879 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 protein_id gnl|my_center|LOCUS_31760 57876 58652 gene locus_tag LOCUS_31770 57876 58652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767689.1 protein_id gnl|my_center|LOCUS_31770 58645 60285 gene locus_tag LOCUS_31780 58645 60285 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730601.1 protein_id gnl|my_center|LOCUS_31780 60282 60647 gene locus_tag LOCUS_31790 60282 60647 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730602.1 protein_id gnl|my_center|LOCUS_31790 60695 61729 gene locus_tag LOCUS_31800 60695 61729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 61726 62790 gene locus_tag LOCUS_31810 61726 62790 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144241.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence27 1757 75 gene locus_tag LOCUS_31820 1757 75 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_31820 2422 1757 gene locus_tag LOCUS_31830 2422 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 2644 2525 gene locus_tag LOCUS_31840 2644 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3285 2674 gene locus_tag LOCUS_31850 3285 2674 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_31850 3324 4439 gene locus_tag LOCUS_31860 3324 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_31860 4449 5471 gene locus_tag LOCUS_31870 4449 5471 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_31870 5468 7858 gene locus_tag LOCUS_31880 5468 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 9469 7871 gene locus_tag LOCUS_31890 9469 7871 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877518.1 protein_id gnl|my_center|LOCUS_31890 9643 10365 gene locus_tag LOCUS_31900 9643 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 11042 10677 gene locus_tag LOCUS_31910 11042 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 11426 11043 gene locus_tag LOCUS_31920 11426 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 12219 11683 gene locus_tag LOCUS_31930 12219 11683 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228949.1 protein_id gnl|my_center|LOCUS_31930 12697 12284 gene locus_tag LOCUS_31940 12697 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 13868 12699 gene locus_tag LOCUS_31950 13868 12699 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731042.1 protein_id gnl|my_center|LOCUS_31950 14386 13976 gene locus_tag LOCUS_31960 14386 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 15379 14513 gene locus_tag LOCUS_31970 15379 14513 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804078.1 protein_id gnl|my_center|LOCUS_31970 15550 16569 gene locus_tag LOCUS_31980 15550 16569 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804077.1 protein_id gnl|my_center|LOCUS_31980 16609 17022 gene locus_tag LOCUS_31990 16609 17022 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_31990 18057 17023 gene locus_tag LOCUS_32000 18057 17023 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728662.1 protein_id gnl|my_center|LOCUS_32000 18767 18054 gene locus_tag LOCUS_32010 18767 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 20245 18767 gene locus_tag LOCUS_32020 20245 18767 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906520.1 protein_id gnl|my_center|LOCUS_32020 21084 20257 gene locus_tag LOCUS_32030 21084 20257 CDS product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247126.1 protein_id gnl|my_center|LOCUS_32030 22535 21081 gene locus_tag LOCUS_32040 22535 21081 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_32040 23731 22532 gene locus_tag LOCUS_32050 23731 22532 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_32050 23897 25483 gene locus_tag LOCUS_32060 23897 25483 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_32060 25480 26109 gene locus_tag LOCUS_32070 25480 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 27245 26445 gene locus_tag LOCUS_32080 27245 26445 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731558.1 protein_id gnl|my_center|LOCUS_32080 27514 29247 gene locus_tag LOCUS_32090 27514 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 29441 30535 gene locus_tag LOCUS_32100 29441 30535 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_32100 30528 31613 gene locus_tag LOCUS_32110 30528 31613 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_32110 31642 31998 gene locus_tag LOCUS_32120 31642 31998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 31995 33092 gene locus_tag LOCUS_32130 31995 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 34761 33142 gene locus_tag LOCUS_32140 34761 33142 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878169.1 protein_id gnl|my_center|LOCUS_32140 36326 34758 gene locus_tag LOCUS_32150 36326 34758 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467246.1 protein_id gnl|my_center|LOCUS_32150 36646 36323 gene locus_tag LOCUS_32160 36646 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 37848 36910 gene locus_tag LOCUS_32170 37848 36910 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227174.1 protein_id gnl|my_center|LOCUS_32170 38984 37845 gene locus_tag LOCUS_32180 38984 37845 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_32180 39134 39751 gene locus_tag LOCUS_32190 39134 39751 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227176.1 protein_id gnl|my_center|LOCUS_32190 41025 39829 gene locus_tag LOCUS_32200 gene yjiB 41025 39829 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_32200 41235 41558 gene locus_tag LOCUS_32210 41235 41558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 42914 41601 gene locus_tag LOCUS_32220 42914 41601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 43614 44720 gene locus_tag LOCUS_32230 43614 44720 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226330.1 protein_id gnl|my_center|LOCUS_32230 45417 44773 gene locus_tag LOCUS_32240 45417 44773 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_32240 46521 45427 gene locus_tag LOCUS_32250 46521 45427 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_32250 47706 46726 gene locus_tag LOCUS_32260 47706 46726 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029747.1 protein_id gnl|my_center|LOCUS_32260 47993 47724 gene locus_tag LOCUS_32270 47993 47724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 48449 53944 gene locus_tag LOCUS_32280 48449 53944 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226015.1 protein_id gnl|my_center|LOCUS_32280 54575 54084 gene locus_tag LOCUS_32290 54575 54084 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_32290 55616 54627 gene locus_tag LOCUS_32300 55616 54627 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920257.1 protein_id gnl|my_center|LOCUS_32300 55739 56974 gene locus_tag LOCUS_32310 55739 56974 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173501.1 protein_id gnl|my_center|LOCUS_32310 56978 58015 gene locus_tag LOCUS_32320 56978 58015 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_32320 58044 58355 gene locus_tag LOCUS_32330 58044 58355 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_32330 58357 59178 gene locus_tag LOCUS_32340 58357 59178 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065256.1 protein_id gnl|my_center|LOCUS_32340 59222 60013 gene locus_tag LOCUS_32350 59222 60013 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_32350 60046 60843 gene locus_tag LOCUS_32360 60046 60843 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742177.1 protein_id gnl|my_center|LOCUS_32360 60845 61051 gene locus_tag LOCUS_32370 60845 61051 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257238.1 protein_id gnl|my_center|LOCUS_32370 61621 62865 gene locus_tag LOCUS_32380 61621 62865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence28 1625 111 gene locus_tag LOCUS_32390 1625 111 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726886.1 protein_id gnl|my_center|LOCUS_32390 1756 2865 gene locus_tag LOCUS_32400 1756 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3865 3083 gene locus_tag LOCUS_32410 3865 3083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730514.1 protein_id gnl|my_center|LOCUS_32410 4488 5012 gene locus_tag LOCUS_32420 4488 5012 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_32420 5093 6043 gene locus_tag LOCUS_32430 5093 6043 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104253.1 protein_id gnl|my_center|LOCUS_32430 6036 6395 gene locus_tag LOCUS_32440 6036 6395 CDS product MSMEG_0570 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_32440 6392 7663 gene locus_tag LOCUS_32450 6392 7663 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_32450 7996 9051 gene locus_tag LOCUS_32460 7996 9051 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_32460 9053 10483 gene locus_tag LOCUS_32470 9053 10483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891988.1 protein_id gnl|my_center|LOCUS_32470 10533 11381 gene locus_tag LOCUS_32480 10533 11381 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_32480 11378 12520 gene locus_tag LOCUS_32490 11378 12520 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_32490 12517 13554 gene locus_tag LOCUS_32500 12517 13554 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803681.1 protein_id gnl|my_center|LOCUS_32500 13565 13930 gene locus_tag LOCUS_32510 13565 13930 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 protein_id gnl|my_center|LOCUS_32510 13927 14961 gene locus_tag LOCUS_32520 13927 14961 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900084.1 protein_id gnl|my_center|LOCUS_32520 14961 15455 gene locus_tag LOCUS_32530 14961 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 15485 16093 gene locus_tag LOCUS_32540 15485 16093 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114376.1 protein_id gnl|my_center|LOCUS_32540 17792 16428 gene locus_tag LOCUS_32550 17792 16428 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727466.1 protein_id gnl|my_center|LOCUS_32550 19218 17944 gene locus_tag LOCUS_32560 19218 17944 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 protein_id gnl|my_center|LOCUS_32560 19735 19289 gene locus_tag LOCUS_32570 19735 19289 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928811.1 protein_id gnl|my_center|LOCUS_32570 21120 19849 gene locus_tag LOCUS_32580 21120 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 21708 22226 gene locus_tag LOCUS_32590 21708 22226 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028183.1 protein_id gnl|my_center|LOCUS_32590 22565 23806 gene locus_tag LOCUS_32600 22565 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 25624 24233 gene locus_tag LOCUS_32610 25624 24233 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110107303.1 protein_id gnl|my_center|LOCUS_32610 28440 26005 gene locus_tag LOCUS_32620 28440 26005 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224401.1 protein_id gnl|my_center|LOCUS_32620 29057 28647 gene locus_tag LOCUS_32630 29057 28647 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078910.1 protein_id gnl|my_center|LOCUS_32630 29508 29077 gene locus_tag LOCUS_32640 29508 29077 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224404.1 protein_id gnl|my_center|LOCUS_32640 31220 29550 gene locus_tag LOCUS_32650 31220 29550 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776135.1 protein_id gnl|my_center|LOCUS_32650 32419 31217 gene locus_tag LOCUS_32660 32419 31217 CDS product glucose-1-phosphate adenylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350023.1 protein_id gnl|my_center|LOCUS_32660 32559 33734 gene locus_tag LOCUS_32670 32559 33734 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_32670 34708 33755 gene locus_tag LOCUS_32680 34708 33755 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222345.1 protein_id gnl|my_center|LOCUS_32680 35607 34882 gene locus_tag LOCUS_32690 35607 34882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 35927 35604 gene locus_tag LOCUS_32700 35927 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 36260 36039 gene locus_tag LOCUS_32710 36260 36039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 37607 36477 gene locus_tag LOCUS_32720 37607 36477 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 protein_id gnl|my_center|LOCUS_32720 37969 37604 gene locus_tag LOCUS_32730 37969 37604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080063.1 protein_id gnl|my_center|LOCUS_32730 38206 38550 gene locus_tag LOCUS_32740 gene rbpA 38206 38550 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895305.1 protein_id gnl|my_center|LOCUS_32740 39445 38627 gene locus_tag LOCUS_32750 39445 38627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 41054 39429 gene locus_tag LOCUS_32760 gene lnt 41054 39429 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_32760 42769 41135 gene locus_tag LOCUS_32770 42769 41135 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729377.1 protein_id gnl|my_center|LOCUS_32770 43387 42878 gene locus_tag LOCUS_32780 gene fxsA 43387 42878 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895309.1 protein_id gnl|my_center|LOCUS_32780 47351 43551 gene locus_tag LOCUS_32790 gene cobN 47351 43551 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729378.1 protein_id gnl|my_center|LOCUS_32790 47563 48774 gene locus_tag LOCUS_32800 gene cobG 47563 48774 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_32800 48788 49411 gene locus_tag LOCUS_32810 48788 49411 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_32810 49414 51024 gene locus_tag LOCUS_32820 49414 51024 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086498.1 protein_id gnl|my_center|LOCUS_32820 51741 50977 gene locus_tag LOCUS_32830 51741 50977 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_32830 52514 51738 gene locus_tag LOCUS_32840 gene cobM 52514 51738 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_32840 53839 52511 gene locus_tag LOCUS_32850 53839 52511 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729388.1 protein_id gnl|my_center|LOCUS_32850 54741 53836 gene locus_tag LOCUS_32860 54741 53836 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900457.1 protein_id gnl|my_center|LOCUS_32860 54682 55083 gene locus_tag LOCUS_32870 54682 55083 CDS product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899157.1 protein_id gnl|my_center|LOCUS_32870 55252 56889 gene locus_tag LOCUS_32880 55252 56889 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence29 1086 307 gene locus_tag LOCUS_32890 gene aqpZ 1086 307 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091677.1 protein_id gnl|my_center|LOCUS_32890 2008 1247 gene locus_tag LOCUS_32900 2008 1247 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296441.1 protein_id gnl|my_center|LOCUS_32900 2766 2092 gene locus_tag LOCUS_32910 2766 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_32910 2873 3166 gene locus_tag LOCUS_32920 2873 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3163 3987 gene locus_tag LOCUS_32930 3163 3987 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 protein_id gnl|my_center|LOCUS_32930 4046 5989 gene locus_tag LOCUS_32940 4046 5989 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_32940 5991 6737 gene locus_tag LOCUS_32950 5991 6737 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_32950 7835 6801 gene locus_tag LOCUS_32960 7835 6801 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896593.1 protein_id gnl|my_center|LOCUS_32960 7942 8583 gene locus_tag LOCUS_32970 7942 8583 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730371.1 protein_id gnl|my_center|LOCUS_32970 8681 9832 gene locus_tag LOCUS_32980 8681 9832 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110589.1 protein_id gnl|my_center|LOCUS_32980 10075 11019 gene locus_tag LOCUS_32990 10075 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 11040 12026 gene locus_tag LOCUS_33000 11040 12026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 12023 13402 gene locus_tag LOCUS_33010 12023 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 13545 13470 gene locus_tag LOCUS_t00380 13545 13470 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14794 14123 gene locus_tag LOCUS_33020 14794 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 14813 15145 gene locus_tag LOCUS_33030 14813 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 15380 16123 gene locus_tag LOCUS_33040 15380 16123 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066682.1 protein_id gnl|my_center|LOCUS_33040 16139 16795 gene locus_tag LOCUS_33050 16139 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 17510 17070 gene locus_tag LOCUS_33060 gene paaI 17510 17070 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223461.1 protein_id gnl|my_center|LOCUS_33060 17821 17507 gene locus_tag LOCUS_33070 17821 17507 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_33070 19857 17818 gene locus_tag LOCUS_33080 gene paaZ 19857 17818 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113323.1 protein_id gnl|my_center|LOCUS_33080 20594 19950 gene locus_tag LOCUS_33090 20594 19950 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083226.1 protein_id gnl|my_center|LOCUS_33090 20710 21933 gene locus_tag LOCUS_33100 20710 21933 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113327.1 protein_id gnl|my_center|LOCUS_33100 21930 22667 gene locus_tag LOCUS_33110 21930 22667 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113991.1 protein_id gnl|my_center|LOCUS_33110 22664 23527 gene locus_tag LOCUS_33120 22664 23527 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 protein_id gnl|my_center|LOCUS_33120 23524 24303 gene locus_tag LOCUS_33130 23524 24303 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113330.1 protein_id gnl|my_center|LOCUS_33130 24381 25340 gene locus_tag LOCUS_33140 gene paaA 24381 25340 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083210.1 protein_id gnl|my_center|LOCUS_33140 25337 25699 gene locus_tag LOCUS_33150 gene paaB 25337 25699 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296362.1 protein_id gnl|my_center|LOCUS_33150 25705 26625 gene locus_tag LOCUS_33160 gene paaC 25705 26625 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083205.1 protein_id gnl|my_center|LOCUS_33160 26619 27140 gene locus_tag LOCUS_33170 gene paaJ 26619 27140 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113332.1 protein_id gnl|my_center|LOCUS_33170 27147 28265 gene locus_tag LOCUS_33180 gene paaK 27147 28265 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083203.1 protein_id gnl|my_center|LOCUS_33180 28302 29618 gene locus_tag LOCUS_33190 gene paaF 28302 29618 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083202.1 protein_id gnl|my_center|LOCUS_33190 29651 30619 gene locus_tag LOCUS_33200 29651 30619 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_33200 31798 30686 gene locus_tag LOCUS_33210 31798 30686 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_33210 33314 31827 gene locus_tag LOCUS_33220 33314 31827 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966249.1 protein_id gnl|my_center|LOCUS_33220 33767 34852 gene locus_tag LOCUS_33230 33767 34852 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015478.1 protein_id gnl|my_center|LOCUS_33230 35296 35220 gene locus_tag LOCUS_t00390 35296 35220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35409 36032 gene locus_tag LOCUS_33240 35409 36032 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057960.1 protein_id gnl|my_center|LOCUS_33240 36257 37591 gene locus_tag LOCUS_33250 36257 37591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_33250 38528 37716 gene locus_tag LOCUS_33260 38528 37716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_33260 39712 38525 gene locus_tag LOCUS_33270 39712 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 40694 39705 gene locus_tag LOCUS_33280 40694 39705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 41951 40698 gene locus_tag LOCUS_33290 41951 40698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 42174 42785 gene locus_tag LOCUS_33300 42174 42785 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076362.1 protein_id gnl|my_center|LOCUS_33300 42822 45626 gene locus_tag LOCUS_33310 gene polA 42822 45626 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111138.1 protein_id gnl|my_center|LOCUS_33310 45626 46711 gene locus_tag LOCUS_33320 45626 46711 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728949.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence30 516 893 gene locus_tag LOCUS_33330 516 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 2364 1201 gene locus_tag LOCUS_33340 2364 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 2257 3762 gene locus_tag LOCUS_33350 2257 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 3841 4824 gene locus_tag LOCUS_33360 3841 4824 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226156.1 protein_id gnl|my_center|LOCUS_33360 4927 6018 gene locus_tag LOCUS_33370 4927 6018 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730370.1 protein_id gnl|my_center|LOCUS_33370 6069 6776 gene locus_tag LOCUS_33380 6069 6776 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 protein_id gnl|my_center|LOCUS_33380 7108 7180 gene locus_tag LOCUS_t00400 7108 7180 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7712 7236 gene locus_tag LOCUS_33390 7712 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 8358 7705 gene locus_tag LOCUS_33400 8358 7705 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092923.1 protein_id gnl|my_center|LOCUS_33400 8483 8986 gene locus_tag LOCUS_33410 8483 8986 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_33410 8986 9324 gene locus_tag LOCUS_33420 8986 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 9321 9500 gene locus_tag LOCUS_33430 9321 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 9493 10047 gene locus_tag LOCUS_33440 9493 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 10044 10622 gene locus_tag LOCUS_33450 10044 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 10619 11167 gene locus_tag LOCUS_33460 10619 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 11240 11437 gene locus_tag LOCUS_33470 11240 11437 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088593.1 protein_id gnl|my_center|LOCUS_33470 12727 11522 gene locus_tag LOCUS_33480 12727 11522 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015557.1 protein_id gnl|my_center|LOCUS_33480 13418 12936 gene locus_tag LOCUS_33490 13418 12936 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729732.1 protein_id gnl|my_center|LOCUS_33490 13837 13415 gene locus_tag LOCUS_33500 13837 13415 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060606.1 protein_id gnl|my_center|LOCUS_33500 14696 14079 gene locus_tag LOCUS_33510 14696 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 14837 17731 gene locus_tag LOCUS_33520 gene aceE 14837 17731 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 protein_id gnl|my_center|LOCUS_33520 17969 17760 gene locus_tag LOCUS_33530 17969 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 17850 19079 gene locus_tag LOCUS_33540 17850 19079 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085223.1 protein_id gnl|my_center|LOCUS_33540 19284 20183 gene locus_tag LOCUS_33550 19284 20183 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878004.1 protein_id gnl|my_center|LOCUS_33550 20316 20618 gene locus_tag LOCUS_33560 gene acpM 20316 20618 CDS product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895721.1 protein_id gnl|my_center|LOCUS_33560 20618 21886 gene locus_tag LOCUS_33570 gene kasA 20618 21886 CDS product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729736.1 protein_id gnl|my_center|LOCUS_33570 21924 23375 gene locus_tag LOCUS_33580 21924 23375 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_33580 23968 23450 gene locus_tag LOCUS_33590 23968 23450 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908531.1 protein_id gnl|my_center|LOCUS_33590 24915 24097 gene locus_tag LOCUS_33600 24915 24097 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224592.1 protein_id gnl|my_center|LOCUS_33600 26069 24939 gene locus_tag LOCUS_33610 26069 24939 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897267.1 protein_id gnl|my_center|LOCUS_33610 27930 26326 gene locus_tag LOCUS_33620 gene fadD5 27930 26326 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127917152.1 protein_id gnl|my_center|LOCUS_33620 28872 28009 gene locus_tag LOCUS_33630 28872 28009 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079775.1 protein_id gnl|my_center|LOCUS_33630 29017 30204 gene locus_tag LOCUS_33640 29017 30204 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876881.1 protein_id gnl|my_center|LOCUS_33640 31656 30745 gene locus_tag LOCUS_33650 31656 30745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 32144 31719 gene locus_tag LOCUS_33660 32144 31719 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974563.1 protein_id gnl|my_center|LOCUS_33660 32963 32211 gene locus_tag LOCUS_33670 32963 32211 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079937.1 protein_id gnl|my_center|LOCUS_33670 33729 33082 gene locus_tag LOCUS_33680 33729 33082 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_33680 34712 33852 gene locus_tag LOCUS_33690 34712 33852 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_33690 34819 35211 gene locus_tag LOCUS_33700 34819 35211 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224929.1 protein_id gnl|my_center|LOCUS_33700 35272 35460 gene locus_tag LOCUS_33710 35272 35460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 36591 35530 gene locus_tag LOCUS_33720 36591 35530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_33720 36760 36687 gene locus_tag LOCUS_t00410 36760 36687 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 36990 36751 gene locus_tag LOCUS_33730 36990 36751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 37058 37132 gene locus_tag LOCUS_t00420 37058 37132 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 37454 37170 gene locus_tag LOCUS_33740 37454 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 38046 37489 gene locus_tag LOCUS_33750 38046 37489 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 protein_id gnl|my_center|LOCUS_33750 40085 38163 gene locus_tag LOCUS_33760 gene dnaG 40085 38163 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085036.1 protein_id gnl|my_center|LOCUS_33760 41466 40150 gene locus_tag LOCUS_33770 41466 40150 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085034.1 protein_id gnl|my_center|LOCUS_33770 42046 41459 gene locus_tag LOCUS_33780 42046 41459 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_33780 43483 42098 gene locus_tag LOCUS_33790 43483 42098 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 protein_id gnl|my_center|LOCUS_33790 43747 45225 gene locus_tag LOCUS_33800 43747 45225 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095059.1 protein_id gnl|my_center|LOCUS_33800 45311 45685 gene locus_tag LOCUS_33810 45311 45685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 45682 46110 gene locus_tag LOCUS_33820 45682 46110 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228384.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence31 298 11172 gene locus_tag LOCUS_33830 298 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 14011 11663 gene locus_tag LOCUS_33840 14011 11663 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_33840 14730 14008 gene locus_tag LOCUS_33850 14730 14008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803677.1 protein_id gnl|my_center|LOCUS_33850 15904 14810 gene locus_tag LOCUS_33860 15904 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 16258 16052 gene locus_tag LOCUS_33870 16258 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 16910 16212 gene locus_tag LOCUS_33880 16910 16212 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895255.1 protein_id gnl|my_center|LOCUS_33880 17154 20036 gene locus_tag LOCUS_33890 gene uvrA 17154 20036 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895254.1 protein_id gnl|my_center|LOCUS_33890 20435 20148 gene locus_tag LOCUS_33900 20435 20148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227717.1 protein_id gnl|my_center|LOCUS_33900 21025 20600 gene locus_tag LOCUS_33910 21025 20600 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 protein_id gnl|my_center|LOCUS_33910 21456 21932 gene locus_tag LOCUS_33920 gene infC 21456 21932 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729330.1 protein_id gnl|my_center|LOCUS_33920 22049 22243 gene locus_tag LOCUS_33930 gene rpmI 22049 22243 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058702.1 protein_id gnl|my_center|LOCUS_33930 22287 22667 gene locus_tag LOCUS_33940 gene rplT 22287 22667 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895237.1 protein_id gnl|my_center|LOCUS_33940 22715 23524 gene locus_tag LOCUS_33950 22715 23524 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_33950 23677 23480 gene locus_tag LOCUS_33960 23677 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 23640 26042 gene locus_tag LOCUS_33970 23640 26042 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_33970 26239 27609 gene locus_tag LOCUS_33980 26239 27609 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878255.1 protein_id gnl|my_center|LOCUS_33980 27735 28787 gene locus_tag LOCUS_33990 gene pheS 27735 28787 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895223.1 protein_id gnl|my_center|LOCUS_33990 28839 31316 gene locus_tag LOCUS_34000 gene pheT 28839 31316 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729318.1 protein_id gnl|my_center|LOCUS_34000 31398 32423 gene locus_tag LOCUS_34010 gene argC 31398 32423 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729317.1 protein_id gnl|my_center|LOCUS_34010 32420 33688 gene locus_tag LOCUS_34020 gene argJ 32420 33688 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408160.1 protein_id gnl|my_center|LOCUS_34020 33685 34602 gene locus_tag LOCUS_34030 gene argB 33685 34602 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895218.1 protein_id gnl|my_center|LOCUS_34030 34599 35861 gene locus_tag LOCUS_34040 34599 35861 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 protein_id gnl|my_center|LOCUS_34040 35858 36781 gene locus_tag LOCUS_34050 gene argF 35858 36781 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 protein_id gnl|my_center|LOCUS_34050 36812 37318 gene locus_tag LOCUS_34060 36812 37318 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058664.1 protein_id gnl|my_center|LOCUS_34060 37478 38677 gene locus_tag LOCUS_34070 37478 38677 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729313.1 protein_id gnl|my_center|LOCUS_34070 38674 40146 gene locus_tag LOCUS_34080 gene argH 38674 40146 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110848.1 protein_id gnl|my_center|LOCUS_34080 40242 43238 gene locus_tag LOCUS_34090 40242 43238 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 protein_id gnl|my_center|LOCUS_34090 43235 43459 gene locus_tag LOCUS_34100 43235 43459 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 protein_id gnl|my_center|LOCUS_34100 43548 44864 gene locus_tag LOCUS_34110 gene tyrS 43548 44864 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408375.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence32 596 1495 gene locus_tag LOCUS_34120 596 1495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 protein_id gnl|my_center|LOCUS_34120 1497 2456 gene locus_tag LOCUS_34130 1497 2456 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_34130 2453 3262 gene locus_tag LOCUS_34140 2453 3262 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_34140 4132 3269 gene locus_tag LOCUS_34150 4132 3269 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_34150 5314 4217 gene locus_tag LOCUS_34160 5314 4217 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_34160 6229 5654 gene locus_tag LOCUS_34170 6229 5654 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407809.1 protein_id gnl|my_center|LOCUS_34170 6455 7930 gene locus_tag LOCUS_34180 gene rpsA 6455 7930 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895279.1 protein_id gnl|my_center|LOCUS_34180 8611 8009 gene locus_tag LOCUS_34190 8611 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 10464 8608 gene locus_tag LOCUS_34200 10464 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 10439 11197 gene locus_tag LOCUS_34210 10439 11197 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_34210 11256 12521 gene locus_tag LOCUS_34220 gene aztD 11256 12521 CDS product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013328.1 protein_id gnl|my_center|LOCUS_34220 13458 12646 gene locus_tag LOCUS_34230 13458 12646 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877404.1 protein_id gnl|my_center|LOCUS_34230 13681 14601 gene locus_tag LOCUS_34240 gene coaE 13681 14601 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088698.1 protein_id gnl|my_center|LOCUS_34240 14737 15207 gene locus_tag LOCUS_34250 14737 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 15812 15231 gene locus_tag LOCUS_34260 15812 15231 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110813.1 protein_id gnl|my_center|LOCUS_34260 15951 18107 gene locus_tag LOCUS_34270 gene uvrB 15951 18107 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895262.1 protein_id gnl|my_center|LOCUS_34270 18281 18724 gene locus_tag LOCUS_34280 18281 18724 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075327.1 protein_id gnl|my_center|LOCUS_34280 19677 18784 gene locus_tag LOCUS_34290 19677 18784 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_34290 20147 28312 gene locus_tag LOCUS_34300 20147 28312 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213558087.