COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2496444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1765 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003699959.1:histidine kinase locus_tag LOCUS_00010 CDS 1762..2418 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(2496..3806) product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3879..4274) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690830.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4276..4479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(4944..5522) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene pth CDS complement(5592..5864) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217575.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5857..6288) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6589..8544) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene ftsH CDS complement(8610..9230) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9341..9625 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene yhbY CDS 9850..10323 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(10399..10632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 note possible pseudo, frameshifted CDS complement(10520..11281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 note possible pseudo, frameshifted CDS complement(11645..13417) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 13706..15946 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267792.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(16032..16748) product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(16809..17879) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 18046..19080 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene purM CDS 19659..21569 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258398.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 21652..21903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(21966..22805) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 23224..23721 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115308544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 24016..24900 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene cysT CDS 24970..25827 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene cysW CDS 25824..26897 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 27020..28210 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(28656..31550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 31788..33170 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene cysG CDS 33408..35981 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702540.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene clpB CDS complement(36093..36698) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene recR CDS complement(36933..38870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(38906..39256) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 39405..40049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001478769.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 40167..42713 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225207.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene glnD CDS 42932..43540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(43594..44631) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene pyrC CDS complement(44911..45093) product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222784.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 45236..45847 product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 46007..46726 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688188.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 46824..47276 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene recX CDS complement(47432..48274) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene kdsA CDS complement(48375..48758) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(49039..49362) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(49844..50512) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(50509..51183) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213636.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene hda CDS 51514..52161 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 52238..52606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(52753..53352) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 53682..55181 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225095.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 55332..55826 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366280.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene tpx CDS 56092..57507 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 57619..58128 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 58516..58836 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(58929..59318) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628746.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene grcA CDS 59522..60667 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225328.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene earP CDS 60707..61270 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219406.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene efp CDS 61590..62897 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222431.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 62890..63324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217157.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 63485..64405 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 64409..64849 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 64898..65491 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 65523..67859 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 68014..68529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 68526..69737 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(69852..72257) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene rnr tRNA 72353..72439 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 72474..72560 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 72645..72735 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(72793..73758) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(73812..74633) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(74636..75499) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(75611..77137) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289765.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 77514..77789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(77923..78354) product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(78454..78930) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene greA CDS complement(79193..79969) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(80083..80928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688791.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(80938..82350) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene thrC CDS complement(82421..82801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 82929..84233 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(84278..85048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 note possible pseudo, frameshifted CDS 85364..85837 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 85992..86822 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(87000..87590) product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene azu CDS complement(87839..88261) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 88416..91172 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene secA CDS 91323..92711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 92711..93154 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene nudB CDS 93238..93771 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219633.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 93886..94323 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230436.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene yciA CDS 94369..94722 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(94754..95302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(95316..95738) product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 96114..97166 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene corA CDS complement(97252..97662) product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813548.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(97817..99640) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 99804..100430 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225428.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene upp CDS 100571..100888 product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(101088..103760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(104509..105258) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688696.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene aroD CDS 105333..106028 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(106287..107153) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688678.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(107163..107777) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(107895..108164) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(108351..110807) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene lon CDS 111027..111296 product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 111296..111916 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217173.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene lipB CDS 111913..112902 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene lipA CDS complement(113176..114162) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene lepB CDS complement(114244..114855) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(114914..116707) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225433.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene lepA CDS complement(116872..117573) product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 117705..118838 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(118942..119412) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 119579..120355 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696991.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 120352..121200 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 121454..122545 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 122902..124593 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene dld CDS complement(124698..125225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 125685..126575 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229732.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 126592..126948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(127034..127900) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(128129..131104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(131567..133285) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene argS CDS 133829..137656 product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 137682..137900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(137977..138504) product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 138585..139376 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692783.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 139419..139991 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 140173..141063 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 141087..141338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(141422..142798) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 143143..144087 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012503687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 144167..144475 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(144574..145293) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene trmB CDS complement(145614..147020) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(147309..148046) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene ubiE CDS complement(148074..148505) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(148508..148741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(148862..149923) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene hemE CDS complement(150271..151491) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225425.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(151488..153875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(153985..154638) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222354.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(154759..156474) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 156869..157711 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene fghA CDS 157973..158527 product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214718.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 158632..160635 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene mutL CDS complement(160730..161227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 161573..162904 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene ribBA CDS 163139..164017 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 164181..167639 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene mfd CDS complement(167743..170916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(171272..173062) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene lpdA CDS complement(173282..174949) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene aceF CDS complement(175114..177783) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222352.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene aceE CDS 178316..178573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 178891..179460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(179873..180787) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene fdhE CDS complement(181013..181810) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099353.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene fdhD CDS 182181..182630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 182758..184239 product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 184417..185331 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene cysD CDS complement(185468..185596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(185683..188136) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 188570..188713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(188984..190141) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688795.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene hflX CDS complement(190450..191271) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 191403..192128 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rph CDS complement(192372..193049) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rpe CDS 193192..193713 product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(193773..194477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(194595..195260) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rpiA CDS complement(195388..195867) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene ispF CDS complement(196152..196856) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225068.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene ispD CDS complement(196853..197266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(197266..197982) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene dnaQ CDS 198332..198814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 198950..199681 product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688930.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 200017..201381 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692969.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 201528..203957 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225165.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 204261..205571 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene tig CDS 205648..206265 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene clpP CDS complement(206528..208171) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene pgi CDS complement(208177..209025) product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene hexR CDS complement(209149..210198) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(210179..210874) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene pgl CDS complement(211165..212610) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene zwf CDS 213024..214859 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene edd CDS 214954..215598 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(215922..216128) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(216365..217531) product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene metZ CDS complement(217732..218241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(218245..219072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 219098..219349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 219431..220261 product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(220304..221332) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212820.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(221418..221984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(222211..223344) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225058.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene dapE CDS complement(223510..224127) product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688277.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(224296..225306) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene trpS CDS complement(225397..227082) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 227273..228370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222398.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 228367..228828 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 229011..229247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 229240..229839 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene rdgB CDS complement(229897..230967) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene lptG CDS complement(230964..232079) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene lptF CDS 232316..233698 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 233776..234216 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244237.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 234377..235204 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 235282..235911 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene purN CDS 235947..236621 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(236713..237753) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 237911..238933 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216969.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene mutY CDS 239333..240712 product multidrug efflux MATE transporter NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980851.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene norM CDS 240850..241902 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene murB CDS 241919..242560 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(242544..242711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 243094..243396 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene ureA CDS 243466..245514 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694142.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene ureC CDS 245751..246299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 246250..246975 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 247177..247734 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 247924..248559 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene ureG CDS 248624..249454 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995202.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 249504..250400 product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794809.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 250495..251547 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene waaF CDS complement(251647..252300) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(252300..252974) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene modB CDS complement(253263..254006) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene modA CDS 254262..254909 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108043587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 254906..255205 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 255274..256023 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231513.