COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2902896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(543..1379) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1410..2177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2457..2822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(2894..4783) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4837..5064) product DUF1414 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705556.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5141..6133 product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene yejK CDS complement(6224..7774) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene ahpF CDS complement(7845..8411) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene ahpC CDS 9065..10663 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(10751..11329) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705571.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(11346..11840) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12113..13159 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705623.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene queA CDS 13240..14379 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 14502..14834 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene yajC CDS 14853..16706 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene secD CDS 16719..17663 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705626.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene secF CDS 17779..18663 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene nlpI CDS 18827..19561 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene trmJ CDS 19679..20098 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene iscR CDS 20208..21422 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 21460..21846 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene iscU CDS 21858..22181 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene iscA CDS 22191..22739 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene hscB CDS 22745..24586 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene hscA CDS 24589..24927 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299781.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene fdx CDS 24949..25149 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene iscX CDS 25346..25777 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene ndk CDS 26124..27650 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 27806..28924 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 29401..30357 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 30372..31490 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene ispG CDS 31580..32863 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene hisS CDS 32853..33497 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33494..34663 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene bamB CDS 34752..36290 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705649.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene der CDS complement(36619..38106) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene mltF CDS 38472..42362 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene purL CDS complement(42468..43001) product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 43103..44560 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene cls CDS complement(44651..45865) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(46181..46444) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(46539..47951) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene dacB CDS complement(48046..49797) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706440.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 49980..51179 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(51314..52273) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(52277..53347) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 53701..55755 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 55752..56234 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 56304..57296 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene rluF CDS complement(57594..58904) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene tyrS CDS 59191..60024 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819278.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 60201..63293 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817986.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 63406..63645 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 63834..63995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 64368..66122 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(66344..67147) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene suhB CDS 67399..67944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(67971..68225) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 68394..69086 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene pdxH CDS 69176..69673 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705313.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(70384..71523) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(71747..73114) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene purB CDS complement(73396..74022) product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334622.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene hflD CDS complement(74019..75125) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene mnmA CDS complement(75805..76206) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 76343..76774 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(76782..78209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(78213..79667) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(79752..81092) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene mgtE CDS complement(81340..81795) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(82350..83066) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene arcA CDS complement(83071..83289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 83604..84095 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706822.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 84577..84783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 85368..86066 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 86349..88808 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene thrA CDS 88809..89765 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene thrB CDS 89762..91042 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene thrC CDS 91871..92470 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(92753..93901) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 94705..95577 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene tesB CDS 95940..96614 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene ung CDS 97090..97821 product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454982.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 97827..98879 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 98876..100117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(100394..100732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 100841..101134 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(102921..103685) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103245.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(103827..104459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(104452..105090) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266514.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 105975..106781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 106859..108166 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 108166..109077 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene rfbD CDS 109074..109976 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene rfbA CDS 109978..110529 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100803.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene rfbC CDS 110526..110921 product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 110918..111655 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 111652..112071 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 112081..113211 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036848.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 113236..114492 product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036849.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 114590..115486 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 115488..116270 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462483.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 117544..118335 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706684.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 118358..119557 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 119614..120570 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 120574..121122 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 121310..121690 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 121964..123703 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 124815..125414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 note possible pseudo, frameshifted CDS 125414..125833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 note possible pseudo, frameshifted CDS complement(126018..126380) product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 126571..128211 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene pgi CDS complement(128304..128516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(129700..130422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(130938..131687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(131801..132601) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene map CDS 133504..134232 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene rpsB CDS 134340..135221 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene tsf CDS 135291..136022 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene pyrH CDS 136793..137350 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene frr CDS 137424..138200 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene uppS CDS 138591..139466 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303453.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 139466..140656 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705098.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene ispC CDS 140656..142005 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene rseP CDS 142912..145365 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene bamA CDS 145445..145945 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 145959..146981 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene lpxD CDS 147005..147478 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634777.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene fabZ CDS 147481..148272 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene lpxA CDS 148265..149464 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene lpxB CDS 149464..150075 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene rnhB CDS 150072..153578 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene dnaE CDS 153587..154537 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene accA CDS 155043..157913 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 158252..161149 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 161209..161958 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 162100..163410 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene tilS CDS complement(164166..164972) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene xthA CDS 165348..166310 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 166297..169395 product multidrug efflux RND transporter permease subunit VmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481813.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene vmeF CDS complement(169764..170243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 tRNA 170367..170451 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 170573..170657 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(170796..171881) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(171991..172368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(172470..173948) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262043.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(174321..174470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(174729..175595) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 175669..176004 product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(176013..176855) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 177004..177708 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(177847..177990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 178203..178469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 178518..179012 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(179253..179690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(179992..180417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(180564..182228) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706534.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene leuA tRNA complement(182649..182723) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(183302..184108) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene trpA CDS complement(184108..185298) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene trpB CDS complement(185298..186704) product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene trpCF CDS complement(186698..188299) product bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene trpD CDS complement(188292..189848) product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 190251..191075 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706722.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 191094..191714 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816405.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 191737..192669 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene rluB CDS complement(193040..194053) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(194046..195575) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS complement(195583..196356) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(196349..197356) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene cmoB CDS complement(197419..198192) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705416.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene cmoA CDS complement(198412..199257) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 199496..200785 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 201228..203030 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene aspS CDS 203033..203470 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene nudB CDS 203536..204276 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 204401..204922 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene ruvC CDS 205079..205684 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene ruvA CDS 205687..206721 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene ruvB CDS 206901..207311 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene ybgC CDS 207301..207981 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707366.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene tolQ CDS 207978..208406 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene tolR CDS 208411..209577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 209595..210878 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707363.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene tolB CDS 210906..211439 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene pal CDS 211455..212249 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351957.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene ybgF tRNA 212412..212487 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 212505..212580 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 212633..212708 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 212761..212836 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 212866..212941 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 212959..213034 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 213064..213139 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 213157..213232 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 213262..213337 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 213355..213430 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 213460..213535 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 213730..214791 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene nadA CDS 214994..215683 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene phoB CDS 215697..217010 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene phoR CDS 217156..218124 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 218277..220514 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 220525..222174 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene pstA CDS 222230..223048 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene pstB CDS 223057..223764 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene phoU CDS complement(223881..224789) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene rdgC CDS 224979..225416 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 225693..226154 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 226512..227834 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005023250.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(228194..229111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 229603..230253 product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 230293..230481 product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 230573..230800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 note possible pseudo, internal stop codon CDS 230903..231043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 note possible pseudo, internal stop codon CDS 231170..231586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 note possible pseudo, internal stop codon CDS 231662..232624 product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 232642..233538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 233668..234117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 234168..234665 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050665004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene radC CDS 234742..234918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(234967..235368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(235572..235778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(236062..236520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(236513..237040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(237053..237490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 237648..237848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 237835..240729 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 240887..241816 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 241834..243672 product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 243725..245380 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 245401..248139 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(248238..249275) product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(249290..249712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(250119..251297) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(251294..251971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 note possible pseudo, frameshifted CDS complement(252163..252474) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 tRNA complement(253155..253231) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 253530..254048 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706618.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene tadA CDS 254732..256912 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(257107..257334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 257252..258568 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 259160..260179 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene epd CDS 260225..261388 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene pgk CDS 261449..262528 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene fbaA CDS 262731..266570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 266872..269016 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 269009..270394 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 270414..271712 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 271741..272337 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 272337..273023 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 273026..274933 product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 274946..275074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 275124..275834 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 276053..277282 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024946386.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene serA CDS complement(277345..278367) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(278367..279269) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene rimK CDS 279659..282382 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene acnA CDS complement(282455..283258) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168058.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene modE CDS 283356..284162 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene modA CDS 284354..285037 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene modB CDS 285034..286113 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene modC CDS 286469..287284 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(287343..288743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(288781..289011) product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(289367..289666) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene zapA CDS 289818..290384 product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705605.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 290404..291624 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512770.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene ubiH CDS 291629..292864 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 293055..293444 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene gcvH CDS 293684..294001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 294128..294523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 294527..294769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(294831..295676) product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(295660..296349) product DnaT-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(296754..297716) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene galU CDS complement(297824..298162) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(298317..298616) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(298673..299212) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 299379..300164 product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene miaE CDS complement(300182..301072) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705748.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(301069..302073) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(302073..302966) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(302950..303912) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705751.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(303915..305564) product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819989.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene sapA CDS complement(305579..306595) product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene pspF CDS 306815..307501 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene pspA CDS 307504..307737 product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene pspB CDS 307722..308105 product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024941345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene pspC tRNA complement(308134..308209) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(308216..308292) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 308545..309402 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene folD CDS 309464..310285 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418550.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(310353..310697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(311009..311317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(311422..312801) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113994347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene cysS CDS 312962..313459 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 313617..314354 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene lpxH CDS complement(314427..315815) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499754.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(316040..316306) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 316492..316917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(316982..318121) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(318377..319126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 319626..320210 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 320227..320553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 320618..321016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(321068..324223) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 324601..325233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(325121..325669) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217538.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene mobB CDS 325804..327507 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 327504..331253 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 331500..333317 product Wzy polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818252.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(333340..333732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 334019..334369 product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene hinT CDS 334410..335009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 334999..335850 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 335908..336924 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene nagZ CDS 337133..338425 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(338556..338837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(338948..339394) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(339572..340690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(340832..341764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(341755..342096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(342132..342374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 342849..344291 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene cls CDS 344462..345895 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 346014..346439 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(346533..347213) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226718.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(347255..348118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(348354..349667) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 350120..351349 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene yegD CDS complement(351468..352043) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(352132..352680) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(352826..354301) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028024693.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(354500..357970) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene mfd CDS complement(357967..358539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 358633..359844 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 359837..360610 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene lolD CDS 360610..361851 product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene lolE CDS complement(361935..362438) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(362435..362923) product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 363128..365170 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 365198..366949 product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene msbA CDS 366949..367914 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene lpxK CDS 367904..368092 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 368089..368838 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706580.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene kdsB CDS 368970..369989 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene fbp CDS complement(370204..371490) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 371899..372288 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene sdhC CDS 372282..372626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 372619..374394 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene sdhA CDS 374408..375124 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 375241..378051 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene sucA CDS 378070..379281 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene odhB CDS 379358..380530 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene sucC CDS 380527..381399 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025475.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene sucD CDS 381653..383269 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(383369..384475) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(384898..386298) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene xseA CDS 386403..387920 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705859.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene guaB CDS 388024..389601 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene guaA CDS 390245..391498 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(391560..391808) product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048897891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(391935..394157) product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032606839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 394376..394657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 394755..394913 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 394910..395275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(395286..395558) product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene yfaE CDS complement(395555..396736) product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene nrdB CDS complement(396736..399009) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819935.