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence33 518 258 gene locus_tag LOCUS_34310 518 258 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322946.1 protein_id gnl|my_center|LOCUS_34310 1194 820 gene locus_tag LOCUS_34320 1194 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 1898 1191 gene locus_tag LOCUS_34330 1898 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 1988 2242 gene locus_tag LOCUS_34340 1988 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 2274 2765 gene locus_tag LOCUS_34350 2274 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 4059 2785 gene locus_tag LOCUS_34360 4059 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 5150 4119 gene locus_tag LOCUS_34370 5150 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 5818 5150 gene locus_tag LOCUS_34380 5818 5150 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112689.1 protein_id gnl|my_center|LOCUS_34380 6504 5944 gene locus_tag LOCUS_34390 6504 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34390 7736 6426 gene locus_tag LOCUS_34400 7736 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34400 7821 8198 gene locus_tag LOCUS_34410 7821 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 8324 8560 gene locus_tag LOCUS_34420 8324 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 9176 9024 gene locus_tag LOCUS_34430 9176 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 9487 9173 gene locus_tag LOCUS_34440 9487 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 9679 10635 gene locus_tag LOCUS_34450 9679 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 11360 10692 gene locus_tag LOCUS_34460 11360 10692 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015525.1 protein_id gnl|my_center|LOCUS_34460 11647 12573 gene locus_tag LOCUS_34470 11647 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 12948 12625 gene locus_tag LOCUS_34480 12948 12625 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_34480 15202 12983 gene locus_tag LOCUS_34490 15202 12983 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_34490 17544 15199 gene locus_tag LOCUS_34500 17544 15199 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776000.1 protein_id gnl|my_center|LOCUS_34500 18560 17592 gene locus_tag LOCUS_34510 18560 17592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 protein_id gnl|my_center|LOCUS_34510 18857 18651 gene locus_tag LOCUS_34520 18857 18651 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_34520 19292 21274 gene locus_tag LOCUS_34530 19292 21274 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900808.1 protein_id gnl|my_center|LOCUS_34530 23461 21212 gene locus_tag LOCUS_34540 23461 21212 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156406754.1 protein_id gnl|my_center|LOCUS_34540 23621 23992 gene locus_tag LOCUS_34550 23621 23992 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_34550 23997 24929 gene locus_tag LOCUS_34560 23997 24929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 25583 25311 gene locus_tag LOCUS_34570 25583 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 27370 25580 gene locus_tag LOCUS_34580 gene ctaD 27370 25580 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 protein_id gnl|my_center|LOCUS_34580 28259 27603 gene locus_tag LOCUS_34590 28259 27603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 28927 29547 gene locus_tag LOCUS_34600 28927 29547 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 protein_id gnl|my_center|LOCUS_34600 29544 30356 gene locus_tag LOCUS_34610 29544 30356 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080301.1 protein_id gnl|my_center|LOCUS_34610 30615 31556 gene locus_tag LOCUS_34620 30615 31556 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_34620 32227 31655 gene locus_tag LOCUS_34630 32227 31655 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415007.1 protein_id gnl|my_center|LOCUS_34630 32937 32293 gene locus_tag LOCUS_34640 32937 32293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 33155 34657 gene locus_tag LOCUS_34650 gene lnt 33155 34657 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_34650 36863 34674 gene locus_tag LOCUS_34660 36863 34674 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 protein_id gnl|my_center|LOCUS_34660 37272 36856 gene locus_tag LOCUS_34670 37272 36856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 38562 37390 gene locus_tag LOCUS_34680 38562 37390 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 protein_id gnl|my_center|LOCUS_34680 39466 38846 gene locus_tag LOCUS_34690 39466 38846 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 protein_id gnl|my_center|LOCUS_34690 39450 39920 gene locus_tag LOCUS_34700 39450 39920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence34 1248 391 gene locus_tag LOCUS_34710 1248 391 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079691.1 protein_id gnl|my_center|LOCUS_34710 1610 2941 gene locus_tag LOCUS_34720 1610 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 4253 2889 gene locus_tag LOCUS_34730 4253 2889 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_34730 4330 4764 gene locus_tag LOCUS_34740 4330 4764 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894385.1 protein_id gnl|my_center|LOCUS_34740 4848 5843 gene locus_tag LOCUS_34750 4848 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 7017 5848 gene locus_tag LOCUS_34760 7017 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 7117 8268 gene locus_tag LOCUS_34770 7117 8268 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876850.1 protein_id gnl|my_center|LOCUS_34770 9396 8320 gene locus_tag LOCUS_34780 9396 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 10598 9495 gene locus_tag LOCUS_34790 10598 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_34790 11081 10614 gene locus_tag LOCUS_34800 11081 10614 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079984.1 protein_id gnl|my_center|LOCUS_34800 11603 11205 gene locus_tag LOCUS_34810 11603 11205 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323434.1 protein_id gnl|my_center|LOCUS_34810 12806 11604 gene locus_tag LOCUS_34820 gene dnaJ 12806 11604 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908930.1 protein_id gnl|my_center|LOCUS_34820 13547 12915 gene locus_tag LOCUS_34830 gene grpE 13547 12915 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086446.1 protein_id gnl|my_center|LOCUS_34830 15388 13544 gene locus_tag LOCUS_34840 gene dnaK 15388 13544 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892134.1 protein_id gnl|my_center|LOCUS_34840 15786 16901 gene locus_tag LOCUS_34850 15786 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112117.1 protein_id gnl|my_center|LOCUS_34850 16898 18145 gene locus_tag LOCUS_34860 16898 18145 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 protein_id gnl|my_center|LOCUS_34860 18944 18156 gene locus_tag LOCUS_34870 18944 18156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729892.1 protein_id gnl|my_center|LOCUS_34870 20104 18941 gene locus_tag LOCUS_34880 20104 18941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729891.1 protein_id gnl|my_center|LOCUS_34880 20778 20101 gene locus_tag LOCUS_34890 20778 20101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093300.1 protein_id gnl|my_center|LOCUS_34890 21845 20811 gene locus_tag LOCUS_34900 21845 20811 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115250.1 protein_id gnl|my_center|LOCUS_34900 22378 21851 gene locus_tag LOCUS_34910 22378 21851 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895885.1 protein_id gnl|my_center|LOCUS_34910 22480 23079 gene locus_tag LOCUS_34920 22480 23079 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878054.1 protein_id gnl|my_center|LOCUS_34920 23197 23970 gene locus_tag LOCUS_34930 23197 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 24072 25775 gene locus_tag LOCUS_34940 24072 25775 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912345.1 protein_id gnl|my_center|LOCUS_34940 28188 25846 gene locus_tag LOCUS_34950 gene lon 28188 25846 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 protein_id gnl|my_center|LOCUS_34950 28897 28253 gene locus_tag LOCUS_34960 28897 28253 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228774.1 protein_id gnl|my_center|LOCUS_34960 29141 28959 gene locus_tag LOCUS_34970 29141 28959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 29338 29757 gene locus_tag LOCUS_34980 29338 29757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_34980 31226 29754 gene locus_tag LOCUS_34990 31226 29754 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_34990 31902 31219 gene locus_tag LOCUS_35000 31902 31219 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258312.1 protein_id gnl|my_center|LOCUS_35000 32517 31960 gene locus_tag LOCUS_35010 32517 31960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727360.1 protein_id gnl|my_center|LOCUS_35010 32664 33569 gene locus_tag LOCUS_35020 32664 33569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_35020 33998 33597 gene locus_tag LOCUS_35030 33998 33597 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728875.1 protein_id gnl|my_center|LOCUS_35030 34879 34070 gene locus_tag LOCUS_35040 34879 34070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 35643 34918 gene locus_tag LOCUS_35050 35643 34918 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 protein_id gnl|my_center|LOCUS_35050 35714 36547 gene locus_tag LOCUS_35060 35714 36547 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730861.1 protein_id gnl|my_center|LOCUS_35060 36842 36558 gene locus_tag LOCUS_35070 36842 36558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533191.1 protein_id gnl|my_center|LOCUS_35070 38396 37011 gene locus_tag LOCUS_35080 38396 37011 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_35080 38922 38584 gene locus_tag LOCUS_35090 38922 38584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727896.1 protein_id gnl|my_center|LOCUS_35090 39287 38919 gene locus_tag LOCUS_35100 39287 38919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727897.1 protein_id gnl|my_center|LOCUS_35100 40513 39284 gene locus_tag LOCUS_35110 40513 39284 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727898.1 protein_id gnl|my_center|LOCUS_35110 40985 40518 gene locus_tag LOCUS_35120 40985 40518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 41254 41688 gene locus_tag LOCUS_35130 41254 41688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 41783 43675 gene locus_tag LOCUS_35140 41783 43675 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730615.1 protein_id gnl|my_center|LOCUS_35140 43689 44471 gene locus_tag LOCUS_35150 43689 44471 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730614.1 protein_id gnl|my_center|LOCUS_35150 45466 44462 gene locus_tag LOCUS_35160 45466 44462 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225980.1 protein_id gnl|my_center|LOCUS_35160 45619 45774 gene locus_tag LOCUS_35170 45619 45774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 46468 45806 gene locus_tag LOCUS_35180 46468 45806 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727155.1 protein_id gnl|my_center|LOCUS_35180 46437 46748 gene locus_tag LOCUS_35190 46437 46748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 46745 47770 gene locus_tag LOCUS_35200 46745 47770 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_35200 47856 48929 gene locus_tag LOCUS_35210 47856 48929 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113220.1 protein_id gnl|my_center|LOCUS_35210 48960 50045 gene locus_tag LOCUS_35220 48960 50045 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727153.1 protein_id gnl|my_center|LOCUS_35220 50985 50053 gene locus_tag LOCUS_35230 50985 50053 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 protein_id gnl|my_center|LOCUS_35230 52498 51140 gene locus_tag LOCUS_35240 52498 51140 CDS product oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067341.1 protein_id gnl|my_center|LOCUS_35240 53184 52624 gene locus_tag LOCUS_35250 53184 52624 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_35250 53325 55541 gene locus_tag LOCUS_35260 53325 55541 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 protein_id gnl|my_center|LOCUS_35260 56117 55545 gene locus_tag LOCUS_35270 56117 55545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 56273 57646 gene locus_tag LOCUS_35280 56273 57646 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071657.1 protein_id gnl|my_center|LOCUS_35280 57876 61544 gene locus_tag LOCUS_35290 57876 61544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 61706 63142 gene locus_tag LOCUS_35300 61706 63142 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159143.1 protein_id gnl|my_center|LOCUS_35300 63198 64460 gene locus_tag LOCUS_35310 63198 64460 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027247.1 protein_id gnl|my_center|LOCUS_35310 64542 65795 gene locus_tag LOCUS_35320 64542 65795 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892107.1 protein_id gnl|my_center|LOCUS_35320 66000 67781 gene locus_tag LOCUS_35330 66000 67781 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113145.1 protein_id gnl|my_center|LOCUS_35330 67778 68692 gene locus_tag LOCUS_35340 67778 68692 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729253.1 protein_id gnl|my_center|LOCUS_35340 68744 69868 gene locus_tag LOCUS_35350 68744 69868 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729254.1 protein_id gnl|my_center|LOCUS_35350 71437 69830 gene locus_tag LOCUS_35360 71437 69830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_35360 71568 72155 gene locus_tag LOCUS_35370 71568 72155 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818508.1 protein_id gnl|my_center|LOCUS_35370 73651 72158 gene locus_tag LOCUS_35380 73651 72158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 75183 73747 gene locus_tag LOCUS_35390 75183 73747 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876837.1 protein_id gnl|my_center|LOCUS_35390 75842 75270 gene locus_tag LOCUS_35400 gene dcd 75842 75270 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727114.1 protein_id gnl|my_center|LOCUS_35400 77381 75864 gene locus_tag LOCUS_35410 77381 75864 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113389.1 protein_id gnl|my_center|LOCUS_35410 77617 77690 gene locus_tag LOCUS_t00430 77617 77690 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 77788 78888 gene locus_tag LOCUS_35420 77788 78888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 78954 80462 gene locus_tag LOCUS_35430 78954 80462 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190875.1 protein_id gnl|my_center|LOCUS_35430 80663 80520 gene locus_tag LOCUS_35440 80663 80520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 80678 81094 gene locus_tag LOCUS_35450 80678 81094 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_35450 81213 81872 gene locus_tag LOCUS_35460 81213 81872 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_35460 82679 81912 gene locus_tag LOCUS_35470 82679 81912 CDS product LysR family substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111803.1 protein_id gnl|my_center|LOCUS_35470 82721 83104 gene locus_tag LOCUS_35480 82721 83104 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090410.1 protein_id gnl|my_center|LOCUS_35480 83766 83173 gene locus_tag LOCUS_35490 83766 83173 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_35490 83844 85019 gene locus_tag LOCUS_35500 83844 85019 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 protein_id gnl|my_center|LOCUS_35500 85119 85640 gene locus_tag LOCUS_35510 85119 85640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 85822 88038 gene locus_tag LOCUS_35520 85822 88038 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_35520 88076 88762 gene locus_tag LOCUS_35530 88076 88762 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_35530 88962 90032 gene locus_tag LOCUS_35540 88962 90032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 90410 91648 gene locus_tag LOCUS_35550 90410 91648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 91786 93789 gene locus_tag LOCUS_35560 91786 93789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35560 93782 94624 gene locus_tag LOCUS_35570 93782 94624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35570 94621 95403 gene locus_tag LOCUS_35580 94621 95403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_35580 95454 96131 gene locus_tag LOCUS_35590 95454 96131 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225231.1 protein_id gnl|my_center|LOCUS_35590 97634 96144 gene locus_tag LOCUS_35600 97634 96144 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485823.1 protein_id gnl|my_center|LOCUS_35600 97828 98463 gene locus_tag LOCUS_35610 97828 98463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 100054 98474 gene locus_tag LOCUS_35620 100054 98474 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225274.1 protein_id gnl|my_center|LOCUS_35620 100388 100188 gene locus_tag LOCUS_35630 100388 100188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 101721 100525 gene locus_tag LOCUS_35640 101721 100525 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_35640 101994 103085 gene locus_tag LOCUS_35650 101994 103085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111078.1 protein_id gnl|my_center|LOCUS_35650 103145 104011 gene locus_tag LOCUS_35660 103145 104011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225794.1 protein_id gnl|my_center|LOCUS_35660 104008 104478 gene locus_tag LOCUS_35670 104008 104478 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_35670 104488 105186 gene locus_tag LOCUS_35680 104488 105186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35680 107790 105268 gene locus_tag LOCUS_35690 107790 105268 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070771.1 protein_id gnl|my_center|LOCUS_35690 108752 108006 gene locus_tag LOCUS_35700 108752 108006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230970.1 protein_id gnl|my_center|LOCUS_35700 109672 108749 gene locus_tag LOCUS_35710 109672 108749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892221.1 protein_id gnl|my_center|LOCUS_35710 110512 109742 gene locus_tag LOCUS_35720 110512 109742 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078072.1 protein_id gnl|my_center|LOCUS_35720 110732 110532 gene locus_tag LOCUS_35730 gene thiS 110732 110532 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727196.1 protein_id gnl|my_center|LOCUS_35730 111793 110729 gene locus_tag LOCUS_35740 gene thiO 111793 110729 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727195.1 protein_id gnl|my_center|LOCUS_35740 111889 112671 gene locus_tag LOCUS_35750 gene thiE 111889 112671 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095063.1 protein_id gnl|my_center|LOCUS_35750 112997 113380 gene locus_tag LOCUS_35760 112997 113380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111810.1 protein_id gnl|my_center|LOCUS_35760 113880 113398 gene locus_tag LOCUS_35770 113880 113398 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876872.1 protein_id gnl|my_center|LOCUS_35770 114233 115684 gene locus_tag LOCUS_35780 gene glnX 114233 115684 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876871.1 protein_id gnl|my_center|LOCUS_35780 115681 116679 gene locus_tag LOCUS_35790 115681 116679 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900142.1 protein_id gnl|my_center|LOCUS_35790 116685 119303 gene locus_tag LOCUS_35800 116685 119303 CDS product serine/threonine-protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727190.1 protein_id gnl|my_center|LOCUS_35800 121150 119300 gene locus_tag LOCUS_35810 121150 119300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 122626 121424 gene locus_tag LOCUS_35820 122626 121424 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402097.1 protein_id gnl|my_center|LOCUS_35820 124842 122623 gene locus_tag LOCUS_35830 gene pta 124842 122623 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_35830 126508 124862 gene locus_tag LOCUS_35840 126508 124862 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_35840 127125 126523 gene locus_tag LOCUS_35850 127125 126523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 127757 127143 gene locus_tag LOCUS_35860 127757 127143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 128791 127715 gene locus_tag LOCUS_35870 128791 127715 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_35870 128882 129829 gene locus_tag LOCUS_35880 128882 129829 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_35880 130910 129900 gene locus_tag LOCUS_35890 gene fgd 130910 129900 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_35890 131732 131043 gene locus_tag LOCUS_35900 131732 131043 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227810.1 protein_id gnl|my_center|LOCUS_35900 132083 131886 gene locus_tag LOCUS_35910 132083 131886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 132025 133272 gene locus_tag LOCUS_35920 132025 133272 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111813.1 protein_id gnl|my_center|LOCUS_35920 133476 134207 gene locus_tag LOCUS_35930 133476 134207 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_35930 134296 136221 gene locus_tag LOCUS_35940 134296 136221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_35940 136762 136466 gene locus_tag LOCUS_35950 136762 136466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 137213 136821 gene locus_tag LOCUS_35960 137213 136821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 138129 137218 gene locus_tag LOCUS_35970 138129 137218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083496.1 protein_id gnl|my_center|LOCUS_35970 138350 142216 gene locus_tag LOCUS_35980 138350 142216 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113120.1 protein_id gnl|my_center|LOCUS_35980 143017 142430 gene locus_tag LOCUS_35990 143017 142430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 143125 144003 gene locus_tag LOCUS_36000 143125 144003 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 protein_id gnl|my_center|LOCUS_36000 144081 145151 gene locus_tag LOCUS_36010 144081 145151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 145899 145234 gene locus_tag LOCUS_36020 145899 145234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 146476 146003 gene locus_tag LOCUS_36030 146476 146003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 147756 146494 gene locus_tag LOCUS_36040 147756 146494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 148009 148224 gene locus_tag LOCUS_36050 148009 148224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 148341 149111 gene locus_tag LOCUS_36060 148341 149111 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_36060 149660 149121 gene locus_tag LOCUS_36070 149660 149121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 protein_id gnl|my_center|LOCUS_36070 149908 151743 gene locus_tag LOCUS_36080 149908 151743 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726920.1 protein_id gnl|my_center|LOCUS_36080 152592 151819 gene locus_tag LOCUS_36090 152592 151819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 153279 152686 gene locus_tag LOCUS_36100 153279 152686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 155613 153529 gene locus_tag LOCUS_36110 155613 153529 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029219.1 protein_id gnl|my_center|LOCUS_36110 156949 155732 gene locus_tag LOCUS_36120 156949 155732 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 protein_id gnl|my_center|LOCUS_36120 158424 157024 gene locus_tag LOCUS_36130 158424 157024 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 protein_id gnl|my_center|LOCUS_36130 159167 158730 gene locus_tag LOCUS_36140 159167 158730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 159956 159177 gene locus_tag LOCUS_36150 159956 159177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891557.1 protein_id gnl|my_center|LOCUS_36150 161663 160020 gene locus_tag LOCUS_36160 161663 160020 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_36160 163355 162024 gene locus_tag LOCUS_36170 163355 162024 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726890.1 protein_id gnl|my_center|LOCUS_36170 163446 164810 gene locus_tag LOCUS_36180 163446 164810 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908960.1 protein_id gnl|my_center|LOCUS_36180 164810 165712 gene locus_tag LOCUS_36190 164810 165712 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112405.1 protein_id gnl|my_center|LOCUS_36190 169268 165822 gene locus_tag LOCUS_36200 169268 165822 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_36200 169797 170465 gene locus_tag LOCUS_36210 169797 170465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 170886 170506 gene locus_tag LOCUS_36220 170886 170506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014272.1 protein_id gnl|my_center|LOCUS_36220 172064 170883 gene locus_tag LOCUS_36230 172064 170883 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156192226.1 protein_id gnl|my_center|LOCUS_36230 173309 172203 gene locus_tag LOCUS_36240 gene mcrC 173309 172203 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_36240 174997 173309 gene locus_tag LOCUS_36250 174997 173309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 176280 175102 gene locus_tag LOCUS_36260 176280 175102 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_36260 177800 176277 gene locus_tag LOCUS_36270 177800 176277 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_36270 178662 178060 gene locus_tag LOCUS_36280 178662 178060 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876752.1 protein_id gnl|my_center|LOCUS_36280 179705 178764 gene locus_tag LOCUS_36290 179705 178764 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908964.1 protein_id gnl|my_center|LOCUS_36290 179626 179937 gene locus_tag LOCUS_36300 179626 179937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 179999 180556 gene locus_tag LOCUS_36310 179999 180556 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 protein_id gnl|my_center|LOCUS_36310 180731 181696 gene locus_tag LOCUS_36320 180731 181696 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083148.1 protein_id gnl|my_center|LOCUS_36320 181725 182447 gene locus_tag LOCUS_36330 181725 182447 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727414.1 protein_id gnl|my_center|LOCUS_36330 182523 182723 gene locus_tag LOCUS_36340 182523 182723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 182970 187163 gene locus_tag LOCUS_36350 182970 187163 CDS product alpha-(1->3)-arabinofuranosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112422.1 protein_id gnl|my_center|LOCUS_36350 188323 189570 gene locus_tag LOCUS_36360 188323 189570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 190053 189583 gene locus_tag LOCUS_36370 190053 189583 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 protein_id gnl|my_center|LOCUS_36370 191402 190218 gene locus_tag LOCUS_36380 191402 190218 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229291.1 protein_id gnl|my_center|LOCUS_36380 191595 192533 gene locus_tag LOCUS_36390 191595 192533 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728516.1 protein_id gnl|my_center|LOCUS_36390 192548 194287 gene locus_tag LOCUS_36400 192548 194287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095415.1 protein_id gnl|my_center|LOCUS_36400 195395 194235 gene locus_tag LOCUS_36410 195395 194235 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296766.1 protein_id gnl|my_center|LOCUS_36410 195456 196235 gene locus_tag LOCUS_36420 195456 196235 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401240.1 protein_id gnl|my_center|LOCUS_36420 197109 196303 gene locus_tag LOCUS_36430 197109 196303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 199710 197164 gene locus_tag LOCUS_36440 199710 197164 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_36440 200547 199732 gene locus_tag LOCUS_36450 200547 199732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_36450 201646 200630 gene locus_tag LOCUS_36460 201646 200630 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 protein_id gnl|my_center|LOCUS_36460 203538 201712 gene locus_tag LOCUS_36470 203538 201712 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_36470 204149 203751 gene locus_tag LOCUS_36480 204149 203751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 205696 204155 gene locus_tag LOCUS_36490 205696 204155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 206571 205693 gene locus_tag LOCUS_36500 206571 205693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 206807 207598 gene locus_tag LOCUS_36510 gene trmB 206807 207598 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104289.1 protein_id gnl|my_center|LOCUS_36510 207591 208262 gene locus_tag LOCUS_36520 207591 208262 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104288.1 protein_id gnl|my_center|LOCUS_36520 208486 211779 gene locus_tag LOCUS_36530 208486 211779 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726778.1 protein_id gnl|my_center|LOCUS_36530 211985 213286 gene locus_tag LOCUS_36540 211985 213286 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015098.1 protein_id gnl|my_center|LOCUS_36540 214009 213332 gene locus_tag LOCUS_36550 214009 213332 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877615.1 protein_id gnl|my_center|LOCUS_36550 215241 214006 gene locus_tag LOCUS_36560 215241 214006 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728916.1 protein_id gnl|my_center|LOCUS_36560 216641 215238 gene locus_tag LOCUS_36570 216641 215238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 216738 217937 gene locus_tag LOCUS_36580 216738 217937 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079822.1 protein_id gnl|my_center|LOCUS_36580 217944 218408 gene locus_tag LOCUS_36590 217944 218408 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079821.1 protein_id gnl|my_center|LOCUS_36590 220142 218433 gene locus_tag LOCUS_36600 220142 218433 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_36600 220274 221017 gene locus_tag LOCUS_36610 220274 221017 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401107.1 protein_id gnl|my_center|LOCUS_36610 221088 221816 gene locus_tag LOCUS_36620 221088 221816 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_36620 221904 223256 gene locus_tag LOCUS_36630 221904 223256 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222324.1 protein_id gnl|my_center|LOCUS_36630 223253 224326 gene locus_tag LOCUS_36640 223253 224326 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_36640 224323 225027 gene locus_tag LOCUS_36650 224323 225027 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_36650 225030 225695 gene locus_tag LOCUS_36660 225030 225695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 225692 227473 gene locus_tag LOCUS_36670 gene atzF 225692 227473 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728210.1 protein_id gnl|my_center|LOCUS_36670 228268 227549 gene locus_tag LOCUS_36680 228268 227549 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090254.1 protein_id gnl|my_center|LOCUS_36680 229011 228268 gene locus_tag LOCUS_36690 229011 228268 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877731.1 protein_id gnl|my_center|LOCUS_36690 229109 229555 gene locus_tag LOCUS_36700 229109 229555 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224742.1 protein_id gnl|my_center|LOCUS_36700 231054 229600 gene locus_tag LOCUS_36710 231054 229600 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_36710 231488 231832 gene locus_tag LOCUS_36720 231488 231832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 231846 233828 gene locus_tag LOCUS_36730 231846 233828 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_36730 233825 234394 gene locus_tag LOCUS_36740 233825 234394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 235548 234421 gene locus_tag LOCUS_36750 235548 234421 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063753.1 protein_id gnl|my_center|LOCUS_36750 235943 236899 gene locus_tag LOCUS_36760 235943 236899 CDS product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230220.1 protein_id gnl|my_center|LOCUS_36760 237588 236974 gene locus_tag LOCUS_36770 237588 236974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36770 238349 237585 gene locus_tag LOCUS_36780 238349 237585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 239215 238346 gene locus_tag LOCUS_36790 239215 238346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_36790 240165 239212 gene locus_tag LOCUS_36800 240165 239212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_36800 241880 240276 