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene rlmB CDS 256158..256409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 256394..256720 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 257235..258545 product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(258740..260251) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ppx CDS 260442..261065 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 261298..262656 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002251980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 262660..263184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(263444..263710) product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 263841..264500 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene ung CDS complement(264568..265074) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(265192..265683) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene greB CDS 266082..266507 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 266536..266994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 267005..267796 product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 267820..268488 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 268524..268862 product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 268907..269533 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 269601..270032 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 270160..270723 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 270922..271593 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 271723..272622 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 272785..273060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 note possible pseudo, internal stop codon CDS 273082..273762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 note possible pseudo, internal stop codon CDS 273779..274405 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 274444..275499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 275770..276003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 note possible pseudo, frameshifted CDS 276239..277117 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 277475..277825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 note possible pseudo, frameshifted CDS 278524..278805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 278827..279258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(279492..279842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 note possible pseudo, frameshifted CDS complement(279966..280874) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 281176..282330 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 282367..282954 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287468.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(283231..284373) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101366.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(284404..284853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 285046..286107 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266942.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(286476..286787) product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837143.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 286921..287127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 note possible pseudo, frameshifted CDS 287160..288968 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene istA CDS 288958..289683 product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene istB CDS complement(289852..290451) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(290514..291200) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(291281..291592) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406609.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 291954..292427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 note possible pseudo, frameshifted CDS complement(292655..293779) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene rluD CDS 293778..294584 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 294792..295007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 295205..296392 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene dapC CDS 296771..297541 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene yaaA tRNA 297626..297716 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 297739..297828 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 297836..297926 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(298253..298714) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene ruvX CDS complement(298707..299255) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222355.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(299265..299822) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222356.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 300032..301789 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 301999..303486 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 303573..304949 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene radA CDS complement(305123..306418) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224981.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene serS CDS complement(306604..306867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(306920..307387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 note possible pseudo, frameshifted CDS complement(307288..308019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 note possible pseudo, frameshifted CDS complement(308115..308372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(308332..309018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 note possible pseudo, frameshifted CDS complement(309015..309629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 note possible pseudo, internal stop codon, frameshifted CDS 309826..310077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(310027..310188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(310293..311096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 note possible pseudo, frameshifted CDS complement(311186..312331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 note possible pseudo, frameshifted CDS complement(312569..312898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 note possible pseudo, frameshifted tRNA complement(313111..313185) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(313198..313274) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(313490..314848) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(314934..316196) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rho CDS complement(316508..316774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(316976..318253) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene brnQ CDS complement(318710..318907) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(319167..319595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(319697..320569) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690783.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene xerD CDS complement(320675..321112) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(321181..321813) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(321999..322514) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687713.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene folK CDS complement(322528..322899) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(322970..323536) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(323677..323952) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene hfq CDS complement(324269..325741) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951041.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene der CDS complement(326178..326444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(326598..327227) product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(327228..328523) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene hisS CDS 328782..329708 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 329904..330323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(330480..331016) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033908763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(331300..332403) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene serC CDS 332794..333225 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene rimP CDS 333277..334773 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225001.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene nusA CDS 334790..337606 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene infB CDS 337754..338311 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212693.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 338646..340475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 340779..341528 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 341629..342384 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(342565..343131) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene dcd CDS complement(343328..343753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(343845..344744) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219474.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 tRNA 344861..344936 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 345087..345296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 345336..345725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 345786..346757 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(346988..347143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(347145..347417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 347756..350731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 350733..351848 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 352042..353502 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(353559..353828) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217790.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rpsO CDS complement(354138..355295) product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene cdaR CDS 355480..356739 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 356838..357971 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(358149..358664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(358900..359523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 359684..360550 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(360624..361571) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705389.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(361574..361870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(361914..363050) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(363059..363775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(363776..364333) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 364436..365338 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(365458..366366) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(366446..367120) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(367181..367309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 367521..368387 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(368436..369326) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene garR CDS complement(369420..370190) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene garL CDS 370642..371688 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene recA CDS complement(371852..372439) product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 372881..373525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 373696..374406 product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275400.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 374393..376885 product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 376910..377995 product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(378396..378539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(378869..379018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(379048..379200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(379629..379916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(379909..380313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(380378..380812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(381016..381906) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene sucD CDS complement(381918..383084) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225315.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene sucC CDS complement(383145..383429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(383522..384955) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene lpdA CDS complement(385041..385298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(385374..386519) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225318.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene odhB CDS complement(386588..389410) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(389527..390807) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene gltA CDS complement(390891..391151) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(391153..391860) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221124.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(391998..393761) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene sdhA CDS complement(393764..394105) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene sdhD CDS complement(394099..394476) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene sdhC CDS 394871..395251 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810367.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(395344..395856) product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(396018..396950) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene cysK CDS complement(397129..397716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(397730..398578) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene dapF CDS 399189..399536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 399725..400204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03890 tRNA 400361..400436 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(400556..400891) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(400976..403126) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene dnaX CDS complement(403370..404452) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene mltB CDS complement(404675..405127) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene rplI CDS complement(405143..405373) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene rpsR CDS complement(405379..405675) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene priB CDS complement(405678..406049) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene rpsF CDS complement(406248..407060) product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211334.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene pflA CDS complement(407245..409530) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653814.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene pflB CDS complement(409804..411102) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222698.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(411134..412285) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(412505..412735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 412626..413069 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene iscR CDS 413093..414307 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688882.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 414423..414590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 note possible pseudo, internal stop codon, frameshifted CDS 414594..414800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 414884..415411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 415478..415861 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene iscU CDS 415974..416459 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222722.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 416593..416832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 416857..417177 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene iscA CDS 417386..417889 product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219110.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene hscB CDS 418120..418833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 419124..420128 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene hemB CDS complement(420371..421528) product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 421749..422522 product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014580530.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene folE2 CDS complement(422606..423823) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene pncB CDS complement(423923..424672) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980846.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(424682..425398) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(425388..426209) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 426398..426733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 426752..427339 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 427409..428449 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene trpD CDS 428717..430273 product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene msrAB CDS 430436..430648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(430597..430944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 430919..431203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(431389..432798) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(433055..433792) product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213776.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(434044..434811) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(435248..436075) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene mutM CDS complement(436353..437027) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(437044..437826) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225108.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(437990..438265) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ftsB CDS complement(438284..439570) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene eno CDS complement(439827..441290) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213540.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene guaB CDS 441500..441937 product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(442184..442876) product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene actS CDS 443145..443627 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene fxsA CDS 443759..444544 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene trpA CDS 444587..445453 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene accD CDS complement(445524..446057) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 446351..446914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(446995..447969) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(448077..448469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(448624..449469) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(449614..450996) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(451204..451764) product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 tRNA 451941..452033 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 452254..454476 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(454554..455453) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene prmB CDS complement(455842..456429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(456573..457409) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene panC CDS complement(457604..458560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 note possible pseudo, frameshifted CDS complement(458763..461087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(461108..462532) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 note possible pseudo, frameshifted CDS complement(462459..463043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(463059..464240) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(464252..465472) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(465544..465825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 note possible pseudo, internal stop codon CDS complement(465931..466722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 note possible pseudo, internal stop codon CDS 467179..468351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(468488..469279) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene panB tRNA complement(469412..469487) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(469526..469601) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 469940..470731 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 470816..471451 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(471542..472585) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 472664..474043 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225520.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene argH CDS complement(474250..476736) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(477046..479052) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174773.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene glgX CDS complement(479403..484001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(484210..484695) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 485257..485562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 485621..486991 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(487044..487358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 note possible pseudo, internal stop codon CDS complement(487377..489278) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154236097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 note possible pseudo, internal stop codon CDS complement(489793..492069) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223856.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene metE CDS complement(492104..493006) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223857.