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene nrdA CDS complement(399369..400046) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(400048..400806) product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350657.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ubiG CDS 400988..403750 product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene gyrA CDS 403981..405066 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705848.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene serC CDS 405258..406367 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene hisC CDS 406518..407798 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene aroA CDS complement(407877..408269) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 408406..408900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(408904..410709) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 tRNA complement(410831..410906) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(410944..411019) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(411057..411132) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(411170..411245) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 412075..412821 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705821.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 412867..414075 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 414116..414448 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 414556..416340 product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 416525..418189 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene glnS CDS complement(418322..418714) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene fur CDS 418932..419345 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 419529..419768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(419972..420265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(420453..421358) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(421477..422004) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene fldA CDS complement(422050..422334) product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene ybfE CDS complement(422338..422559) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705431.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(422625..423392) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 423510..424034 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene seqA CDS 424060..425703 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene pgm CDS 425850..426887 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene astE CDS 427123..427989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(428682..429236) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 tRNA 429608..429698 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(429949..431085) product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(431152..432036) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072413.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(432152..432898) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 433114..434136 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706895.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene sohB CDS complement(434157..434432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 note possible pseudo, frameshifted CDS complement(434366..435514) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene astB note possible pseudo, frameshifted CDS 435936..437744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 note possible pseudo, frameshifted CDS 437720..438565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 note possible pseudo, frameshifted CDS 438672..438848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(438901..440238) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene lysC CDS complement(440528..441856) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene argA CDS 442170..443615 product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene nhaD CDS complement(443754..446336) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(446504..447457) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(447645..448904) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095928.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 449028..449921 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(449978..450295) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(450313..451467) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene nagA CDS complement(451496..452263) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464933.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene nagB tRNA complement(452836..452911) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 453067..455064 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene uvrB CDS complement(455135..455734) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(455759..456235) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(456269..457216) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705843.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene corA CDS 457405..457902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(457996..459933) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene mnmC CDS 460039..461253 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene fabB CDS complement(461303..461893) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706868.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene mobA CDS 462056..463261 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886905.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 463336..464196 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 464273..465061 product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(465237..465368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(465378..467075) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 467563..468057 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene purE CDS 468054..469121 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene purK CDS complement(469241..469462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 469731..470879 product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene vmeJ CDS 470876..473929 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(474082..475899) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(476032..476826) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 477004..477993 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 478448..479152 product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene osmY CDS 479265..479426 product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 479903..480526 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene cobO CDS 480704..481222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 481618..483354 product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(483404..483889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(484060..484509) product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(484648..484962) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 485139..487253 product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene ovoA CDS complement(487469..488893) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(489265..490077) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 490252..492636 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene ppsA CDS 492805..493518 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene queC CDS complement(493607..494863) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene moeA CDS 495092..495748 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene folE CDS 495777..496049 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 496351..498255 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705508.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene speA CDS complement(498419..498574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 498871..499512 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 499525..501759 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(501910..503349) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene pyk CDS complement(504194..504775) product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene sodB CDS 505140..505472 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010673955.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(505537..505866) product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene tusE CDS complement(505904..506938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 note possible pseudo, frameshifted CDS complement(506902..508107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 note possible pseudo, frameshifted CDS complement(508347..509006) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 tRNA 509252..509342 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 509416..510087 product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 510214..510918 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512724.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(510987..511592) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene ribA CDS 511825..512520 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene cmk CDS 512664..514349 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene rpsA CDS 514418..514699 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene ihfB CDS 514855..515142 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705692.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 515151..516320 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene lapB CDS 516410..517117 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene pyrF CDS 517199..517417 product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(517532..517942) product DNA-binding transcriptional regulator H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene hns CDS 518636..520192 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705702.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(520328..521551) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(521683..522918) product long-chain fatty acid transporter FadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene fadL CDS complement(523126..524598) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene putP CDS complement(524854..525579) product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(525572..526144) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 526429..527742 product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209704.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene fadI CDS 527739..529922 product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene fadJ CDS 530290..532206 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene htpG CDS 532485..533129 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072102.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene adk CDS 533237..534217 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene hemH CDS complement(534300..534725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 534904..535107 product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 535173..535856 product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 536132..537499 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 537584..538156 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(539073..539699) product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(539869..541977) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene dinG CDS 542356..543411 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(544312..544680) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(544749..545684) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene dusC CDS 545925..547106 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(547308..547847) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517116.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(547841..548605) product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 548814..549788 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene cysB CDS complement(549888..550295) product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene gloA CDS 550567..550773 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(551425..552060) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706455.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene nth CDS complement(552076..552771) product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005002.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(552768..553400) product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene rsxG CDS complement(553400..554449) product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706452.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene rsxD CDS complement(554449..556992) product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene rsxC CDS complement(556994..557548) product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene rsxB CDS complement(557548..558162) product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene rsxA CDS complement(558719..559681) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene pfkA CDS complement(559783..560565) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene tpiA CDS complement(560688..561476) product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene elyC CDS 561552..562376 product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene cmoM CDS 562429..563697 product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene mukF CDS 563678..564379 product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene mukE CDS 564379..568878 product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene mukB CDS complement(568958..570469) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 570785..571555 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(571633..573966) product mechanosensitive channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene ybiO CDS 574251..574769 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 575798..576346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 576622..577833 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 577886..578260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 578554..579213 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(579270..579677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(580035..581393) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 581740..582321 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 582628..583614 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 583614..591428 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 591458..592105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 note possible pseudo, frameshifted CDS complement(592193..592606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 592861..594414 product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 594542..594883 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 594935..595627 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(595544..595765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 596260..596901 product DUF6037 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248477.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(597031..597321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(597314..597535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 597997..598833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 598972..599592 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(599689..600090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 note possible pseudo, frameshifted CDS complement(600090..600782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 note possible pseudo, frameshifted CDS 601036..601920 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 602068..602433 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 602592..603137 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene apt CDS 603144..605639 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene dnaX CDS 605714..606043 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 606175..606783 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene recR CDS complement(606825..607733) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705769.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene cdd CDS complement(607788..608036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 note possible pseudo, frameshifted CDS complement(608030..608476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 note possible pseudo, frameshifted CDS complement(608473..608790) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705771.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(608834..610255) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene sbcB CDS complement(610487..610828) product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(610998..611891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(612001..612210) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 612486..613013 product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene ectA CDS 613089..614363 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene ectB CDS 614453..614848 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 614978..616414 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 616547..616828 product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002883180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene ppiC CDS 616899..618521 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 618544..619260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 619374..620510 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211335.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 620570..621109 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 621872..625735 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene hrpA CDS 625867..626154 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945378.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene rplY CDS complement(626201..626704) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 626795..627301 product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 627308..627535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 627670..628935 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 629025..629411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 629470..630495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 630504..631343 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 631498..634935 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene recC CDS 634932..638675 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene recB CDS 638668..640737 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene recD CDS complement(640802..643312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(643483..644121) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(644481..644930) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 645088..645675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 note possible pseudo, frameshifted CDS 645642..645947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(645999..646808) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124233367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene cysQ CDS 647068..648660 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(648740..649594) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007372648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(649734..650618) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(650630..652111) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(652177..653781) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(653805..654557) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(654579..655253) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene mtgA CDS complement(655237..655410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 655413..656429 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 656568..657446 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 657609..658400 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(658430..658612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(658566..659534) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene lpxM CDS complement(659589..660389) product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 660485..663124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 663379..664632 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 664748..665626 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 665837..666709 product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene mshI CDS 666706..667287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 667284..667934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 667927..668229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 668244..669932 product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene mshL CDS 669932..670744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 670752..672452 product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene mshE CDS 672452..673672 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 674509..675009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 675166..675705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 675745..676308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 676298..676834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 676831..677583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 677573..677959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 677949..680939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 681087..682865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 683076..684854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(685049..685672) product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(685672..687312) product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene pqiB CDS complement(687305..688690) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 688894..689265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 689262..689888 product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 689888..691720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(691818..693008) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(693183..694109) product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(694220..695272) product heme ABC transporter ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687540.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene fbpC CDS complement(695296..696846) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(697070..698071) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(698442..699071) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene hisIE CDS complement(699064..699837) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880146.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene hisF CDS complement(699819..700556) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene hisA CDS complement(700560..701204) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene hisH CDS complement(701161..702285) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene hisB CDS complement(702286..703386) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706051.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene hisC CDS complement(703390..704676) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene hisD CDS complement(704679..705581) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene hisG CDS complement(706137..707975) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 708128..710065 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 710069..710767 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene tsaB CDS 710777..710926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 711170..712879 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene fadD CDS 712946..714043 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene rnd CDS complement(714107..714391) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene minE CDS complement(714395..715207) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene minD CDS complement(715229..715933) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene minC CDS 716039..716320 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 716472..717134 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 717152..717586 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(717686..718216) product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene dsbB CDS 718364..719131 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene fadR CDS complement(719225..720748) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706275.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(720756..721655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 note possible pseudo, frameshifted CDS complement(721811..722023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 note possible pseudo, frameshifted CDS complement(722045..723967) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 724668..725771 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704606.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 725929..727068 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 tRNA complement(727225..727301) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(727325..727401) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(727507..728502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(728558..729946) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 730065..730670 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210939.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(730766..730969) product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(731046..731792) product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 731932..732369 product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 732617..734551 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706169.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene thrS CDS 734650..735090 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene infC CDS 735164..735358 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene rpmI CDS 735373..735732 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene rplT CDS 735885..736868 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene pheS CDS 736884..739271 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706166.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pheT CDS 739273..739587 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene ihfA CDS 739756..740457 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056950.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene cobB CDS complement(740499..742073) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 742544..743002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 743037..744845 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene nrdD CDS complement(744842..745360) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 745457..746452 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 746492..747379 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 747523..748281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029303065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 748278..748880 product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706152.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(748961..749884) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene ttcA CDS complement(749964..750893) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300766.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene uspE CDS complement(750925..751596) product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300768.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(751733..752416) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706150.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(752400..752639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(752636..755005) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(755008..755379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(755602..756678) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene ccoP CDS complement(756675..756896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(756909..757526) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300783.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene ccoO CDS complement(757539..758963) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene ccoN CDS 759288..759758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 759972..761261 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706131.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 761453..761656 product transcription antiterminator/RNA stability regulator CspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004716300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene cspE CDS complement(762089..762535) product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 762635..763009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(763091..763381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(763480..763779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 note possible pseudo, frameshifted CDS complement(763776..764444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 note possible pseudo, frameshifted CDS complement(764882..766108) product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(766119..766898) product N-acetylmuramoyl-L-alanine amidase AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene ampDh2 CDS 767119..767772 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(767810..768691) product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 769103..770380 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 770435..771382 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(771387..772961) product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 773286..774002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(774105..774995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(774988..776376) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 776640..778595 product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 778689..779234 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene fabA CDS complement(779552..781462) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(781462..781692) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(781718..783895) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene rlmKL tRNA 784044..784120 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 784189..784265 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 784323..784399 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 784457..784533 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(784750..785286) product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(785432..786439) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063878970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene pyrD CDS complement(786501..791306) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(791636..791860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(791860..794466) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene pepN CDS complement(794556..796562) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene prc CDS complement(796573..797190) product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706143.