gene locus_tag LOCUS_36810 241880 240276 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_36810 242002 242334 gene locus_tag LOCUS_36820 242002 242334 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877443.1 protein_id gnl|my_center|LOCUS_36820 242357 243214 gene locus_tag LOCUS_36830 242357 243214 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055673.1 protein_id gnl|my_center|LOCUS_36830 243233 243772 gene locus_tag LOCUS_36840 243233 243772 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_36840 243983 245503 gene locus_tag LOCUS_36850 243983 245503 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939933.1 protein_id gnl|my_center|LOCUS_36850 245551 245925 gene locus_tag LOCUS_36860 245551 245925 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859631.1 protein_id gnl|my_center|LOCUS_36860 245985 246503 gene locus_tag LOCUS_36870 245985 246503 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112900.1 protein_id gnl|my_center|LOCUS_36870 246572 247495 gene locus_tag LOCUS_36880 246572 247495 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972317.1 protein_id gnl|my_center|LOCUS_36880 247505 248503 gene locus_tag LOCUS_36890 247505 248503 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_36890 248500 249294 gene locus_tag LOCUS_36900 248500 249294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 249291 250034 gene locus_tag LOCUS_36910 249291 250034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098651.1 protein_id gnl|my_center|LOCUS_36910 >Feature sequence35 1020 361 gene locus_tag LOCUS_36920 1020 361 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079467.1 protein_id gnl|my_center|LOCUS_36920 1697 1017 gene locus_tag LOCUS_36930 1697 1017 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110996.1 protein_id gnl|my_center|LOCUS_36930 2566 1934 gene locus_tag LOCUS_36940 2566 1934 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 protein_id gnl|my_center|LOCUS_36940 3651 2563 gene locus_tag LOCUS_36950 3651 2563 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115042.1 protein_id gnl|my_center|LOCUS_36950 4005 4280 gene locus_tag LOCUS_36960 4005 4280 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_36960 5398 4475 gene locus_tag LOCUS_36970 5398 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 6442 5639 gene locus_tag LOCUS_36980 6442 5639 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030730.1 protein_id gnl|my_center|LOCUS_36980 6538 8115 gene locus_tag LOCUS_36990 6538 8115 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729448.1 protein_id gnl|my_center|LOCUS_36990 8982 8332 gene locus_tag LOCUS_37000 8982 8332 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_37000 9216 9797 gene locus_tag LOCUS_37010 9216 9797 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223196.1 protein_id gnl|my_center|LOCUS_37010 9937 10605 gene locus_tag LOCUS_37020 gene mpt83 9937 10605 CDS product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 protein_id gnl|my_center|LOCUS_37020 12927 10687 gene locus_tag LOCUS_37030 12927 10687 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 protein_id gnl|my_center|LOCUS_37030 13063 14541 gene locus_tag LOCUS_37040 13063 14541 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728107.1 protein_id gnl|my_center|LOCUS_37040 14785 16536 gene locus_tag LOCUS_37050 14785 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 16569 17231 gene locus_tag LOCUS_37060 16569 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 17281 18804 gene locus_tag LOCUS_37070 17281 18804 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_37070 19543 20052 gene locus_tag LOCUS_37080 19543 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 20450 20890 gene locus_tag LOCUS_37090 20450 20890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 20917 21525 gene locus_tag LOCUS_37100 20917 21525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 21764 22186 gene locus_tag LOCUS_37110 21764 22186 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230088.1 protein_id gnl|my_center|LOCUS_37110 22944 22522 gene locus_tag LOCUS_37120 22944 22522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 22826 23050 gene locus_tag LOCUS_37130 22826 23050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 23177 23392 gene locus_tag LOCUS_37140 23177 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 23953 23432 gene locus_tag LOCUS_37150 23953 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 25091 24093 gene locus_tag LOCUS_37160 25091 24093 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226916.1 protein_id gnl|my_center|LOCUS_37160 26088 25102 gene locus_tag LOCUS_37170 26088 25102 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226919.1 protein_id gnl|my_center|LOCUS_37170 27536 26085 gene locus_tag LOCUS_37180 27536 26085 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_37180 28521 27667 gene locus_tag LOCUS_37190 28521 27667 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 protein_id gnl|my_center|LOCUS_37190 29527 28907 gene locus_tag LOCUS_37200 29527 28907 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_37200 30330 29566 gene locus_tag LOCUS_37210 30330 29566 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_37210 30649 31284 gene locus_tag LOCUS_37220 30649 31284 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079975.1 protein_id gnl|my_center|LOCUS_37220 31735 31502 gene locus_tag LOCUS_37230 31735 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 32046 32426 gene locus_tag LOCUS_37240 32046 32426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 32552 32848 gene locus_tag LOCUS_37250 32552 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 34215 32905 gene locus_tag LOCUS_37260 34215 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 34368 35261 gene locus_tag LOCUS_37270 34368 35261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 35528 35950 gene locus_tag LOCUS_37280 35528 35950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 35947 36243 gene locus_tag LOCUS_37290 35947 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 36347 36526 gene locus_tag LOCUS_37300 36347 36526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 37631 36708 gene locus_tag LOCUS_37310 37631 36708 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730776.1 protein_id gnl|my_center|LOCUS_37310 37707 38348 gene locus_tag LOCUS_37320 37707 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 39286 38414 gene locus_tag LOCUS_37330 39286 38414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 >Feature sequence36 576 890 gene locus_tag LOCUS_37340 576 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 1223 1149 gene locus_tag LOCUS_t00440 1223 1149 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1318 1245 gene locus_tag LOCUS_t00450 1318 1245 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1413 1340 gene locus_tag LOCUS_t00460 1413 1340 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1667 1740 gene locus_tag LOCUS_t00470 1667 1740 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2585 1824 gene locus_tag LOCUS_37350 2585 1824 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775993.1 protein_id gnl|my_center|LOCUS_37350 2991 3320 gene locus_tag LOCUS_37360 2991 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 3633 3367 gene locus_tag LOCUS_37370 3633 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 3796 5148 gene locus_tag LOCUS_37380 3796 5148 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112852.1 protein_id gnl|my_center|LOCUS_37380 5362 5754 gene locus_tag LOCUS_37390 5362 5754 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 protein_id gnl|my_center|LOCUS_37390 5876 7969 gene locus_tag LOCUS_37400 gene thrS 5876 7969 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082399.1 protein_id gnl|my_center|LOCUS_37400 7962 8525 gene locus_tag LOCUS_37410 7962 8525 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057529.1 protein_id gnl|my_center|LOCUS_37410 8623 9324 gene locus_tag LOCUS_37420 8623 9324 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057532.1 protein_id gnl|my_center|LOCUS_37420 9321 10244 gene locus_tag LOCUS_37430 9321 10244 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082398.1 protein_id gnl|my_center|LOCUS_37430 10291 11415 gene locus_tag LOCUS_37440 10291 11415 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090090.1 protein_id gnl|my_center|LOCUS_37440 11415 11960 gene locus_tag LOCUS_37450 11415 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 12056 12967 gene locus_tag LOCUS_37460 gene pdxS 12056 12967 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939476.1 protein_id gnl|my_center|LOCUS_37460 13099 13965 gene locus_tag LOCUS_37470 13099 13965 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776167.1 protein_id gnl|my_center|LOCUS_37470 13977 14744 gene locus_tag LOCUS_37480 13977 14744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776164.1 protein_id gnl|my_center|LOCUS_37480 14915 15403 gene locus_tag LOCUS_37490 14915 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 15461 16321 gene locus_tag LOCUS_37500 15461 16321 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068926.1 protein_id gnl|my_center|LOCUS_37500 16318 16938 gene locus_tag LOCUS_37510 gene pdxT 16318 16938 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111403.1 protein_id gnl|my_center|LOCUS_37510 17081 17836 gene locus_tag LOCUS_37520 17081 17836 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_37520 17947 18507 gene locus_tag LOCUS_37530 gene ruvC 17947 18507 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894321.1 protein_id gnl|my_center|LOCUS_37530 18504 19097 gene locus_tag LOCUS_37540 gene ruvA 18504 19097 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_37540 19098 20186 gene locus_tag LOCUS_37550 gene ruvB 19098 20186 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 protein_id gnl|my_center|LOCUS_37550 20336 20719 gene locus_tag LOCUS_37560 gene yajC 20336 20719 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284470.1 protein_id gnl|my_center|LOCUS_37560 20972 22597 gene locus_tag LOCUS_37570 gene secD 20972 22597 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413385.1 protein_id gnl|my_center|LOCUS_37570 22594 23790 gene locus_tag LOCUS_37580 gene secF 22594 23790 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899387.1 protein_id gnl|my_center|LOCUS_37580 23801 25528 gene locus_tag LOCUS_37590 23801 25528 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093597.1 protein_id gnl|my_center|LOCUS_37590 25545 26120 gene locus_tag LOCUS_37600 25545 26120 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082386.1 protein_id gnl|my_center|LOCUS_37600 26229 28610 gene locus_tag LOCUS_37610 26229 28610 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894345.1 protein_id gnl|my_center|LOCUS_37610 29569 28649 gene locus_tag LOCUS_37620 29569 28649 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 protein_id gnl|my_center|LOCUS_37620 29805 30545 gene locus_tag LOCUS_37630 29805 30545 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068898.1 protein_id gnl|my_center|LOCUS_37630 30542 31807 gene locus_tag LOCUS_37640 gene hisS 30542 31807 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 protein_id gnl|my_center|LOCUS_37640 32497 31820 gene locus_tag LOCUS_37650 32497 31820 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727467.1 protein_id gnl|my_center|LOCUS_37650 32611 33288 gene locus_tag LOCUS_37660 32611 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 33285 34100 gene locus_tag LOCUS_37670 33285 34100 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060018.1 protein_id gnl|my_center|LOCUS_37670 35789 34116 gene locus_tag LOCUS_37680 35789 34116 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728748.1 protein_id gnl|my_center|LOCUS_37680 <36609 35786 gene locus_tag LOCUS_37690 <36609 35786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728749.1:neutral zinc metallopeptidase >Feature sequence37 <1 595 gene locus_tag LOCUS_37700 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224486.1:TIGR03086 family metal-binding protein 1389 898 gene locus_tag LOCUS_37710 1389 898 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466832.1 protein_id gnl|my_center|LOCUS_37710 2552 1389 gene locus_tag LOCUS_37720 2552 1389 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_37720 2985 4208 gene locus_tag LOCUS_37730 2985 4208 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 protein_id gnl|my_center|LOCUS_37730 4205 4669 gene locus_tag LOCUS_37740 4205 4669 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062283.1 protein_id gnl|my_center|LOCUS_37740 4909 5388 gene locus_tag LOCUS_37750 4909 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 5385 6023 gene locus_tag LOCUS_37760 5385 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 6020 6568 gene locus_tag LOCUS_37770 6020 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 7790 6612 gene locus_tag LOCUS_37780 7790 6612 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 protein_id gnl|my_center|LOCUS_37780 8840 7797 gene locus_tag LOCUS_37790 8840 7797 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 protein_id gnl|my_center|LOCUS_37790 9888 8857 gene locus_tag LOCUS_37800 9888 8857 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116049.1 protein_id gnl|my_center|LOCUS_37800 9981 11018 gene locus_tag LOCUS_37810 9981 11018 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078017.1 protein_id gnl|my_center|LOCUS_37810 11223 11858 gene locus_tag LOCUS_37820 11223 11858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 12736 11915 gene locus_tag LOCUS_37830 12736 11915 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086373.1 protein_id gnl|my_center|LOCUS_37830 12860 14485 gene locus_tag LOCUS_37840 12860 14485 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_37840 14509 15648 gene locus_tag LOCUS_37850 14509 15648 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_37850 16026 15742 gene locus_tag LOCUS_37860 16026 15742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 16352 16107 gene locus_tag LOCUS_37870 16352 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 18086 16701 gene locus_tag LOCUS_37880 18086 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 18498 18088 gene locus_tag LOCUS_37890 18498 18088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 20207 18675 gene locus_tag LOCUS_37900 gene fadD17 20207 18675 CDS product long-chain-fatty-acid--CoA ligase FadD17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730885.1 protein_id gnl|my_center|LOCUS_37900 21328 20204 gene locus_tag LOCUS_37910 21328 20204 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_37910 22555 21353 gene locus_tag LOCUS_37920 22555 21353 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094904.1 protein_id gnl|my_center|LOCUS_37920 22703 22897 gene locus_tag LOCUS_37930 22703 22897 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062259.1 protein_id gnl|my_center|LOCUS_37930 22980 23870 gene locus_tag LOCUS_37940 22980 23870 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078006.1 protein_id gnl|my_center|LOCUS_37940 23934 24698 gene locus_tag LOCUS_37950 23934 24698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071300.1 protein_id gnl|my_center|LOCUS_37950 24702 25553 gene locus_tag LOCUS_37960 24702 25553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418983.1 protein_id gnl|my_center|LOCUS_37960 25557 26732 gene locus_tag LOCUS_37970 25557 26732 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897298.1 protein_id gnl|my_center|LOCUS_37970 26725 27783 gene locus_tag LOCUS_37980 26725 27783 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085899.1 protein_id gnl|my_center|LOCUS_37980 27780 29000 gene locus_tag LOCUS_37990 27780 29000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 29002 30276 gene locus_tag LOCUS_38000 29002 30276 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730877.1 protein_id gnl|my_center|LOCUS_38000 30273 31550 gene locus_tag LOCUS_38010 30273 31550 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730084.1 protein_id gnl|my_center|LOCUS_38010 31550 32983 gene locus_tag LOCUS_38020 31550 32983 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062239.1 protein_id gnl|my_center|LOCUS_38020 32980 33945 gene locus_tag LOCUS_38030 32980 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 33945 34622 gene locus_tag LOCUS_38040 33945 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence38 1234 740 gene locus_tag LOCUS_38050 1234 740 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804237.1 protein_id gnl|my_center|LOCUS_38050 2120 1521 gene locus_tag LOCUS_38060 gene wrbA 2120 1521 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_38060 2255 3004 gene locus_tag LOCUS_38070 2255 3004 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_38070 3063 3332 gene locus_tag LOCUS_38080 3063 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 3412 3906 gene locus_tag LOCUS_38090 gene nsrR 3412 3906 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_38090 3988 5169 gene locus_tag LOCUS_38100 3988 5169 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_38100 5166 5600 gene locus_tag LOCUS_38110 5166 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077089871.1 protein_id gnl|my_center|LOCUS_38110 5868 6122 gene locus_tag LOCUS_38120 5868 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 6251 6976 gene locus_tag LOCUS_38130 6251 6976 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775986.1 protein_id gnl|my_center|LOCUS_38130 8231 6987 gene locus_tag LOCUS_38140 8231 6987 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 protein_id gnl|my_center|LOCUS_38140 10120 8300 gene locus_tag LOCUS_38150 10120 8300 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538267.1 protein_id gnl|my_center|LOCUS_38150 12200 10122 gene locus_tag LOCUS_38160 12200 10122 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_38160 12456 13013 gene locus_tag LOCUS_38170 12456 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 13010 14224 gene locus_tag LOCUS_38180 13010 14224 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_38180 14221 15603 gene locus_tag LOCUS_38190 14221 15603 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_38190 15682 16845 gene locus_tag LOCUS_38200 15682 16845 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_38200 16842 17681 gene locus_tag LOCUS_38210 16842 17681 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_38210 17714 17857 gene locus_tag LOCUS_38220 17714 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 18021 18419 gene locus_tag LOCUS_38230 18021 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 19044 18478 gene locus_tag LOCUS_38240 19044 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 19621 19073 gene locus_tag LOCUS_38250 19621 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 20148 19816 gene locus_tag LOCUS_38260 20148 19816 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_38260 20581 20138 gene locus_tag LOCUS_38270 20581 20138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 21095 20736 gene locus_tag LOCUS_38280 21095 20736 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728052.1 protein_id gnl|my_center|LOCUS_38280 21198 22070 gene locus_tag LOCUS_38290 21198 22070 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_38290 22653 24191 gene locus_tag LOCUS_38300 22653 24191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 24188 25144 gene locus_tag LOCUS_38310 24188 25144 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730358.1 protein_id gnl|my_center|LOCUS_38310 26230 25187 gene locus_tag LOCUS_38320 26230 25187 CDS product phenol 2-monooxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206216.1 protein_id gnl|my_center|LOCUS_38320 27444 26233 gene locus_tag LOCUS_38330 27444 26233 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173501.1 protein_id gnl|my_center|LOCUS_38330 27683 28615 gene locus_tag LOCUS_38340 27683 28615 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206714.1 protein_id gnl|my_center|LOCUS_38340 28734 29447 gene locus_tag LOCUS_38350 28734 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 29444 29893 gene locus_tag LOCUS_38360 29444 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 30084 31523 gene locus_tag LOCUS_38370 30084 31523 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731437.1 protein_id gnl|my_center|LOCUS_38370 31644 32603 gene locus_tag LOCUS_38380 31644 32603 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224997.1 protein_id gnl|my_center|LOCUS_38380 33422 32625 gene locus_tag LOCUS_38390 33422 32625 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111593.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence39 1874 522 gene locus_tag LOCUS_38400 1874 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 1807 2031 gene locus_tag LOCUS_38410 1807 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 3341 1974 gene locus_tag LOCUS_38420 3341 1974 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296698.1 protein_id gnl|my_center|LOCUS_38420 3538 4581 gene locus_tag LOCUS_38430 3538 4581 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056643.1 protein_id gnl|my_center|LOCUS_38430 4657 5790 gene locus_tag LOCUS_38440 4657 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413610.1 protein_id gnl|my_center|LOCUS_38440 5960 6169 gene locus_tag LOCUS_38450 5960 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 6186 7307 gene locus_tag LOCUS_38460 6186 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225426.1 protein_id gnl|my_center|LOCUS_38460 7355 8815 gene locus_tag LOCUS_38470 7355 8815 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726793.1 protein_id gnl|my_center|LOCUS_38470 9430 8825 gene locus_tag LOCUS_38480 9430 8825 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226114.1 protein_id gnl|my_center|LOCUS_38480 9905 9471 gene locus_tag LOCUS_38490 9905 9471 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896798.1 protein_id gnl|my_center|LOCUS_38490 11521 9920 gene locus_tag LOCUS_38500 11521 9920 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896797.1 protein_id gnl|my_center|LOCUS_38500 11709 12689 gene locus_tag LOCUS_38510 11709 12689 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222203.1 protein_id gnl|my_center|LOCUS_38510 14232 12706 gene locus_tag LOCUS_38520 14232 12706 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104247.1 protein_id gnl|my_center|LOCUS_38520 14443 16089 gene locus_tag LOCUS_38530 14443 16089 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901204.1 protein_id gnl|my_center|LOCUS_38530 16144 17157 gene locus_tag LOCUS_38540 16144 17157 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728075.1 protein_id gnl|my_center|LOCUS_38540 17341 18177 gene locus_tag LOCUS_38550 17341 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 18533 18880 gene locus_tag LOCUS_38560 18533 18880 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 protein_id gnl|my_center|LOCUS_38560 18931 19137 gene locus_tag LOCUS_38570 18931 19137 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_38570 19140 19325 gene locus_tag LOCUS_38580 19140 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 19322 21598 gene locus_tag LOCUS_38590 19322 21598 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_38590 23179 21686 gene locus_tag LOCUS_38600 23179 21686 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_38600 23299 24897 gene locus_tag LOCUS_38610 23299 24897 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112402.1 protein_id gnl|my_center|LOCUS_38610 25324 24926 gene locus_tag LOCUS_38620 25324 24926 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 protein_id gnl|my_center|LOCUS_38620 25801 26889 gene locus_tag LOCUS_38630 25801 26889 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_38630 26889 27194 gene locus_tag LOCUS_38640 26889 27194 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063774.1 protein_id gnl|my_center|LOCUS_38640 27191 28723 gene locus_tag LOCUS_38650 27191 28723 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071687.1 protein_id gnl|my_center|LOCUS_38650 28967 29404 gene locus_tag LOCUS_38660 28967 29404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 >Feature sequence40 <1 1070 gene locus_tag LOCUS_38670 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014466774.1:lipoyl synthase 1101 1841 gene locus_tag LOCUS_38680 1101 1841 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895683.1 protein_id gnl|my_center|LOCUS_38680 2520 2017 gene locus_tag LOCUS_38690 2520 2017 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085293.1 protein_id gnl|my_center|LOCUS_38690 2843 4276 gene locus_tag LOCUS_38700 gene glnA 2843 4276 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895686.1 protein_id gnl|my_center|LOCUS_38700 4418 4675 gene locus_tag LOCUS_38710 4418 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 5769 4711 gene locus_tag LOCUS_38720 5769 4711 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_38720 5963 6148 gene locus_tag LOCUS_38730 5963 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 6797 6192 gene locus_tag LOCUS_38740 6797 6192 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014970.1 protein_id gnl|my_center|LOCUS_38740 7822 6872 gene locus_tag LOCUS_38750 7822 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 10796 7902 gene locus_tag LOCUS_38760 10796 7902 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110447.1 protein_id gnl|my_center|LOCUS_38760 12339 10999 gene locus_tag LOCUS_38770 gene glnA 12339 10999 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729709.1 protein_id gnl|my_center|LOCUS_38770 12667 13512 gene locus_tag LOCUS_38780 gene panB 12667 13512 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085258.1 protein_id gnl|my_center|LOCUS_38780 13600 14568 gene locus_tag LOCUS_38790 gene pip 13600 14568 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204007.1 protein_id gnl|my_center|LOCUS_38790 14637 16130 gene locus_tag LOCUS_38800 14637 16130 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729717.1 protein_id gnl|my_center|LOCUS_38800 17836 16238 gene locus_tag LOCUS_38810 17836 16238 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128382995.1 protein_id gnl|my_center|LOCUS_38810 18926 18234 gene locus_tag LOCUS_38820 18926 18234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38820 19668 18931 gene locus_tag LOCUS_38830 19668 18931 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223078.1 protein_id gnl|my_center|LOCUS_38830 20892 19750 gene locus_tag LOCUS_38840 20892 19750 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411502.1 protein_id gnl|my_center|LOCUS_38840 22066 20870 gene locus_tag LOCUS_38850 gene cobC 22066 20870 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 protein_id gnl|my_center|LOCUS_38850 22097 22783 gene locus_tag LOCUS_38860 22097 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 22891 23313 gene locus_tag LOCUS_38870 22891 23313 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 protein_id gnl|my_center|LOCUS_38870 24804 23800 gene locus_tag LOCUS_38880 24804 23800 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 protein_id gnl|my_center|LOCUS_38880 24893 25837 gene locus_tag LOCUS_38890 24893 25837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 26750 25815 gene locus_tag LOCUS_38900 26750 25815 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 protein_id gnl|my_center|LOCUS_38900 26845 27822 gene locus_tag LOCUS_38910 26845 27822 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 protein_id gnl|my_center|LOCUS_38910 27910 29925 gene locus_tag LOCUS_38920 27910 29925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence41 493 687 gene locus_tag LOCUS_38930 493 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 891 1778 gene locus_tag LOCUS_38940 891 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 1775 2326 gene locus_tag LOCUS_38950 1775 2326 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896412.1 protein_id gnl|my_center|LOCUS_38950 3206 2379 gene locus_tag LOCUS_38960 3206 2379 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 protein_id gnl|my_center|LOCUS_38960 3307 4983 gene locus_tag LOCUS_38970 3307 4983 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404631.1 protein_id gnl|my_center|LOCUS_38970 4980 6260 gene locus_tag LOCUS_38980 4980 6260 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_38980 6247 6978 gene locus_tag LOCUS_38990 6247 6978 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_38990 7004 8059 gene locus_tag LOCUS_39000 7004 8059 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_39000 8900 8079 gene locus_tag LOCUS_39010 8900 8079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_39010 9631 8897 gene locus_tag LOCUS_39020 9631 8897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_39020 10700 9663 gene locus_tag LOCUS_39030 10700 9663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530798.1 protein_id gnl|my_center|LOCUS_39030 11395 10685 gene locus_tag LOCUS_39040 gene tenA 11395 10685 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 protein_id gnl|my_center|LOCUS_39040 12399 11542 gene locus_tag LOCUS_39050 12399 11542 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896922.1 protein_id gnl|my_center|LOCUS_39050 13116 12514 gene locus_tag LOCUS_39060 13116 12514 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111124.1 protein_id gnl|my_center|LOCUS_39060 13291 14667 gene locus_tag LOCUS_39070 13291 14667 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111128.1 protein_id gnl|my_center|LOCUS_39070 14664 15617 gene locus_tag LOCUS_39080 14664 15617 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111129.1 protein_id gnl|my_center|LOCUS_39080 15614 16369 gene locus_tag LOCUS_39090 15614 16369 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_39090 17097 16399 gene locus_tag LOCUS_39100 17097 16399 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_39100 17160 18122 gene locus_tag LOCUS_39110 17160 18122 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063804.1 protein_id gnl|my_center|LOCUS_39110 18200 18469 gene locus_tag LOCUS_39120 18200 18469 CDS product DUF2277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414489.1 protein_id gnl|my_center|LOCUS_39120 19051 20877 gene locus_tag LOCUS_39130 19051 20877 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731623.1 protein_id gnl|my_center|LOCUS_39130 20882 21682 gene locus_tag LOCUS_39140 20882 21682 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731624.1 protein_id gnl|my_center|LOCUS_39140 22609 21695 gene locus_tag LOCUS_39150 22609 21695 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079681.1 protein_id gnl|my_center|LOCUS_39150 23710 22655 gene locus_tag LOCUS_39160 23710 22655 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533083.1 protein_id gnl|my_center|LOCUS_39160 24351 23710 gene locus_tag LOCUS_39170 24351 23710 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_39170 24551 25348 gene locus_tag LOCUS_39180 24551 25348 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_39180 25365 27017 gene locus_tag LOCUS_39190 gene fadD12 25365 27017 CDS product acyl-CoA ligase FadD12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898876.1 protein_id gnl|my_center|LOCUS_39190 27021 28472 gene locus_tag LOCUS_39200 27021 28472 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_39200 28469 29647 gene locus_tag LOCUS_39210 28469 29647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence42 769 485 gene locus_tag LOCUS_39220 769 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 1883 873 gene locus_tag LOCUS_39230 gene nusA 1883 873 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894006.1 protein_id gnl|my_center|LOCUS_39230 2509 1913 gene locus_tag LOCUS_39240 gene rimP 2509 1913 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728481.1 protein_id gnl|my_center|LOCUS_39240 2606 3169 gene locus_tag LOCUS_39250 2606 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 3166 3648 gene locus_tag LOCUS_39260 3166 3648 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093837.1 protein_id gnl|my_center|LOCUS_39260 5386 3656 gene locus_tag LOCUS_39270 5386 3656 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081714.1 protein_id gnl|my_center|LOCUS_39270 5385 6167 gene locus_tag LOCUS_39280 gene yaaA 5385 6167 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223956.1 protein_id gnl|my_center|LOCUS_39280 7781 6279 gene locus_tag LOCUS_39290 7781 6279 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 protein_id gnl|my_center|LOCUS_39290 9159 7900 gene locus_tag LOCUS_39300 gene cobA 9159 7900 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088280.1 protein_id gnl|my_center|LOCUS_39300 9484 9188 gene locus_tag LOCUS_39310 9484 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 10488 9481 gene locus_tag LOCUS_39320 10488 9481 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 protein_id gnl|my_center|LOCUS_39320 10630 11325 gene locus_tag LOCUS_39330 gene devR 10630 11325 CDS product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416369.1 protein_id