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene metF CDS complement(493736..494401) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene fdoI CDS complement(494401..495312) product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene fdxH CDS complement(495324..498377) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene fdnG CDS complement(498644..499174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(499346..501184) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229553.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene uvrC CDS complement(501288..502346) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951235.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene alr CDS 502851..503141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 note possible pseudo, frameshifted CDS 503047..503502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 note possible pseudo, frameshifted CDS complement(503660..505009) product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(505155..506504) product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 506776..507354 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 507507..507869 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689264.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 508193..509614 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172763941.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 509720..510829 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(510941..511618) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene radC CDS 511978..513102 product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene potA CDS 513118..514095 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 514095..515000 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(515203..515817) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(515913..516113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 516871..517140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 517199..519055 product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(519276..520280) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene rfaD CDS complement(520331..520654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 note possible pseudo, frameshifted CDS complement(520897..521082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(521184..522146) product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene hldA CDS complement(522192..522923) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene pyrF CDS 523294..524439 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene lldD CDS complement(524513..525160) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222696.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene adk CDS complement(525274..525792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003713441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(525913..526680) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225504.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene kdsB CDS complement(526677..526859) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221286.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(526859..527890) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene lpxK CDS 528679..528834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 528893..529039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 529122..529271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 529289..529516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 529603..529833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(529878..530138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 531054..531227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 531469..532824 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene xseA CDS 533144..533896 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene pssA CDS 533900..534703 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688964.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(534892..535572) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 535996..536271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(536338..536487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(536596..537411) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(537386..537736) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(537746..538723) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 539536..539766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(540297..541997) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene recJ CDS complement(542188..542706) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225402.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene yjgA CDS 542823..544154 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene pmbA CDS complement(544212..544655) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 544944..546167 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217858.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(546302..547306) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689966.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(548005..549642) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 550089..551297 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697398.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(551363..552556) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217853.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(552728..553393) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene thiE CDS complement(553779..554606) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene thiD CDS complement(554736..555536) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826244.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene thiM CDS 556156..557337 product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 557341..558819 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene galT CDS 558899..559897 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900516.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene galE CDS 560046..563078 product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(563194..563484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(563631..563867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(564322..564549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(564831..566963) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(567036..568289) product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene lacY CDS complement(568538..569329) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(569551..570186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(570400..571785) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene pntB CDS complement(571790..573328) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225308.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 573545..573955 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene gloA CDS complement(574019..574216) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222472.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene iscX CDS complement(574342..574680) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene fdx CDS complement(574759..575172) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529399.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(575241..577100) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene hscA CDS 577369..578217 product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene hpnD CDS 578214..579539 product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene hpnE CDS 579731..580450 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(580877..581710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(581799..582230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(582383..583150) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(583164..584378) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(584407..585444) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(585612..586727) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(587047..587622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 587818..589815 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225110.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rep CDS complement(590000..590647) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(590720..591679) product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene czcD CDS complement(591782..592618) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(592684..593436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 593757..594377 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene lolA CDS complement(594452..595780) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene miaB CDS complement(596003..596392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 596886..598169 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene hemL CDS complement(598252..599442) product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene ccsB CDS complement(599429..601450) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(601792..602421) product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 602573..603217 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene yihA CDS complement(603326..605692) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 605877..606977 product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 606979..607605 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214520.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 607609..608280 product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 608301..608867 product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 608885..610993 product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene pilQ CDS 611115..611651 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 612105..613202 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221481.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene aroB CDS 613638..614480 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687345.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 614553..615056 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene nrdR CDS 615209..616309 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704923.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene ribD CDS 616717..618021 product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene wbpA CDS 618108..619160 product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene wlbA CDS 619179..620219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 620336..620920 product O-antigen biosynthesis protein WlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807114.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene wlbB CDS 621168..622247 product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene wbpE CDS 622666..624081 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 624116..625312 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 625309..626580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 626577..627644 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 627657..628829 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 628865..629962 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 630033..630650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 630637..631617 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 631601..632326 product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 632573..633355 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene fmt CDS 633348..634523 product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 634887..636788 product NADH-dependent dehydratase PglD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene pglD CDS 636898..638031 product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014170829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 638066..638509 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 638556..640739 product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene wzc CDS complement(641000..642334) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212610.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene gdhA CDS 642696..643490 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(643716..645296) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene purH CDS complement(645475..646128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(646272..647147) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693582.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(647376..647618) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(647704..648297) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(648797..649795) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene dusB CDS complement(649920..650570) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693735.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(650716..651336) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(651452..651952) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(652112..652645) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(652743..653825) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene pheA CDS complement(653916..655145) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323740.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 655590..657125 product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(657244..658176) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 658372..659691 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212503.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 660191..660388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 660411..660674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 note possible pseudo, internal stop codon CDS 660808..661224 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 661496..662209 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(662279..663154) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(663424..664149) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208635371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 664577..664876 product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 665272..665757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(665837..666307) product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050789038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(666510..668852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(668870..669088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(669604..670632) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene queA CDS 671003..671455 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687267.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene accB CDS 671615..672976 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene accC CDS 673156..674043 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene prmA CDS complement(674279..674905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(675076..676860) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(677194..678432) product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 678836..679441 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene wrbA CDS 679764..680045 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 680239..681009 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222015.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene xth CDS complement(681119..682753) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene groL CDS complement(682849..683136) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene groES CDS 683511..685463 product TonB-dependent siderophore receptor FetA/FrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene fetA CDS 685554..686516 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 686941..687906 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981018.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 687896..688870 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 689210..689839 product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002258733.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 690149..690907 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 tRNA complement(691116..691201) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(691222..691587) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene secG CDS complement(691594..692445) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene tpiA CDS 692519..693067 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 693090..693746 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 693963..694289 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 695156..696130 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene moaA CDS complement(696525..696950) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(696961..698358) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene atpD CDS complement(698395..699270) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225829.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene atpG CDS complement(699295..700842) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene atpA CDS complement(700853..701386) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225831.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(701391..701861) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(701935..702171) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene atpE CDS complement(702249..703115) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene atpB CDS complement(703747..704604) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 704965..705543 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 705616..706338 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098689.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(706397..707125) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(707149..708234) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(708290..710029) product acyl-CoA synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(710259..710798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180320626.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(710885..711133) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222119.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(711144..711401) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(711398..712159) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(712156..712905) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 713027..713533 product thioester dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435477.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 713590..714321 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222115.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene fabG CDS 714336..715553 product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(715714..716073) product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(716114..716755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(716757..717293) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(717309..718406) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(718447..719916) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(720079..721440) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rlmD CDS 721555..722553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 722803..723846 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene argC CDS 724079..724549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 note possible pseudo, frameshifted CDS complement(724578..724739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(724690..724905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(724947..725168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 725601..726086 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene lspA CDS 726153..726494 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 726531..727499 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221497.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene ispH CDS complement(727624..729069) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene tldD CDS complement(729274..729516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(729521..730423) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(730420..732168) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225711.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(732165..732671) product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rfaE2 tRNA complement(732893..732968) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(732980..733056) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(733096..733173) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 733565..734416 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene folD CDS 734787..735065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 note possible pseudo, internal stop codon CDS 735472..735690 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene rpmE CDS 735869..737521 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 737778..739121 product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 739334..740323 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 740336..742591 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 742760..743425 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene pgmB CDS complement(743488..743643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 note possible pseudo, internal stop codon CDS complement(743659..744015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 note possible pseudo, internal stop codon, frameshifted CDS complement(744512..745348) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206551.