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene proQ CDS complement(797278..797736) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 797810..799621 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(799622..799948) product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 800185..801375 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(801382..802341) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(802356..802769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(802800..803612) product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(803675..804652) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163136678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene holB CDS complement(804633..805259) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706110.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene tmk CDS complement(805263..806270) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350715.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene mltG CDS complement(806254..807102) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706108.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene pabC CDS complement(807162..808403) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene fabF CDS complement(808476..808712) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene acpP CDS complement(808871..809605) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene fabG CDS complement(809726..810664) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706105.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene fabD CDS complement(810743..811702) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(811708..812718) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene plsX CDS complement(812727..812897) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene rpmF CDS complement(812919..813440) product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene yceD CDS 813634..814224 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(814310..814951) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(814948..815904) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene rluC CDS 816249..819338 product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene rne CDS 819504..820394 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(820395..821435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(821467..821946) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(821973..823979) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(824003..824584) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene dcd CDS complement(824719..825789) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706090.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene apbC CDS 826104..828068 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene metG CDS complement(828227..829603) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(829738..830304) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(830347..831753) product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene pabB CDS 831931..832449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 note possible pseudo, frameshifted CDS 832404..833450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 note possible pseudo, frameshifted CDS complement(833723..834760) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene arsB CDS complement(834863..835588) product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene arsH CDS complement(835639..836103) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070873.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(836119..836460) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(836563..837186) product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene narL CDS complement(837247..839088) product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene narX CDS 839407..841011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 841086..842573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 842651..846406 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 846417..847964 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene narH CDS 847967..848713 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene narJ CDS 848723..849403 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene narI CDS 849417..850295 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 850372..851364 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene moaA CDS 851406..851810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 851979..853016 product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene selD CDS 853009..854100 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706080.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene mnmH CDS 854232..854864 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706079.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(855159..855767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705673.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 855978..856754 product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene mepA CDS 856796..858298 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene glpK CDS 858339..859856 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011913952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene glpD CDS complement(859886..861016) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 861725..862270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(862370..864628) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(864615..865205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(865209..865826) product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(865823..867439) product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 867718..868398 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 868518..869450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(869464..870231) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(870448..872382) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(872691..874625) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 875112..876266 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 876732..877649 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970090.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene arcC CDS complement(877746..878804) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene nmoA CDS complement(878869..879477) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 879829..881565 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ggt CDS complement(881576..882061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 882318..882758 product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(882755..884971) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene betT CDS complement(885226..885570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(885612..886469) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(886789..887097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(887247..887828) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 887947..888330 product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018971.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(888365..888739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(888736..889278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 note possible pseudo, frameshifted CDS complement(889391..890440) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(890578..891144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(891225..891698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(892065..892955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 893654..893863 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(894236..895924) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 896085..896984 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene cysD CDS 897164..897511 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 897515..899545 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene cysN CDS complement(899617..899913) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(900059..900586) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209714.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(900669..901754) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene aroC CDS complement(901766..902695) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706198.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene prmB CDS 902757..903281 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706199.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene smrB CDS complement(903339..903851) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene sixA CDS 904797..905783 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 905821..906264 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 906435..907127 product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 tRNA complement(907188..907275) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 907535..908233 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene rnt CDS complement(908324..909790) product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene modF CDS 909965..910210 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(910283..910894) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244647.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 911197..912519 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 912726..913616 product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene aguB CDS 913628..914686 product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704695.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene aguA CDS complement(914775..915512) product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171804.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene dedD CDS complement(915543..916814) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene folC CDS complement(916814..917707) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene accD CDS complement(917918..918712) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene truA CDS complement(918803..920932) product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(921098..922207) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706497.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 922329..923087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(923169..923723) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(923846..925852) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 926069..927916 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene sppA CDS 927943..928965 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ansA CDS complement(929005..929598) product tetrathionate respiration response regulator TtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019083413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene ttrR CDS complement(929624..931279) product tetrathionate respiration histidine kinase TtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene ttrS CDS 931454..932182 product tetrathionate reductase subunit TtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170783.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene ttrB CDS 932191..933255 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene nrfD CDS 933248..936319 product tetrathionate reductase subunit TtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002364.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene ttrA CDS complement(936404..936931) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene hutZ CDS complement(936924..937427) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445093.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene hutX CDS 937631..938197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 note possible pseudo, frameshifted CDS 938212..938469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 note possible pseudo, frameshifted CDS 938466..939158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 note possible pseudo, frameshifted CDS 939167..939481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 note possible pseudo, frameshifted CDS 939478..940383 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 940464..941060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(941071..941562) product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 941676..942686 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(942894..943196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 943294..943704 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(943802..944566) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(944553..944702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 note possible pseudo, frameshifted CDS complement(944672..945559) product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706548.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene btuC note possible pseudo, frameshifted CDS complement(945606..946388) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 946594..947208 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene msrA CDS 947211..947681 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene msrB CDS complement(947718..949217) product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 949340..950458 product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 950696..951289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 951492..951947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(952293..952892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 953079..954128 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(954176..954460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 repeat_region 954637..956345 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagccgcctgtgtggcggtgaag CDS complement(956474..957106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(957116..958141) product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene csy3 CDS complement(958171..959118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(959115..960380) product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene csy1 CDS complement(960653..964060) product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene cas3f CDS complement(964057..965034) product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene cas1f CDS complement(965259..966131) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 966364..967452 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(968032..968901) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene htpX CDS complement(968992..969684) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705390.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene bioD CDS complement(969677..970528) product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene bioC CDS complement(970587..970802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 note possible pseudo, frameshifted CDS complement(970981..971721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 note possible pseudo, frameshifted CDS complement(971997..973058) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene bioB CDS 973185..974540 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene bioA CDS complement(974605..976587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(976674..977018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 977139..978539 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene asnS CDS 978864..979019 product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene torE CDS 979058..980242 product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene torC CDS 980265..981539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 note possible pseudo, frameshifted CDS 981448..982734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 note possible pseudo, frameshifted CDS 982771..983415 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene torD CDS complement(983412..984290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 note possible pseudo, frameshifted CDS complement(984179..985324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 note possible pseudo, frameshifted CDS complement(985325..985888) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(985965..987893) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(988236..988706) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706386.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 989196..990494 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 990781..991788 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 991917..992798 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(992802..993719) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765209.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene rarD CDS 994005..994874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 995001..995651 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(995709..995906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(995909..996358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 note possible pseudo, frameshifted CDS 996569..997129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 tRNA complement(997224..997310) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(997330..997403) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(997680..998228) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene pgsA CDS complement(998268..999143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 note possible pseudo, frameshifted CDS complement(999125..1000096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 note possible pseudo, frameshifted CDS complement(1000103..1000744) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene uvrY CDS complement(1000741..1000896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(1000941..1002836) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene ppiD CDS complement(1002952..1003233) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene hupB CDS complement(1003437..1005788) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene lon CDS complement(1006027..1007310) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005301524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene clpX CDS complement(1007389..1007976) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene clpP CDS complement(1008103..1009413) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene tig CDS complement(1009734..1011431) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(1011551..1012651) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 1012970..1013323 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156592.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1013337..1014020 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208550.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 1014024..1014263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1014333..1015454) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene ald CDS 1015620..1015856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1015896..1016753) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(1016908..1017357) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350081.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene moaE CDS complement(1017358..1017606) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654167.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene moaD CDS complement(1017603..1018076) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705487.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene moaC CDS complement(1018076..1018597) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene moaB CDS complement(1018655..1019635) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene moaA CDS complement(1020098..1020478) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705471.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1020471..1021850) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1022187..1022945) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1023031..1023837 product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 1024025..1025578 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706482.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1025582..1025944 product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706891.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1025948..1028293) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(1028437..1029435) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene bamC CDS 1029832..1030299 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene bcp CDS complement(1030493..1030924) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1030925..1031341) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479368.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1031539..1034496 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1034541..1034780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(1034770..1035924) product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene yedE CDS 1036181..1037215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(1037237..1037494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1037518..1037856) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523720.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1038023..1038310 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381183.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1038307..1038582 product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483176.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1038714..1039253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1039545..1040843) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene dcm CDS complement(1040910..1041626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(1041753..1042250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1042255..1042674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1042726..1044045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1044230..1044820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1044862..1046139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1046297..1047763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1048369..1049142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1049240..1050103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1050231..1050968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1051087..1051335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(1051594..1052037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1052496..1052876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(1052960..1054711) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(1054808..1055539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(1055639..1056280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1056633..1057625 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1058232..1060232) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene tkt CDS 1060570..1061730 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706910.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene metK CDS 1061848..1062327 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 1062380..1063483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1063601..1064332 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene rsmE CDS 1064329..1065279 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene gshB CDS 1065344..1065901 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1065898..1066311 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene ruvX CDS complement(1066487..1066690) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(1067031..1070258) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene carB CDS complement(1070274..1071410) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene carA CDS complement(1071818..1072630) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene dapB CDS complement(1072749..1073360) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(1073424..1073729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 note possible pseudo, frameshifted CDS complement(1073804..1074343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 note possible pseudo, frameshifted CDS complement(1074608..1074868) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1075278..1076231 product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene ompA CDS 1076340..1076816 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883447.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1076889..1077731 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene purU CDS complement(1077790..1077954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1077951..1078241) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1078396..1079001 product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene yfbR CDS complement(1079066..1079608) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1079610..1080140) product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1080124..1080624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1080597..1081847) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1081859..1082620) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1082617..1083906) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1083903..1084631) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1084628..1085050) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1085047..1086540) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705028.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene phrB CDS complement(1086515..1087390) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1087380..1088333) product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1088595..1088873) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(1088999..1090429) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102988105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 1090570..1091370 product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1091576..1092565 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene gapA CDS 1092707..1093051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1093213..1094586 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene yegQ CDS complement(1094659..1096833) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene pnp CDS complement(1097059..1097328) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298162.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rpsO CDS complement(1097529..1098464) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene truB CDS complement(1098467..1098925) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene rbfA CDS complement(1099022..1100332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 note possible pseudo, frameshifted CDS complement(1100362..1101711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 note possible pseudo, frameshifted CDS complement(1101731..1103233) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene nusA CDS complement(1103248..1103706) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene rimP tRNA complement(1103891..1103967) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(1104023..1104109) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1104120..1104479) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703601.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene secG CDS complement(1104635..1105960) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene glmM CDS complement(1105964..1106797) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene folP CDS complement(1106911..1108809) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene ftsH CDS complement(1108905..1109534) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene rlmE CDS 1109619..1109918 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene yhbY CDS 1110058..1110684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(1110713..1111174) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene greA CDS complement(1111318..1111605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 note possible pseudo, frameshifted CDS complement(1111608..1112447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 note possible pseudo, frameshifted CDS complement(1112538..1114460) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene dnaK CDS complement(1114579..1115187) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene grpE CDS 1115379..1116263 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene nadK CDS 1116474..1118138 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene recN CDS complement(1118196..1118954) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene udp CDS 1119227..1119598 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1119670..1120026) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1120007..1120456) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1120635..1121120 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene smpB tmRNA 1121163..1121522 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1121633..1124263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1124664..1126184) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene purF CDS complement(1126205..1126696) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1126933..1128231) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene serS CDS complement(1128367..1129695) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196299305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1129871..1130479) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene lolA CDS complement(1130480..1132525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 note possible pseudo, frameshifted CDS complement(1132564..1133130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1133302..1133805) product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene lrp CDS 1134435..1135388 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene trxB CDS complement(1135445..1137181) product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene dauA CDS 1137317..1137490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1137502..1138197 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705736.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene aat CDS 1138194..1138898 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1138975..1139193 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene infA CDS complement(1139363..1141618) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705733.