gnl|my_center|LOCUS_39330 12952 11339 gene locus_tag LOCUS_39340 12952 11339 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878257.1 protein_id gnl|my_center|LOCUS_39340 14433 12952 gene locus_tag LOCUS_39350 14433 12952 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728476.1 protein_id gnl|my_center|LOCUS_39350 15044 14427 gene locus_tag LOCUS_39360 gene cobO 15044 14427 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 protein_id gnl|my_center|LOCUS_39360 17081 15087 gene locus_tag LOCUS_39370 17081 15087 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 protein_id gnl|my_center|LOCUS_39370 17557 17078 gene locus_tag LOCUS_39380 17557 17078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728473.1 protein_id gnl|my_center|LOCUS_39380 19131 17605 gene locus_tag LOCUS_39390 gene mqo 19131 17605 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624310.1 protein_id gnl|my_center|LOCUS_39390 19329 20357 gene locus_tag LOCUS_39400 19329 20357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414553.1 protein_id gnl|my_center|LOCUS_39400 20354 21751 gene locus_tag LOCUS_39410 20354 21751 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086123.1 protein_id gnl|my_center|LOCUS_39410 22595 21774 gene locus_tag LOCUS_39420 22595 21774 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_39420 24244 22646 gene locus_tag LOCUS_39430 24244 22646 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093851.1 protein_id gnl|my_center|LOCUS_39430 24380 25345 gene locus_tag LOCUS_39440 24380 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence43 2453 1224 gene locus_tag LOCUS_39450 2453 1224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086674640.1 protein_id gnl|my_center|LOCUS_39450 3346 2450 gene locus_tag LOCUS_39460 3346 2450 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_39460 3957 3343 gene locus_tag LOCUS_39470 3957 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730608.1 protein_id gnl|my_center|LOCUS_39470 4286 3954 gene locus_tag LOCUS_39480 4286 3954 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104405.1 protein_id gnl|my_center|LOCUS_39480 5499 4348 gene locus_tag LOCUS_39490 5499 4348 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113368.1 protein_id gnl|my_center|LOCUS_39490 5570 6301 gene locus_tag LOCUS_39500 5570 6301 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_39500 7412 6318 gene locus_tag LOCUS_39510 7412 6318 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093625.1 protein_id gnl|my_center|LOCUS_39510 8178 7471 gene locus_tag LOCUS_39520 8178 7471 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226414.1 protein_id gnl|my_center|LOCUS_39520 8344 9327 gene locus_tag LOCUS_39530 8344 9327 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_39530 9339 10898 gene locus_tag LOCUS_39540 9339 10898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_39540 10898 12061 gene locus_tag LOCUS_39550 10898 12061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_39550 12058 12984 gene locus_tag LOCUS_39560 12058 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 13021 14001 gene locus_tag LOCUS_39570 gene ala 13021 14001 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_39570 13998 14465 gene locus_tag LOCUS_39580 13998 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 15807 14476 gene locus_tag LOCUS_39590 15807 14476 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_39590 17084 15795 gene locus_tag LOCUS_39600 17084 15795 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_39600 17691 17068 gene locus_tag LOCUS_39610 17691 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 17776 18981 gene locus_tag LOCUS_39620 17776 18981 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404705.1 protein_id gnl|my_center|LOCUS_39620 18978 21491 gene locus_tag LOCUS_39630 18978 21491 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence44 312 755 gene locus_tag LOCUS_39640 312 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 2026 782 gene locus_tag LOCUS_39650 2026 782 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730641.1 protein_id gnl|my_center|LOCUS_39650 2502 4079 gene locus_tag LOCUS_39660 2502 4079 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 protein_id gnl|my_center|LOCUS_39660 4170 4484 gene locus_tag LOCUS_39670 4170 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 5500 4763 gene locus_tag LOCUS_39680 5500 4763 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222712.1 protein_id gnl|my_center|LOCUS_39680 6335 7303 gene locus_tag LOCUS_39690 6335 7303 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085283.1 protein_id gnl|my_center|LOCUS_39690 8255 8094 gene locus_tag LOCUS_39700 8255 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 8373 8993 gene locus_tag LOCUS_39710 8373 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 8975 10972 gene locus_tag LOCUS_39720 8975 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 12289 11174 gene locus_tag LOCUS_39730 12289 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 12764 12372 gene locus_tag LOCUS_39740 12764 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 13663 16017 gene locus_tag LOCUS_39750 13663 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 16463 16194 gene locus_tag LOCUS_39760 16463 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 17209 16679 gene locus_tag LOCUS_39770 17209 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 17447 18199 gene locus_tag LOCUS_39780 17447 18199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 19476 18295 gene locus_tag LOCUS_39790 19476 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence45 1200 88 gene locus_tag LOCUS_39800 1200 88 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730368.1 protein_id gnl|my_center|LOCUS_39800 1397 2092 gene locus_tag LOCUS_39810 gene mftE 1397 2092 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112045.1 protein_id gnl|my_center|LOCUS_39810 2089 3624 gene locus_tag LOCUS_39820 gene mftF 2089 3624 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_39820 3621 4955 gene locus_tag LOCUS_39830 gene mftG 3621 4955 CDS product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403503.1 protein_id gnl|my_center|LOCUS_39830 4952 5425 gene locus_tag LOCUS_39840 4952 5425 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_39840 5412 6068 gene locus_tag LOCUS_39850 5412 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 6841 6083 gene locus_tag LOCUS_39860 6841 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 8339 6846 gene locus_tag LOCUS_39870 8339 6846 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095417.1 protein_id gnl|my_center|LOCUS_39870 9273 8350 gene locus_tag LOCUS_39880 9273 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095418.1 protein_id gnl|my_center|LOCUS_39880 10177 9317 gene locus_tag LOCUS_39890 10177 9317 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112168.1 protein_id gnl|my_center|LOCUS_39890 11181 10174 gene locus_tag LOCUS_39900 11181 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 12888 11236 gene locus_tag LOCUS_39910 12888 11236 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057378.1 protein_id gnl|my_center|LOCUS_39910 14980 13070 gene locus_tag LOCUS_39920 14980 13070 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495724.1 protein_id gnl|my_center|LOCUS_39920 16776 14977 gene locus_tag LOCUS_39930 16776 14977 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_39930 17376 16900 gene locus_tag LOCUS_39940 17376 16900 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055627.1 protein_id gnl|my_center|LOCUS_39940 17782 18087 gene locus_tag LOCUS_39950 gene rpsJ 17782 18087 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102098.1 protein_id gnl|my_center|LOCUS_39950 18107 18760 gene locus_tag LOCUS_39960 gene rplC 18107 18760 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892823.1 protein_id gnl|my_center|LOCUS_39960 18763 19464 gene locus_tag LOCUS_39970 gene rplD 18763 19464 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403580.1 protein_id gnl|my_center|LOCUS_39970 19466 19771 gene locus_tag LOCUS_39980 gene rplW 19466 19771 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892825.1 protein_id gnl|my_center|LOCUS_39980 19802 20638 gene locus_tag LOCUS_39990 gene rplB 19802 20638 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_39990 20656 20937 gene locus_tag LOCUS_40000 gene rpsS 20656 20937 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908582.1 protein_id gnl|my_center|LOCUS_40000 20937 21347 gene locus_tag LOCUS_40010 gene rplV 20937 21347 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055650.1 protein_id gnl|my_center|LOCUS_40010 21350 22156 gene locus_tag LOCUS_40020 gene rpsC 21350 22156 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_40020 22160 22576 gene locus_tag LOCUS_40030 gene rplP 22160 22576 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055656.1 protein_id gnl|my_center|LOCUS_40030 22576 22809 gene locus_tag LOCUS_40040 gene rpmC 22576 22809 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_40040 22806 23096 gene locus_tag LOCUS_40050 gene rpsQ 22806 23096 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727674.1 protein_id gnl|my_center|LOCUS_40050 23300 24571 gene locus_tag LOCUS_40060 23300 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 24556 25671 gene locus_tag LOCUS_40070 24556 25671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 26054 25674 gene locus_tag LOCUS_40080 26054 25674 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031865.1 protein_id gnl|my_center|LOCUS_40080 26548 26051 gene locus_tag LOCUS_40090 26548 26051 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975262.1 protein_id gnl|my_center|LOCUS_40090 26906 28414 gene locus_tag LOCUS_40100 26906 28414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 28416 29243 gene locus_tag LOCUS_40110 gene drrA 28416 29243 CDS product daunorubicin ABC transporter ATP-binding protein DrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414848.1 protein_id gnl|my_center|LOCUS_40110 29243 30109 gene locus_tag LOCUS_40120 29243 30109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414851.1 protein_id gnl|my_center|LOCUS_40120 30482 38677 gene locus_tag LOCUS_40130 30482 38677 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213558087.1 protein_id gnl|my_center|LOCUS_40130 38674 78900 gene locus_tag LOCUS_40140 38674 78900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 78994 92844 gene locus_tag LOCUS_40150 78994 92844 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163682492.1 protein_id gnl|my_center|LOCUS_40150 92966 93193 gene locus_tag LOCUS_40160 gene mbtH 92966 93193 CDS product mycobactin NRPS accessory protein MbtH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412265.1 protein_id gnl|my_center|LOCUS_40160 93498 93815 gene locus_tag LOCUS_40170 93498 93815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 94558 93923 gene locus_tag LOCUS_40180 94558 93923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 95172 94639 gene locus_tag LOCUS_40190 95172 94639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 95292 96422 gene locus_tag LOCUS_40200 95292 96422 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_40200 96419 97093 gene locus_tag LOCUS_40210 96419 97093 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 protein_id gnl|my_center|LOCUS_40210 98123 97110 gene locus_tag LOCUS_40220 98123 97110 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094641.1 protein_id gnl|my_center|LOCUS_40220 98946 98191 gene locus_tag LOCUS_40230 98946 98191 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730893.1 protein_id gnl|my_center|LOCUS_40230 99274 99990 gene locus_tag LOCUS_40240 99274 99990 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_40240 100343 100639 gene locus_tag LOCUS_40250 100343 100639 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892560.1 protein_id gnl|my_center|LOCUS_40250 101750 100698 gene locus_tag LOCUS_40260 101750 100698 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_40260 102837 101893 gene locus_tag LOCUS_40270 102837 101893 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977104.1 protein_id gnl|my_center|LOCUS_40270 103453 102845 gene locus_tag LOCUS_40280 gene sigK 103453 102845 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_40280 104327 103545 gene locus_tag LOCUS_40290 104327 103545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 protein_id gnl|my_center|LOCUS_40290 105570 104317 gene locus_tag LOCUS_40300 105570 104317 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467380.1 protein_id gnl|my_center|LOCUS_40300 105805 105548 gene locus_tag LOCUS_40310 105805 105548 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729883.1 protein_id gnl|my_center|LOCUS_40310 119685 105802 gene locus_tag LOCUS_40320 119685 105802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 120288 120656 gene locus_tag LOCUS_40330 gene rplN 120288 120656 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_40330 120658 120975 gene locus_tag LOCUS_40340 gene rplX 120658 120975 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055682.1 protein_id gnl|my_center|LOCUS_40340 120977 121588 gene locus_tag LOCUS_40350 gene rplE 120977 121588 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055683.1 protein_id gnl|my_center|LOCUS_40350 121590 121775 gene locus_tag LOCUS_40360 121590 121775 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892855.1 protein_id gnl|my_center|LOCUS_40360 122328 121876 gene locus_tag LOCUS_40370 122328 121876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 123832 122411 gene locus_tag LOCUS_40380 123832 122411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 124101 124241 gene locus_tag LOCUS_40390 124101 124241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 125793 124300 gene locus_tag LOCUS_40400 125793 124300 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_40400 126594 125926 gene locus_tag LOCUS_40410 126594 125926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 127810 126641 gene locus_tag LOCUS_40420 127810 126641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 129126 127855 gene locus_tag LOCUS_40430 129126 127855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 130219 129113 gene locus_tag LOCUS_40440 130219 129113 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113397.1 protein_id gnl|my_center|LOCUS_40440 131600 130209 gene locus_tag LOCUS_40450 131600 130209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 132840 131749 gene locus_tag LOCUS_40460 132840 131749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 134000 132903 gene locus_tag LOCUS_40470 134000 132903 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_40470 135517 133997 gene locus_tag LOCUS_40480 135517 133997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 136587 135514 gene locus_tag LOCUS_40490 136587 135514 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_40490 137960 136497 gene locus_tag LOCUS_40500 137960 136497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 138662 138036 gene locus_tag LOCUS_40510 138662 138036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 139957 138749 gene locus_tag LOCUS_40520 139957 138749 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 protein_id gnl|my_center|LOCUS_40520 140703 139954 gene locus_tag LOCUS_40530 gene narI 140703 139954 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_40530 141377 140712 gene locus_tag LOCUS_40540 141377 140712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 143065 141374 gene locus_tag LOCUS_40550 gene narH 143065 141374 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_40550 146835 143065 gene locus_tag LOCUS_40560 146835 143065 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878246.1 protein_id gnl|my_center|LOCUS_40560 147301 146948 gene locus_tag LOCUS_40570 147301 146948 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413583.1 protein_id gnl|my_center|LOCUS_40570 147884 147513 gene locus_tag LOCUS_40580 147884 147513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 148280 148678 gene locus_tag LOCUS_40590 gene rpsH 148280 148678 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055710.1 protein_id gnl|my_center|LOCUS_40590 148694 149230 gene locus_tag LOCUS_40600 gene rplF 148694 149230 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892857.1 protein_id gnl|my_center|LOCUS_40600 149234 149638 gene locus_tag LOCUS_40610 gene rplR 149234 149638 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130474831.1 protein_id gnl|my_center|LOCUS_40610 149700 150350 gene locus_tag LOCUS_40620 gene rpsE 149700 150350 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_40620 150353 150538 gene locus_tag LOCUS_40630 gene rpmD 150353 150538 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_40630 150535 150975 gene locus_tag LOCUS_40640 gene rplO 150535 150975 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055720.1 protein_id gnl|my_center|LOCUS_40640 151181 152509 gene locus_tag LOCUS_40650 gene secY 151181 152509 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892870.1 protein_id gnl|my_center|LOCUS_40650 152506 153060 gene locus_tag LOCUS_40660 152506 153060 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 protein_id gnl|my_center|LOCUS_40660 153099 153896 gene locus_tag LOCUS_40670 gene map 153099 153896 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112014.1 protein_id gnl|my_center|LOCUS_40670 155377 153944 gene locus_tag LOCUS_40680 155377 153944 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_40680 156095 155466 gene locus_tag LOCUS_40690 156095 155466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776712.1 protein_id gnl|my_center|LOCUS_40690 156239 156841 gene locus_tag LOCUS_40700 156239 156841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 158366 156855 gene locus_tag LOCUS_40710 158366 156855 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_40710 158765 159706 gene locus_tag LOCUS_40720 158765 159706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 159759 161849 gene locus_tag LOCUS_40730 159759 161849 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742185.1 protein_id gnl|my_center|LOCUS_40730 161959 162873 gene locus_tag LOCUS_40740 161959 162873 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414505.1 protein_id gnl|my_center|LOCUS_40740 163035 163820 gene locus_tag LOCUS_40750 163035 163820 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414504.1 protein_id gnl|my_center|LOCUS_40750 163932 165245 gene locus_tag LOCUS_40760 163932 165245 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414501.1 protein_id gnl|my_center|LOCUS_40760 165274 166425 gene locus_tag LOCUS_40770 gene ugpC 165274 166425 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414499.1 protein_id gnl|my_center|LOCUS_40770 167266 166397 gene locus_tag LOCUS_40780 gene fdhD 167266 166397 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_40780 167720 167307 gene locus_tag LOCUS_40790 gene dtd 167720 167307 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729707.1 protein_id gnl|my_center|LOCUS_40790 168535 167801 gene locus_tag LOCUS_40800 168535 167801 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113130.1 protein_id gnl|my_center|LOCUS_40800 168924 168532 gene locus_tag LOCUS_40810 168924 168532 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409542.1 protein_id gnl|my_center|LOCUS_40810 169778 169008 gene locus_tag LOCUS_40820 169778 169008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729922.1 protein_id gnl|my_center|LOCUS_40820 170811 169807 gene locus_tag LOCUS_40830 170811 169807 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510662.1 protein_id gnl|my_center|LOCUS_40830 171938 170892 gene locus_tag LOCUS_40840 171938 170892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729924.1 protein_id gnl|my_center|LOCUS_40840 173601 172156 gene locus_tag LOCUS_40850 173601 172156 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731423.1 protein_id gnl|my_center|LOCUS_40850 173762 175267 gene locus_tag LOCUS_40860 173762 175267 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104208.1 protein_id gnl|my_center|LOCUS_40860 175264 176208 gene locus_tag LOCUS_40870 gene prpB 175264 176208 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 protein_id gnl|my_center|LOCUS_40870 176205 177356 gene locus_tag LOCUS_40880 176205 177356 CDS product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079735.1 protein_id gnl|my_center|LOCUS_40880 177390 180779 gene locus_tag LOCUS_40890 177390 180779 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081500.1 protein_id gnl|my_center|LOCUS_40890 183181 180878 gene locus_tag LOCUS_40900 gene metE 183181 180878 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_40900 183965 183621 gene locus_tag LOCUS_40910 183965 183621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 184188 184436 gene locus_tag LOCUS_40920 gene infA 184188 184436 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003886926.1 protein_id gnl|my_center|LOCUS_40920 184904 185272 gene locus_tag LOCUS_40930 gene rpsM 184904 185272 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 protein_id gnl|my_center|LOCUS_40930 185272 185679 gene locus_tag LOCUS_40940 gene rpsK 185272 185679 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_40940 185704 186309 gene locus_tag LOCUS_40950 gene rpsD 185704 186309 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_40950 186392 187444 gene locus_tag LOCUS_40960 186392 187444 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_40960 187529 188155 gene locus_tag LOCUS_40970 187529 188155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 188112 189050 gene locus_tag LOCUS_40980 gene truA 188112 189050 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 protein_id gnl|my_center|LOCUS_40980 189781 189158 gene locus_tag LOCUS_40990 189781 189158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 190401 189859 gene locus_tag LOCUS_41000 190401 189859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 191509 190436 gene locus_tag LOCUS_41010 191509 190436 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076519.1 protein_id gnl|my_center|LOCUS_41010 191759 192394 gene locus_tag LOCUS_41020 191759 192394 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111955.1 protein_id gnl|my_center|LOCUS_41020 193521 192550 gene locus_tag LOCUS_41030 193521 192550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 194608 194988 gene locus_tag LOCUS_41040 194608 194988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 194985 195308 gene locus_tag LOCUS_41050 194985 195308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 195368 195676 gene locus_tag LOCUS_41060 195368 195676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 195673 196965 gene locus_tag LOCUS_41070 195673 196965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 196962 197273 gene locus_tag LOCUS_41080 196962 197273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 197373 198434 gene locus_tag LOCUS_41090 197373 198434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 198431 199255 gene locus_tag LOCUS_41100 gene espG3 198431 199255 CDS product type VII secretion system ESX-3 associated protein EspG3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401521.1 protein_id gnl|my_center|LOCUS_41100 199374 199697 gene locus_tag LOCUS_41110 199374 199697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 199743 200045 gene locus_tag LOCUS_41120 199743 200045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 200352 201908 gene locus_tag LOCUS_41130 200352 201908 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727944.1 protein_id gnl|my_center|LOCUS_41130 202017 203486 gene locus_tag LOCUS_41140 gene ahcY 202017 203486 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080862.1 protein_id gnl|my_center|LOCUS_41140 204218 203568 gene locus_tag LOCUS_41150 204218 203568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 205071 204436 gene locus_tag LOCUS_41160 205071 204436 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229736.1 protein_id gnl|my_center|LOCUS_41160 205212 205889 gene locus_tag LOCUS_41170 gene mtrA 205212 205889 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899985.1 protein_id gnl|my_center|LOCUS_41170 205886 207562 gene locus_tag LOCUS_41180 gene mtrB 205886 207562 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877234.1 protein_id gnl|my_center|LOCUS_41180 207559 209307 gene locus_tag LOCUS_41190 gene lpqB 207559 209307 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727973.1 protein_id gnl|my_center|LOCUS_41190 210029 209340 gene locus_tag LOCUS_41200 210029 209340 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094308.1 protein_id gnl|my_center|LOCUS_41200 210366 211187 gene locus_tag LOCUS_41210 gene raiA 210366 211187 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727974.1 protein_id gnl|my_center|LOCUS_41210 211363 214188 gene locus_tag LOCUS_41220 gene secA 211363 214188 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 protein_id gnl|my_center|LOCUS_41220 214356 214949 gene locus_tag LOCUS_41230 214356 214949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 215036 216547 gene locus_tag LOCUS_41240 215036 216547 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727977.1 protein_id gnl|my_center|LOCUS_41240 216544 217110 gene locus_tag LOCUS_41250 216544 217110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229719.1 protein_id gnl|my_center|LOCUS_41250 217186 218301 gene locus_tag LOCUS_41260 217186 218301 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_41260 218384 219526 gene locus_tag LOCUS_41270 218384 219526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 219773 221122 gene locus_tag LOCUS_41280 219773 221122 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080953.1 protein_id gnl|my_center|LOCUS_41280 221195 222394 gene locus_tag LOCUS_41290 gene desA3 221195 222394 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_41290 223465 222407 gene locus_tag LOCUS_41300 gene rsgA 223465 222407 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 protein_id gnl|my_center|LOCUS_41300 224810 223488 gene locus_tag LOCUS_41310 gene aroA 224810 223488 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727983.1 protein_id gnl|my_center|LOCUS_41310 225297 224914 gene locus_tag LOCUS_41320 225297 224914 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402907.1 protein_id gnl|my_center|LOCUS_41320 225531 225298 gene locus_tag LOCUS_41330 225531 225298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 227730 226021 gene locus_tag LOCUS_41340 227730 226021 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124874314.1 protein_id gnl|my_center|LOCUS_41340 227807 228307 gene locus_tag LOCUS_41350 227807 228307 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_41350 228939 228256 gene locus_tag LOCUS_41360 228939 228256 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125138.1 protein_id gnl|my_center|LOCUS_41360 230779 228947 gene locus_tag LOCUS_41370 230779 228947 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_41370 231362 230931 gene locus_tag LOCUS_41380 231362 230931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 231835 231359 gene locus_tag LOCUS_41390 231835 231359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 232011 233450 gene locus_tag LOCUS_41400 gene chrA 232011 233450 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 protein_id gnl|my_center|LOCUS_41400 234980 233475 gene locus_tag LOCUS_41410 234980 233475 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406262.1 protein_id gnl|my_center|LOCUS_41410 235497 234967 gene locus_tag LOCUS_41420 235497 234967 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_41420 236290 235529 gene locus_tag LOCUS_41430 236290 235529 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_41430 238132 236354 gene locus_tag LOCUS_41440 238132 236354 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_41440 240044 238239 gene locus_tag LOCUS_41450 gene mimR 240044 238239 CDS product transcriptional regulator MimR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728053.1 protein_id gnl|my_center|LOCUS_41450 241993 240341 gene locus_tag LOCUS_41460 gene groL 241993 240341 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893353.1 protein_id gnl|my_center|LOCUS_41460 243243 242218 gene locus_tag LOCUS_41470 243243 242218 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728056.1 protein_id gnl|my_center|LOCUS_41470 244047 243247 gene locus_tag LOCUS_41480 244047 243247 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893351.1 protein_id gnl|my_center|LOCUS_41480 245090 244044 gene locus_tag LOCUS_41490 245090 244044 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728055.1 protein_id gnl|my_center|LOCUS_41490 >Feature sequence46 159 353 gene locus_tag LOCUS_41500 159 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 1748 417 gene locus_tag LOCUS_41510 1748 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 2370 1732 gene locus_tag LOCUS_41520 2370 1732 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087440.1 protein_id gnl|my_center|LOCUS_41520 2686 4104 gene locus_tag LOCUS_41530 2686 4104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030428446.1 protein_id gnl|my_center|LOCUS_41530 4127 4771 gene locus_tag LOCUS_41540 4127 4771 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_41540 4793 5605 gene locus_tag LOCUS_41550 4793 5605 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_41550 5602 6285 gene locus_tag LOCUS_41560 5602 6285 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_41560 6288 7742 gene locus_tag LOCUS_41570 6288 7742 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528540.1 protein_id gnl|my_center|LOCUS_41570 7754 8101 gene locus_tag LOCUS_41580 7754 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 8111 8635 gene locus_tag LOCUS_41590 8111 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 8729 9721 gene locus_tag LOCUS_41600 8729 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 9773 11953 gene locus_tag LOCUS_41610 9773 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 12004 14742 gene locus_tag LOCUS_41620 12004 14742 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229885.1 protein_id gnl|my_center|LOCUS_41620 14963 14784 gene locus_tag LOCUS_41630 14963 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 15039 15308 gene locus_tag LOCUS_41640 15039 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 15305 15487 gene locus_tag LOCUS_41650 15305 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 15646 16002 gene locus_tag LOCUS_41660 15646 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 17172 16405 gene locus_tag LOCUS_41670 17172 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 17643 17236 gene locus_tag LOCUS_41680 17643 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 18307 17681 gene locus_tag LOCUS_41690 18307 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 18953 18591 gene locus_tag LOCUS_41700 18953 18591 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229055.1 protein_id gnl|my_center|LOCUS_41700 19174 18932 gene locus_tag LOCUS_41710 19174 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence47 <1 2390 gene locus_tag LOCUS_41720 <1 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877447.1:translation initiation factor IF-2 note possible pseudo, internal stop codon, frameshifted 2490 2945 gene locus_tag LOCUS_41730 gene rbfA 2490 2945 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728485.1 protein_id gnl|my_center|LOCUS_41730 2942 3898 gene locus_tag LOCUS_41740 gene nrnA 2942 3898 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414507.1 protein_id gnl|my_center|LOCUS_41740 3916 5274 gene locus_tag LOCUS_41750 3916 5274 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122934.1 protein_id gnl|my_center|LOCUS_41750 5277 6305 gene locus_tag LOCUS_41760 5277 6305 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414151.1 protein_id gnl|my_center|LOCUS_41760 6302 6958 gene locus_tag LOCUS_41770 6302 6958 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728500.1 protein_id gnl|my_center|LOCUS_41770 6960 7859 gene locus_tag LOCUS_41780 gene truB 6960 7859 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_41780 8556 7888 gene locus_tag LOCUS_41790 gene mntR 8556 7888 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057117.1 protein_id gnl|my_center|LOCUS_41790 8708 9625 gene locus_tag LOCUS_41800 8708 9625 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081766.1 protein_id gnl|my_center|LOCUS_41800 9782 10051 gene locus_tag LOCUS_41810 gene rpsO 9782 10051 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057119.1 protein_id gnl|my_center|LOCUS_41810 10510 12798 gene locus_tag LOCUS_41820 10510 12798 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_41820 12948 14543 gene locus_tag LOCUS_41830 12948 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 14550 15326 gene locus_tag LOCUS_41840 14550 15326 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_41840 16442 15327 gene locus_tag LOCUS_41850 gene ald 16442 15327 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 