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 745495..745908 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 746026..746253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 746157..747092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 note possible pseudo, frameshifted CDS 747040..747348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 note possible pseudo, frameshifted CDS 747387..747953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 note possible pseudo, frameshifted CDS 748269..750155 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115437557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene mnmG CDS complement(750233..750577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 750779..750973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 751080..751211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(751285..751653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 751928..753097 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033909557.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene lpxB CDS 753984..754580 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene rnhB CDS 754739..755119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(755403..756197) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(756908..757777) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 tRNA complement(757921..757996) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 758217..758780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 759031..759468 product MarR family adhesin repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687296.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene nadR CDS 759476..759976 product 4-hydroxyphenylacetate 3-monooxygenase, reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244300.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene hpaC CDS complement(760090..760566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 760866..761561 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225669.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(761912..762568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 762728..763639 product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene glyQ CDS 763692..764528 product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rhuM note possible pseudo, internal stop codon, frameshifted CDS 764765..766615 product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238384.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene msbA CDS 766688..770323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 770767..771012 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 771009..771395 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 771453..771572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 771747..773804 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene glyS CDS complement(773837..774028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 774351..774608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 774583..776031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 776015..776947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(777017..777466) product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269323.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(777463..778188) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223081.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 778260..779051 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 779399..780922 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene istA CDS 780912..781637 product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene istB CDS complement(782234..782704) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 782871..783719 product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(784266..785708) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(786431..787540) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(788097..789026) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene arcC CDS complement(789258..790622) product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene allB CDS complement(790812..792233) product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(792677..793705) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene pyrB CDS complement(793943..794719) product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540997.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene allE CDS complement(794900..795367) product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(795772..796428) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 796761..797648 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 797645..797947 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 798017..798727 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230026.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ubiG CDS complement(798958..801015) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene ppk1 CDS 801364..802590 product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene gltS CDS 802774..803793 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 803990..804862 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 805129..806670 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687663.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene lnt CDS 807114..807680 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 807981..808844 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435401.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene rpoH CDS 809003..810256 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene hemA CDS 810634..811128 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216721.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(811191..812942) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene ptsP CDS complement(812942..813211) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(813447..813884) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(814110..814673) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(814803..815345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 815597..817486 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene dxs CDS complement(817739..819154) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 819786..823052 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene recC CDS complement(823197..824021) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene truA CDS complement(824160..825785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(825778..827358) product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225015.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(827543..829852) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951227.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene parC CDS 830064..830276 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(830689..831195) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218149.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene coaD CDS complement(831357..832046) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 832265..832768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(832899..833192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 833300..833671 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(834040..835287) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene fabF CDS complement(835465..835701) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene acpP CDS complement(835964..837979) product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(838096..838995) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene xerC CDS complement(838999..839427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 840032..841096 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene fba CDS 841315..842310 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene pdxA CDS complement(842388..842828) product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene mscL CDS complement(843052..843837) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene fabI CDS complement(843980..844561) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206731.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(844558..845577) product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(845811..846221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(846335..846997) product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(846999..848258) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(848512..850797) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(851257..852336) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene plsX CDS complement(852648..853172) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244314.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(853280..853459) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene rpmF CDS complement(853518..854015) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 854069..854659 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 854714..855424 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(855522..857156) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221552.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene yidC CDS complement(857342..857563) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214730.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene yidD CDS complement(857563..857811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(857904..858038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 858354..859925 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene dnaA CDS 860021..861124 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene dnaN CDS 861440..862954 product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene katA CDS complement(863295..864188) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206484.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 864292..864675 product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461358.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 864686..865396 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 865590..867980 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene gyrB CDS complement(868271..868651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 868897..869859 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 870450..871769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 871778..872707 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene fabD CDS 872794..873816 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963749.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 873826..874857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 874885..875913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 876039..876785 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene fabG CDS 877273..879258 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017146899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 tRNA 879330..879405 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 879438..879514 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 879561..879636 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 879669..879745 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(879972..881117) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene dnaJ CDS 881463..882035 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 882047..882694 product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 882694..883371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 883689..886385 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225801.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene leuS CDS complement(886510..886980) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(887191..887496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 rRNA complement(887938..888046) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(888160..891044) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(891378..891453) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(891482..891558) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 rRNA complement(891649..893184) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 893620..894546 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene ribF CDS 894743..897529 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene ileS CDS complement(898072..898587) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(898604..899989) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(900228..903659) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene dnaE CDS 903823..904056 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 904034..904213 product oxidoreductase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 904252..905088 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 905153..905785 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 905782..906744 product YheT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224842.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 906818..907423 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 907475..908377 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene trpC CDS 908639..909616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(909901..910269) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224774.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene rplQ CDS complement(910294..911280) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene rpoA CDS complement(911306..911926) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene rpsD CDS complement(911945..912340) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene rpsK CDS complement(912360..912722) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215453.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene rpsM CDS complement(912931..913149) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene infA CDS complement(913155..914468) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215450.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene secY CDS complement(914482..914916) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215449.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene rplO CDS complement(914918..915103) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690310.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rpmD CDS complement(915096..915614) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene rpsE CDS complement(915632..915985) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene rplR CDS complement(915999..916535) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene rplF CDS complement(916550..916942) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene rpsH CDS complement(916957..917262) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene rpsN CDS complement(917266..917805) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene rplE CDS complement(917815..918138) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene rplX CDS complement(918150..918518) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene rplN CDS complement(918743..919006) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene rpsQ CDS complement(919006..919197) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene rpmC CDS complement(919197..919613) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene rplP CDS complement(919597..920289) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene rpsC CDS complement(920299..920628) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene rplV CDS complement(920637..920915) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215422.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene rpsS CDS complement(920921..921754) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene rplB CDS complement(921767..922081) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene rplW CDS complement(922072..922695) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene rplD CDS complement(922692..923336) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215400.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rplC CDS complement(923573..923884) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215394.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene rpsJ CDS complement(923900..925084) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene tuf CDS complement(925176..927281) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene fusA CDS complement(927300..927770) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690099.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene rpsG CDS complement(927890..928261) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218431.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene rpsL CDS 928530..929678 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene obgE CDS 929759..929884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 929973..931379 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene cysS CDS 931526..932566 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(932736..933167) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(933154..934062) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205164.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(934174..935178) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(935391..935600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(935604..935897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(936497..939199) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244350.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene ppc CDS 939471..939971 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene moaC CDS 940396..941148 product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935810.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(941393..941851) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene pyrI CDS complement(941860..942780) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene pyrB CDS 943172..943981 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 944207..944341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(944672..946093) product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 946342..947640 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225758.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene waaA CDS complement(947834..948202) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687781.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(948296..948631) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 948799..949722 product efflux transporter MtrCDE transcriptional activator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212798.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene mtrA CDS complement(949963..950178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 950359..950805 product CopD family copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225757.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 950906..951895 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225756.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(951975..952277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 tRNA 952416..952491 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(952427..953560) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(953769..954023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(954031..954471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(954473..955249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(955362..956234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 956653..956865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(956879..957412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(957541..957717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(957736..957873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(957957..958331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(958331..959110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 959614..960183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(960131..960502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(960504..960857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(961843..962568) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 962646..962858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 962868..963653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 964177..964425 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584499.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 964422..964685 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(964727..965107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 965759..966157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 966217..967002 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 967052..967513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 967506..968048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 968871..970205 product two-partner secretion system transporter HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene hrpB CDS 970357..975951 product DUF637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149449321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 975961..976233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214440.