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene clpA CDS complement(1141667..1141990) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene clpS CDS 1142365..1142574 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene cspD CDS 1142689..1145322 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene glnD CDS 1145465..1146841 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene dbpA CDS complement(1146943..1147233) product DUF3081 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1147258..1149183) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 1149434..1150267 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817517.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1150471..1151460 product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1151533..1151973) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705087.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1152102..1152866) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene truC CDS complement(1152860..1153195) product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 1153313..1154347 product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1154344..1154646 product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1154690..1154917 product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1154917..1155252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1155260..1156033 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705081.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1156064..1156594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1156649..1157500 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene queF CDS 1157705..1159708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 1159714..1159959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 note possible pseudo, frameshifted CDS 1159997..1161496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1161522..1162874 product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene ppnN CDS 1162886..1163674 product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene xni CDS 1163741..1164748 product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1164907..1165419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1165497..1166588) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene rlmM CDS complement(1166596..1166970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1166960..1167592) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1167966..1168421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(1168467..1169894) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1170031..1170894) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene yghU CDS complement(1170946..1171299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1171465..1172496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1172486..1174678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1174688..1175539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1175860..1177455) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1177442..1178551) product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1178795..1180807) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545775.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1181090..1182037) product ferric enterobactin esterase PfeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene pfeE CDS 1182196..1184481 product siderophore enterobactin receptor PfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene pfeA CDS 1184932..1185432 product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1185436..1187172 product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173515063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1187206..1189272 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1189669..1189857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 note possible pseudo, frameshifted CDS 1189812..1189985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 note possible pseudo, frameshifted CDS complement(1190353..1190952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1191188..1191997) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1192251..1193048) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1193045..1194013) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1194287..1195414) product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene yiuA CDS complement(1195954..1196727) product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1196718..1200839) product enterobactin non-ribosomal peptide synthetase EntF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene entF CDS complement(1200841..1201176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 note possible pseudo, internal stop codon, frameshifted CDS complement(1201176..1201811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 note possible pseudo, frameshifted CDS complement(1202068..1203735) product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1203745..1204983) product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene dhbC CDS complement(1204980..1206296) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1206515..1207684 product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1208333..1208833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 note possible pseudo, frameshifted CDS complement(1208973..1209845) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 1210071..1211228 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1211285..1212322) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1212365..1213405) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1213720..1214604) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1214697..1215314) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1215635..1217863) product TonB-dependent iron piracy receptor TdfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene tdfF CDS complement(1218062..1218526) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1219110..1223792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1223825..1226065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1226163..1226513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 note possible pseudo, frameshifted CDS complement(1227000..1227974) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1228125..1228340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1228441..1229013) product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene mntP tRNA complement(1229798..1229874) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(1230020..1230187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1230298..1231137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1231122..1231853) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene dnaQ CDS 1231997..1232458 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene rnhA CDS complement(1232526..1233275) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350242.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1233323..1234141 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene gloB CDS 1234388..1235584 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1235654..1236046) product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705756.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene yciA CDS complement(1236149..1236973) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705457.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1236963..1238870) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1239268..1239660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1240075..1241952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1242364..1243500) product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene tyrA CDS complement(1243641..1244711) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1245082..1245675 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1245749..1246579) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1246677..1247879) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705304.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene ccmI CDS complement(1247881..1248363) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1248367..1248900) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298853.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1248897..1250885) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705302.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1250882..1251376) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705301.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ccmE CDS complement(1251373..1251579) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705300.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene ccmD CDS complement(1251569..1252315) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1252420..1253088) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene ccmB CDS complement(1253085..1253717) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene ccmA CDS complement(1254275..1254676) product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1254676..1255164) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1255184..1256032) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705295.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1256029..1256814) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1256811..1257767) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1257764..1258507) product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1258509..1259663) product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1259690..1261708) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1261718..1262473) product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1262487..1262870) product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene cheY CDS complement(1263079..1263798) product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1263782..1264624) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1264659..1266161) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene flhF CDS complement(1266190..1268292) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene flhA CDS complement(1268412..1269557) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene flhB CDS complement(1269558..1270346) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene fliR CDS complement(1270483..1270752) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene fliQ CDS complement(1270753..1271502) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene fliP CDS complement(1271559..1271933) product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298795.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene fliO CDS complement(1271933..1272364) product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene fliN CDS complement(1272361..1273419) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene fliM CDS complement(1273427..1273900) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705278.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene fliL CDS complement(1273973..1276060) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625952.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1276195..1276641) product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene fliJ CDS complement(1276638..1276862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1276859..1278208) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene fliI CDS complement(1278195..1279031) product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705274.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene fliH CDS complement(1279028..1280074) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene fliG CDS complement(1280067..1281776) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene fliF CDS complement(1281788..1282102) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene fliE CDS complement(1282355..1283782) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1284007..1285011) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706627.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1285229..1286683) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818210.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1287098..1287751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 note possible pseudo, internal stop codon, frameshifted CDS 1287756..1288106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 note possible pseudo, internal stop codon, frameshifted CDS 1288109..1289047 product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene pseC CDS complement(1289020..1289844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 note possible pseudo, frameshifted CDS complement(1289889..1290200) product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1290548..1292014 product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene fliC CDS 1292218..1292640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1292668..1294092 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene fliD CDS 1294089..1294385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1294404..1294802 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073117.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene fliS CDS 1295166..1295477 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1295735..1296346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1296926..1297246) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1297489..1297638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1297862..1299130) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene flgL CDS complement(1299140..1301113) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073124.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene flgK CDS complement(1301123..1302106) product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604908.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene flgJ CDS complement(1302322..1303425) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706637.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(1303815..1304501) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene flgH CDS complement(1304552..1305340) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene flgG CDS complement(1305352..1306095) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene flgF CDS complement(1306876..1308165) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene flgE CDS complement(1308177..1308875) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene flgD CDS complement(1308882..1309301) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene flgC CDS complement(1309298..1309699) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene flgB CDS complement(1311062..1311883) product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706645.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1311902..1312816) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1312993..1313742 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161785096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene flgA CDS 1313825..1314145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 1314147..1314560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1314676..1315083) product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(1315073..1315822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1316123..1317271 product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1317678..1318160) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1318448..1318690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1318680..1319852 product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063790.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1320114..1320710 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071613.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1320710..1323214 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1323375..1323899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1323924..1325348) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1325612..1326079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1326102..1326416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1326489..1327208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1327345..1329036) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706289.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1329343..1330311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1330367..1331143) product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene hdhA CDS complement(1331305..1332681) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1332957..1333937) product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1334276..1334407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1334614..1336035 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene nirK CDS 1336035..1336856 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1336856..1337398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1337778..1338404) product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706673.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1338593..1339183 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1339245..1340681) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1340966..1341925 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene tal CDS 1342214..1342405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1342664..1343041 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene rcsF CDS 1343041..1343796 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene tsaA CDS 1343980..1345695 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260694.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene proS CDS 1345959..1347101 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705128.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(1347096..1347803) product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205596950.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene hda CDS complement(1347846..1349123) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(1349194..1349820) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene upp CDS 1350276..1351313 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene purM CDS 1351310..1351969 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209778.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene purN CDS 1352176..1353402 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538115.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1353404..1353817) product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1353869..1354660) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705470.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1354666..1355247) product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene lpcA CDS 1355477..1357219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 note possible pseudo, frameshifted CDS 1357216..1357965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 note possible pseudo, frameshifted CDS complement(1358242..1359090) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene kdsA CDS complement(1359099..1360166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1360159..1361001) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene prmC CDS complement(1361015..1362100) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073597.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene prfA CDS complement(1362121..1363380) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene hemA CDS 1363504..1364079 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene lolB CDS 1364251..1365102 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene ispE CDS 1365323..1366390 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1366801..1367529) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1367671..1368267 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene pth CDS 1368327..1369418 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096225.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene ychF tRNA 1369940..1370016 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1370021..1370095 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1370177..1370251 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1370365..1370441 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 1370449..1370533 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 1370637..1370711 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(1370914..1372083) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1372291..1373721 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene miaB CDS 1373881..1374894 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 1374891..1375355 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707018.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene ybeY CDS 1375365..1376246 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene corC CDS 1376249..1377799 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene lnt CDS complement(1377893..1378378) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298255.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 1378501..1381095 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene leuS CDS 1381178..1381663 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene lptE CDS 1381663..1382682 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707024.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene holA CDS 1382790..1383437 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene nadD CDS 1383472..1383813 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707026.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rsfS CDS 1383813..1384283 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene rlmH CDS 1384286..1386178 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene mrdA CDS 1386171..1387277 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rodA CDS 1387289..1388266 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene mltB CDS 1388244..1389263 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1389341..1390528 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1390741..1391016 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene ybeD CDS 1391027..1391695 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene lipB CDS 1391692..1392657 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707035.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene lipA CDS complement(1392840..1393895) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene aroG CDS 1394236..1394637 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1394637..1395074 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704544.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1395142..1395687 product DUF1439 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080151.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1396212..1396814 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1396907..1397236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1397361..1398860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 note possible pseudo, frameshifted CDS 1398851..1399366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 note possible pseudo, frameshifted CDS 1399363..1399866 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421462.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1400459..1401817 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1401927..1402148 product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1402463..1404523 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1404598..1405038) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1405147..1405575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1405667..1406923) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1406986..1408089) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene proB CDS complement(1408211..1408609) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene crl CDS complement(1408901..1409632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1409753..1411387 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 1411681..1413015 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1413160..1413657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1413784..1413960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1413985..1415034) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene dinB CDS complement(1415138..1415362) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene nqrM CDS complement(1415364..1416389) product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1416498..1417721) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene nqrF CDS complement(1417747..1418343) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene nqrE CDS complement(1418346..1418978) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1418971..1419756) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1419749..1420987) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(1420991..1422340) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1422681..1422998) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1423086..1423697) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1423753..1424898 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1424908..1425486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 1425486..1426112 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 1426109..1427494 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1427723..1428205) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1428419..1429255 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1429356..1430810) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene thiI CDS complement(1430995..1431888) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1431888..1432643) product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene pomA CDS 1432880..1433125 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene xseB CDS 1433127..1434029 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene ispA CDS 1434051..1435928 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene dxs CDS 1436146..1436805 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1436968..1439061) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene fusA CDS complement(1439420..1440769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1440881..1441840) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1441843..1442817) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1442927..1444483) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1444503..1446242) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707092.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1446436..1446915) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1447086..1448045) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene thiL CDS complement(1448094..1448504) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene nusB CDS complement(1448518..1448964) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ribE CDS 1449468..1450370 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1450367..1451287) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1451335..1451679) product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1451873..1452538) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1452710..1453819) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene ribBA CDS complement(1453991..1455163) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707100.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene ribD CDS complement(1455164..1455613) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene nrdR CDS complement(1455741..1456994) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 1457258..1457878 product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707104.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene torD CDS 1457882..1458250 product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1458520..1460469 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene acs CDS 1460899..1461348 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151656372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene aroQ CDS 1461384..1461857 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene accB CDS 1461868..1463208 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene accC CDS 1463474..1464349 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene prmA CDS 1464686..1465159 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 1465146..1466345 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1466322..1466492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1466491..1467894 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 1468065..1469030 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene dusB CDS 1469056..1469355 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene fis CDS complement(1469417..1470100) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 1470637..1471833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1471830..1472957 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1473195..1474958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1475189..1476187 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689799.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene ilvE CDS 1476289..1476945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1476952..1477812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 note possible pseudo, frameshifted CDS complement(1477787..1478221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 note possible pseudo, frameshifted CDS complement(1478218..1478643) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882790.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene umuD CDS 1478926..1479969 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1480165..1481136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 note possible pseudo, frameshifted CDS 1481223..1481822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 note possible pseudo, frameshifted CDS 1481819..1484125 product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1484127..1484753) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1484791..1485972) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene purT CDS complement(1486024..1486587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1486907..1487593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1487684..1489792) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130624425.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene betT CDS complement(1490059..1491504) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1491731..1492501) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1492592..1493032) product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene yfbV CDS 1493315..1494550 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1494560..1496737 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene pta CDS 1496981..1497481 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene tpx CDS 1497718..1498620 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1498644..1501076) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1501069..1501758) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1501757..1502356 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707238.