protein_id gnl|my_center|LOCUS_41850 16590 17072 gene locus_tag LOCUS_41860 16590 17072 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081784.1 protein_id gnl|my_center|LOCUS_41860 17135 17890 gene locus_tag LOCUS_41870 gene dapB 17135 17890 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728512.1 protein_id gnl|my_center|LOCUS_41870 17894 18433 gene locus_tag LOCUS_41880 17894 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 protein_id gnl|my_center|LOCUS_41880 18438 18893 gene locus_tag LOCUS_41890 18438 18893 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence48 517 945 gene locus_tag LOCUS_41900 517 945 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896434.1 protein_id gnl|my_center|LOCUS_41900 1660 968 gene locus_tag LOCUS_41910 1660 968 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 protein_id gnl|my_center|LOCUS_41910 1679 2269 gene locus_tag LOCUS_41920 1679 2269 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230001.1 protein_id gnl|my_center|LOCUS_41920 2331 2879 gene locus_tag LOCUS_41930 2331 2879 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803749.1 protein_id gnl|my_center|LOCUS_41930 3419 2886 gene locus_tag LOCUS_41940 3419 2886 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972173.1 protein_id gnl|my_center|LOCUS_41940 3568 3483 gene locus_tag LOCUS_t00480 3568 3483 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3846 5219 gene locus_tag LOCUS_41950 3846 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 5445 5909 gene locus_tag LOCUS_41960 5445 5909 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726620.1 protein_id gnl|my_center|LOCUS_41960 5906 7423 gene locus_tag LOCUS_41970 5906 7423 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726619.1 protein_id gnl|my_center|LOCUS_41970 7420 8853 gene locus_tag LOCUS_41980 7420 8853 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 protein_id gnl|my_center|LOCUS_41980 8850 10346 gene locus_tag LOCUS_41990 gene pbpA 8850 10346 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_41990 10343 11713 gene locus_tag LOCUS_42000 10343 11713 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726617.1 protein_id gnl|my_center|LOCUS_42000 11841 13793 gene locus_tag LOCUS_42010 gene pknB 11841 13793 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891355.1 protein_id gnl|my_center|LOCUS_42010 14474 13815 gene locus_tag LOCUS_42020 14474 13815 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891354.1 protein_id gnl|my_center|LOCUS_42020 14621 14911 gene locus_tag LOCUS_42030 gene crgA 14621 14911 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891352.1 protein_id gnl|my_center|LOCUS_42030 15027 15530 gene locus_tag LOCUS_42040 15027 15530 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726616.1 protein_id gnl|my_center|LOCUS_42040 16424 15711 gene locus_tag LOCUS_42050 16424 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 17155 16634 gene locus_tag LOCUS_42060 17155 16634 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907463.1 protein_id gnl|my_center|LOCUS_42060 17216 17446 gene locus_tag LOCUS_42070 17216 17446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 >Feature sequence49 398 598 gene locus_tag LOCUS_42080 398 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 966 649 gene locus_tag LOCUS_42090 966 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 1956 2342 gene locus_tag LOCUS_42100 1956 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 2727 3143 gene locus_tag LOCUS_42110 2727 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 4870 3059 gene locus_tag LOCUS_42120 4870 3059 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775796.1 protein_id gnl|my_center|LOCUS_42120 5764 4973 gene locus_tag LOCUS_42130 5764 4973 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929513.1 protein_id gnl|my_center|LOCUS_42130 6799 5813 gene locus_tag LOCUS_42140 6799 5813 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729503.1 protein_id gnl|my_center|LOCUS_42140 6930 7619 gene locus_tag LOCUS_42150 6930 7619 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031841.1 protein_id gnl|my_center|LOCUS_42150 8352 7801 gene locus_tag LOCUS_42160 8352 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 8489 10702 gene locus_tag LOCUS_42170 8489 10702 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112075.1 protein_id gnl|my_center|LOCUS_42170 10699 12357 gene locus_tag LOCUS_42180 10699 12357 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032668362.1 protein_id gnl|my_center|LOCUS_42180 12354 13118 gene locus_tag LOCUS_42190 12354 13118 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878672.1 protein_id gnl|my_center|LOCUS_42190 13667 13497 gene locus_tag LOCUS_42200 13667 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 14373 14185 gene locus_tag LOCUS_42210 14373 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 14785 14378 gene locus_tag LOCUS_42220 14785 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 15767 15273 gene locus_tag LOCUS_42230 15767 15273 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111906.1 protein_id gnl|my_center|LOCUS_42230 15878 17215 gene locus_tag LOCUS_42240 15878 17215 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080886.1 protein_id gnl|my_center|LOCUS_42240 >Feature sequence50 52 1506 gene locus_tag LOCUS_42250 52 1506 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_42250 1544 2938 gene locus_tag LOCUS_42260 1544 2938 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258112.1 protein_id gnl|my_center|LOCUS_42260 2990 3403 gene locus_tag LOCUS_42270 2990 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 3432 3761 gene locus_tag LOCUS_42280 3432 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 4905 3778 gene locus_tag LOCUS_42290 4905 3778 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112987.1 protein_id gnl|my_center|LOCUS_42290 6346 5087 gene locus_tag LOCUS_42300 6346 5087 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877706.1 protein_id gnl|my_center|LOCUS_42300 6449 6994 gene locus_tag LOCUS_42310 6449 6994 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349890.1 protein_id gnl|my_center|LOCUS_42310 6991 7974 gene locus_tag LOCUS_42320 6991 7974 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727119.1 protein_id gnl|my_center|LOCUS_42320 7971 10076 gene locus_tag LOCUS_42330 7971 10076 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_42330 10868 10101 gene locus_tag LOCUS_42340 10868 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 11582 10998 gene locus_tag LOCUS_42350 11582 10998 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093643.1 protein_id gnl|my_center|LOCUS_42350 11634 12137 gene locus_tag LOCUS_42360 gene uraD 11634 12137 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076325.1 protein_id gnl|my_center|LOCUS_42360 12134 12460 gene locus_tag LOCUS_42370 gene uraH 12134 12460 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057392.1 protein_id gnl|my_center|LOCUS_42370 15884 12495 gene locus_tag LOCUS_42380 15884 12495 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081500.1 protein_id gnl|my_center|LOCUS_42380 16403 17179 gene locus_tag LOCUS_42390 16403 17179 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence51 234 425 gene locus_tag LOCUS_42400 234 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 988 473 gene locus_tag LOCUS_42410 988 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 4282 1232 gene locus_tag LOCUS_42420 4282 1232 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083307.1 protein_id gnl|my_center|LOCUS_42420 4986 4360 gene locus_tag LOCUS_42430 4986 4360 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727665.1 protein_id gnl|my_center|LOCUS_42430 6039 5287 gene locus_tag LOCUS_42440 6039 5287 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727362.1 protein_id gnl|my_center|LOCUS_42440 7030 6125 gene locus_tag LOCUS_42450 7030 6125 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_42450 8093 7020 gene locus_tag LOCUS_42460 8093 7020 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088985.1 protein_id gnl|my_center|LOCUS_42460 8917 8090 gene locus_tag LOCUS_42470 8917 8090 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_42470 10527 9007 gene locus_tag LOCUS_42480 10527 9007 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230822.1 protein_id gnl|my_center|LOCUS_42480 11657 10689 gene locus_tag LOCUS_42490 11657 10689 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061562.1 protein_id gnl|my_center|LOCUS_42490 11791 12129 gene locus_tag LOCUS_42500 11791 12129 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080347.1 protein_id gnl|my_center|LOCUS_42500 12212 15244 gene locus_tag LOCUS_42510 12212 15244 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083307.1 protein_id gnl|my_center|LOCUS_42510 >Feature sequence52 184 2001 gene locus_tag LOCUS_42520 gene aspS 184 2001 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082377.1 protein_id gnl|my_center|LOCUS_42520 2099 5584 gene locus_tag LOCUS_42530 2099 5584 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728760.1 protein_id gnl|my_center|LOCUS_42530 5581 8286 gene locus_tag LOCUS_42540 5581 8286 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413330.1 protein_id gnl|my_center|LOCUS_42540 8283 9188 gene locus_tag LOCUS_42550 8283 9188 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091036.1 protein_id gnl|my_center|LOCUS_42550 9337 10515 gene locus_tag LOCUS_42560 9337 10515 CDS product kae1-associated kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093587.1 protein_id gnl|my_center|LOCUS_42560 10523 11908 gene locus_tag LOCUS_42570 10523 11908 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 protein_id gnl|my_center|LOCUS_42570 12045 14756 gene locus_tag LOCUS_42580 gene alaS 12045 14756 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 protein_id gnl|my_center|LOCUS_42580 14756 15217 gene locus_tag LOCUS_42590 gene ruvX 14756 15217 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057628.1 protein_id gnl|my_center|LOCUS_42590 >Feature sequence53 246 803 gene locus_tag LOCUS_42600 246 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 995 3166 gene locus_tag LOCUS_42610 995 3166 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_42610 4111 3311 gene locus_tag LOCUS_42620 4111 3311 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731359.1 protein_id gnl|my_center|LOCUS_42620 5855 4254 gene locus_tag LOCUS_42630 5855 4254 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730330.1 protein_id gnl|my_center|LOCUS_42630 5930 7576 gene locus_tag LOCUS_42640 gene pruA 5930 7576 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 protein_id gnl|my_center|LOCUS_42640 7576 8526 gene locus_tag LOCUS_42650 7576 8526 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896514.1 protein_id gnl|my_center|LOCUS_42650 10650 9070 gene locus_tag LOCUS_42660 10650 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 11432 10647 gene locus_tag LOCUS_42670 11432 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 12088 11531 gene locus_tag LOCUS_42680 12088 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 13891 12155 gene locus_tag LOCUS_42690 13891 12155 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113135.1 protein_id gnl|my_center|LOCUS_42690 14439 14002 gene locus_tag LOCUS_42700 14439 14002 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404726.1 protein_id gnl|my_center|LOCUS_42700 14417 15037 gene locus_tag LOCUS_42710 14417 15037 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408373.1 protein_id gnl|my_center|LOCUS_42710 >Feature sequence54 1217 303 gene locus_tag LOCUS_42720 1217 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 1584 2918 gene locus_tag LOCUS_42730 1584 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 2915 5557 gene locus_tag LOCUS_42740 2915 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 6479 5562 gene locus_tag LOCUS_42750 gene mshD 6479 5562 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092494.1 protein_id gnl|my_center|LOCUS_42750 7278 6460 gene locus_tag LOCUS_42760 7278 6460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 protein_id gnl|my_center|LOCUS_42760 7491 8348 gene locus_tag LOCUS_42770 gene lmeA 7491 8348 CDS product mannan chain length control protein LmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730787.1 protein_id gnl|my_center|LOCUS_42770 8763 9602 gene locus_tag LOCUS_42780 8763 9602 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730790.1 protein_id gnl|my_center|LOCUS_42780 9608 9913 gene locus_tag LOCUS_42790 9608 9913 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878457.1 protein_id gnl|my_center|LOCUS_42790 10302 11012 gene locus_tag LOCUS_42800 10302 11012 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730793.1 protein_id gnl|my_center|LOCUS_42800 12116 11019 gene locus_tag LOCUS_42810 12116 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 14070 12136 gene locus_tag LOCUS_42820 14070 12136 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113050.1 protein_id gnl|my_center|LOCUS_42820 >Feature sequence55 1137 523 gene locus_tag LOCUS_42830 1137 523 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_42830 1124 1957 gene locus_tag LOCUS_42840 1124 1957 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_42840 2175 1873 gene locus_tag LOCUS_42850 2175 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 2081 3373 gene locus_tag LOCUS_42860 2081 3373 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111336.1 protein_id gnl|my_center|LOCUS_42860 3561 5084 gene locus_tag LOCUS_42870 3561 5084 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727276.1 protein_id gnl|my_center|LOCUS_42870 5256 5681 gene locus_tag LOCUS_42880 5256 5681 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727277.1 protein_id gnl|my_center|LOCUS_42880 6220 5756 gene locus_tag LOCUS_42890 6220 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 6442 6984 gene locus_tag LOCUS_42900 6442 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 8473 6965 gene locus_tag LOCUS_42910 gene iniC 8473 6965 CDS product isoniazid-induced dynamin-like GTPase IniC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401747.1 protein_id gnl|my_center|LOCUS_42910 10251 8470 gene locus_tag LOCUS_42920 gene iniA 10251 8470 CDS product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876844.1 protein_id gnl|my_center|LOCUS_42920 14018 10674 gene locus_tag LOCUS_42930 14018 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence56 575 1666 gene locus_tag LOCUS_42940 575 1666 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415173.1 protein_id gnl|my_center|LOCUS_42940 3475 1970 gene locus_tag LOCUS_42950 gene gatB 3475 1970 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093966.1 protein_id gnl|my_center|LOCUS_42950 3609 3842 gene locus_tag LOCUS_42960 3609 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 4890 3856 gene locus_tag LOCUS_42970 4890 3856 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804723.1 protein_id gnl|my_center|LOCUS_42970 5596 4982 gene locus_tag LOCUS_42980 5596 4982 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031938971.1 protein_id gnl|my_center|LOCUS_42980 6934 5642 gene locus_tag LOCUS_42990 6934 5642 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_42990 7094 7804 gene locus_tag LOCUS_43000 7094 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 7801 9045 gene locus_tag LOCUS_43010 7801 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 10558 9053 gene locus_tag LOCUS_43020 gene gatA 10558 9053 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081368.1 protein_id gnl|my_center|LOCUS_43020 10884 10555 gene locus_tag LOCUS_43030 gene gatC 10884 10555 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223569.1 protein_id gnl|my_center|LOCUS_43030 11050 11709 gene locus_tag LOCUS_43040 11050 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_43040 11706 12266 gene locus_tag LOCUS_43050 11706 12266 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_43050 14361 12271 gene locus_tag LOCUS_43060 gene ligA 14361 12271 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_43060 15965 14673 gene locus_tag LOCUS_43070 15965 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 16302 16799 gene locus_tag LOCUS_43080 16302 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094420.1 protein_id gnl|my_center|LOCUS_43080 16831 17274 gene locus_tag LOCUS_43090 16831 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 18002 17616 gene locus_tag LOCUS_43100 18002 17616 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093972.1 protein_id gnl|my_center|LOCUS_43100 19060 18044 gene locus_tag LOCUS_43110 19060 18044 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728293.1 protein_id gnl|my_center|LOCUS_43110 20175 19057 gene locus_tag LOCUS_43120 gene mnmA 20175 19057 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893725.1 protein_id gnl|my_center|LOCUS_43120 21371 20175 gene locus_tag LOCUS_43130 21371 20175 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_43130 22017 21538 gene locus_tag LOCUS_43140 22017 21538 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972215.1 protein_id gnl|my_center|LOCUS_43140 23024 22080 gene locus_tag LOCUS_43150 23024 22080 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081343.1 protein_id gnl|my_center|LOCUS_43150 23911 23021 gene locus_tag LOCUS_43160 23911 23021 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900617.1 protein_id gnl|my_center|LOCUS_43160 25064 24108 gene locus_tag LOCUS_43170 25064 24108 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056737.1 protein_id gnl|my_center|LOCUS_43170 25903 25118 gene locus_tag LOCUS_43180 25903 25118 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728286.1 protein_id gnl|my_center|LOCUS_43180 26089 26907 gene locus_tag LOCUS_43190 26089 26907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086476.1 protein_id gnl|my_center|LOCUS_43190 26910 28538 gene locus_tag LOCUS_43200 26910 28538 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728284.1 protein_id gnl|my_center|LOCUS_43200 28535 29887 gene locus_tag LOCUS_43210 28535 29887 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056727.1 protein_id gnl|my_center|LOCUS_43210 30733 29987 gene locus_tag LOCUS_43220 30733 29987 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111782.1 protein_id gnl|my_center|LOCUS_43220 30899 32236 gene locus_tag LOCUS_43230 30899 32236 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727377.1 protein_id gnl|my_center|LOCUS_43230 33495 32296 gene locus_tag LOCUS_43240 33495 32296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093988.1 protein_id gnl|my_center|LOCUS_43240 33598 34212 gene locus_tag LOCUS_43250 33598 34212 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013557.1 protein_id gnl|my_center|LOCUS_43250 34280 34543 gene locus_tag LOCUS_43260 34280 34543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 35533 34559 gene locus_tag LOCUS_43270 35533 34559 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 protein_id gnl|my_center|LOCUS_43270 36388 35600 gene locus_tag LOCUS_43280 36388 35600 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_43280 36491 37471 gene locus_tag LOCUS_43290 gene ligD 36491 37471 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_43290 38413 37589 gene locus_tag LOCUS_43300 38413 37589 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230560.1 protein_id gnl|my_center|LOCUS_43300 39249 38413 gene locus_tag LOCUS_43310 39249 38413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078324130.1 protein_id gnl|my_center|LOCUS_43310 39370 40353 gene locus_tag LOCUS_43320 39370 40353 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094369.1 protein_id gnl|my_center|LOCUS_43320 40825 40376 gene locus_tag LOCUS_43330 40825 40376 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_43330 41643 40822 gene locus_tag LOCUS_43340 41643 40822 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229474.1 protein_id gnl|my_center|LOCUS_43340 42900 41659 gene locus_tag LOCUS_43350 gene serB 42900 41659 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056675.1 protein_id gnl|my_center|LOCUS_43350 44688 42904 gene locus_tag LOCUS_43360 gene ctaD 44688 42904 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056670.1 protein_id gnl|my_center|LOCUS_43360 44981 46021 gene locus_tag LOCUS_43370 44981 46021 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727368.1 protein_id gnl|my_center|LOCUS_43370 46160 46648 gene locus_tag LOCUS_43380 46160 46648 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730233.1 protein_id gnl|my_center|LOCUS_43380 46828 46658 gene locus_tag LOCUS_43390 46828 46658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 46968 49970 gene locus_tag LOCUS_43400 46968 49970 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161897637.1 protein_id gnl|my_center|LOCUS_43400 49967 50776 gene locus_tag LOCUS_43410 49967 50776 CDS product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 protein_id gnl|my_center|LOCUS_43410 51827 50823 gene locus_tag LOCUS_43420 gene nrdF 51827 50823 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070938867.1 protein_id gnl|my_center|LOCUS_43420 54086 51894 gene locus_tag LOCUS_43430 gene nrdE 54086 51894 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914457.1 protein_id gnl|my_center|LOCUS_43430 54648 54181 gene locus_tag LOCUS_43440 gene nrdI 54648 54181 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 protein_id gnl|my_center|LOCUS_43440 55083 54850 gene locus_tag LOCUS_43450 55083 54850 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056596.1 protein_id gnl|my_center|LOCUS_43450 56026 55469 gene locus_tag LOCUS_43460 56026 55469 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977971.1 protein_id gnl|my_center|LOCUS_43460 56145 56771 gene locus_tag LOCUS_43470 56145 56771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 56890 58038 gene locus_tag LOCUS_43480 gene hpxO 56890 58038 CDS product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_43480 59559 58063 gene locus_tag LOCUS_43490 gene eccB 59559 58063 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077544.1 protein_id gnl|my_center|LOCUS_43490 59784 61499 gene locus_tag LOCUS_43500 gene eccE 59784 61499 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094468.1 protein_id gnl|my_center|LOCUS_43500 62821 61535 gene locus_tag LOCUS_43510 gene manA 62821 61535 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111913.1 protein_id gnl|my_center|LOCUS_43510 64251 62818 gene locus_tag LOCUS_43520 64251 62818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111915.1 protein_id gnl|my_center|LOCUS_43520 64736 64275 gene locus_tag LOCUS_43530 64736 64275 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417073.1 protein_id gnl|my_center|LOCUS_43530 64785 65447 gene locus_tag LOCUS_43540 64785 65447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 65996 65535 gene locus_tag LOCUS_43550 65996 65535 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020102910.1 protein_id gnl|my_center|LOCUS_43550 66484 67521 gene locus_tag LOCUS_43560 gene cofD 66484 67521 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727938.1 protein_id gnl|my_center|LOCUS_43560 67518 68867 gene locus_tag LOCUS_43570 67518 68867 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222932.1 protein_id gnl|my_center|LOCUS_43570 68864 69460 gene locus_tag LOCUS_43580 68864 69460 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_43580 70671 69457 gene locus_tag LOCUS_43590 gene glgC 70671 69457 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 protein_id gnl|my_center|LOCUS_43590 70803 71969 gene locus_tag LOCUS_43600 gene glgA 70803 71969 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 protein_id gnl|my_center|LOCUS_43600 72919 71948 gene locus_tag LOCUS_43610 72919 71948 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804543.1 protein_id gnl|my_center|LOCUS_43610 73089 72922 gene locus_tag LOCUS_43620 73089 72922 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_43620 73588 73193 gene locus_tag LOCUS_43630 73588 73193 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730301.1 protein_id gnl|my_center|LOCUS_43630 74762 73731 gene locus_tag LOCUS_43640 74762 73731 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084466.1 protein_id gnl|my_center|LOCUS_43640 75658 74759 gene locus_tag LOCUS_43650 gene folP 75658 74759 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296421.1 protein_id gnl|my_center|LOCUS_43650 77460 75655 gene locus_tag LOCUS_43660 gene fadD6 77460 75655 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074247.1 protein_id gnl|my_center|LOCUS_43660 78073 77537 gene locus_tag LOCUS_43670 78073 77537 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 protein_id gnl|my_center|LOCUS_43670 78905 78117 gene locus_tag LOCUS_43680 78905 78117 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_43680 80052 78952 gene locus_tag LOCUS_43690 gene dapE 80052 78952 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406235.1 protein_id gnl|my_center|LOCUS_43690 80572 80057 gene locus_tag LOCUS_43700 80572 80057 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_43700 80800 81726 gene locus_tag LOCUS_43710 gene dapD 80800 81726 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_43710 81773 82015 gene locus_tag LOCUS_43720 81773 82015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 83201 82059 gene locus_tag LOCUS_43730 gene dapC 83201 82059 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 protein_id gnl|my_center|LOCUS_43730 83541 83212 gene locus_tag LOCUS_43740 83541 83212 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296419.1 protein_id gnl|my_center|LOCUS_43740 83983 84642 gene locus_tag LOCUS_43750 83983 84642 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073964.1 protein_id gnl|my_center|LOCUS_43750 84639 85013 gene locus_tag LOCUS_43760 84639 85013 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896680.1 protein_id gnl|my_center|LOCUS_43760 86569 85322 gene locus_tag LOCUS_43770 86569 85322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 88131 86566 gene locus_tag LOCUS_43780 88131 86566 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064265.1 protein_id gnl|my_center|LOCUS_43780 89267 88128 gene locus_tag LOCUS_43790 89267 88128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 89725 89327 gene locus_tag LOCUS_43800 89725 89327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 90633 89743 gene locus_tag LOCUS_43810 gene mshB 90633 89743 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088014.1 protein_id gnl|my_center|LOCUS_43810 92603 90630 gene locus_tag LOCUS_43820 92603 90630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 94584 92674 gene locus_tag LOCUS_43830 gene typA 94584 92674 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066672.1 protein_id gnl|my_center|LOCUS_43830 94795 94971 gene locus_tag LOCUS_43840 94795 94971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789306.1 protein_id gnl|my_center|LOCUS_43840 95869 94979 gene locus_tag LOCUS_43850 95869 94979 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224458.1 protein_id gnl|my_center|LOCUS_43850 96974 95898 gene locus_tag LOCUS_43860 96974 95898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_43860 98626 96971 gene locus_tag LOCUS_43870 98626 96971 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125313541.1 protein_id gnl|my_center|LOCUS_43870 99704 98634 gene locus_tag LOCUS_43880 99704 98634 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878186.1 protein_id gnl|my_center|LOCUS_43880 100005 100835 gene locus_tag LOCUS_43890 100005 100835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 102809 100908 gene locus_tag LOCUS_43900 102809 100908 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237518.1 protein_id gnl|my_center|LOCUS_43900 104660 102834 gene locus_tag LOCUS_43910 104660 102834 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_43910 104850 105509 gene locus_tag LOCUS_43920 104850 105509 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418922.1 protein_id gnl|my_center|LOCUS_43920 105515 107191 gene locus_tag LOCUS_43930 105515 107191 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114602.1 protein_id gnl|my_center|LOCUS_43930 107484 108299 gene locus_tag LOCUS_43940 107484 108299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 108348 109631 gene locus_tag LOCUS_43950 108348 109631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 109628 110290 gene locus_tag LOCUS_43960 109628 110290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 110759 110292 gene locus_tag LOCUS_43970 110759 110292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 110886 111470 gene locus_tag LOCUS_43980 110886 111470 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_43980 111543 112511 gene locus_tag LOCUS_43990 111543 112511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403862.1 protein_id gnl|my_center|LOCUS_43990 114209 112539 gene locus_tag LOCUS_44000 114209 112539 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912345.1 protein_id gnl|my_center|LOCUS_44000 116102 114807 gene locus_tag LOCUS_44010 116102 114807 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059466.1 protein_id gnl|my_center|LOCUS_44010 117372 116131 gene locus_tag LOCUS_44020 117372 116131 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 protein_id gnl|my_center|LOCUS_44020 117559 119955 gene locus_tag LOCUS_44030 117559 119955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 120112 121386 gene locus_tag LOCUS_44040 120112 121386 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_44040 121477 122709 gene locus_tag LOCUS_44050 121477 122709 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_44050 122730 123881 gene locus_tag LOCUS_44060 122730 123881 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728212.1 protein_id gnl|my_center|LOCUS_44060 124732 123944 gene locus_tag LOCUS_44070 124732 123944 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390005.1 protein_id gnl|my_center|LOCUS_44070 125293 124769 gene locus_tag LOCUS_44080 125293 124769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 125354 126439 gene locus_tag LOCUS_44090 125354 126439 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804875.1 protein_id gnl|my_center|LOCUS_44090 127002 126463 gene locus_tag LOCUS_44100 127002 126463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226338.1 protein_id gnl|my_center|LOCUS_44100 127193 128500 gene locus_tag LOCUS_44110 127193 128500 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093031.1 protein_id gnl|my_center|LOCUS_44110 128837 129172 gene locus_tag LOCUS_44120 128837 129172 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084899.1 protein_id gnl|my_center|LOCUS_44120 129699 129277 gene locus_tag LOCUS_44130 129699 129277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729260.1 protein_id gnl|my_center|LOCUS_44130 129982 130722 gene locus_tag LOCUS_44140 129982 130722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896615.1 protein_id gnl|my_center|LOCUS_44140 131364 130744 gene locus_tag LOCUS_44150 131364 130744 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_44150 131454 132275 gene locus_tag LOCUS_44160 131454 132275 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224810.1 protein_id gnl|my_center|LOCUS_44160 132990 132298 gene locus_tag LOCUS_44170 gene urtE 132990 132298 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 protein_id gnl|my_center|LOCUS_44170 133875 132994 gene locus_tag LOCUS_44180 gene urtD 133875 132994 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_44180 134984 133872 gene locus_tag LOCUS_44190 gene urtC 134984 133872 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_44190 135868 134981 gene locus_tag LOCUS_44200 gene urtB 135868 134981 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_44200 137282 135969 gene locus_tag LOCUS_44210 gene urtA 137282 135969 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_44210 138607 137561 gene locus_tag LOCUS_44220 138607 137561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 138723 139328 gene locus_tag LOCUS_44230 138723 139328 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892743.1 protein_id gnl|my_center|LOCUS_44230 140610 139360 gene locus_tag LOCUS_44240 140610 139360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528114.1 protein_id gnl|my_center|LOCUS_44240 141200 140691 gene locus_tag LOCUS_44250 141200 140691 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080331.1 protein_id gnl|my_center|LOCUS_44250 141565 141227 gene locus_tag LOCUS_44260 141565 141227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104250.1 protein_id gnl|my_center|LOCUS_44260 142228 141971 gene locus_tag LOCUS_44270 142228 141971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 142188 143801 gene locus_tag LOCUS_44280 142188 143801 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728918.1 protein_id gnl|my_center|LOCUS_44280 144734 143868 gene locus_tag LOCUS_44290 144734 143868 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_44290 144979 145431 gene