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 976584..976805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 976871..977056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 977059..977994 product immunity 49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002246836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 978929..979087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(979736..980824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(980817..982991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(982982..984244) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(984621..985784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(985830..986351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(986425..988134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(988230..988496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(988510..990780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(990900..991148) product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(991165..991362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(991359..991553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(991689..993707) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(993773..994141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 994296..994565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(994538..994849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(994888..995982) product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967686.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene virB11 CDS complement(996035..997354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(997351..998196) product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene virB9 CDS complement(998216..998932) product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967689.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(999120..999593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(999612..999806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(999829..1000746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(1000806..1001468) product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene virB5 CDS complement(1001558..1003972) product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037611.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(1003872..1004306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1004324..1004638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(1004708..1005343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 1006045..1007628 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689325.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1007697..1007969) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1008063..1008599) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1009174..1009650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1009790..1010146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686892.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1010127..1010906) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(1011006..1011191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1012116..1012757 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene pyrE CDS 1012974..1013369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1013366..1014679 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene argA CDS complement(1015409..1016224) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225788.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1016218..1016658) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225787.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene rimI CDS complement(1016655..1017332) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene tsaB CDS 1017535..1017774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(1018367..1019920) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703579.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene garD CDS 1020252..1021073 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140342.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1021951..1022904) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 1023166..1024641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(1024689..1026335) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene ubiB CDS 1026567..1027229 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 1027243..1027461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1027904..1029016 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696344.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene asd CDS complement(1029424..1029837) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(1029857..1030462) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1030638..1031108) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225675.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene rlmH CDS complement(1031219..1031605) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene rsfS CDS complement(1031668..1032285) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene nadD CDS 1032722..1033612 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244347.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1033760..1037932) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700598.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene rpoC CDS complement(1038043..1042221) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224771.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene rpoB CDS complement(1042433..1042804) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene rplL CDS complement(1042862..1043362) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rplJ CDS complement(1043604..1044299) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene rplA CDS complement(1044299..1044730) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene rplK CDS complement(1044836..1045369) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215369.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene nusG CDS complement(1045372..1045626) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene secE tRNA complement(1045745..1045820) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(1045828..1047012) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221846.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene tuf tRNA complement(1047064..1047138) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(1047147..1047220) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1047249..1047332) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(1047430..1047681) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1047804..1048385) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene rsmD CDS 1049003..1049932 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697690.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene fmt CDS 1050153..1051412 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene rsmB CDS 1051378..1051971 product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1051975..1054104 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690126.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1054091..1055371 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1055838..1057019 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene dprA CDS 1057063..1057518 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1057608..1059932 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene topA CDS complement(1059989..1061050) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1061362..1061919 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene frr CDS 1062339..1063085 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218592.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1063090..1063884 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002239446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1064081..1065262 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011798751.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ispC CDS 1065498..1066838 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243948.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rseP CDS 1066843..1069236 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene bamA CDS 1069375..1069863 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1070037..1071083 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene lpxD CDS 1071251..1071706 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231544.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene fabZ CDS 1071850..1072638 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651701.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene lpxA CDS complement(1072877..1073458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(1073460..1074572) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 note possible pseudo, internal stop codon CDS 1075364..1075549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1075656..1076780) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene proB CDS complement(1076906..1077205) product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1077437..1078879) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene nuoN CDS complement(1078892..1080409) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224834.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(1080639..1080863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1080864..1081052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1081055..1081321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1081460..1081801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1082206..1082508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1082570..1082779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(1082885..1084897) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene nuoL CDS complement(1084962..1085267) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene nuoK CDS complement(1085264..1085917) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1085968..1087008) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1087104..1087583) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene nuoI CDS complement(1087642..1088052) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(1088088..1089164) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene nuoH CDS complement(1089225..1089458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1089448..1089726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(1089731..1089991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1090037..1090222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1090666..1092930) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene nuoG CDS complement(1093032..1094003) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1094097..1094510) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(1095036..1095311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(1095356..1096651) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene nuoF CDS complement(1096776..1097165) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1097162..1097320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1097606..1098109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(1098183..1098656) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene nuoE CDS complement(1098656..1099912) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene nuoD CDS complement(1099905..1100492) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1100574..1100804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1100899..1101093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1101499..1101978) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(1101969..1102325) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1102989..1103459) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(1103670..1103975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 rRNA complement(1104417..1104525) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(1104639..1107523) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(1107857..1107932) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(1107961..1108037) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 rRNA complement(1108128..1109663) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(1110023..1110490) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1110559..1112667) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(1112667..1113917) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696697.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1114591..1114773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1114839..1115006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(1115083..1115253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1115523..1116866 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1116990..1117997 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1118223..1119140) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene ftsX CDS complement(1119137..1119787) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225752.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene ftsE CDS complement(1120482..1120964) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688077.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1121114..1121470 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225750.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene arsC CDS 1121487..1122143 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1122260..1122841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1122838..1126017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1126421..1127344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1127668..1128591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1129457..1130860 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene mnmE CDS 1130945..1131199 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1131196..1131531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1131648..1133789 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221798.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene yccS CDS 1133900..1134790 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1134889..1135125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1135665..1135901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1135984..1136241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1136668..1137846) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248921.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1138011..1138436) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393264.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1138604..1139329) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1139792..1142389 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene mutS CDS complement(1142564..1143184) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1143329..1144723) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene gltX CDS complement(1144891..1146213) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene ftsY CDS complement(1146389..1146721) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1146816..1147268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(1147356..1149425) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene metG CDS complement(1149529..1150413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1150628..1151122 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1151542..1151907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 note possible pseudo, frameshifted CDS 1152055..1152273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 1152393..1152689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 1152760..1153614 product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1153601..1154338 product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1154733..1155065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1155393..1155668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1155909..1156334 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212270.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1156371..1156847 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 1156844..1157578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1157742..1158977 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1158958..1160787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1160862..1162115) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene murA CDS complement(1162309..1162878) product reactive chlorine resistance membrane protein RclC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene rclC CDS complement(1163386..1164717) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1164723..1164938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1164917..1165165) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951370.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1165379..1166017 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1166136..1166402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1166971..1168338 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene glmU CDS 1168859..1170697 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene glmS CDS complement(1170760..1171662) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene rarD CDS complement(1171795..1172061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1172274..1172579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1172630..1172887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1173220..1173546) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1173679..1174626 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225762.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1174910..1175326) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215267.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene dksA CDS complement(1175659..1176456) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene proC CDS complement(1176707..1177393) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 1177532..1178575 product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218487.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene pilT CDS 1178632..1179861 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1179931..1181235) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1181828..1183168) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1183281..1184036) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1184253..1185701) product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene gnd CDS 1186118..1187893 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225268.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene ggt CDS complement(1187996..1188913) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene lpxC CDS 1189383..1190387 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene gap CDS complement(1190644..1191255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1191283..1191447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1191615..1191905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1192067..1192753) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688090.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene tsaA CDS 1193122..1194093 product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene waaC CDS 1194250..1194999 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1195011..1195946 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1196022..1196636 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1196704..1197807) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene prfB CDS 1198005..1199273 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene purD CDS 1199344..1199913 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1200151..1200597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1200847..1203186 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene recQ CDS 1203539..1203952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1203933..1204124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(1204768..1205151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1205241..1205786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(1205830..1206294) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene trmL CDS complement(1206360..1207073) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951335.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1207072..1207815 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012503964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene bioH CDS 1208061..1208840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1209027..1209317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1209369..1209578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(1209848..1212031) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224852.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene dinG CDS 1212255..1212833 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene ruvA CDS 1212961..1214808 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1215323..1215802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS 1216060..1216971 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 1217306..1217887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1218056..1219426 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene purB CDS complement(1219539..1219877) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1220113..1220994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 1221091..1221444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1221493..1224942) product DUF3418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1225002..1225571) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 1225801..1226133 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene trxA CDS 1226186..1226731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1226794..1227585 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104931.