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1502386..1503057) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 tRNA complement(1503219..1503294) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(1503341..1503416) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(1503454..1503529) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1503575..1503650) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(1503851..1505263) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707206.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene gltX CDS 1505568..1506095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1506186..1508219) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene ligA CDS complement(1508306..1509391) product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705144.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene zipA CDS 1509749..1510510 product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene cysZ CDS complement(1510474..1511070) product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1511403..1513064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1513377..1514345 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene cysK CDS 1514499..1515008 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303134.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene crr CDS 1515076..1517202 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1517290..1518633 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 1518771..1520126 product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene dsdA CDS complement(1520186..1520788) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1521057..1523315 product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1523442..1523753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 1524196..1525056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(1525163..1526107) product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene pbpG tRNA complement(1526594..1526670) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 rRNA complement(1526705..1526814) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(1526929..1529818) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(1530210..1530285) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 rRNA complement(1530540..1532078) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 1532818..1535691 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene rapA CDS 1535701..1536366 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene rluA CDS 1536381..1537202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 1537141..1538091 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707005.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1538254..1539048) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene djlA CDS 1539305..1541671 product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704882.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene lptD CDS 1541696..1543012 product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene surA CDS 1543009..1543998 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene pdxA CDS 1543991..1544797 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210490.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene rsmA CDS 1544800..1545174 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene apaG CDS 1545174..1546037 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1546149..1546631) product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene folA CDS complement(1546687..1547865) product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704870.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene cgtA CDS complement(1547982..1548239) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rpmA CDS complement(1548257..1548568) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene rplU CDS 1548805..1549779 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene ispB CDS complement(1549913..1551229) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1551359..1552249) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene hflC CDS complement(1552253..1553437) product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene hflK CDS complement(1553484..1554770) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene hflX CDS complement(1554831..1555091) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene hfq CDS complement(1555126..1556061) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1556051..1557892) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene mutL CDS complement(1557894..1559213) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1559210..1559677) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene tsaE CDS complement(1559667..1561220) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1561235..1562380 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819425.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene queG CDS 1562451..1562741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 tRNA complement(1562817..1562892) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(1562947..1563022) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1563077..1563152) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(1563207..1563282) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(1563431..1563506) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(1563770..1564315) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene orn CDS 1564404..1565441 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene rsgA CDS 1565499..1566365 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene asd CDS 1566430..1569804 product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene mscM CDS 1569840..1570730 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1570767..1571741) product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene epmA CDS complement(1571771..1572274) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1572504..1573547 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707000.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1573646..1574212) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262737.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene efp CDS 1574246..1575289 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene epmB CDS 1575328..1575642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1575668..1577602) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704806.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1577599..1578099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349563.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1578606..1580252) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729136.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene groL CDS complement(1580299..1580589) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309514.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1580832..1582127 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1582168..1582650) product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1582804..1583292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1583341..1583676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1583726..1584676) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene fkpA CDS 1585158..1585790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 note possible pseudo, frameshifted CDS 1585783..1585995 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1586073..1586612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1586694..1586894) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 1586957..1587637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1587698..1589596 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1589617..1590048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1590081..1590986 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene rlmJ CDS 1591092..1591967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1592074..1593537 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925621.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1593617..1594804) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1595063..1595473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 note possible pseudo, internal stop codon, frameshifted CDS 1595634..1596083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 note possible pseudo, frameshifted CDS 1596065..1596613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 note possible pseudo, frameshifted CDS 1596610..1596834 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 1596891..1597760 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1597840..1598844) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1598968..1599372) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1599532..1600191 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene crp CDS complement(1600258..1601361) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1601471..1602133) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1602321..1602857 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173162.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 1602960..1603433 product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene cosR CDS complement(1603505..1604083) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1604238..1605182 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1605239..1605847 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1606001..1606789) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene znuB CDS complement(1606779..1607516) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707444.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene znuC CDS 1607602..1608504 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene znuA CDS 1608870..1610102 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene mepM CDS complement(1610292..1611359) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene hemE CDS 1611750..1612223 product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1612236..1612613 product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene mapZ CDS complement(1612626..1613996) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene radA CDS 1614072..1616297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1616294..1617277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1617349..1618014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1618202..1619143 product COG2958 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1619264..1619662 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263243.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1619664..1620380) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene deoD CDS complement(1620492..1621721) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816482.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene deoB CDS complement(1621804..1622583) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071446.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene deoC CDS 1622735..1623187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 1623299..1624345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1624372..1625157) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1625452..1627041) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene prfC CDS 1627258..1627872 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1628339..1629619 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 1629921..1630673 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 1631007..1633094 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1633188..1633514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1633511..1634173) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1634295..1635722) product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(1635719..1636390) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1636613..1637023 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene uraH CDS complement(1637147..1638097) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180871.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene htpX CDS complement(1638148..1638717) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020842.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1638848..1640227) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene pntB CDS complement(1640232..1641758) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene pntA CDS complement(1642055..1643347) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1643485..1644693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1644743..1645213) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene rimI CDS complement(1645174..1645515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15010 tRNA complement(1645620..1645696) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 1646013..1646936 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene pyrB CDS 1646945..1647400 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene pyrI CDS 1647676..1649601 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 1650004..1650501 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1650900..1654436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1654635..1656146 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174847132.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS 1656143..1657756 product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1657749..1658960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 tRNA complement(1659629..1659705) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 rRNA complement(1659740..1659849) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(1659965..1662852) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(1663262..1663337) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(1663484..1663560) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 rRNA complement(1663706..1665243) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 1665913..1667010 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1667115..1669694) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene clpB CDS complement(1669937..1670683) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene pgeF CDS complement(1670699..1671679) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene rluD CDS 1671792..1672544 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409782.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(1672608..1673375) product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1673723..1675312) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene gshA CDS complement(1675372..1678179) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1678208..1679140) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051773499.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 1679369..1679536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1679570..1680307) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1680401..1680850) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196054.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene rplI CDS complement(1680889..1681116) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308890.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene rpsR CDS complement(1681145..1681522) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene rpsF CDS complement(1681719..1682582) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1682705..1683442) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rlmB CDS complement(1683530..1685866) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704662.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene rnr CDS complement(1685997..1686506) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene luxS CDS complement(1686758..1687096) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene glnB CDS complement(1687147..1688787) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704658.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1688911..1689393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(1689383..1690471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(1690468..1691151) product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704655.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1691145..1691648) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704654.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 1691732..1692169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1692262..1693206) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene ispH CDS complement(1693271..1693705) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene fkpB CDS complement(1693698..1694225) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene lspA CDS complement(1694225..1696963) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene ileS CDS complement(1697050..1697997) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene ribF CDS complement(1698064..1699578) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene murJ CDS 1699818..1700078 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene rpsT CDS complement(1700204..1700518) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1700540..1701484) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704639.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene nhaR CDS complement(1701596..1702798) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene nhaA CDS complement(1703001..1703795) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene thyA CDS complement(1703792..1704622) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704636.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene lgt CDS complement(1704747..1707008) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene ptsP CDS complement(1707055..1707684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 note possible pseudo, frameshifted CDS complement(1708025..1708537) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rppH CDS 1709182..1709859 product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene mutH CDS complement(1709913..1711088) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1711213..1711590) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene rplS CDS complement(1711623..1712372) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene trmD CDS complement(1712402..1712923) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene rimM CDS complement(1712949..1713206) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene rpsP CDS complement(1713422..1714810) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ffh CDS 1714955..1715746 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene ccsA CDS 1715805..1717070 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1717139..1717594) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1717762..1718103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 note possible pseudo, frameshifted CDS complement(1718106..1718567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 note possible pseudo, frameshifted CDS complement(1718642..1719445) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene mazG CDS complement(1719516..1721729) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene relA CDS complement(1721739..1723055) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene rlmD CDS 1723136..1725859 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene barA CDS complement(1725929..1726666) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene pdxJ CDS complement(1726659..1727369) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704751.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene recO CDS complement(1727369..1727632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 note possible pseudo, frameshifted CDS complement(1727629..1728273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 note possible pseudo, frameshifted CDS complement(1728270..1728938) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene rnc CDS complement(1728938..1729852) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene lepB CDS complement(1729856..1731652) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene lepA CDS complement(1731774..1732241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1732283..1733338) product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1733354..1733950) product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1733967..1734545) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene rpoE CDS 1734729..1736345 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene nadB CDS complement(1736425..1736823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1736792..1737004) product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004390965.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene sdhE CDS 1737191..1738093 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704740.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene ygfZ CDS 1738191..1738628 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1739090..1740286 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene doeA CDS 1740308..1740796 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1740950..1742461 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1742542..1743963 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1744015..1745745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1745935..1747215) product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene dctM CDS complement(1747212..1747850) product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene dctQ CDS complement(1747937..1748929) product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene dctP CDS 1749292..1749480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1749395..1749709) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155655847.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1750251..1751084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1751135..1752520 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1752522..1753340 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1753342..1755408 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110170977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1755427..1756077) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1756155..1756385) product putative cation transport regulator ChaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene chaB CDS 1756575..1757096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1757189..1757431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1757670..1758203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1758380..1758592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1758876..1759061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1759231..1759581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1759871..1761391) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1761638..1763125) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene lysS CDS complement(1763148..1764050) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene prfB note possible pseudo, frameshifted CDS 1764479..1766362 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707132.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1766879..1768627) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene recJ CDS complement(1769470..1770357) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene xerD CDS 1770432..1770947 product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene fldB CDS complement(1771059..1772372) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene brnQ CDS complement(1772549..1773256) product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707393.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 1773329..1774690 product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene srmB CDS complement(1775316..1776092) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene yaaA CDS complement(1776130..1777239) product type IVa pilus ATPase TapU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707390.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene tapU CDS complement(1777267..1778304) product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene tapT CDS 1778340..1779032 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1779042..1779881 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707387.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene proC CDS 1779891..1780442 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707386.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1780427..1780741 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene yggU CDS 1780779..1781201 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1781275..1781892 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1781892..1783037 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene hemW CDS 1783088..1783822 product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene zapD CDS 1783819..1784010 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene yacG CDS 1783994..1784455 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352173.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene mutT CDS complement(1784614..1786881) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene parC CDS complement(1786894..1788789) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene parE CDS complement(1788910..1789488) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1789490..1790350) product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene cpdA CDS complement(1790347..1790790) product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1790945..1791559) product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene nudF CDS 1791793..1793097 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene tolC CDS 1793352..1794104 product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1794175..1795602) product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene hldE CDS 1795755..1796684 product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene lpxL CDS complement(1796870..1799740) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene glnE CDS complement(1799787..1800749) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1800917..1801597 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1801619..1802884 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1803004..1803624 product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 1803804..1806962 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene putA CDS 1807186..1810248 product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528945.1 transl_table 11 codon_start 1 transl_except (pos:1807774..1807776,aa:Sec) note codon on position 197 is selenocysteine opal codon. locus_tag LOCUS_16430 gene fdnG CDS 1810258..1811220 product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene fdxH CDS 1811207..1811842 product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1811954..1812880 product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene fdhE CDS 1812877..1814307 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene selA CDS 1814304..1816205 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene selB tRNA 1816252..1816347 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 1816409..1817191 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene fdhD CDS 1817236..1818378 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1818546..1818902) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene folB CDS 1819026..1819643 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352149.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene plsY CDS complement(1819730..1820767) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704779.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene tsaD CDS 1820943..1821158 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene rpsU CDS 1821173..1821616 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1821691..1823475 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene dnaG CDS 1823722..1825557 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene rpoD tRNA 1825735..1825811 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 CDS 1826339..1827343 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 1827474..1827902 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1828034..1828747) product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1829188..1829658 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1829735..1829902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1830028..1831080) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1831410..1832240) product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rlmA CDS 1832461..1833855 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1834107..1834520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 1834736..1835404 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1835406..1836089) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1836100..1837032) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1837089..1837703) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1837916..1839238 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477129.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(1839335..1841248) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1841430..1842278) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1842441..1844111 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1844273..1845409 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1845546..1846055) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1846162..1846677) product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene uraD CDS complement(1846677..1847597) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765316.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene puuE CDS 1847959..1848315 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene uraH CDS 1848408..1849763 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 1850200..1851336 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1851333..1852478 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038781.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene glf CDS 1852702..1853649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 note possible pseudo, frameshifted CDS 1853843..1855708 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1855810..1856301 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1856363..1857106) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1857299..1857544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 note possible pseudo, frameshifted CDS complement(1857526..1858605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 note possible pseudo, frameshifted CDS complement(1858714..1859577) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene xdhC CDS complement(1859596..1861974) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene xdhB CDS complement(1861967..1863412) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene xdhA CDS complement(1863751..1864371) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1864637..1865068) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1865374..1865946 product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635988.