locus_tag LOCUS_44300 gene cynS 144979 145431 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_44300 146999 145419 gene locus_tag LOCUS_44310 146999 145419 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_44310 147053 147589 gene locus_tag LOCUS_44320 147053 147589 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 protein_id gnl|my_center|LOCUS_44320 147586 148557 gene locus_tag LOCUS_44330 147586 148557 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730009.1 protein_id gnl|my_center|LOCUS_44330 149721 148840 gene locus_tag LOCUS_44340 gene sseA 149721 148840 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 protein_id gnl|my_center|LOCUS_44340 150863 149877 gene locus_tag LOCUS_44350 150863 149877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 151806 151258 gene locus_tag LOCUS_44360 151806 151258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_44360 152281 151829 gene locus_tag LOCUS_44370 152281 151829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 152827 152612 gene locus_tag LOCUS_44380 152827 152612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 152748 153968 gene locus_tag LOCUS_44390 152748 153968 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 protein_id gnl|my_center|LOCUS_44390 154441 154004 gene locus_tag LOCUS_44400 154441 154004 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 protein_id gnl|my_center|LOCUS_44400 155046 154555 gene locus_tag LOCUS_44410 155046 154555 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481508.1 protein_id gnl|my_center|LOCUS_44410 155881 155054 gene locus_tag LOCUS_44420 155881 155054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 156977 155898 gene locus_tag LOCUS_44430 gene ychF 156977 155898 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059441.1 protein_id gnl|my_center|LOCUS_44430 158333 157035 gene locus_tag LOCUS_44440 158333 157035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 158702 158445 gene locus_tag LOCUS_44450 158702 158445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 158909 160465 gene locus_tag LOCUS_44460 158909 160465 CDS product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091823.1 protein_id gnl|my_center|LOCUS_44460 160818 161156 gene locus_tag LOCUS_44470 160818 161156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 161194 162459 gene locus_tag LOCUS_44480 161194 162459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 162464 163444 gene locus_tag LOCUS_44490 162464 163444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44490 164033 163449 gene locus_tag LOCUS_44500 164033 163449 CDS product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 protein_id gnl|my_center|LOCUS_44500 164847 164050 gene locus_tag LOCUS_44510 164847 164050 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015195.1 protein_id gnl|my_center|LOCUS_44510 165767 164844 gene locus_tag LOCUS_44520 165767 164844 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 protein_id gnl|my_center|LOCUS_44520 166879 165857 gene locus_tag LOCUS_44530 166879 165857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 168151 167090 gene locus_tag LOCUS_44540 168151 167090 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226002.1 protein_id gnl|my_center|LOCUS_44540 169008 168148 gene locus_tag LOCUS_44550 169008 168148 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 protein_id gnl|my_center|LOCUS_44550 169205 169906 gene locus_tag LOCUS_44560 169205 169906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 170098 170442 gene locus_tag LOCUS_44570 170098 170442 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_44570 170533 171579 gene locus_tag LOCUS_44580 170533 171579 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_44580 172701 171607 gene locus_tag LOCUS_44590 172701 171607 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729370.1 protein_id gnl|my_center|LOCUS_44590 173815 172745 gene locus_tag LOCUS_44600 173815 172745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296523.1 protein_id gnl|my_center|LOCUS_44600 174641 173853 gene locus_tag LOCUS_44610 174641 173853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729372.1 protein_id gnl|my_center|LOCUS_44610 175533 174682 gene locus_tag LOCUS_44620 175533 174682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080062.1 protein_id gnl|my_center|LOCUS_44620 176261 175662 gene locus_tag LOCUS_44630 176261 175662 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029169.1 protein_id gnl|my_center|LOCUS_44630 176972 176331 gene locus_tag LOCUS_44640 176972 176331 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228754.1 protein_id gnl|my_center|LOCUS_44640 177082 178029 gene locus_tag LOCUS_44650 177082 178029 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060018.1 protein_id gnl|my_center|LOCUS_44650 177990 178958 gene locus_tag LOCUS_44660 177990 178958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 178955 180433 gene locus_tag LOCUS_44670 178955 180433 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084767.1 protein_id gnl|my_center|LOCUS_44670 180879 181760 gene locus_tag LOCUS_44680 gene ygiD 180879 181760 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 protein_id gnl|my_center|LOCUS_44680 182252 181764 gene locus_tag LOCUS_44690 182252 181764 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898141.1 protein_id gnl|my_center|LOCUS_44690 182627 182256 gene locus_tag LOCUS_44700 182627 182256 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089022.1 protein_id gnl|my_center|LOCUS_44700 182794 184164 gene locus_tag LOCUS_44710 182794 184164 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283890.1 protein_id gnl|my_center|LOCUS_44710 185839 184178 gene locus_tag LOCUS_44720 185839 184178 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104457.1 protein_id gnl|my_center|LOCUS_44720 185976 187175 gene locus_tag LOCUS_44730 185976 187175 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403096.1 protein_id gnl|my_center|LOCUS_44730 187162 187329 gene locus_tag LOCUS_44740 187162 187329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 187775 187389 gene locus_tag LOCUS_44750 187775 187389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 188373 188873 gene locus_tag LOCUS_44760 188373 188873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 188881 190176 gene locus_tag LOCUS_44770 188881 190176 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_44770 190179 191456 gene locus_tag LOCUS_44780 190179 191456 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_44780 191693 192550 gene locus_tag LOCUS_44790 191693 192550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_44790 192600 192977 gene locus_tag LOCUS_44800 192600 192977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 193087 194061 gene locus_tag LOCUS_44810 193087 194061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 194770 194042 gene locus_tag LOCUS_44820 194770 194042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 194939 195058 gene locus_tag LOCUS_44830 194939 195058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 195055 195408 gene locus_tag LOCUS_44840 195055 195408 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_44840 195398 195931 gene locus_tag LOCUS_44850 195398 195931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 195950 196249 gene locus_tag LOCUS_44860 195950 196249 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767500.1 protein_id gnl|my_center|LOCUS_44860 196371 197399 gene locus_tag LOCUS_44870 196371 197399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 198514 197396 gene locus_tag LOCUS_44880 198514 197396 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532992.1 protein_id gnl|my_center|LOCUS_44880 198769 198695 gene locus_tag LOCUS_t00490 198769 198695 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 199650 198898 gene locus_tag LOCUS_44890 199650 198898 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090334.1 protein_id gnl|my_center|LOCUS_44890 201375 199756 gene locus_tag LOCUS_44900 gene pgm 201375 199756 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_44900 201398 202156 gene locus_tag LOCUS_44910 201398 202156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 203960 202176 gene locus_tag LOCUS_44920 gene fadD6 203960 202176 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730303.1 protein_id gnl|my_center|LOCUS_44920 204135 205391 gene locus_tag LOCUS_44930 204135 205391 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893442.1 protein_id gnl|my_center|LOCUS_44930 205388 206008 gene locus_tag LOCUS_44940 205388 206008 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222336.1 protein_id gnl|my_center|LOCUS_44940 206063 206986 gene locus_tag LOCUS_44950 206063 206986 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 protein_id gnl|my_center|LOCUS_44950 207028 207774 gene locus_tag LOCUS_44960 207028 207774 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 protein_id gnl|my_center|LOCUS_44960 207771 208649 gene locus_tag LOCUS_44970 207771 208649 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_44970 209083 208712 gene locus_tag LOCUS_tm00010 209083 208712 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 209726 209145 gene locus_tag LOCUS_44980 209726 209145 CDS product TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131022173.1 protein_id gnl|my_center|LOCUS_44980 209870 210226 gene locus_tag LOCUS_44990 209870 210226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 210373 210915 gene locus_tag LOCUS_45000 210373 210915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 211393 210917 gene locus_tag LOCUS_45010 gene smpB 211393 210917 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728144.1 protein_id gnl|my_center|LOCUS_45010 212392 211484 gene locus_tag LOCUS_45020 gene ftsX 212392 211484 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907867.1 protein_id gnl|my_center|LOCUS_45020 213133 212447 gene locus_tag LOCUS_45030 gene ftsE 213133 212447 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728142.1 protein_id gnl|my_center|LOCUS_45030 213787 213224 gene locus_tag LOCUS_45040 213787 213224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 214743 213787 gene locus_tag LOCUS_45050 214743 213787 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 protein_id gnl|my_center|LOCUS_45050 215855 214740 gene locus_tag LOCUS_45060 gene prfB 215855 214740 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728139.1 protein_id gnl|my_center|LOCUS_45060 216295 215903 gene locus_tag LOCUS_45070 216295 215903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 216315 217118 gene locus_tag LOCUS_45080 gene hisN 216315 217118 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081049.1 protein_id gnl|my_center|LOCUS_45080 218822 217125 gene locus_tag LOCUS_45090 218822 217125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 218973 219548 gene locus_tag LOCUS_45100 218973 219548 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095569.1 protein_id gnl|my_center|LOCUS_45100 220518 219844 gene locus_tag LOCUS_45110 220518 219844 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897237.1 protein_id gnl|my_center|LOCUS_45110 220995 220537 gene locus_tag LOCUS_45120 220995 220537 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111747.1 protein_id gnl|my_center|LOCUS_45120 221173 222549 gene locus_tag LOCUS_45130 221173 222549 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094221.1 protein_id gnl|my_center|LOCUS_45130 222581 223804 gene locus_tag LOCUS_45140 222581 223804 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056417.1 protein_id gnl|my_center|LOCUS_45140 224246 223878 gene locus_tag LOCUS_45150 gene crcB 224246 223878 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 protein_id gnl|my_center|LOCUS_45150 224695 224243 gene locus_tag LOCUS_45160 224695 224243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 225192 224710 gene locus_tag LOCUS_45170 225192 224710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 227076 225196 gene locus_tag LOCUS_45180 227076 225196 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_45180 227833 227222 gene locus_tag LOCUS_45190 227833 227222 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_45190 228498 227860 gene locus_tag LOCUS_45200 228498 227860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 228662 229834 gene locus_tag LOCUS_45210 228662 229834 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093083.1 protein_id gnl|my_center|LOCUS_45210 229831 230517 gene locus_tag LOCUS_45220 229831 230517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093084.1 protein_id gnl|my_center|LOCUS_45220 231824 230580 gene locus_tag LOCUS_45230 231824 230580 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878214.1 protein_id gnl|my_center|LOCUS_45230 231983 233848 gene locus_tag LOCUS_45240 231983 233848 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896427.1 protein_id gnl|my_center|LOCUS_45240 234017 233916 gene locus_tag LOCUS_r00030 234017 233916 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence57 1639 317 gene locus_tag LOCUS_45250 1639 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 2540 1728 gene locus_tag LOCUS_45260 2540 1728 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731536.1 protein_id gnl|my_center|LOCUS_45260 3853 2684 gene locus_tag LOCUS_45270 3853 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 4611 4144 gene locus_tag LOCUS_45280 4611 4144 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024451011.1 protein_id gnl|my_center|LOCUS_45280 5049 4618 gene locus_tag LOCUS_45290 5049 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 6404 5214 gene locus_tag LOCUS_45300 6404 5214 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_45300 7124 6516 gene locus_tag LOCUS_45310 7124 6516 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083692.1 protein_id gnl|my_center|LOCUS_45310 7235 7966 gene locus_tag LOCUS_45320 7235 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699949.1 protein_id gnl|my_center|LOCUS_45320 8000 8239 gene locus_tag LOCUS_45330 8000 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 8766 8413 gene locus_tag LOCUS_45340 8766 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 9261 8773 gene locus_tag LOCUS_45350 9261 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 9608 9258 gene locus_tag LOCUS_45360 9608 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 9580 9861 gene locus_tag LOCUS_45370 9580 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 11391 10126 gene locus_tag LOCUS_45380 11391 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 12718 11792 gene locus_tag LOCUS_45390 12718 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 >Feature sequence58 354 584 gene locus_tag LOCUS_45400 354 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 2344 704 gene locus_tag LOCUS_45410 2344 704 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 protein_id gnl|my_center|LOCUS_45410 3063 2374 gene locus_tag LOCUS_45420 3063 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 4065 3109 gene locus_tag LOCUS_45430 4065 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 5105 4062 gene locus_tag LOCUS_45440 5105 4062 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071126.1 protein_id gnl|my_center|LOCUS_45440 6163 5102 gene locus_tag LOCUS_45450 6163 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 7152 6157 gene locus_tag LOCUS_45460 7152 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 8162 7149 gene locus_tag LOCUS_45470 8162 7149 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085985.1 protein_id gnl|my_center|LOCUS_45470 9196 8159 gene locus_tag LOCUS_45480 9196 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 9861 9205 gene locus_tag LOCUS_45490 9861 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 9931 10089 gene locus_tag LOCUS_45500 9931 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 10885 10079 gene locus_tag LOCUS_45510 10885 10079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077888.1 protein_id gnl|my_center|LOCUS_45510 11073 11549 gene locus_tag LOCUS_45520 11073 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 11825 11685 gene locus_tag LOCUS_45530 11825 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 >Feature sequence59 2155 209 gene locus_tag LOCUS_45540 2155 209 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 protein_id gnl|my_center|LOCUS_45540 2547 2152 gene locus_tag LOCUS_45550 2547 2152 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_45550 3059 4129 gene locus_tag LOCUS_45560 3059 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 4126 4452 gene locus_tag LOCUS_45570 4126 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 5148 6356 gene locus_tag LOCUS_45580 5148 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 6680 6321 gene locus_tag LOCUS_45590 6680 6321 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727473.1 protein_id gnl|my_center|LOCUS_45590 6778 7275 gene locus_tag LOCUS_45600 6778 7275 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_45600 7750 7328 gene locus_tag LOCUS_45610 7750 7328 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112739.1 protein_id gnl|my_center|LOCUS_45610 8175 7747 gene locus_tag LOCUS_45620 8175 7747 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_45620 8469 8206 gene locus_tag LOCUS_45630 8469 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45630 9996 8887 gene locus_tag LOCUS_45640 gene arsB 9996 8887 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112738.1 protein_id gnl|my_center|LOCUS_45640 10355 9993 gene locus_tag LOCUS_45650 10355 9993 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_45650 >Feature sequence60 1491 415 gene locus_tag LOCUS_45660 1491 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 1980 6563 gene locus_tag LOCUS_45670 gene gltB 1980 6563 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 protein_id gnl|my_center|LOCUS_45670 6556 8010 gene locus_tag LOCUS_45680 6556 8010 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_45680 8238 9125 gene locus_tag LOCUS_45690 8238 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 9249 9920 gene locus_tag LOCUS_45700 9249 9920 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897986.1 protein_id gnl|my_center|LOCUS_45700 >Feature sequence61 23 277 gene locus_tag LOCUS_45710 23 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 345 1130 gene locus_tag LOCUS_45720 345 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 1674 1273 gene locus_tag LOCUS_45730 1674 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 2979 1921 gene locus_tag LOCUS_45740 2979 1921 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110591.1 protein_id gnl|my_center|LOCUS_45740 3717 3046 gene locus_tag LOCUS_45750 3717 3046 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110587.1 protein_id gnl|my_center|LOCUS_45750 4895 3714 gene locus_tag LOCUS_45760 4895 3714 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_45760 6301 4910 gene locus_tag LOCUS_45770 6301 4910 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086616.1 protein_id gnl|my_center|LOCUS_45770 6648 6328 gene locus_tag LOCUS_45780 6648 6328 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086615.1 protein_id gnl|my_center|LOCUS_45780 6748 7773 gene locus_tag LOCUS_45790 6748 7773 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086614.1 protein_id gnl|my_center|LOCUS_45790 8255 7779 gene locus_tag LOCUS_45800 8255 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 8515 8778 gene locus_tag LOCUS_45810 8515 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 9727 8804 gene locus_tag LOCUS_45820 9727 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_45820 10081 9827 gene locus_tag LOCUS_45830 10081 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 >Feature sequence62 1000 95 gene locus_tag LOCUS_45840 gene dapA 1000 95 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900564.1 protein_id gnl|my_center|LOCUS_45840 1791 1039 gene locus_tag LOCUS_45850 gene thyX 1791 1039 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057143.1 protein_id gnl|my_center|LOCUS_45850 1979 3598 gene locus_tag LOCUS_45860 1979 3598 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_45860 4374 3595 gene locus_tag LOCUS_45870 4374 3595 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_45870 5680 4451 gene locus_tag LOCUS_45880 5680 4451 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728523.1 protein_id gnl|my_center|LOCUS_45880 6207 5680 gene locus_tag LOCUS_45890 6207 5680 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728519.1 protein_id gnl|my_center|LOCUS_45890 7055 6204 gene locus_tag LOCUS_45900 7055 6204 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057138.1 protein_id gnl|my_center|LOCUS_45900 7146 7520 gene locus_tag LOCUS_45910 7146 7520 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084459.1 protein_id gnl|my_center|LOCUS_45910 9038 7713 gene locus_tag LOCUS_45920 gene nhaA 9038 7713 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_45920 9344 9168 gene locus_tag LOCUS_45930 9344 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence63 2577 1819 gene locus_tag LOCUS_45940 2577 1819 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_45940 3374 2574 gene locus_tag LOCUS_45950 3374 2574 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086691.1 protein_id gnl|my_center|LOCUS_45950 6030 3574 gene locus_tag LOCUS_45960 gene iniR 6030 3574 CDS product isoniazid response ATPase/transcriptional regulator IniR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112276.1 protein_id gnl|my_center|LOCUS_45960 7876 6122 gene locus_tag LOCUS_45970 7876 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence64 231 539 gene locus_tag LOCUS_45980 231 539 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_45980 1067 732 gene locus_tag LOCUS_45990 1067 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 3574 1064 gene locus_tag LOCUS_46000 gene nasD 3574 1064 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_46000 3945 3574 gene locus_tag LOCUS_46010 3945 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 4382 4029 gene locus_tag LOCUS_46020 4382 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 6093 4465 gene locus_tag LOCUS_46030 6093 4465 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225258.1 protein_id gnl|my_center|LOCUS_46030 7016 6093 gene locus_tag LOCUS_46040 7016 6093 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225257.1 protein_id gnl|my_center|LOCUS_46040 >Feature sequence65 3 719 gene locus_tag LOCUS_46050 3 719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072792.1 protein_id gnl|my_center|LOCUS_46050 779 1663 gene locus_tag LOCUS_46060 779 1663 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_46060 1660 2040 gene locus_tag LOCUS_46070 1660 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113168.1 protein_id gnl|my_center|LOCUS_46070 2774 2118 gene locus_tag LOCUS_46080 2774 2118 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093324.1 protein_id gnl|my_center|LOCUS_46080 2944 4584 gene locus_tag LOCUS_46090 gene fadD8 2944 4584 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 protein_id gnl|my_center|LOCUS_46090 5689 4619 gene locus_tag LOCUS_46100 5689 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 6803 5820 gene locus_tag LOCUS_46110 6803 5820 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033272919.1 protein_id gnl|my_center|LOCUS_46110 >Feature sequence66 2432 279 gene locus_tag LOCUS_46120 2432 279 CDS product Rv1355c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728218.1 protein_id gnl|my_center|LOCUS_46120 2603 3361 gene locus_tag LOCUS_46130 2603 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893573.1 protein_id gnl|my_center|LOCUS_46130 4494 3307 gene locus_tag LOCUS_46140 4494 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 4974 6179 gene locus_tag LOCUS_46150 4974 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 >Feature sequence67 930 88 gene locus_tag LOCUS_46160 930 88 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111769.1 protein_id gnl|my_center|LOCUS_46160 1074 1733 gene locus_tag LOCUS_46170 1074 1733 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_46170 2351 1797 gene locus_tag LOCUS_46180 2351 1797 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_46180 3295 2351 gene locus_tag LOCUS_46190 3295 2351 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726832.1 protein_id gnl|my_center|LOCUS_46190 5117 3366 gene locus_tag LOCUS_46200 5117 3366 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730437.1 protein_id gnl|my_center|LOCUS_46200 6033 5221 gene locus_tag LOCUS_46210 6033 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 6953 6030 gene locus_tag LOCUS_46220 6953 6030 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776493.1 protein_id gnl|my_center|LOCUS_46220 7077 8237 gene locus_tag LOCUS_46230 7077 8237 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031803.1 protein_id gnl|my_center|LOCUS_46230 8234 8884 gene locus_tag LOCUS_46240 8234 8884 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_46240 9191 8859 gene locus_tag LOCUS_46250 9191 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46250 9389 9228 gene locus_tag LOCUS_46260 9389 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46260 10663 10217 gene locus_tag LOCUS_46270 10663 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 11539 10958 gene locus_tag LOCUS_46280 11539 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 12117 11575 gene locus_tag LOCUS_46290 12117 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 13152 12274 gene locus_tag LOCUS_46300 13152 12274 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230013.1 protein_id gnl|my_center|LOCUS_46300 13199 13570 gene locus_tag LOCUS_46310 13199 13570 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189554466.1 protein_id gnl|my_center|LOCUS_46310 13967 13635 gene locus_tag LOCUS_46320 13967 13635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 14249 15019 gene locus_tag LOCUS_46330 14249 15019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328117.1 protein_id gnl|my_center|LOCUS_46330 15344 15541 gene locus_tag LOCUS_46340 15344 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 15844 15575 gene locus_tag LOCUS_46350 15844 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 16593 16075 gene locus_tag LOCUS_46360 16593 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 16818 17942 gene locus_tag LOCUS_46370 16818 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 18183 18019 gene locus_tag LOCUS_46380 18183 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 20068 18983 gene locus_tag LOCUS_46390 20068 18983 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_46390 20204 20938 gene locus_tag LOCUS_46400 20204 20938 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_46400 22034 20913 gene locus_tag LOCUS_46410 22034 20913 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_46410 21951 22661 gene locus_tag LOCUS_46420 21951 22661 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899053.1 protein_id gnl|my_center|LOCUS_46420 23740 23111 gene locus_tag LOCUS_46430 gene upp 23740 23111 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729095.1 protein_id gnl|my_center|LOCUS_46430 25051 23807 gene locus_tag LOCUS_46440 25051 23807 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729094.1 protein_id gnl|my_center|LOCUS_46440 26298 25051 gene locus_tag LOCUS_46450 26298 25051 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729093.1 protein_id gnl|my_center|LOCUS_46450 28728 26467 gene locus_tag LOCUS_46460 gene katG 28728 26467 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731250.1 protein_id gnl|my_center|LOCUS_46460 29249 28809 gene locus_tag LOCUS_46470 29249 28809 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058377.1 protein_id gnl|my_center|LOCUS_46470 29296 30252 gene locus_tag LOCUS_46480 29296 30252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 30697 30284 gene locus_tag LOCUS_46490 30697 30284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 31333 30773 gene locus_tag LOCUS_46500 31333 30773 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 protein_id gnl|my_center|LOCUS_46500 31457 31888 gene locus_tag LOCUS_46510 31457 31888 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897995.1 protein_id gnl|my_center|LOCUS_46510 31948 32406 gene locus_tag LOCUS_46520 31948 32406 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_46520 34073 32430 gene locus_tag LOCUS_46530 34073 32430 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_46530 34245 34544 gene locus_tag LOCUS_46540 34245 34544 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 protein_id gnl|my_center|LOCUS_46540 34608 35291 gene locus_tag LOCUS_46550 34608 35291 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_46550 36117 35302 gene locus_tag LOCUS_46560 36117 35302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 37364 36279 gene locus_tag LOCUS_46570 37364 36279 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037683496.1 protein_id gnl|my_center|LOCUS_46570 38784 37423 gene locus_tag LOCUS_46580 gene gdhA 38784 37423 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_46580 39425 38973 gene locus_tag LOCUS_46590 39425 38973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 40792 39797 gene locus_tag LOCUS_46600 40792 39797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 41042 42418 gene locus_tag LOCUS_46610 41042 42418 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 protein_id gnl|my_center|LOCUS_46610 43263 42517 gene locus_tag LOCUS_46620 43263 42517 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727181.1 protein_id gnl|my_center|LOCUS_46620 43959 43453 gene locus_tag LOCUS_46630 43959 43453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_46630 44459 43956 gene locus_tag LOCUS_46640 44459 43956 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112386.1 protein_id gnl|my_center|LOCUS_46640 44582 45754 gene locus_tag LOCUS_46650 44582 45754 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 protein_id gnl|my_center|LOCUS_46650 47438 45921 gene locus_tag LOCUS_46660 47438 45921 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729913.1 protein_id gnl|my_center|LOCUS_46660 48986 47691 gene locus_tag LOCUS_46670 48986 47691 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551559.1 protein_id gnl|my_center|LOCUS_46670 49944 49045 gene locus_tag LOCUS_46680 49944 49045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 51198 49948 gene locus_tag LOCUS_46690 51198 49948 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729911.1 protein_id gnl|my_center|LOCUS_46690 52510 51251 gene locus_tag LOCUS_46700 52510 51251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296732.1 protein_id gnl|my_center|LOCUS_46700 52691 54286 gene locus_tag LOCUS_46710 52691 54286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727398.1 protein_id gnl|my_center|LOCUS_46710 54286 55356 gene locus_tag LOCUS_46720 54286 55356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727399.1 protein_id gnl|my_center|LOCUS_46720 55457 56254 gene locus_tag LOCUS_46730 55457 56254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892452.1 protein_id gnl|my_center|LOCUS_46730 56251 57942 gene locus_tag LOCUS_46740 56251 57942 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384487.1 protein_id gnl|my_center|LOCUS_46740 60094 58004 gene locus_tag LOCUS_46750 60094 58004 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_46750 60197 60709 gene locus_tag LOCUS_46760 60197 60709 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226972.1 protein_id gnl|my_center|LOCUS_46760 61018 60725 gene locus_tag LOCUS_46770 61018 60725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 61186 61635 gene locus_tag LOCUS_46780 61186 61635 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776784.1 protein_id gnl|my_center|LOCUS_46780 62293 61682 gene locus_tag LOCUS_46790 gene tmrB 62293 61682 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_46790 62899 62366 gene locus_tag LOCUS_46800 62899 62366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 63843 63004 gene locus_tag LOCUS_46810 63843 63004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 64841 63981 gene locus_tag LOCUS_46820 64841 63981 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089248.1 protein_id gnl|my_center|LOCUS_46820 64986 65588 gene locus_tag LOCUS_46830 64986 65588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 65729 66616 gene locus_tag LOCUS_46840 65729 66616 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_46840 67119 66679 gene locus_tag LOCUS_46850 67119 66679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 67751 67272 gene locus_tag LOCUS_46860 67751 67272 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031523.1 protein_id gnl|my_center|LOCUS_46860 68406 67891 gene locus_tag LOCUS_46870 68406 67891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 69109 69945 gene locus_tag LOCUS_46880 69109 69945 CDS product DUF4436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084649.1 protein_id gnl|my_center|LOCUS_46880 70261 71475 gene