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 1227628..1227957 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1228155..1229552) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene hrpA CDS complement(1229646..1230806) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1230860..1232308) product multidrug efflux MFS transporter NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722177.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1232603..1233037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1233449..1235308) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1235518..1235742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1235927..1236826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(1237241..1237750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1238113..1239582 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690149.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene pyk CDS 1239739..1240605 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rsgA CDS complement(1240656..1241120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1241412..1241642 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1241626..1242522 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691917.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(1242584..1243006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1243230..1243460 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1243501..1244370 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1245509..1246141 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1246617..1248191) product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200871.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1248404..1249561) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 1250049..1251467 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1251542..1252762) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215131.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene sstT CDS 1253092..1254948 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1255530..1259753 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1259984..1260487) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216218.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene def CDS 1260674..1261957 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1262137..1262742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1262914..1263897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1264527..1266023) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225872.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene mgtE CDS complement(1266260..1267198) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1267381..1267842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128261979.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1267949..1268329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1268466..1269158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1269301..1269873 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963525.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1269925..1270869) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1271026..1271928 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1272088..1272837 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1272957..1273541 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene petA CDS 1273561..1274910 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1274925..1275713 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1276311..1278182) product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1278326..1279249 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705040.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene ppk2 CDS 1279447..1281453 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1281686..1281913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1281960..1282148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1282300..1283211 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981020.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene hslO CDS 1283375..1283857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1283929..1284651) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1284954..1285778) product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1285775..1286053) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1286055..1286651) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225840.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1286690..1287187) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene mlaD CDS complement(1287208..1287984) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene mlaE CDS complement(1288088..1288345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1288713..1289513) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1289880..1290530) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1290605..1291249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1291747..1292742) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225965.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 1293401..1296304 product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1296439..1299129 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene glnE CDS 1299248..1300201 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene gluQRS CDS 1300373..1301104 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 1301358..1302029 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1302502..1303755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 1303818..1304279 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225802.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 tRNA 1304391..1304466 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(1304402..1305382) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1305409..1305741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1305741..1305998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1306006..1306449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1306451..1307227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1307378..1307911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1308038..1308214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1308233..1308370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1308454..1308828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1308828..1309607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 1310109..1310735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1310721..1310993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1311172..1311297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1311972..1312373) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1312370..1312630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1312743..1313384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1313468..1313677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 1313684..1314484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1314966..1315253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 1315253..1315540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1315587..1315973) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1315970..1316215) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212658.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1316310..1316744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 1317403..1317801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1317861..1318646 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1318696..1319157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1319150..1319692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1319761..1319910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1320063..1320305 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 1320295..1320582 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1320721..1321587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1321594..1321803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1321804..1322424) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042061.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1322433..1323107) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225856.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1323319..1323543 product TraY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390943.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 1323527..1323802 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1323857..1324141) product virulence-associated protein VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene vapD CDS complement(1324141..1324341) product DUF5397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(1324475..1325527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1325538..1326056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1326118..1327320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1327416..1327682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1327696..1328340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1328396..1329121) product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene istB CDS complement(1329111..1330634) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene istA CDS complement(1330753..1331466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1331366..1331800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1331818..1332132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1332202..1332825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1333224..1334303) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002257287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene apbC CDS complement(1334703..1335020) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene raiA CDS complement(1335065..1336435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(1336782..1337516) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689540.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene lptB CDS complement(1337649..1338176) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene lptA CDS complement(1338157..1338738) product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene lptC CDS complement(1338735..1339271) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1339429..1340403) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1340523..1341578 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene tal CDS complement(1341944..1343893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1344314..1344622) product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005636074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1344783..1345466 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1345495..1345758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1345655..1346830 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 1347065..1347817 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1347908..1348726) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1348876..1349880) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224845.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1349978..1352371 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1352368..1353273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1353335..1354630) product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1354992..1355798) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689993.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene dapB CDS complement(1355812..1356234) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218608.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene bamE CDS 1356444..1356878 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218609.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene fur CDS 1356949..1357692 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene aat CDS 1357745..1358182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1358366..1359187 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224875.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene dapD CDS 1359816..1371032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1371388..1372314 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1373025..1373378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1373504..1373665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1373927..1374616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1374961..1375920 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1375996..1377570) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1377762..1378865 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455827.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1378943..1379620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1379816..1381288) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219978.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1381609..1382223) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1382336..1382680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1382742..1383467 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene rpsB CDS 1383608..1384462 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218222.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene tsf CDS complement(1384610..1384822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1384875..1385126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1385483..1386202 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686859.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene pyrH CDS 1386857..1387021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 note possible pseudo, frameshifted CDS 1387068..1387259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1387614..1388333 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224775.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene minC CDS 1388366..1389178 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene minD CDS 1389182..1389442 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215465.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene minE CDS 1389446..1390366 product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene oxyR tRNA 1390523..1390599 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 1390717..1390974 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 1390974..1391393 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 1391816..1392094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 1392087..1392344 product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 1392930..1393373 product fimbrial major subunit PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene pilE CDS 1393473..1393916 product fimbrial major subunit PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene pilE CDS 1393939..1395357 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1395671..1395979 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1395976..1396284 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1396331..1397134) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 1397256..1398599 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene argG tRNA complement(1398910..1398986) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(1399106..1399414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1399475..1400158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1400281..1401153) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene rsmI CDS 1401314..1401661 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1401667..1402260 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1402344..1403000 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1403110..1403712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1404070..1404849 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene map CDS 1405185..1405478 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 1405613..1408444 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224777.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 1408932..1410530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1410706..1410927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1410902..1411792 product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(1411955..1413586) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene pgi CDS 1413996..1415033 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1415400..1416698 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1416785..1417117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1417295..1417873) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 1418072..1418284 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1418602..1418772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1420070..1420258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1420595..1423390) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687077.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene polA CDS complement(1423584..1424921) product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223278.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1425082..1427157) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(1427285..1427824) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene rfbC CDS complement(1427981..1428847) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224747.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene rfbA CDS complement(1429024..1430088) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene rfbB CDS complement(1430374..1430652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1430663..1434244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1434277..1438026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1437977..1439185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 1439522..1440559 product capsule polysaccharide export outer membrane protein CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene ctrA CDS 1440584..1441750 product capsule polysaccharide export protein CtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene ctrB CDS 1441750..1442547 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 1442544..1443194 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1443246..1445021) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1445188..1445964) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(1446049..1446678) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene rsmG CDS 1447395..1447934 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1448029..1448913 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222047.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1449144..1449392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 1449507..1450901 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene uhpT CDS complement(1451031..1451387) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 1451466..1451843 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254740.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1452198..1453355) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1453494..1453859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224933.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1454000..1454443 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 1454729..1455646 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1455712..1456371 product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene exbB CDS 1456375..1456809 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1457307..1457741) product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1458027..1459781) product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1460106..1461539 product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216619.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene ccoN CDS 1461562..1462173 product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene ccoO CDS 1462178..1462342 product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212597.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1462373..1463770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1463933..1464655 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225597.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene queC CDS 1464870..1465022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 note possible pseudo, internal stop codon CDS 1465330..1465752 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene queD CDS 1465749..1466123 product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1466123..1466755 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1468028..1469539 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene lysS CDS complement(1469883..1471424) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935990.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene murJ CDS 1471728..1472423 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215704.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1472535..1473905) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1474385..1474873) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981013.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1474870..1475256) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687109.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1475256..1475618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229974.