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1866033..1866494) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1866673..1866864) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1866987..1867424) product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1867566..1868750) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212326.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene tuf CDS complement(1868812..1870914) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene fusA CDS complement(1870989..1871459) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene rpsG CDS complement(1871545..1871919) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene rpsL CDS complement(1872070..1872354) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945207.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene tusB CDS complement(1872367..1872723) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene tusC CDS complement(1872774..1873142) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707698.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene tusD CDS complement(1873228..1873611) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1873981..1874475) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene ilvN CDS complement(1874475..1876193) product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 1876987..1878552 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene leuA CDS 1878555..1879655 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704821.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene leuB CDS 1879655..1881052 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704820.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene leuC CDS 1881065..1881664 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene leuD CDS complement(1882010..1882297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1882461..1883438 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene thiB CDS 1883438..1885039 product thiamine/thiamine pyrophosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704815.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene thiP CDS 1885023..1885721 product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704814.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene thiQ CDS complement(1885741..1887120) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 rRNA complement(1887567..1887676) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(1887844..1890732) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(1891124..1891199) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 rRNA complement(1891451..1892989) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(1893340..1893897) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044801009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene gmhB CDS complement(1893953..1895035) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1895032..1896012) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(1896012..1897823) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1897836..1897970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 note possible pseudo, frameshifted CDS complement(1897967..1898890) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 note possible pseudo, frameshifted CDS complement(1898883..1899902) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1900144..1901187 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704855.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene metN CDS 1901168..1901821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1901838..1902671 product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1902795..1903307 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene rfaH CDS complement(1903326..1904498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1904649..1906037) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene dgt CDS complement(1906034..1908388) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704845.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene arcB CDS 1908615..1909313 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene mtnN CDS 1909316..1910260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1910251..1911141 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1911205..1911618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 note possible pseudo, frameshifted CDS 1911615..1911833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 note possible pseudo, frameshifted CDS complement(1911991..1913187) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene tyrS CDS 1913361..1914659 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706904.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1914739..1915185) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704842.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1915178..1915504) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1915520..1915864) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene erpA CDS complement(1915958..1916593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1916762..1918048 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene hemL CDS complement(1918179..1920521) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene mrcB CDS complement(1920524..1922941) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818758.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene hrpB CDS 1923259..1923780 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene thpR CDS complement(1923777..1924517) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene sfsA CDS 1924797..1925249 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene dksA CDS 1925259..1926140 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818759.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene gluQRS CDS 1926303..1927625 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene pcnB CDS 1927622..1928128 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene folK CDS 1928121..1928915 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene panB CDS 1928933..1929778 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene panC CDS 1929923..1930309 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 1930465..1931082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1931240..1932013) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1932010..1932933) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1933086..1933616) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene hpt CDS complement(1933713..1934369) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1934366..1935754) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene mpl CDS 1935944..1936474 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene ppa CDS 1936950..1937765 product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818770.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1937858..1939198) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene cysG CDS complement(1939589..1939990) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1940031..1940801) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707138.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1940788..1942482) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene cysI CDS complement(1942482..1944290) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1944576..1948775) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene rpoC CDS complement(1948857..1952885) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene rpoB CDS complement(1953111..1953476) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene rplL CDS complement(1953531..1954031) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070609.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene rplJ CDS complement(1954269..1954970) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene rplA CDS complement(1954975..1955403) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene rplK CDS complement(1955531..1956079) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene nusG CDS complement(1956089..1956460) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene secE tRNA complement(1956524..1956600) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA complement(1956759..1956834) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA complement(1956847..1956921) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA complement(1956982..1957066) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA complement(1957073..1957148) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 CDS 1957395..1958336 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene coaA CDS complement(1958386..1959351) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene birA CDS complement(1959339..1960376) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707708.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene murB CDS 1960604..1962358 product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951394.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene msrAB CDS complement(1962511..1964460) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707714.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1964531..1964992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(1965188..1965757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 note possible pseudo, frameshifted CDS complement(1965694..1966530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 note possible pseudo, frameshifted CDS complement(1966536..1967021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1967014..1968459) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1968612..1969727) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 1970305..1970919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1971000..1972157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1972279..1972899 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1972907..1973635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 1973659..1974843 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1975032..1975445 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1975517..1976509) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368997.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene asnA CDS 1976648..1977121 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707730.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene asnC CDS complement(1977239..1977745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 1977924..1978649 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 1978639..1980027 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707647.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1980104..1981372 product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(1981482..1982390) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene metF CDS complement(1982858..1983469) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1983713..1984120 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096424.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene rnk CDS 1984212..1985168 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1985179..1985877) product Kdo(2)-lipid A phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297918.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene lpxT CDS 1986102..1986389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 tRNA complement(1986833..1986909) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 rRNA complement(1986944..1987053) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(1987168..1990056) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(1990448..1990523) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 rRNA complement(1990778..1992328) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 1992955..1993422 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1993424..1994272) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene murI CDS complement(1994391..1996214) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704111.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1996622..1997962 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 1997971..1998333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1998488..1999585 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene trmA CDS complement(1999689..2000933) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(2001596..2001811) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene rpmE CDS 2001953..2004151 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene priA CDS 2004283..2006040 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene argS CDS 2006044..2006628 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155661806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2006791..2007243 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene hslV CDS 2007299..2008630 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene hslU CDS 2008719..2009321 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073880.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene rraA CDS complement(2009457..2009708) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene zapB CDS complement(2009853..2010635) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene cysE CDS complement(2010674..2011588) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(2011623..2012087) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene trmL CDS complement(2012176..2013534) product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene dinF CDS complement(2013646..2014257) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819116.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(2014566..2015177) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene lexA CDS complement(2015258..2016124) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene ubiA CDS complement(2016130..2016684) product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene ubiC CDS 2016818..2017210 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704197.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(2017204..2018040) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704134.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene glpG CDS complement(2018040..2018357) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene glpE CDS complement(2018437..2019141) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704138.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(2019181..2019954) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene livG CDS complement(2019951..2021192) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410832.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2021189..2022112) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene livH CDS complement(2022223..2023335) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2023625..2024650) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene tdh CDS complement(2024660..2025076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 note possible pseudo, frameshifted CDS complement(2025073..2025849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 note possible pseudo, frameshifted CDS complement(2025945..2026601) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707886.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 2026745..2027698 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene rfaD CDS 2027767..2029533 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023767.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 2029555..2030166 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496715.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 2030169..2030831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(2030843..2031502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2031577..2032629 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene waaF CDS 2032626..2033399 product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 2033404..2034666 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene waaA CDS complement(2034675..2036705) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(2036771..2037484) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 2037568..2038632 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2038629..2039408 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(2039377..2040399) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704186.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2040478..2040969 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene coaD CDS complement(2041360..2042184) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene mutM CDS complement(2042365..2042532) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene rpmG CDS complement(2042544..2042780) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene rpmB CDS complement(2042916..2043590) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene radC CDS 2043732..2044964 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene coaBC CDS 2044951..2045406 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene dut CDS 2045422..2046033 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene slmA CDS complement(2046296..2047129) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 2047362..2047715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 note possible pseudo, frameshifted CDS 2047682..2048257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 note possible pseudo, frameshifted CDS complement(2048326..2048967) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene pyrE CDS complement(2049144..2049866) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene rph CDS 2050036..2050899 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2051015..2051932) product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene thpD CDS 2052580..2053209 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene gmk CDS 2053259..2053537 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene rpoZ CDS 2053615..2055732 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene spoT CDS 2055801..2056862 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 2056973..2057173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 2057173..2058300 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2058461..2059393 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene murQ CDS complement(2059422..2059739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2059891..2060766 product methylglyoxal reductase YeaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene yeaE CDS 2060832..2061794 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2061796..2062710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 note possible pseudo, frameshifted CDS 2062898..2063065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(2063127..2064329) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2064551..2065759 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2065787..2066569 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2066742..2067188 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(2067196..2068119) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704088.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(2068376..2068528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2068648..2069511 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704084.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2069613..2070587 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2070963..2071991 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2072278..2072754) product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene dps CDS complement(2073111..2073920) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(2074027..2076075) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene prlC CDS 2076315..2077670 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421460.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene gorA CDS complement(2077814..2078056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2078307..2081591 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2082062..2083060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 2083128..2083439 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 2083484..2084308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 note possible pseudo, frameshifted CDS 2084562..2084708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 2084740..2086317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2086536..2089472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 2089465..2090328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 2090694..2091005 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001406079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 2091050..2091874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 note possible pseudo, frameshifted CDS complement(2092254..2092616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 2092859..2094289 product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2094308..2095654 product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 2096043..2097296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 2097357..2098352 product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2098596..2099039 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2099253..2099987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2100194..2100676) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 2101047..2101742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 2101907..2102458 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene phaR CDS complement(2102503..2103126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 2104006..2105784 product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene gcl CDS 2105853..2106638 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene hyi CDS 2106739..2107626 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2108157..2109539 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 2109773..2110834 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene nspC CDS 2110887..2112128 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2112240..2113049) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 tRNA complement(2113593..2113669) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 tRNA complement(2113728..2113804) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA complement(2113896..2113979) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(2114013..2114088) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(2114156..2114232) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 CDS 2114465..2115031 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 2115062..2116213 product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene vmeC CDS 2116226..2119300 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2119446..2119640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2119687..2121495 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2121597..2122946 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene pssA CDS 2123247..2125319 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene recG CDS complement(2125412..2126410) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2126779..2128848 product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2128917..2129843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2130944..2131834) product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704289.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2131914..2132351) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene dtd CDS complement(2132348..2133307) product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene pip CDS complement(2133307..2134209) product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2134433..2136262) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene typA CDS 2136733..2138142 product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260968.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene glnA CDS complement(2138211..2139233) product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2139258..2140307) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2140315..2140749) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445639.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene slyA CDS 2140930..2142066 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704282.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene glnL CDS 2142078..2143481 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001334023.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene glnG CDS complement(2143620..2144990) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene hemN CDS complement(2145004..2145462) product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704279.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2145459..2146034) product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041217267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene yihI CDS complement(2146332..2146949) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2147093..2147740 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704276.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene yihA CDS 2147740..2148426 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene rsuA CDS complement(2148470..2151328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(2151325..2153118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2153311..2154969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2154973..2156175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2156177..2156569 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(2156747..2157133) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene mnhG CDS complement(2157126..2157401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(2157404..2157877) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2157874..2159385) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2159382..2159729) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2159729..2160160) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2160157..2162460) product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2162709..2163530) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene thiD CDS complement(2163817..2166555) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene polA CDS 2166867..2167514 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482741.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene elbB CDS complement(2167826..2168494) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707785.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2168680..2168961) product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162901770.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(2168978..2170411) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707787.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2170610..2170909 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2170983..2172809) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene recQ CDS complement(2172967..2173362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2173781..2174683 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene rarD CDS complement(2175006..2176313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 note possible pseudo, frameshifted CDS complement(2176373..2177104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 note possible pseudo, frameshifted CDS complement(2177101..2177670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 note possible pseudo, frameshifted CDS complement(2177682..2182613) product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338903.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2182846..2185014) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene uvrD CDS complement(2185263..2185970) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2186065..2186967) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704449.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene xerC CDS complement(2186969..2187727) product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2187724..2188551) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene dapF CDS complement(2188562..2189818) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704446.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene lysA CDS 2190025..2190336 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene cyaY CDS complement(2190361..2192862) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2193059..2193988 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene hemC CDS 2193985..2194737 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2194727..2195986 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2195997..2197259 product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704439.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2197321..2198187) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2198184..2198477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(2198477..2199028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2199231..2200784) product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene ilvA CDS complement(2200786..2202636) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene ilvD CDS complement(2202807..2203061) product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074003.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene ilvM CDS complement(2203058..2204737) product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene ilvG CDS 2205102..2206613 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(2206664..2207266) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707872.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2207307..2208275) product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2208345..2209766) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene ccoG rRNA complement(2210209..2210304) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA complement(2210326..2210401) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 rRNA complement(2210415..2210524) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA complement(2210614..2213503) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 tRNA complement(2213913..2213988) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA complement(2214135..2214211) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 rRNA complement(2214350..2215888) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 CDS complement(2216251..2217456) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815438.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2217784..2218887 product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 2218865..2219791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2219821..2221653) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene glmS CDS complement(2221987..2223345) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707907.