locus_tag LOCUS_46890 70261 71475 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731557.1 protein_id gnl|my_center|LOCUS_46890 71499 72404 gene locus_tag LOCUS_46900 71499 72404 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730538.1 protein_id gnl|my_center|LOCUS_46900 72622 73002 gene locus_tag LOCUS_46910 72622 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 75015 73183 gene locus_tag LOCUS_46920 75015 73183 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112322.1 protein_id gnl|my_center|LOCUS_46920 76613 75015 gene locus_tag LOCUS_46930 76613 75015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 76847 77002 gene locus_tag LOCUS_46940 76847 77002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 77048 78247 gene locus_tag LOCUS_46950 77048 78247 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229126.1 protein_id gnl|my_center|LOCUS_46950 78294 78728 gene locus_tag LOCUS_46960 78294 78728 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730672.1 protein_id gnl|my_center|LOCUS_46960 79402 78752 gene locus_tag LOCUS_46970 79402 78752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 80214 79456 gene locus_tag LOCUS_46980 80214 79456 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_46980 81039 80242 gene locus_tag LOCUS_46990 81039 80242 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088003.1 protein_id gnl|my_center|LOCUS_46990 82022 81147 gene locus_tag LOCUS_47000 82022 81147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 82680 83459 gene locus_tag LOCUS_47010 82680 83459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727057.1 protein_id gnl|my_center|LOCUS_47010 84776 85762 gene locus_tag LOCUS_47020 84776 85762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 85869 86348 gene locus_tag LOCUS_47030 85869 86348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47030 86342 86641 gene locus_tag LOCUS_47040 86342 86641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47040 87635 87048 gene locus_tag LOCUS_47050 87635 87048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411199.1 protein_id gnl|my_center|LOCUS_47050 87725 88222 gene locus_tag LOCUS_47060 87725 88222 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_47060 89464 88628 gene locus_tag LOCUS_47070 89464 88628 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228167.1 protein_id gnl|my_center|LOCUS_47070 89640 90257 gene locus_tag LOCUS_47080 89640 90257 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031841.1 protein_id gnl|my_center|LOCUS_47080 91635 90445 gene locus_tag LOCUS_47090 91635 90445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 91769 92743 gene locus_tag LOCUS_47100 91769 92743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 92759 94303 gene locus_tag LOCUS_47110 92759 94303 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_47110 94300 95145 gene locus_tag LOCUS_47120 94300 95145 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172927.1 protein_id gnl|my_center|LOCUS_47120 95173 95409 gene locus_tag LOCUS_47130 95173 95409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 98504 96309 gene locus_tag LOCUS_47140 98504 96309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 99025 98687 gene locus_tag LOCUS_47150 99025 98687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 99642 99064 gene locus_tag LOCUS_47160 99642 99064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 99592 99783 gene locus_tag LOCUS_47170 99592 99783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 99888 100073 gene locus_tag LOCUS_47180 99888 100073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 100571 100930 gene locus_tag LOCUS_47190 100571 100930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 100927 101205 gene locus_tag LOCUS_47200 100927 101205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 102168 101701 gene locus_tag LOCUS_47210 102168 101701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 102329 102826 gene locus_tag LOCUS_47220 102329 102826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 103751 102921 gene locus_tag LOCUS_47230 103751 102921 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_47230 104074 104697 gene locus_tag LOCUS_47240 104074 104697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 105102 104734 gene locus_tag LOCUS_47250 105102 104734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 105371 107170 gene locus_tag LOCUS_47260 105371 107170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_47260 107482 108567 gene locus_tag LOCUS_47270 gene rsgA 107482 108567 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_47270 109335 108586 gene locus_tag LOCUS_47280 109335 108586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 109458 109679 gene locus_tag LOCUS_47290 109458 109679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 110752 109811 gene locus_tag LOCUS_47300 110752 109811 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090311.1 protein_id gnl|my_center|LOCUS_47300 110875 111714 gene locus_tag LOCUS_47310 110875 111714 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133070.1 protein_id gnl|my_center|LOCUS_47310 112528 111755 gene locus_tag LOCUS_47320 112528 111755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 112770 113234 gene locus_tag LOCUS_47330 112770 113234 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228108.1 protein_id gnl|my_center|LOCUS_47330 113287 113490 gene locus_tag LOCUS_47340 113287 113490 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731507.1 protein_id gnl|my_center|LOCUS_47340 113549 115081 gene locus_tag LOCUS_47350 113549 115081 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 protein_id gnl|my_center|LOCUS_47350 115106 115477 gene locus_tag LOCUS_47360 115106 115477 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_47360 115593 116636 gene locus_tag LOCUS_47370 115593 116636 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_47370 116715 117440 gene locus_tag LOCUS_47380 116715 117440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 117513 118604 gene locus_tag LOCUS_47390 117513 118604 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_47390 118684 119502 gene locus_tag LOCUS_47400 118684 119502 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 protein_id gnl|my_center|LOCUS_47400 120165 119530 gene locus_tag LOCUS_47410 120165 119530 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529947.1 protein_id gnl|my_center|LOCUS_47410 120289 121236 gene locus_tag LOCUS_47420 120289 121236 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063674.1 protein_id gnl|my_center|LOCUS_47420 122755 121256 gene locus_tag LOCUS_47430 122755 121256 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111186.1 protein_id gnl|my_center|LOCUS_47430 123279 122839 gene locus_tag LOCUS_47440 123279 122839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 123337 123672 gene locus_tag LOCUS_47450 123337 123672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730478.1 protein_id gnl|my_center|LOCUS_47450 124597 123803 gene locus_tag LOCUS_47460 124597 123803 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726964.1 protein_id gnl|my_center|LOCUS_47460 124740 125888 gene locus_tag LOCUS_47470 124740 125888 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727112.1 protein_id gnl|my_center|LOCUS_47470 125899 126480 gene locus_tag LOCUS_47480 125899 126480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224912.1 protein_id gnl|my_center|LOCUS_47480 126477 127172 gene locus_tag LOCUS_47490 126477 127172 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726794.1 protein_id gnl|my_center|LOCUS_47490 127304 127753 gene locus_tag LOCUS_47500 127304 127753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 127966 129300 gene locus_tag LOCUS_47510 127966 129300 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510669.1 protein_id gnl|my_center|LOCUS_47510 129437 130444 gene locus_tag LOCUS_47520 129437 130444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 130804 130484 gene locus_tag LOCUS_47530 130804 130484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 131151 130807 gene locus_tag LOCUS_47540 131151 130807 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777071.1 protein_id gnl|my_center|LOCUS_47540 131819 131355 gene locus_tag LOCUS_47550 131819 131355 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_47550 131935 132405 gene locus_tag LOCUS_47560 131935 132405 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_47560 133275 132424 gene locus_tag LOCUS_47570 133275 132424 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225425.1 protein_id gnl|my_center|LOCUS_47570 133378 134142 gene locus_tag LOCUS_47580 133378 134142 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082662.1 protein_id gnl|my_center|LOCUS_47580 135236 134223 gene locus_tag LOCUS_47590 135236 134223 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 protein_id gnl|my_center|LOCUS_47590 136733 135237 gene locus_tag LOCUS_47600 136733 135237 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 protein_id gnl|my_center|LOCUS_47600 139387 136925 gene locus_tag LOCUS_47610 139387 136925 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222319.1 protein_id gnl|my_center|LOCUS_47610 139619 140830 gene locus_tag LOCUS_47620 139619 140830 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_47620 141001 141888 gene locus_tag LOCUS_47630 141001 141888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728690.1 protein_id gnl|my_center|LOCUS_47630 141942 142802 gene locus_tag LOCUS_47640 141942 142802 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_47640 144838 143249 gene locus_tag LOCUS_47650 144838 143249 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_47650 145826 144843 gene locus_tag LOCUS_47660 145826 144843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_47660 145941 146144 gene locus_tag LOCUS_47670 145941 146144 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339146.1 protein_id gnl|my_center|LOCUS_47670 146220 146579 gene locus_tag LOCUS_47680 146220 146579 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_47680 146576 147919 gene locus_tag LOCUS_47690 146576 147919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 147995 148654 gene locus_tag LOCUS_47700 147995 148654 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729809.1 protein_id gnl|my_center|LOCUS_47700 148651 149367 gene locus_tag LOCUS_47710 148651 149367 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_47710 149427 149903 gene locus_tag LOCUS_47720 149427 149903 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387781.1 protein_id gnl|my_center|LOCUS_47720 149908 150837 gene locus_tag LOCUS_47730 149908 150837 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_47730 150834 151955 gene locus_tag LOCUS_47740 150834 151955 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104228.1 protein_id gnl|my_center|LOCUS_47740 152233 152712 gene locus_tag LOCUS_47750 152233 152712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110122.1 protein_id gnl|my_center|LOCUS_47750 152717 153517 gene locus_tag LOCUS_47760 152717 153517 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_47760 155141 153537 gene locus_tag LOCUS_47770 gene fadD5 155141 153537 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_47770 156793 155558 gene locus_tag LOCUS_47780 156793 155558 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_47780 158054 157554 gene locus_tag LOCUS_47790 158054 157554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 158167 159336 gene locus_tag LOCUS_47800 158167 159336 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_47800 159741 159337 gene locus_tag LOCUS_47810 159741 159337 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_47810 160109 159738 gene locus_tag LOCUS_47820 160109 159738 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864957.1 protein_id gnl|my_center|LOCUS_47820 161191 160469 gene locus_tag LOCUS_47830 161191 160469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616503.1 protein_id gnl|my_center|LOCUS_47830 163983 161188 gene locus_tag LOCUS_47840 163983 161188 CDS product branched-chain amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228917.1 protein_id gnl|my_center|LOCUS_47840 165240 164050 gene locus_tag LOCUS_47850 165240 164050 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199821035.1 protein_id gnl|my_center|LOCUS_47850 165592 166248 gene locus_tag LOCUS_47860 gene fadR 165592 166248 CDS product TetR family transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227711.1 protein_id gnl|my_center|LOCUS_47860 166540 166256 gene locus_tag LOCUS_47870 166540 166256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 protein_id gnl|my_center|LOCUS_47870 166708 167463 gene locus_tag LOCUS_47880 166708 167463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 168359 167568 gene locus_tag LOCUS_47890 168359 167568 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 protein_id gnl|my_center|LOCUS_47890 168512 169375 gene locus_tag LOCUS_47900 168512 169375 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731590.1 protein_id gnl|my_center|LOCUS_47900 169375 170637 gene locus_tag LOCUS_47910 169375 170637 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_47910 170634 171170 gene locus_tag LOCUS_47920 gene leuD 170634 171170 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816726.1 protein_id gnl|my_center|LOCUS_47920 171170 172531 gene locus_tag LOCUS_47930 171170 172531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 protein_id gnl|my_center|LOCUS_47930 173347 172754 gene locus_tag LOCUS_47940 173347 172754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 179646 173344 gene locus_tag LOCUS_47950 179646 173344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 180294 179647 gene locus_tag LOCUS_47960 180294 179647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 180683 180291 gene locus_tag LOCUS_47970 180683 180291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 181008 181382 gene locus_tag LOCUS_47980 181008 181382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 183184 182126 gene locus_tag LOCUS_47990 183184 182126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 183344 183676 gene locus_tag LOCUS_48000 183344 183676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 184222 184365 gene locus_tag LOCUS_48010 184222 184365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 184810 185253 gene locus_tag LOCUS_48020 184810 185253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 185327 185932 gene locus_tag LOCUS_48030 185327 185932 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729062.1 protein_id gnl|my_center|LOCUS_48030 186482 185991 gene locus_tag LOCUS_48040 186482 185991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 186754 187635 gene locus_tag LOCUS_48050 186754 187635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157746499.1 protein_id gnl|my_center|LOCUS_48050 189036 189995 gene locus_tag LOCUS_48060 189036 189995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 190195 190536 gene locus_tag LOCUS_48070 190195 190536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 191348 191022 gene locus_tag LOCUS_48080 191348 191022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 191533 192732 gene locus_tag LOCUS_48090 gene dcm 191533 192732 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_48090 192729 193352 gene locus_tag LOCUS_48100 192729 193352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 193673 193371 gene locus_tag LOCUS_48110 193673 193371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 194441 193833 gene locus_tag LOCUS_48120 194441 193833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 196138 194438 gene locus_tag LOCUS_48130 196138 194438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 198459 196135 gene locus_tag LOCUS_48140 198459 196135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 199463 199762 gene locus_tag LOCUS_48150 199463 199762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 199711 201453 gene locus_tag LOCUS_48160 199711 201453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 201450 202058 gene locus_tag LOCUS_48170 201450 202058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 205643 202299 gene locus_tag LOCUS_48180 205643 202299 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726887.1 protein_id gnl|my_center|LOCUS_48180 <206406 205640 gene locus_tag LOCUS_48190 <206406 205640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891691.1:DUF4194 domain-containing protein >Feature sequence68 3 290 gene locus_tag LOCUS_48200 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 374 1741 gene locus_tag LOCUS_48210 374 1741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_48210 1815 3332 gene locus_tag LOCUS_48220 1815 3332 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229798.1 protein_id gnl|my_center|LOCUS_48220 4534 3647 gene locus_tag LOCUS_48230 gene rskA 4534 3647 CDS product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 protein_id gnl|my_center|LOCUS_48230 5286 4879 gene locus_tag LOCUS_48240 5286 4879 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_48240 5378 5632 gene locus_tag LOCUS_48250 5378 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 >Feature sequence69 761 138 gene locus_tag LOCUS_48260 761 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 1004 1429 gene locus_tag LOCUS_48270 1004 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 1541 2158 gene locus_tag LOCUS_48280 1541 2158 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262508.1 protein_id gnl|my_center|LOCUS_48280 2171 2371 gene locus_tag LOCUS_48290 2171 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 2706 2332 gene locus_tag LOCUS_48300 2706 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 3308 2856 gene locus_tag LOCUS_48310 3308 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 3495 4148 gene locus_tag LOCUS_48320 3495 4148 CDS product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057745.1 protein_id gnl|my_center|LOCUS_48320 >Feature sequence70 1029 520 gene locus_tag LOCUS_48330 1029 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 2711 1029 gene locus_tag LOCUS_48340 2711 1029 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524004.1 protein_id gnl|my_center|LOCUS_48340 3540 2761 gene locus_tag LOCUS_48350 3540 2761 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195447.1 protein_id gnl|my_center|LOCUS_48350 >Feature sequence71 176 75 gene locus_tag LOCUS_r00040 176 75 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3436 309 gene locus_tag LOCUS_r00050 3436 309 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence72 1316 471 gene locus_tag LOCUS_48360 1316 471 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877026.1 protein_id gnl|my_center|LOCUS_48360 <2941 1501 gene locus_tag LOCUS_48370 <2941 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225330.1:MFS transporter >Feature sequence73 609 445 gene locus_tag LOCUS_48380 609 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 1368 619 gene locus_tag LOCUS_48390 1368 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 2374 2460 gene locus_tag LOCUS_t00500 2374 2460 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence74 >Feature sequence75 32 1552 gene locus_tag LOCUS_r00060 32 1552 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence76 439 1788 gene locus_tag LOCUS_48400 439 1788 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_48400 >Feature sequence77 1589 399 gene locus_tag LOCUS_48410 1589 399 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228721.1 protein_id gnl|my_center|LOCUS_48410 >Feature sequence78 1285 284 gene locus_tag LOCUS_48420 1285 284 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731049.1 protein_id gnl|my_center|LOCUS_48420 2650 1292 gene locus_tag LOCUS_48430 2650 1292 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731050.1 protein_id gnl|my_center|LOCUS_48430 3390 2671 gene locus_tag LOCUS_48440 3390 2671 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_48440 4501 3422 gene locus_tag LOCUS_48450 4501 3422 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731053.1 protein_id gnl|my_center|LOCUS_48450 5513 4494 gene locus_tag LOCUS_48460 5513 4494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731054.1 protein_id gnl|my_center|LOCUS_48460 6508 5510 gene locus_tag LOCUS_48470 6508 5510 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897523.1 protein_id gnl|my_center|LOCUS_48470 7466 6540 gene locus_tag LOCUS_48480 7466 6540 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731055.1 protein_id gnl|my_center|LOCUS_48480 9058 7484 gene locus_tag LOCUS_48490 9058 7484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731056.1 protein_id gnl|my_center|LOCUS_48490 9486 10466 gene locus_tag LOCUS_48500 9486 10466 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731057.1 protein_id gnl|my_center|LOCUS_48500 10466 10861 gene locus_tag LOCUS_48510 10466 10861 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 protein_id gnl|my_center|LOCUS_48510 10993 10757 gene locus_tag LOCUS_48520 10993 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 11877 10984 gene locus_tag LOCUS_48530 11877 10984 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897528.1 protein_id gnl|my_center|LOCUS_48530 13333 11993 gene locus_tag LOCUS_48540 13333 11993 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_48540 14272 13340 gene locus_tag LOCUS_48550 14272 13340 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731064.1 protein_id gnl|my_center|LOCUS_48550 15908 14298 gene locus_tag LOCUS_48560 15908 14298 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_48560 16328 16927 gene locus_tag LOCUS_48570 16328 16927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 17247 18482 gene locus_tag LOCUS_48580 17247 18482 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_48580 18479 18763 gene locus_tag LOCUS_48590 18479 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 18760 18939 gene locus_tag LOCUS_48600 18760 18939 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056265.1 protein_id gnl|my_center|LOCUS_48600 18936 20141 gene locus_tag LOCUS_48610 18936 20141 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929895.1 protein_id gnl|my_center|LOCUS_48610 20138 20740 gene locus_tag LOCUS_48620 20138 20740 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417042.1 protein_id gnl|my_center|LOCUS_48620 22228 20744 gene locus_tag LOCUS_48630 22228 20744 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 protein_id gnl|my_center|LOCUS_48630 22335 22994 gene locus_tag LOCUS_48640 22335 22994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 23000 23632 gene locus_tag LOCUS_48650 23000 23632 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_48650 23798 25213 gene locus_tag LOCUS_48660 23798 25213 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900395.1 protein_id gnl|my_center|LOCUS_48660 25248 26243 gene locus_tag LOCUS_48670 25248 26243 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086660.1 protein_id gnl|my_center|LOCUS_48670 26254 27507 gene locus_tag LOCUS_48680 26254 27507 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966278.1 protein_id gnl|my_center|LOCUS_48680 27552 28949 gene locus_tag LOCUS_48690 27552 28949 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296612.1 protein_id gnl|my_center|LOCUS_48690 29039 29968 gene locus_tag LOCUS_48700 29039 29968 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219111346.1 protein_id gnl|my_center|LOCUS_48700 30258 29977 gene locus_tag LOCUS_48710 30258 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 30479 30706 gene locus_tag LOCUS_48720 30479 30706 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930433.1 protein_id gnl|my_center|LOCUS_48720 31614 30724 gene locus_tag LOCUS_48730 31614 30724 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227697.1 protein_id gnl|my_center|LOCUS_48730 31710 32324 gene locus_tag LOCUS_48740 31710 32324 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090991.1 protein_id gnl|my_center|LOCUS_48740 32453 33862 gene locus_tag LOCUS_48750 32453 33862 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892941.1 protein_id gnl|my_center|LOCUS_48750 33859 34665 gene locus_tag LOCUS_48760 gene eutC 33859 34665 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727733.1 protein_id gnl|my_center|LOCUS_48760 34920 35068 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggacgctcctcagggagc 35374 35060 gene locus_tag LOCUS_48770 35374 35060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 35882 35421 gene locus_tag LOCUS_48780 35882 35421 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065467.1 protein_id gnl|my_center|LOCUS_48780 37759 35930 gene locus_tag LOCUS_48790 37759 35930 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110404.1 protein_id gnl|my_center|LOCUS_48790 39853 37868 gene locus_tag LOCUS_48800 39853 37868 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111800.1 protein_id gnl|my_center|LOCUS_48800 40584 40075 gene locus_tag LOCUS_48810 40584 40075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 41487 40609 gene locus_tag LOCUS_48820 41487 40609 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894617.1 protein_id gnl|my_center|LOCUS_48820 42990 41566 gene locus_tag LOCUS_48830 gene pyk 42990 41566 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 protein_id gnl|my_center|LOCUS_48830 44665 43160 gene locus_tag LOCUS_48840 44665 43160 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 protein_id gnl|my_center|LOCUS_48840 49229 44658 gene locus_tag LOCUS_48850 gene gltB 49229 44658 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728908.1 protein_id gnl|my_center|LOCUS_48850 51447 49669 gene locus_tag LOCUS_48860 gene lgt 51447 49669 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728906.1 protein_id gnl|my_center|LOCUS_48860 52336 51527 gene locus_tag LOCUS_48870 gene trpA 52336 51527 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_48870 53679 52333 gene locus_tag LOCUS_48880 gene trpB 53679 52333 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_48880 54560 53742 gene locus_tag LOCUS_48890 gene trpC 54560 53742 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 protein_id gnl|my_center|LOCUS_48890 55524 54724 gene locus_tag LOCUS_48900 55524 54724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 57095 55521 gene locus_tag LOCUS_48910 57095 55521 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111172.1 protein_id gnl|my_center|LOCUS_48910 57271 57092 gene locus_tag LOCUS_48920 57271 57092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 57749 57348 gene locus_tag LOCUS_48930 gene hisI 57749 57348 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908233.1 protein_id gnl|my_center|LOCUS_48930 58563 57790 gene locus_tag LOCUS_48940 gene hisF 58563 57790 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 protein_id gnl|my_center|LOCUS_48940 59426 58560 gene locus_tag LOCUS_48950 59426 58560 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894599.1 protein_id gnl|my_center|LOCUS_48950 60169 59426 gene locus_tag LOCUS_48960 gene priA 60169 59426 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114402.1 protein_id gnl|my_center|LOCUS_48960 60569 60234 gene locus_tag LOCUS_48970 60569 60234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 61207 60566 gene locus_tag LOCUS_48980 gene hisH 61207 60566 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_48980 61833 61204 gene locus_tag LOCUS_48990 gene hisB 61833 61204 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728897.1 protein_id gnl|my_center|LOCUS_48990 62981 61830 gene locus_tag LOCUS_49000 62981 61830 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728896.1 protein_id gnl|my_center|LOCUS_49000 64321 62978 gene locus_tag LOCUS_49010 gene hisD 64321 62978 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068574.1 protein_id gnl|my_center|LOCUS_49010 64556 65008 gene locus_tag LOCUS_49020 64556 65008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 65114 66748 gene locus_tag LOCUS_49030 65114 66748 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110870.1 protein_id gnl|my_center|LOCUS_49030 66974 67363 gene locus_tag LOCUS_49040 66974 67363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 68195 67368 gene locus_tag LOCUS_49050 gene nadC 68195 67368 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894590.1 protein_id gnl|my_center|LOCUS_49050 69367 68294 gene locus_tag LOCUS_49060 gene nadA 69367 68294 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296580.1 protein_id gnl|my_center|LOCUS_49060 70055 69555 gene locus_tag LOCUS_49070 70055 69555 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296608.1 protein_id gnl|my_center|LOCUS_49070 70318 70058 gene locus_tag LOCUS_49080 70318 70058 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730282.1 protein_id gnl|my_center|LOCUS_49080 70436 71173 gene locus_tag LOCUS_49090 gene map 70436 71173 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084151.1 protein_id gnl|my_center|LOCUS_49090 71261 72019 gene locus_tag LOCUS_49100 71261 72019 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898937.1 protein_id gnl|my_center|LOCUS_49100 72578 71982 gene locus_tag LOCUS_49110 72578 71982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 72814 72575 gene locus_tag LOCUS_49120 72814 72575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407914.1 protein_id gnl|my_center|LOCUS_49120 73885 72848 gene locus_tag LOCUS_49130 gene bioB 73885 72848 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_49130 74556 73927 gene locus_tag LOCUS_49140 gene bioD 74556 73927 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_49140 75932 74751 gene locus_tag LOCUS_49150 75932 74751 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111242.1 protein_id gnl|my_center|LOCUS_49150 77251 75929 gene locus_tag LOCUS_49160 77251 75929 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_49160 77213 77941 gene locus_tag LOCUS_49170 77213 77941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 78111 80288 gene locus_tag LOCUS_49180 78111 80288 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 protein_id gnl|my_center|LOCUS_49180 80420 82975 gene locus_tag LOCUS_49190 80420 82975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 82980 85403 gene locus_tag LOCUS_49200 gene treY 82980 85403 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407790.1 protein_id gnl|my_center|LOCUS_49200 86427 85519 gene locus_tag LOCUS_49210 86427 85519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 87659 86487 gene locus_tag LOCUS_49220 87659 86487 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073462.1 protein_id gnl|my_center|LOCUS_49220 88828 87656 gene locus_tag LOCUS_49230 88828 87656 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112497.1 protein_id gnl|my_center|LOCUS_49230 89940 88840 gene locus_tag LOCUS_49240 89940 88840 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113394.1 protein_id gnl|my_center|LOCUS_49240 90956 89967 gene locus_tag LOCUS_49250 90956 89967 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112459.1 protein_id gnl|my_center|LOCUS_49250 91987 90953 gene locus_tag LOCUS_49260 91987 90953 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073472.1 protein_id gnl|my_center|LOCUS_49260 93318 91984 gene locus_tag LOCUS_49270 93318 91984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 94195 93329 gene locus_tag LOCUS_49280 94195 93329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083018.1 protein_id gnl|my_center|LOCUS_49280 95054 94197 gene locus_tag LOCUS_49290 95054 94197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727445.1 protein_id gnl|my_center|LOCUS_49290 95486 97156 gene locus_tag LOCUS_49300 gene treZ 95486 97156 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728877.1 protein_id gnl|my_center|LOCUS_49300 98811 97480 gene locus_tag LOCUS_49310 gene ilvA 98811 97480 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296584.1 protein_id gnl|my_center|LOCUS_49310 99065 100051 gene locus_tag LOCUS_49320 99065 100051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 100263 99994 gene locus_tag LOCUS_49330 100263 99994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 103939 100397 gene locus_tag LOCUS_49340 gene dnaE 103939 100397 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082233.1 protein_id gnl|my_center|LOCUS_49340 105702 104170 gene locus_tag LOCUS_49350 105702 104170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 106761 105835 gene locus_tag LOCUS_49360 106761 105835 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728869.1 protein_id gnl|my_center|LOCUS_49360 107614 106754 gene locus_tag LOCUS_49370 107614 106754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 107670 108416 gene locus_tag LOCUS_49380 107670 108416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 109018 108542 gene locus_tag LOCUS_49390 109018 108542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 109291 110283 gene locus_tag LOCUS_49400 109291 110283 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973324.1 protein_id gnl|my_center|LOCUS_49400 111916 