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1475742..1476140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 note possible pseudo, frameshifted CDS complement(1476481..1477125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1477448..1478245) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(1478405..1479400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1479388..1479765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 note possible pseudo, frameshifted tRNA complement(1480578..1480653) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(1480661..1480737) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(1480895..1482046) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1482417..1482872 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene mraZ CDS 1482869..1483828 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rsmH CDS 1483876..1484139 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene ftsL CDS 1484383..1486134 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1486250..1487752 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 1488031..1488831 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1489019..1489366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 1489296..1490027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 1490185..1490709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 1491143..1491838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 note possible pseudo, frameshifted CDS 1491993..1493369 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1493732..1494814 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene mraY CDS 1495284..1495646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1495673..1497010 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene murD CDS 1497073..1498236 product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003752201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1498240..1499307 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene murG CDS 1499622..1501025 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033908872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene murC CDS 1501083..1501994 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1502026..1502718 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1502853..1504094 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene ftsA CDS 1504427..1505629 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212501.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene ftsZ CDS 1506040..1507083 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene aroG CDS complement(1507252..1509276) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224746.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1509808..1510551) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1510805..1513126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 1513434..1513967 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1513970..1514260 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1514260..1514529 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216424.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 1514551..1515423 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1515595..1516665) product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene rfaQ CDS 1517177..1518856 product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene pilB CDS 1518927..1520168 product type 4 pilus assembly protein PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene pilG CDS 1520170..1521033 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1521035..1521649 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene coaE CDS 1521663..1521848 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene yacG CDS 1522190..1523623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1523620..1523985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1523993..1524931 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703607.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1524922..1525635 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1525751..1526899 product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1526980..1527789) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1528093..1528725 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1528956..1530254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1530663..1531175 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225802.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 1531189..1531617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225803.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1531684..1532370) product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1532509..1532982) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene queF CDS 1533623..1534117 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1534160..1535557 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1536029..1537216 product fatty acid resistance MFS efflux transporter adaptor subunit FarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene farA CDS 1537446..1538972 product fatty acid resistance MFS efflux transporter permease subunit FarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene farB CDS complement(1539017..1539973) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene thrB CDS complement(1540367..1541056) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1541060..1541794) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225683.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1542074..1542643) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene gmhB CDS complement(1542664..1543737) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951397.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1543782..1544225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1544295..1545536) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225681.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1545664..1545990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1546279..1547310) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene gap CDS 1547845..1548663 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224778.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene zupT CDS 1548845..1550065 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene argJ CDS 1550157..1551146 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1551479..1551931 product DUF417 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012132309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1551976..1552287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 note possible pseudo, frameshifted CDS complement(1552454..1552792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 note possible pseudo, frameshifted CDS complement(1552843..1553733) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 1553834..1554235 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1554258..1554863 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230218.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1555054..1556424) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene ffh CDS 1556575..1557384 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221947.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1557635..1558108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15020 note possible pseudo, frameshifted rRNA 1558628..1560163 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 tRNA 1560254..1560330 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1560359..1560434 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 rRNA 1560768..1563652 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA 1563766..1563874 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS 1564315..1564620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1564831..1565301 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214937.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1565498..1566793) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225666.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene tyrS CDS complement(1567586..1567891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1567952..1568302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1568474..1569565) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene ychF CDS complement(1569677..1570162) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217944.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1570268..1571944 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698015.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1572142..1572324 product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 1572433..1572837 product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1572921..1573472 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene orn CDS 1574085..1575182 product trimeric porin PorB.IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene porB CDS complement(1575337..1577367) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951242.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1577470..1577982) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1578301..1579434 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244039.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1579769..1581427) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1581739..1582467) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 1582803..1584224 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237261.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1584316..1584942) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 tRNA complement(1585191..1585265) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(1585278..1585354) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS 1585472..1586845 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1587117..1588016 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1588230..1588973) product peptidoglycan-binding outer membrane protein RmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene rmpM CDS 1589373..1590353 product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689503.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1590453..1591187) product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene fnr CDS 1591333..1592736 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene hemN CDS 1592803..1593066 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1593404..1594915) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703693.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene ubiB CDS 1595455..1596309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 note possible pseudo, frameshifted CDS complement(1596811..1597071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1597121..1603942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1604138..1606354 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene uvrD CDS 1606439..1606762 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1606773..1607075 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1607109..1607966 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1608064..1608927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088592.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1609236..1611284 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1611503..1611754) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811953.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1612211..1612603) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene rpsI CDS complement(1612613..1613044) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215010.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene rplM CDS complement(1613375..1613671) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686942.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1613681..1614160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215012.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1614239..1615228) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215013.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1615531..1616688 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS 1616929..1618113 product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243976.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene ubiM CDS complement(1618423..1618578) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rpmG CDS complement(1618611..1618844) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene rpmB CDS complement(1619126..1620448) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1620754..1621731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1621971..1622651) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703604.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(1622818..1623708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1623994..1624380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1624543..1624812) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene rpmA CDS complement(1624840..1625160) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene rplU CDS 1625394..1626368 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ispB tRNA 1626384..1626458 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 1626815..1627948 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene carA CDS 1628328..1628855 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1629443..1630195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1630221..1633430 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene carB CDS 1633631..1634290 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694521.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1634534..1635712 product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1636111..1637019 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1637006..1637920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1638246..1639064 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene prmC CDS 1639198..1639575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 1639901..1641271 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 1641271..1641489 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 1641767..1642102 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1642202..1643413 product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1643514..1644734) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene lysA CDS complement(1644739..1644909) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225850.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1644979..1645302 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225851.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene cyaY CDS 1645357..1645863 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene luxS CDS 1646117..1646674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 note possible pseudo, frameshifted CDS 1646865..1647428 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1647438..1647914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 1647907..1648395 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1648517..1648885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1649385..1649876) product DNA-mimic protein DMP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 1650138..1652039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1652395..1652742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1652753..1652944) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1653070..1654068) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene ilvE CDS 1654524..1654844 product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1654866..1656035 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689796.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene lapB CDS 1656218..1657606 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene nhaC CDS 1657876..1658691 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(1658880..1659890) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010359848.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene hemH CDS complement(1660170..1660436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1660368..1662059 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1662086..1664692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1664798..1665913) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene tgt tRNA 1666110..1666186 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 1666295..1668208 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene thrS CDS 1668344..1668748 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene infC CDS 1668896..1669093 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene rpmI CDS 1669106..1669465 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rplT CDS 1669727..1670716 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951025.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene pheS CDS 1670991..1671551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 note possible pseudo, internal stop codon, frameshifted CDS 1671548..1671835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 note possible pseudo, internal stop codon, frameshifted CDS 1671855..1672511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 note possible pseudo, frameshifted CDS 1672511..1672849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 note possible pseudo, frameshifted CDS 1672853..1675216 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene pheT CDS 1675346..1675648 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687686.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1675632..1675952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690777.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1676222..1679797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1680348..1680866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1681050..1681751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1681806..1682240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1682240..1682629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1682813..1682935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1682937..1683419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 1683816..1684112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1684155..1684328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 1684657..1685814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 1685966..1686268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1686293..1686502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1686645..1687493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 note possible pseudo, internal stop codon CDS complement(1687763..1688413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1688424..1688759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1689178..1689543) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217809.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene rplS CDS complement(1689557..1690306) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene trmD CDS complement(1690306..1690815) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene rimM CDS complement(1690819..1691067) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene rpsP CDS complement(1691144..1693555) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(1694229..1695611) product two-component system sensor histidine kinase MisS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687478.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene misS CDS complement(1695627..1696304) product two-component system response regulator MisR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene misR CDS complement(1696462..1698321) product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1698318..1698677) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(1698975..1699751) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene tatC CDS complement(1699759..1700406) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 gene tatB CDS complement(1700410..1700610) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene tatA CDS complement(1700649..1700972) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1701246..1701569) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1701653..1702054) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene hisI CDS complement(1702366..1703133) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene hisF CDS complement(1703174..1703497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1703887..1704624) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene hisA CDS complement(1705027..1705671) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene hisH CDS 1705670..1705900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1705895..1706185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1706480..1707805) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene hisD CDS complement(1707847..1708488) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458388.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene nfsA CDS complement(1708639..1709919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1710019..1710678) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261539.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene hisG CDS complement(1710749..1711411) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 tRNA 1711643..1711727 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 1711878..1713143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1713273..1714109 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene serB CDS 1714435..1715307 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225470.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1715603..1716073 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626611.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1716412..1717413) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene dusA CDS 1717829..1719907 product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 1719876..1720103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1720229..1721521) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1721509..1721979) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218833.