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene glmU CDS complement(2223507..2223923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2223942..2225330) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene atpD CDS complement(2225364..2226224) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene atpG CDS complement(2226267..2227808) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862367.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene atpA CDS complement(2227823..2228353) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707911.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene atpH CDS complement(2228367..2228837) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707912.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene atpF CDS complement(2228887..2229114) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene atpE CDS complement(2229177..2229956) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene atpB CDS complement(2229965..2230357) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2230548..2231453) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2231450..2232253) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2232345..2232980) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene rsmG CDS complement(2233015..2234904) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707918.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene mnmG CDS complement(2235393..2235839) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352400.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene mioC CDS 2235978..2237474 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene gdhA CDS complement(2237728..2238078) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 2238254..2240053 product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2240101..2243025) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706377.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2243453..2244487 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2244735..2245238) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2245240..2245512) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2245737..2247179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(2247451..2248407) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214197.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(2248437..2249045) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2249114..2250037 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382934.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2250103..2251146) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene pyrC CDS 2251466..2252260 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 2252260..2253567 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013841.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 2253737..2254423 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2254646..2255878 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene sstT CDS complement(2255916..2256815) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705966.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2256933..2257892 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2258275..2259108) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2259105..2259962) product iron/manganese ABC transporter permease subunit SitC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101732.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene sitC CDS complement(2259946..2260863) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(2260860..2261786) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242572.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2262326..2264029 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2264045..2264659 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2264642..2264806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2265033..2266493 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2266512..2266655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS 2266670..2267686 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene rhuM CDS 2267683..2270895 product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2270983..2272038) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(2272063..2273220) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(2273314..2273913) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2274251..2275219) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2275341..2276081 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2276137..2277498) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707924.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene mnmE CDS complement(2277595..2279277) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene yidC CDS complement(2279488..2279850) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene rnpA CDS 2280367..2282508 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2282586..2283326) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707928.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2283334..2283999) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707929.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2284001..2284759) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2284995..2285459) product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene azu CDS 2285823..2287226 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene dnaA CDS 2287240..2288343 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704048.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene dnaN CDS 2288346..2289437 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene recF CDS 2289442..2291859 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene gyrB CDS 2292039..2293715 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene ilvD CDS 2294081..2294506 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635612.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2294578..2295843) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(2296166..2298235) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene glyS CDS complement(2298245..2299156) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174901.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene glyQ CDS 2299428..2299997 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2300084..2300734 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2300881..2301126) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307416.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene tusA CDS complement(2301313..2302488) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene fadA CDS complement(2302485..2304653) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704165.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene fadB CDS 2304949..2305578 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2305599..2307056 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260910.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2307066..2307593 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene hemG rRNA 2308021..2309571 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 tRNA 2309908..2309983 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 rRNA 2310384..2313271 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 rRNA 2313387..2313496 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 CDS complement(2313633..2316308) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208750.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2316522..2317412 product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene cysM CDS complement(2317492..2318583) product sulfate/thiosulfate ABC transporter ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene cysA CDS complement(2318590..2319429) product sulfate/thiosulfate ABC transporter permease CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene cysW CDS complement(2319429..2320271) product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene cysT CDS complement(2320275..2321279) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365488.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2321535..2323499) product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2323594..2324523) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene menC CDS 2324890..2326878 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene thiC CDS 2326875..2328383 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene thiE CDS 2328385..2329143 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2329156..2329356 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene thiS CDS 2329358..2330125 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912209.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 2330328..2330726 product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(2330842..2332416) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(2332518..2334059) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 2334408..2335790 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2335934..2336863) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2336860..2337594) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2337591..2338337) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2338725..2340266 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(2340362..2340901) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2341006..2341971) product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene zntB CDS 2342081..2343874 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2343941..2344438 product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 2344476..2344901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 2344933..2345478 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 2345611..2346123 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094124518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2346237..2346698 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2346877..2347398 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2347426..2348001 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2348070..2348747) product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2348920..2349609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2349691..2350029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 2350104..2351213 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929866.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2351517..2352608) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389003.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene ftsZ CDS complement(2352679..2353638) product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2353841..2355376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2355465..2355857) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2356020..2356460 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2356474..2356818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2356980..2358797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2358798..2358980 product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2358990..2359304 product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2359448..2361523 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819168.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2361619..2362965) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2363310..2363921 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308043.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene fabR CDS 2363939..2364325 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113995426.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2364381..2365250) product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene sseA CDS 2365846..2366166 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2366163..2366489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2366486..2367076) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene rsmD CDS 2367210..2368664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 2368665..2369330 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene ftsE CDS 2369327..2370274 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene ftsX CDS 2370455..2371327 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene rpoH CDS 2371414..2372064 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene can CDS 2372101..2373108 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene glpX CDS complement(2373275..2374636) product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene fumC CDS complement(2374662..2375033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2375251..2375835 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329552.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2375838..2376089 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704438.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2376212..2377465) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene envC CDS complement(2377504..2379036) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene gpmM CDS 2379263..2379691 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2379721..2380224 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene secB CDS 2380224..2381228 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene gpsA CDS complement(2381369..2381947) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene nfuA CDS complement(2382042..2382620) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704303.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 2382780..2383553 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene bioH CDS 2383720..2384040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2384158..2384874 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 2385099..2385581 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2386095..2386790 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090029.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 2387471..2387656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 note possible pseudo, frameshifted CDS 2387584..2390613 product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2390694..2391959) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2391961..2392266) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083182810.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2392643..2393512) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2393499..2393663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 2393903..2394748 product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2394824..2395426) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2395499..2396173) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene yjjG CDS 2396188..2396370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2396404..2397009 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2397276..2397662) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2397815..2399431) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242456.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 2399603..2400337 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(2400406..2400669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 note possible pseudo, internal stop codon CDS complement(2400679..2401503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 note possible pseudo, internal stop codon CDS 2401713..2403995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2404016..2405911) product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2405917..2406849) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2407040..2408278) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762604.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2408362..2408703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2408704..2409405) product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene rsuA CDS complement(2409563..2410945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2411670..2411966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2412051..2413025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2413130..2413561) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2413673..2416015) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819165.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2416311..2416736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2416916..2418433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2418434..2419903 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2420131..2420619) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074226.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene greB CDS 2420799..2421176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2421416..2422207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2422226..2422711) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2423140..2423673) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266857.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2424031..2425701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 2425884..2428415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 2428805..2431360 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2431400..2432260) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943636.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene hslO CDS complement(2432482..2432775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 2433029..2433592 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene nudE CDS complement(2433778..2434683) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2434972..2435430) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 2435850..2436680 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106799.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene cysQ CDS complement(2436762..2437094) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene metJ CDS 2437278..2438435 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene metB CDS 2438438..2440879 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704558.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2441125..2442555) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739655.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene aspA CDS complement(2443049..2443474) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528320.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2443555..2443821) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2443907..2444995) product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162796599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2444995..2446032) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2446029..2447417) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457832.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2447547..2448812) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2449040..2449780) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2449765..2450409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 note possible pseudo, internal stop codon CDS complement(2450473..2451249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 note possible pseudo, internal stop codon CDS complement(2451482..2451940) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene ybaK CDS 2452117..2453067 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2453126..2453620) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2453664..2454536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2454552..2455175) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2455225..2455791) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 2456091..2456507 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 2456535..2457842 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2457917..2460559) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene ppc CDS complement(2460922..2462082) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704559.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene argE CDS 2462326..2463339 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704560.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene argC CDS 2463344..2464132 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene argB CDS 2464160..2465077 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819287.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 2465077..2466288 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 2466504..2468378 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene argH CDS 2468966..2469277 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene rpsJ CDS 2469295..2469933 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene rplC CDS 2469951..2470556 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene rplD CDS 2470553..2470855 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene rplW CDS 2470873..2471697 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene rplB CDS 2471718..2471996 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene rpsS CDS 2472007..2472339 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene rplV CDS 2472358..2473047 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331168.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene rpsC CDS 2473060..2473473 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene rplP CDS 2473473..2473664 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene rpmC CDS 2473666..2473926 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene rpsQ CDS 2474092..2474460 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene rplN CDS 2474471..2474788 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene rplX CDS 2474803..2475342 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213329.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene rplE CDS 2475354..2475659 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213330.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene rpsN CDS 2475682..2476074 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099025.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene rpsH CDS 2476084..2476617 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307981.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene rplF CDS 2476627..2476980 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene rplR CDS 2476995..2477495 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704318.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rpsE CDS 2477502..2477684 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307985.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rpmD CDS 2477689..2478123 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene rplO CDS 2478132..2479463 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene secY CDS 2479743..2480099 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene rpsM CDS 2480114..2480506 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene rpsK CDS 2480537..2481157 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704319.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene rpsD CDS 2481182..2482171 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307997.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene rpoA CDS 2482215..2482604 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene rplQ rRNA 2483408..2484946 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 tRNA 2485092..2485168 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA 2485315..2485390 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 rRNA 2485800..2488689 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 rRNA 2488806..2488915 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 CDS 2489578..2491677 product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 2491712..2493631 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene nosZ CDS 2493734..2495071 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2495083..2495988 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 2495988..2496818 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 2496838..2497383 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(2497440..2497751) product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene nirM CDS 2498071..2498271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 2498516..2498902 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819067.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene crcB CDS 2498960..2499715 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene ubiE CDS 2499715..2500335 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2500332..2501969 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704118.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene ubiB CDS 2502042..2502308 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 gene tatA CDS 2502311..2502715 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704120.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene tatB CDS 2502773..2503465 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene tatC CDS 2503462..2504241 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 2504261..2505298 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene hemB CDS complement(2505518..2507011) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704128.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene gppA CDS complement(2507024..2508301) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene rhlB CDS 2508424..2508750 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307306.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene trxA CDS 2508948..2510213 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene rho CDS 2510327..2511808 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene ubiD CDS 2511840..2512538 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene fre CDS complement(2512593..2512778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2512762..2513049) product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2513194..2514096) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene ilvY CDS 2514285..2515772 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene ilvC CDS 2516245..2517021 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707894.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene tcdA CDS complement(2517169..2517606) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261341.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene csdE CDS complement(2517606..2518820) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2519245..2521257 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene rep CDS complement(2521407..2521844) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 2522051..2522338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 note possible pseudo, frameshifted CDS 2522352..2522609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 note possible pseudo, frameshifted CDS 2522804..2523424 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(2523508..2524416) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533894.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2524584..2525822 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816916.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene sbcD CDS 2525819..2529241 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene sbcC CDS complement(2529488..2530948) product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2531198..2531932 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 2531992..2533299 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(2533362..2534420) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS complement(2534420..2535034) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2535171..2535668) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2535776..2537182) product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene ompQ CDS complement(2537247..2539175) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397097.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2539172..2540281) product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene macA CDS complement(2540531..2541385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(2541387..2541674) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(2541847..2542833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(2542835..2543209) product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2543399..2545675) product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2545668..2546213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 2546376..2547935 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene norR CDS complement(2548063..2549349) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2549399..2549992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(2550082..2551104) product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 2551218..2551442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(2551502..2552260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 2552472..2552828 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(2552913..2555144) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2555368..2556669) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(2556831..2558279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261856.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2558623..2558868 product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707214.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2558954..2560792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 2560949..2561425 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(2561546..2561986) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(2562142..2562573) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene trxC CDS complement(2562576..2562983) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352339.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2563056..2563235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 2563267..2563953 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(2563985..2564200) product ribosome-associated protein YbcJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene ybcJ CDS 2564562..2565695 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889090.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 2565833..2566402 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228019.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene yeiP CDS 2566438..2567274 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 2567331..2567570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2567570..2568931 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene rmuC CDS complement(2568972..2570348) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene trkA CDS complement(2570345..2571640) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene rsmB CDS complement(2571666..2572616) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene fmt CDS complement(2572626..2573147) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene def CDS 2573341..2574438 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene dprA CDS 2574441..2574914 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 2574962..2575531 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704270.