110342 gene locus_tag LOCUS_49410 111916 110342 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296586.1 protein_id gnl|my_center|LOCUS_49410 112382 111927 gene locus_tag LOCUS_49420 112382 111927 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729240.1 protein_id gnl|my_center|LOCUS_49420 112498 113190 gene locus_tag LOCUS_49430 112498 113190 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729239.1 protein_id gnl|my_center|LOCUS_49430 114123 113218 gene locus_tag LOCUS_49440 114123 113218 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730538.1 protein_id gnl|my_center|LOCUS_49440 115191 114496 gene locus_tag LOCUS_49450 115191 114496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 118392 115195 gene locus_tag LOCUS_49460 gene ileS 118392 115195 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728863.1 protein_id gnl|my_center|LOCUS_49460 119628 118729 gene locus_tag LOCUS_49470 119628 118729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 120477 119662 gene locus_tag LOCUS_49480 120477 119662 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_49480 121153 120812 gene locus_tag LOCUS_49490 121153 120812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 121926 121210 gene locus_tag LOCUS_49500 121926 121210 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895610.1 protein_id gnl|my_center|LOCUS_49500 122807 122040 gene locus_tag LOCUS_49510 122807 122040 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080212.1 protein_id gnl|my_center|LOCUS_49510 123633 122833 gene locus_tag LOCUS_49520 gene pgeF 123633 122833 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080213.1 protein_id gnl|my_center|LOCUS_49520 124808 123642 gene locus_tag LOCUS_49530 gene ftsZ 124808 123642 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080214.1 protein_id gnl|my_center|LOCUS_49530 125836 125135 gene locus_tag LOCUS_49540 125836 125135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 127455 125833 gene locus_tag LOCUS_49550 gene murC 127455 125833 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729655.1 protein_id gnl|my_center|LOCUS_49550 128641 127508 gene locus_tag LOCUS_49560 gene murG 128641 127508 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729656.1 protein_id gnl|my_center|LOCUS_49560 130745 128793 gene locus_tag LOCUS_49570 130745 128793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 132334 130751 gene locus_tag LOCUS_49580 gene murD 132334 130751 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729658.1 protein_id gnl|my_center|LOCUS_49580 133424 132327 gene locus_tag LOCUS_49590 gene mraY 133424 132327 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060906.1 protein_id gnl|my_center|LOCUS_49590 134034 133549 gene locus_tag LOCUS_49600 134034 133549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 135635 134034 gene locus_tag LOCUS_49610 135635 134034 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 protein_id gnl|my_center|LOCUS_49610 137736 135982 gene locus_tag LOCUS_49620 137736 135982 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729661.1 protein_id gnl|my_center|LOCUS_49620 138867 138016 gene locus_tag LOCUS_49630 138867 138016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49630 139799 138870 gene locus_tag LOCUS_49640 gene rsmH 139799 138870 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 protein_id gnl|my_center|LOCUS_49640 140558 140118 gene locus_tag LOCUS_49650 gene mraZ 140558 140118 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729664.1 protein_id gnl|my_center|LOCUS_49650 141523 141119 gene locus_tag LOCUS_49660 141523 141119 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110487.1 protein_id gnl|my_center|LOCUS_49660 142169 141690 gene locus_tag LOCUS_49670 142169 141690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 142398 143234 gene locus_tag LOCUS_49680 142398 143234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 143236 144855 gene locus_tag LOCUS_49690 143236 144855 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_49690 145052 146047 gene locus_tag LOCUS_49700 145052 146047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 147073 146123 gene locus_tag LOCUS_49710 147073 146123 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234353719.1 protein_id gnl|my_center|LOCUS_49710 147112 148281 gene locus_tag LOCUS_49720 147112 148281 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 protein_id gnl|my_center|LOCUS_49720 148278 149909 gene locus_tag LOCUS_49730 148278 149909 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086651.1 protein_id gnl|my_center|LOCUS_49730 150336 149878 gene locus_tag LOCUS_49740 150336 149878 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 protein_id gnl|my_center|LOCUS_49740 150397 151611 gene locus_tag LOCUS_49750 150397 151611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 153116 151725 gene locus_tag LOCUS_49760 153116 151725 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110483.1 protein_id gnl|my_center|LOCUS_49760 153642 153160 gene locus_tag LOCUS_49770 153642 153160 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224331.1 protein_id gnl|my_center|LOCUS_49770 153746 155317 gene locus_tag LOCUS_49780 153746 155317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 156364 155654 gene locus_tag LOCUS_49790 156364 155654 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_49790 157526 156519 gene locus_tag LOCUS_49800 157526 156519 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224324.1 protein_id gnl|my_center|LOCUS_49800 158041 157526 gene locus_tag LOCUS_49810 158041 157526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 159463 158234 gene locus_tag LOCUS_49820 159463 158234 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729675.1 protein_id gnl|my_center|LOCUS_49820 159921 159484 gene locus_tag LOCUS_49830 159921 159484 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060860.1 protein_id gnl|my_center|LOCUS_49830 160376 159921 gene locus_tag LOCUS_49840 160376 159921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729677.1 protein_id gnl|my_center|LOCUS_49840 160485 162293 gene locus_tag LOCUS_49850 160485 162293 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080244.1 protein_id gnl|my_center|LOCUS_49850 163446 162334 gene locus_tag LOCUS_49860 gene pimB 163446 162334 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877983.1 protein_id gnl|my_center|LOCUS_49860 164855 163458 gene locus_tag LOCUS_49870 164855 163458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110481.1 protein_id gnl|my_center|LOCUS_49870 165899 164862 gene locus_tag LOCUS_49880 gene ripC 165899 164862 CDS product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729681.1 protein_id gnl|my_center|LOCUS_49880 166806 166123 gene locus_tag LOCUS_49890 166806 166123 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 protein_id gnl|my_center|LOCUS_49890 167668 169470 gene locus_tag LOCUS_49900 167668 169470 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712239.1 protein_id gnl|my_center|LOCUS_49900 169497 169775 gene locus_tag LOCUS_49910 169497 169775 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224084.1 protein_id gnl|my_center|LOCUS_49910 170890 169820 gene locus_tag LOCUS_49920 gene trpD 170890 169820 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_49920 171563 171072 gene locus_tag LOCUS_49930 171563 171072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 171756 172322 gene locus_tag LOCUS_49940 171756 172322 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_49940 172378 173274 gene locus_tag LOCUS_49950 172378 173274 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086661.1 protein_id gnl|my_center|LOCUS_49950 173271 174428 gene locus_tag LOCUS_49960 173271 174428 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093315.1 protein_id gnl|my_center|LOCUS_49960 174425 176047 gene locus_tag LOCUS_49970 174425 176047 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096648.1 protein_id gnl|my_center|LOCUS_49970 176248 177696 gene locus_tag LOCUS_49980 176248 177696 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091992.1 protein_id gnl|my_center|LOCUS_49980 178233 177817 gene locus_tag LOCUS_49990 178233 177817 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895661.1 protein_id gnl|my_center|LOCUS_49990 179333 178236 gene locus_tag LOCUS_50000 179333 178236 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899214.1 protein_id gnl|my_center|LOCUS_50000 179738 181663 gene locus_tag LOCUS_50010 gene asnB 179738 181663 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729689.1 protein_id gnl|my_center|LOCUS_50010 182103 181789 gene locus_tag LOCUS_50020 182103 181789 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_50020 183181 182246 gene locus_tag LOCUS_50030 183181 182246 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074905.1 protein_id gnl|my_center|LOCUS_50030 183787 183428 gene locus_tag LOCUS_50040 183787 183428 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895666.1 protein_id gnl|my_center|LOCUS_50040 185085 184009 gene locus_tag LOCUS_50050 185085 184009 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411420.1 protein_id gnl|my_center|LOCUS_50050 185338 186027 gene locus_tag LOCUS_50060 185338 186027 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729692.1 protein_id gnl|my_center|LOCUS_50060 186031 187863 gene locus_tag LOCUS_50070 186031 187863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 187881 188678 gene locus_tag LOCUS_50080 187881 188678 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110464.1 protein_id gnl|my_center|LOCUS_50080 189797 188691 gene locus_tag LOCUS_50090 189797 188691 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110461.1 protein_id gnl|my_center|LOCUS_50090 191007 189889 gene locus_tag LOCUS_50100 gene gcvT 191007 189889 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085318.1 protein_id gnl|my_center|LOCUS_50100 191121 192665 gene locus_tag LOCUS_50110 191121 192665 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296489.1 protein_id gnl|my_center|LOCUS_50110 192895 194709 gene locus_tag LOCUS_50120 gene sucB 192895 194709 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729702.1 protein_id gnl|my_center|LOCUS_50120 194745 195644 gene locus_tag LOCUS_50130 194745 195644 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110454.1 protein_id gnl|my_center|LOCUS_50130 195637 196374 gene locus_tag LOCUS_50140 gene lipB 195637 196374 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224047.1 protein_id gnl|my_center|LOCUS_50140 >Feature sequence79 1590 1291 gene locus_tag LOCUS_50150 1590 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 >Feature sequence80 277 1494 gene locus_tag LOCUS_50160 277 1494 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728499.1 protein_id gnl|my_center|LOCUS_50160 >Feature sequence81 621 1424 gene locus_tag LOCUS_50170 621 1424 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_50170 >Feature sequence82 678 136 gene locus_tag LOCUS_50180 678 136 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258315.1 protein_id gnl|my_center|LOCUS_50180 >Feature sequence83 >Feature sequence84 >Feature sequence85 549 94 gene locus_tag LOCUS_50190 gene arr 549 94 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064798.1 protein_id gnl|my_center|LOCUS_50190 >Feature sequence86 >Feature sequence87 >Feature sequence88 209 640 gene locus_tag LOCUS_50200 209 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 >Feature sequence89 <1 627 gene locus_tag LOCUS_50210 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976854.1:TerD family protein 1906 638 gene locus_tag LOCUS_50220 1906 638 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728502.1 protein_id gnl|my_center|LOCUS_50220 3015 1903 gene locus_tag LOCUS_50230 gene sfnG 3015 1903 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730592.1 protein_id gnl|my_center|LOCUS_50230 4246 3068 gene locus_tag LOCUS_50240 4246 3068 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014210.1 protein_id gnl|my_center|LOCUS_50240 5182 4439 gene locus_tag LOCUS_50250 5182 4439 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223976.1 protein_id gnl|my_center|LOCUS_50250 5262 6383 gene locus_tag LOCUS_50260 5262 6383 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074520.1 protein_id gnl|my_center|LOCUS_50260 6454 7668 gene locus_tag LOCUS_50270 6454 7668 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093119.1 protein_id gnl|my_center|LOCUS_50270 7774 8262 gene locus_tag LOCUS_50280 7774 8262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 8365 8862 gene locus_tag LOCUS_50290 8365 8862 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015609.1 protein_id gnl|my_center|LOCUS_50290 9150 8944 gene locus_tag LOCUS_50300 9150 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 10098 9151 gene locus_tag LOCUS_50310 10098 9151 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109982.1 protein_id gnl|my_center|LOCUS_50310 10649 10095 gene locus_tag LOCUS_50320 10649 10095 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109980.1 protein_id gnl|my_center|LOCUS_50320 11197 10646 gene locus_tag LOCUS_50330 11197 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 12613 11330 gene locus_tag LOCUS_50340 gene eno 12613 11330 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 protein_id gnl|my_center|LOCUS_50340 13586 12798 gene locus_tag LOCUS_50350 13586 12798 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066466.1 protein_id gnl|my_center|LOCUS_50350 14691 13894 gene locus_tag LOCUS_50360 14691 13894 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_50360 16742 14820 gene locus_tag LOCUS_50370 gene cysC 16742 14820 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084798.1 protein_id gnl|my_center|LOCUS_50370 17650 16742 gene locus_tag LOCUS_50380 gene cysD 17650 16742 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060060.1 protein_id gnl|my_center|LOCUS_50380 18498 17728 gene locus_tag LOCUS_50390 18498 17728 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401540.1 protein_id gnl|my_center|LOCUS_50390 20086 18680 gene locus_tag LOCUS_50400 20086 18680 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_50400 20338 21306 gene locus_tag LOCUS_50410 20338 21306 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084203.1 protein_id gnl|my_center|LOCUS_50410 21303 22511 gene locus_tag LOCUS_50420 21303 22511 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090880.1 protein_id gnl|my_center|LOCUS_50420 22508 23833 gene locus_tag LOCUS_50430 gene efeB 22508 23833 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730522.1 protein_id gnl|my_center|LOCUS_50430 24505 23855 gene locus_tag LOCUS_50440 24505 23855 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384586.1 protein_id gnl|my_center|LOCUS_50440 25588 24557 gene locus_tag LOCUS_50450 25588 24557 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727579.1 protein_id gnl|my_center|LOCUS_50450 26371 25637 gene locus_tag LOCUS_50460 26371 25637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223884.1 protein_id gnl|my_center|LOCUS_50460 27297 26518 gene locus_tag LOCUS_50470 27297 26518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223885.1 protein_id gnl|my_center|LOCUS_50470 27596 28774 gene locus_tag LOCUS_50480 27596 28774 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223883.1 protein_id gnl|my_center|LOCUS_50480 28816 29820 gene locus_tag LOCUS_50490 28816 29820 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139593.1 protein_id gnl|my_center|LOCUS_50490 29817 31151 gene locus_tag LOCUS_50500 29817 31151 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890213.1 protein_id gnl|my_center|LOCUS_50500 32211 31303 gene locus_tag LOCUS_50510 32211 31303 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109977.1 protein_id gnl|my_center|LOCUS_50510 35919 32338 gene locus_tag LOCUS_50520 gene mfd 35919 32338 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109976.1 protein_id gnl|my_center|LOCUS_50520 36010 36585 gene locus_tag LOCUS_50530 36010 36585 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 protein_id gnl|my_center|LOCUS_50530 38208 36625 gene locus_tag LOCUS_50540 38208 36625 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_50540 38989 38324 gene locus_tag LOCUS_50550 38989 38324 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 protein_id gnl|my_center|LOCUS_50550 39696 39046 gene locus_tag LOCUS_50560 39696 39046 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_50560 39832 40476 gene locus_tag LOCUS_50570 39832 40476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_50570 40473 41804 gene locus_tag LOCUS_50580 40473 41804 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110021.1 protein_id gnl|my_center|LOCUS_50580 41801 42619 gene locus_tag LOCUS_50590 41801 42619 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_50590 42619 43626 gene locus_tag LOCUS_50600 42619 43626 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 protein_id gnl|my_center|LOCUS_50600 44417 43908 gene locus_tag LOCUS_50610 44417 43908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 45849 44689 gene locus_tag LOCUS_50620 45849 44689 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_50620 46038 47210 gene locus_tag LOCUS_50630 46038 47210 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_50630 47207 48547 gene locus_tag LOCUS_50640 47207 48547 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728200.1 protein_id gnl|my_center|LOCUS_50640 48684 48612 gene locus_tag LOCUS_t00510 48684 48612 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 49554 48799 gene locus_tag LOCUS_50650 gene fabG 49554 48799 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_50650 49846 51342 gene locus_tag LOCUS_50660 gene glmU 49846 51342 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950485.1 protein_id gnl|my_center|LOCUS_50660 51400 52377 gene locus_tag LOCUS_50670 51400 52377 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405263.1 protein_id gnl|my_center|LOCUS_50670 53511 52579 gene locus_tag LOCUS_50680 53511 52579 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392461.1 protein_id gnl|my_center|LOCUS_50680 53786 54361 gene locus_tag LOCUS_50690 53786 54361 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256309.1 protein_id gnl|my_center|LOCUS_50690 54436 56073 gene locus_tag LOCUS_50700 54436 56073 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_50700 56126 56968 gene locus_tag LOCUS_50710 gene catA 56126 56968 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015093.1 protein_id gnl|my_center|LOCUS_50710 57068 57409 gene locus_tag LOCUS_50720 gene arsC 57068 57409 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896825.1 protein_id gnl|my_center|LOCUS_50720 57887 57426 gene locus_tag LOCUS_50730 57887 57426 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877467.1 protein_id gnl|my_center|LOCUS_50730 58125 58766 gene locus_tag LOCUS_50740 58125 58766 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896828.1 protein_id gnl|my_center|LOCUS_50740 58840 59409 gene locus_tag LOCUS_50750 gene pth 58840 59409 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_50750 59479 60540 gene locus_tag LOCUS_50760 59479 60540 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109965.1 protein_id gnl|my_center|LOCUS_50760 61651 60887 gene locus_tag LOCUS_50770 61651 60887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_50770 62721 61648 gene locus_tag LOCUS_50780 62721 61648 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_50780 63019 64035 gene locus_tag LOCUS_50790 63019 64035 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109965.1 protein_id gnl|my_center|LOCUS_50790 64393 66003 gene locus_tag LOCUS_50800 64393 66003 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 protein_id gnl|my_center|LOCUS_50800 66044 66760 gene locus_tag LOCUS_50810 66044 66760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 67774 66785 gene locus_tag LOCUS_50820 67774 66785 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_50820 68010 69629 gene locus_tag LOCUS_50830 68010 69629 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_50830 69686 70510 gene locus_tag LOCUS_50840 69686 70510 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804932.1 protein_id gnl|my_center|LOCUS_50840 70642 71766 gene locus_tag LOCUS_50850 70642 71766 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240578.1 protein_id gnl|my_center|LOCUS_50850 71801 72562 gene locus_tag LOCUS_50860 71801 72562 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_50860 72584 73495 gene locus_tag LOCUS_50870 gene cynR 72584 73495 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256690.1 protein_id gnl|my_center|LOCUS_50870 73504 74376 gene locus_tag LOCUS_50880 73504 74376 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970995.1 protein_id gnl|my_center|LOCUS_50880 75693 74434 gene locus_tag LOCUS_50890 75693 74434 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 protein_id gnl|my_center|LOCUS_50890 76503 75742 gene locus_tag LOCUS_50900 gene fabG 76503 75742 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406963.1 protein_id gnl|my_center|LOCUS_50900 76718 77902 gene locus_tag LOCUS_50910 76718 77902 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_50910 79592 77946 gene locus_tag LOCUS_50920 79592 77946 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466616.1 protein_id gnl|my_center|LOCUS_50920 80418 79654 gene locus_tag LOCUS_50930 80418 79654 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808206.1 protein_id gnl|my_center|LOCUS_50930 81817 80684 gene locus_tag LOCUS_50940 81817 80684 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225706.1 protein_id gnl|my_center|LOCUS_50940 83328 81979 gene locus_tag LOCUS_50950 83328 81979 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027008.1 protein_id gnl|my_center|LOCUS_50950 83726 84922 gene locus_tag LOCUS_50960 83726 84922 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728223.1 protein_id gnl|my_center|LOCUS_50960 84980 86137 gene locus_tag LOCUS_50970 84980 86137 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_50970 86807 86202 gene locus_tag LOCUS_50980 86807 86202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50980 87293 88174 gene locus_tag LOCUS_50990 87293 88174 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_50990 88207 90036 gene locus_tag LOCUS_51000 88207 90036 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_51000 91216 90071 gene locus_tag LOCUS_51010 91216 90071 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728306.1 protein_id gnl|my_center|LOCUS_51010 92199 91234 gene locus_tag LOCUS_51020 92199 91234 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_51020 92921 92253 gene locus_tag LOCUS_51030 92921 92253 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_51030 93064 94056 gene locus_tag LOCUS_51040 93064 94056 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162266193.1 protein_id gnl|my_center|LOCUS_51040 95412 94474 gene locus_tag LOCUS_51050 gene rsmA 95412 94474 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 protein_id gnl|my_center|LOCUS_51050 96557 95376 gene locus_tag LOCUS_51060 96557 95376 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082874.1 protein_id gnl|my_center|LOCUS_51060 97566 96649 gene locus_tag LOCUS_51070 97566 96649 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180038.1 protein_id gnl|my_center|LOCUS_51070 98465 97635 gene locus_tag LOCUS_51080 98465 97635 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_51080 98647 99369 gene locus_tag LOCUS_51090 98647 99369 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224844.1 protein_id gnl|my_center|LOCUS_51090 99366 101723 gene locus_tag LOCUS_51100 99366 101723 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224843.1 protein_id gnl|my_center|LOCUS_51100 101797 102486 gene locus_tag LOCUS_51110 101797 102486 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742149.1 protein_id gnl|my_center|LOCUS_51110 102489 103478 gene locus_tag LOCUS_51120 102489 103478 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226641.1 protein_id gnl|my_center|LOCUS_51120 103660 104238 gene locus_tag LOCUS_51130 103660 104238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 104244 104948 gene locus_tag LOCUS_51140 104244 104948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 105698 107272 gene locus_tag LOCUS_51150 gene metG 105698 107272 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730537.1 protein_id gnl|my_center|LOCUS_51150 107288 108514 gene locus_tag LOCUS_51160 107288 108514 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905428.1 protein_id gnl|my_center|LOCUS_51160 108511 109791 gene locus_tag LOCUS_51170 108511 109791 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_51170 110653 109715 gene locus_tag LOCUS_51180 gene rsmI 110653 109715 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229988.1 protein_id gnl|my_center|LOCUS_51180 110692 112272 gene locus_tag LOCUS_51190 110692 112272 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109948.1 protein_id gnl|my_center|LOCUS_51190 112738 112322 gene locus_tag LOCUS_51200 112738 112322 CDS product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 protein_id gnl|my_center|LOCUS_51200 112924 114240 gene locus_tag LOCUS_51210 gene ptsJ 112924 114240 CDS product transcriptional regulator PtsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565130.1 protein_id gnl|my_center|LOCUS_51210 116161 114350 gene locus_tag LOCUS_51220 116161 114350 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_51220 116609 116193 gene locus_tag LOCUS_51230 116609 116193 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222929.1 protein_id gnl|my_center|LOCUS_51230 117868 116606 gene locus_tag LOCUS_51240 gene arcA 117868 116606 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082883.1 protein_id gnl|my_center|LOCUS_51240 119315 118014 gene locus_tag LOCUS_51250 119315 118014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_51250 120343 119312 gene locus_tag LOCUS_51260 120343 119312 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 protein_id gnl|my_center|LOCUS_51260 120896 120447 gene locus_tag LOCUS_51270 gene soxR 120896 120447 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476095.1 protein_id gnl|my_center|LOCUS_51270 121833 120970 gene locus_tag LOCUS_51280 121833 120970 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 protein_id gnl|my_center|LOCUS_51280 122037 122342 gene locus_tag LOCUS_51290 122037 122342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 123102 122404 gene locus_tag LOCUS_51300 123102 122404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 123455 123700 gene locus_tag LOCUS_51310 123455 123700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 124563 123751 gene locus_tag LOCUS_51320 124563 123751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 126691 124565 gene locus_tag LOCUS_51330 126691 124565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 128287 126710 gene locus_tag LOCUS_51340 128287 126710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 128733 128284 gene locus_tag LOCUS_51350 128733 128284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 130279 128735 gene locus_tag LOCUS_51360 130279 128735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 130861 131895 gene locus_tag LOCUS_51370 130861 131895 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065932.1 protein_id gnl|my_center|LOCUS_51370 131929 133530 gene locus_tag LOCUS_51380 131929 133530 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404631.1 protein_id gnl|my_center|LOCUS_51380 133537 134019 gene locus_tag LOCUS_51390 133537 134019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 133971 134978 gene locus_tag LOCUS_51400 133971 134978 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_51400 135054 135923 gene locus_tag LOCUS_51410 135054 135923 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230371.1 protein_id gnl|my_center|LOCUS_51410 137974 136265 gene locus_tag LOCUS_51420 137974 136265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 138742 138179 gene locus_tag LOCUS_51430 138742 138179 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284483.1 protein_id gnl|my_center|LOCUS_51430 138800 139579 gene locus_tag LOCUS_51440 138800 139579 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284464.1 protein_id gnl|my_center|LOCUS_51440 139576 139899 gene locus_tag LOCUS_51450 139576 139899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 141210 139918 gene locus_tag LOCUS_51460 141210 139918 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115973.1 protein_id gnl|my_center|LOCUS_51460 142211 141267 gene locus_tag LOCUS_51470 142211 141267 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_51470 142759 142322 gene locus_tag LOCUS_51480 142759 142322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 143265 142843 gene locus_tag LOCUS_51490 143265 142843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 143945 143490 gene locus_tag LOCUS_51500 143945 143490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 144398 144000 gene locus_tag LOCUS_51510 144398 144000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 145078 145560 gene locus_tag LOCUS_51520 145078 145560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 146445 146927 gene locus_tag LOCUS_51530 146445 146927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 147089 147580 gene locus_tag LOCUS_51540 147089 147580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 148556 148482 gene locus_tag LOCUS_t00520 148556 148482 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 148807 148535 gene locus_tag LOCUS_51550 148807 148535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 148697 149386 gene locus_tag LOCUS_51560 148697 149386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891983.1 protein_id gnl|my_center|LOCUS_51560 150756 149476 gene locus_tag LOCUS_51570 150756 149476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730554.1 protein_id gnl|my_center|LOCUS_51570 151572 150904 gene locus_tag LOCUS_51580 151572 150904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 151653 152462 gene locus_tag LOCUS_51590 151653 152462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 153159 152515 gene locus_tag LOCUS_51600 153159 152515 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104413.1 protein_id gnl|my_center|LOCUS_51600 154704 153400 gene locus_tag LOCUS_51610 154704 153400 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063361.1 protein_id gnl|my_center|LOCUS_51610 155806 154862 gene locus_tag LOCUS_51620 155806 154862 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082898.1 protein_id gnl|my_center|LOCUS_51620 155970 156548 gene locus_tag LOCUS_51630 155970 156548 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048375.1 protein_id gnl|my_center|LOCUS_51630 156647 156805 gene locus_tag LOCUS_51640 156647 156805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 157193 158740 gene locus_tag LOCUS_51650 157193 158740 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727376.1 protein_id gnl|my_center|LOCUS_51650 160010 158745 gene locus_tag LOCUS_51660 gene nhaA 160010 158745 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_51660 160240 160911 gene locus_tag LOCUS_51670 160240 160911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 161035 161925 gene locus_tag LOCUS_51680 161035 161925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 162067 162195 gene locus_tag LOCUS_51690 162067 162195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 163114 162491 gene locus_tag LOCUS_51700 163114 162491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 164453 166216 gene locus_tag LOCUS_51710 164453 166216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730254.1 protein_id gnl|my_center|LOCUS_51710 166209 168104 gene locus_tag LOCUS_51720 166209 168104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_51720 168167 169147 gene locus_tag LOCUS_51730 168167 169147 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 protein_id gnl|my_center|LOCUS_51730 170929 169082 gene locus_tag LOCUS_51740 170929 169082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_51740 171867 171181 gene locus_tag LOCUS_51750 171867 171181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 172579 171938 gene locus_tag LOCUS_51760 172579 171938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 173954 173286 gene locus_tag LOCUS_51770 173954 173286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 175595 174093 gene locus_tag LOCUS_51780 175595 174093 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730565.1 protein_id gnl|my_center|LOCUS_51780 177225 175819 gene locus_tag LOCUS_51790 177225 175819 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082904.1 protein_id gnl|my_center|LOCUS_51790 178040 177354 gene locus_tag LOCUS_51800 gene mprA 178040 177354 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_51800 178280 182395 gene locus_tag LOCUS_51810 178280 182395 CDS product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 protein_id gnl|my_center|LOCUS_51810 >Feature sequence90