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 2575555..2576118 product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 2576143..2577051 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene hemF CDS complement(2577048..2577914) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene hdfR CDS complement(2577892..2578056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 2578055..2578879 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene aroE CDS 2578890..2579150 product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS complement(2579157..2579645) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 rRNA 2580270..2581820 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00230 tRNA 2582075..2582150 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 rRNA 2582542..2585431 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00240 rRNA 2585599..2585708 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00250 CDS 2585851..2586555 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171423.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2586640..2587824) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704460.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2587966..2588910 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene metA CDS complement(2589091..2590308) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 2590620..2594300 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene metH CDS 2594548..2595879 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(2596477..2596977) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2597016..2597339) product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2597454..2598029) product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043122718.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 2598164..2599279 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 2599273..2600103 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 2600114..2601052 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 2601049..2601666 product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 2601678..2603390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(2603465..2604421) product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS complement(2604421..2604813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 2605155..2605973 product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(2606079..2608919) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707637.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene uvrA CDS 2609062..2610435 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2610450..2611052 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene ssb1 CDS complement(2611212..2611415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2611876..2612526) product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858707.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2612547..2612951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2613058..2614227) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2614686..2616701 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039212856.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2616660..2617613) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2617778..2618821 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 2618870..2619757 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene mreC CDS 2619754..2620242 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene mreD CDS 2620266..2620841 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 2620907..2622376 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene rng CDS 2622442..2626197 product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 2626250..2627071 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS 2627068..2628513 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene tldD CDS complement(2628603..2629127) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene yjgA CDS 2629230..2630570 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene pmbA CDS complement(2630676..2630951) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(2630938..2631804) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707611.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene rapZ CDS complement(2631814..2632260) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305951.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene ptsN CDS complement(2632263..2632550) product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene hpf CDS complement(2632574..2634028) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707612.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(2634115..2634840) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707613.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 gene lptB CDS complement(2634843..2635316) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352198.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene lptA CDS complement(2635342..2635890) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707615.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene lptC CDS complement(2635887..2636438) product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene kdsC CDS complement(2636438..2637412) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2637659..2638459 product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene mlaF CDS 2638449..2639228 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene mlaE CDS 2639235..2639708 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene mlaD CDS 2639735..2640373 product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene mlaC CDS 2640370..2640651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 2640641..2640901 product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369504.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene ibaG CDS 2640914..2642170 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707623.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene murA CDS complement(2642310..2643350) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707601.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene degS CDS complement(2643614..2644972) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 2645231..2646331 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene zapE CDS 2646583..2647011 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene rplM CDS 2647027..2647419 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene rpsI CDS 2647704..2648294 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene petA CDS 2648297..2649511 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707596.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2649511..2650242 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 2650329..2650958 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene sspA CDS 2650961..2651404 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409380.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(2651474..2652052) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818900.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene dolP CDS complement(2652049..2652645) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707591.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2652655..2652879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2653013..2654788) product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818899.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 2654959..2655801 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene rsmI CDS 2656537..2656794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 note possible pseudo, frameshifted CDS 2656731..2656994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 note possible pseudo, frameshifted CDS 2656996..2657940 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene rsmH CDS 2657952..2658251 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305726.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene ftsL CDS 2658248..2659993 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707586.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 2659977..2661449 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707585.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene murE CDS 2661446..2662792 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707584.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene murF CDS 2662786..2663868 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167069.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene mraY CDS 2663871..2665181 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707582.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene murD CDS 2665178..2666350 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352178.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene ftsW CDS 2666350..2667438 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene murG CDS 2667452..2667697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 note possible pseudo, frameshifted CDS 2667676..2668911 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene murC note possible pseudo, frameshifted CDS 2668908..2669825 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 2669827..2670594 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707579.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 2670554..2671810 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305690.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 gene ftsA CDS 2671864..2673006 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene ftsZ CDS 2673212..2674060 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene lpxC CDS 2674136..2674984 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707577.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 2675095..2677767 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene secA CDS 2677990..2679651 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406612.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 2680006..2681682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2681802..2682524 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707454.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2682588..2682932 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006810300.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene rraB CDS complement(2683086..2683598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 2683688..2684101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 2684235..2684450 product osmotically-inducible lipoprotein OsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 gene osmB CDS complement(2684584..2687448) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(2687453..2687896) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene holC CDS complement(2687899..2689410) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene pepA CDS 2689572..2690681 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305138.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene lptF CDS 2690681..2691751 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene lptG CDS complement(2691822..2692328) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045788985.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 tRNA 2692585..2692669 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 CDS complement(2693068..2693538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 2693637..2694116 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815814.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene mscL CDS 2694405..2695751 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene rlmD CDS 2695814..2696023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(2696101..2697126) product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707512.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene rsmC CDS 2697420..2698292 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 gene dapA CDS complement(2698388..2698756) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707507.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene hfq CDS 2698871..2700043 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2700203..2700412) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 2700714..2701022 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2701054..2702034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2702240..2703445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2703445..2703771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2703993..2705900) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105557.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 tRNA complement(2706585..2706660) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA complement(2706666..2706741) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(2706772..2706847) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA complement(2706878..2706953) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 CDS complement(2707049..2707324) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2707321..2708268) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene mutY CDS 2708754..2709488 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene trmB CDS 2709633..2710943 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2711084..2711686) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene coaE CDS complement(2711683..2712549) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(2712589..2713800) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(2713841..2715559) product PilB family type IVa pilus assembly ATPase TapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707569.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene tapB CDS complement(2715553..2716017) product type IVa pilus major pilin TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene tapA CDS complement(2716147..2718324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(2718436..2718978) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene ampD CDS 2719100..2719603 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 2719845..2720717 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene nadC CDS 2721099..2721860 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707564.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene pdhR CDS 2721922..2724582 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene aceE CDS 2724594..2726489 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707562.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene aceF CDS 2726636..2728060 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene lpdA CDS 2728297..2730168 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269422.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 2730286..2732640 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707557.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 2732880..2735477 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene acnB CDS 2735742..2738000 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082728.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 2738124..2738804 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(2738938..2740404) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193501.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 2740818..2741174 product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704605.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(2741389..2741805) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene arfB CDS 2742121..2743134 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704616.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 2743168..2744790 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704617.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 2744790..2745851 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2745848..2746312) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308670.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene argR CDS 2746479..2747216 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308671.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 2747258..2747995 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 2747997..2748644 product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704621.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene artQ CDS 2748637..2749347 product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704622.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 gene artM CDS 2749490..2750425 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071073.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 gene mdh CDS complement(2750660..2752120) product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(2752480..2753148) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 gene tenA CDS 2753534..2755171 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455581.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 2755259..2756560 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648049.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene eno CDS 2756690..2756977 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704770.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 gene ftsB CDS 2756974..2757657 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene ispD CDS 2757936..2758415 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704772.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene ispF CDS 2758431..2759540 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene truD CDS 2759521..2760267 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene surE CDS 2760270..2760902 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704775.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 2760899..2761480 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 2761480..2762454 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819395.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2762497..2763465 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393877.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene rpoS CDS complement(2763540..2766152) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 gene mutS CDS complement(2766228..2766362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 2766440..2766673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2766794..2767318 product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687047.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(2767406..2768443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(2768633..2769418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 2769689..2770426 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 2770456..2770950 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 gene pncC CDS 2771200..2772273 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene recA CDS 2772499..2772960 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 gene recX CDS 2773224..2775845 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707429.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene alaS CDS 2776020..2776211 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906485.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 gene csrA tRNA 2776347..2776437 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA 2776444..2776520 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 tRNA 2776577..2776653 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 tRNA 2776684..2776760 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 CDS 2777294..2778511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 2778514..2779077 product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene vpsN CDS 2779089..2781251 product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene vpsO CDS 2781431..2782858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435728.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 2782888..2784162 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177620.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS 2784159..2785076 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391746.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 2785097..2786224 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 2786234..2787292 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104563.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 2787292..2788389 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 2788476..2789885 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586529.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS 2789917..2790942 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679067.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 2790939..2792054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 2792058..2792825 product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207634.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 2792865..2794229 product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene cpsG CDS 2794246..2795628 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009934990.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 2795715..2796080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(2796161..2797012) product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704944.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2797241..2798635 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704946.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene dnaB CDS 2798645..2799733 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene alr CDS complement(2799798..2800232) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene zur CDS 2800364..2801350 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene dusA CDS 2801521..2802249 product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 2802470..2803927 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809405.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 2804077..2804982 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene oxyR CDS complement(2805036..2807414) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668733.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 2807564..2808646 product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene pilM CDS 2808634..2809299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2809296..2809892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2809889..2810497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 2810926..2811408 product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene aroK CDS 2811422..2812501 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706965.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene aroB CDS 2812498..2813061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 2813031..2813897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 2813959..2814789 product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2814904..2815578 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene rpe CDS 2815571..2816272 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 2816367..2817398 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene trpS CDS 2817456..2817668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706959.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 2817927..2819120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 2819388..2819852 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071355.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene bfr CDS 2819865..2820332 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071356.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene bfr CDS 2820699..2821727 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072127.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 2821777..2822610 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene fghA CDS 2822866..2824914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 2825080..2826519 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 2826707..2828113 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399952.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 2828115..2829104 product cyanide-insensitive cytochrome bd quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093053.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 gene cioB CDS 2829444..2830433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(2830504..2830839) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2831004..2832224) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035921.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene pncB CDS complement(2832237..2832875) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813004.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 2833167..2833508 product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 2833652..2833879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 2833800..2834762 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 gene zapE note possible pseudo, frameshifted CDS complement(2834771..2835241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 2835465..2836523 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 2836722..2839769 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263237.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 2840184..2841137 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 2841453..2842064 product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 2842335..2843549 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 2843646..2844692 product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene astA CDS 2844715..2846202 product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene astD CDS complement(2846281..2848287) product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 2848491..2849825 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 2849829..2850386 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2850515..2851387 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266186.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 2851743..2852015 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305063.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene hupA CDS 2852139..2852564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707401.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS 2852613..2852969 product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 2853102..2854814 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2854871..2855263) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928488.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(2855424..2856716) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 gene purD CDS complement(2856794..2858377) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene purH CDS 2858672..2859973 product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090635852.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 2860024..2860227 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 2860332..2860730 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939394.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 gene cueR CDS 2861034..2863517 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(2863596..2864732) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 gene chrA CDS 2864942..2865106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2865221..2865595) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(2865729..2866559) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(2866684..2867880) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704625.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 gene hmpA CDS 2868131..2868736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(2868797..2869114) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(2869111..2869860) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(2870013..2870531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(2870697..2872364) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene ettA CDS complement(2872636..2873058) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2873055..2873675) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479222.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(2873679..2874413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 2874740..2875186 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 2875300..2876463 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707630.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(2876591..2877910) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2878067..2878810) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073603.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene ugpQ CDS complement(2878822..2879154) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(2879195..2880184) product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 2880336..2883794 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704911.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS complement(2883791..2884423) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 2884546..2885886 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 2885934..2886629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2886681..2887346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2887331..2888353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 2888487..2889110 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 2889178..2889912 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390181.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(2889968..2891725) product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705813.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(2891966..2893009) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene asd CDS complement(2893002..2893220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(2893258..2894163) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705573.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS 2894435..2895202 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705574.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 2895256..2896032 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 2896083..2896811 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 2896819..2897547 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(2897624..2897998) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(2897998..2898345) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene arsC CDS 2898514..2898975 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705567.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(2899051..2900448) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 2900616..2900843 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705565.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 2900850..2901923 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300