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene tsaE CDS 1722230..1723039 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene murI CDS complement(1723451..1723927) product ProQ/FINO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1724225..1725328) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene aroC CDS complement(1725478..1726407) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene hisB CDS complement(1726435..1727517) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene hisC CDS 1727667..1728227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1728511..1729476 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 1729740..1730315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1730330..1730992 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene deoC CDS complement(1731044..1733059) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1733354..1734439) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene nagZ CDS complement(1734529..1734693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1734746..1736263) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1736570..1738075) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1738436..1738675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1738695..1739324) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene nth CDS complement(1739429..1740079) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1740076..1741980) product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1742437..1743819) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012468297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1744123..1745346) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1745616..1746299) product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene narI CDS complement(1746302..1746967) product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192818.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene narJ CDS complement(1746967..1748526) product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene narH CDS complement(1748667..1752338) product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1753048..1753848) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1753896..1754111) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene nqrM CDS complement(1754123..1755274) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242382.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1755367..1756590) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene nqrF CDS complement(1756601..1757194) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene nqrE CDS complement(1757198..1757824) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1757824..1758594) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689271.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1758587..1759819) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1759822..1761165) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225561.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1761480..1761941) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224881.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene dtd CDS complement(1762169..1762501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1762645..1763448 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1763593..1764279) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1764413..1766245) product lytic transglycosylase LtgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene ltgA CDS complement(1766493..1767920) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1768055..1768621 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1768665..1770836) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 1770978..1771793 product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1772097..1773185) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene tsaD CDS 1773447..1773818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1774002..1774589 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene pnuC CDS 1774586..1775233 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1775306..1776004) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene mtgA CDS complement(1776004..1776819) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene aroE CDS 1777095..1778513 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene glnA CDS 1778629..1779216 product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207608.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1779265..1779567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1779687..1781165) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene ubiD CDS complement(1781667..1781990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1782022..1782264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688538.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1782450..1782986) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene ruvC CDS complement(1783119..1785074) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene rpoD CDS complement(1785380..1787161) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene dnaG CDS complement(1787356..1787670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1787696..1788916) product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610441.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene pgaC CDS complement(1789160..1791034) product poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene pgaB CDS complement(1791107..1793512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1793824..1794462) product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223229.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1794866..1796209) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224972.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 tRNA complement(1796499..1796574) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(1796785..1797651) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene galU CDS complement(1797662..1798069) product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1798056..1798262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1798338..1800842) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951014.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene ligA CDS complement(1800986..1802245) product cell division protein ZipA C-terminal FtsZ-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1802634..1803200) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ampD CDS 1803314..1804309 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225508.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene mltG CDS 1804977..1805600 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225507.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene tmk CDS 1806079..1808694 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene adhE CDS 1809009..1810289 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225506.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1810375..1810821) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1810942..1811772 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222631.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1811820..1812068) product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene yoeB CDS complement(1812084..1812335) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769716.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1812480..1812950 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1812938..1813867 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706094.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1814102..1814785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(1815112..1815450) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219692.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene erpA CDS complement(1815546..1816232) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1816531..1816806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1816924..1817964 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1818154..1819176 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193524.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 1819716..1821257 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192088.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1821319..1821651 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247584.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene trxA CDS complement(1822061..1823380) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219025.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1823377..1823559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1823568..1823867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 1824116..1825312 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1825432..1826751) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1827439..1829415) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene tkt CDS 1829828..1831303 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene ccoG CDS 1831275..1831862 product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1831954..1832496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 1832489..1833049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1833155..1833718 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244239.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene pgsA tRNA 1833820..1833895 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA 1833921..1833996 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 1834022..1834097 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA 1834120..1834195 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA 1834235..1834308 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA 1834431..1834520 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(1834633..1835283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 note possible pseudo, frameshifted CDS complement(1835716..1836102) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1836102..1836344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1836619..1837704 product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene trmA CDS complement(1837775..1839277) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene pta CDS complement(1840476..1841552) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene prfA CDS complement(1841872..1842660) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222128.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1842861..1843844) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693790.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(1844090..1844773) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224979.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(1845105..1846445) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691680.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene glmM CDS 1846584..1847549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 note possible pseudo, frameshifted CDS 1847554..1848393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 note possible pseudo, frameshifted CDS complement(1848473..1849312) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693788.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene folP CDS 1849473..1850678 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224987.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 tRNA complement(1850844..1850919) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 1851207..1852064 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(1852192..1853070) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222124.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1853244..1855355 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1855457..1855939) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 1856185..1856409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 1856545..1856928 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695621.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene gcvH CDS 1857114..1857815 product aspartate/glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 1857819..1858376 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1858520..1859659) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 1859903..1860166 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene rpsT CDS 1860383..1861510 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689377.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1861640..1862326 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 1862433..1864238 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene aspS CDS complement(1864339..1864626) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 1864762..1865466 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225581.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene lpxH CDS 1865642..1866160 product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225505.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1866538..1868316 product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225031.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ilvB CDS 1868313..1868804 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene ilvN CDS 1868879..1869178 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212818.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1869284..1870297 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene ilvC CDS 1870716..1873034 product NosR/NirI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204371611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 1873115..1875085 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083147.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene nosZ CDS 1875237..1876589 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 1876929..1877819 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689241.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1878018..1878848 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1878845..1879342 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689238.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 1879749..1879964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(1880022..1880327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 1880214..1880834 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1880948..1881577 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1882074..1883093 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1883427..1883732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 note possible pseudo, internal stop codon CDS complement(1883779..1884156) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1884242..1884790 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1884968..1885216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 1885100..1885567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1885772..1886593) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1887011..1889398 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene ppsA CDS 1889692..1890432 product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691604.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1891175..1892632 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706675.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1892752..1893612) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229395.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1893819..1894340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 note possible pseudo, frameshifted CDS 1894268..1894672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 note possible pseudo, frameshifted CDS 1894687..1895853 product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215233.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1896076..1896348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1896652..1897212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1897271..1897627) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 1897746..1898231 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene ybaK CDS 1898301..1898720 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1899045..1899920 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 1900182..1901513 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005655513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 1901595..1902839 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225191.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1902981..1905062) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819036.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 1905547..1906833 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 1907423..1908745 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 1908747..1909628 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1909988..1910752) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(1910834..1911334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1911444..1911779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(1911668..1912873) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene nirK CDS 1913245..1915500 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1915928..1916365) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225009.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene rnhA CDS complement(1916515..1916709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1917034..1918632 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1918730..1919275 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1919450..1919836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 1920004..1920567 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 1920564..1921058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1921410..1922174) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1922370..1923065) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 1923421..1924776 product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene yegQ CDS complement(1924850..1925050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 1925604..1926341 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687134.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 1926343..1927029 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692419.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 1927118..1928032 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1928626..1929960) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 1930111..1931637 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene ilvA CDS complement(1931685..1931945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 1932100..1933239 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 1933236..1933817 product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene metW repeat_region 1933943..1936442 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatacacagccacccgcgagggtggctg CDS complement(1936631..1936924) product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene cas2 CDS complement(1937029..1938042) product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene cas1c CDS complement(1938164..1938391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1938388..1939821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 note possible pseudo, frameshifted CDS complement(1939775..1940401) product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691017.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene cas4 CDS complement(1940727..1941590) product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene cas7c CDS complement(1941601..1943445) product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene cas8c CDS complement(1943442..1944119) product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene cas5c CDS complement(1944344..1944523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1944607..1946895) product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 1947123..1948511 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1948577..1949365) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348575.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene nadE CDS complement(1949897..1950337) product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(1950330..1950521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(1950524..1951429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1951426..1952931) product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 1953019..1953231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1953214..1954701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169542415.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1954791..1954952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 1955026..1956549 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene istA CDS 1956539..1957264 product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene istB CDS 1957344..1958282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 1958623..1959468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 1959523..1960143 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 note possible pseudo, frameshifted CDS 1960148..1960285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 1960461..1962002 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1962474..1963733) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1963881..1964468) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1964487..1965350) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692740.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene rfbD CDS 1965574..1966164 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084923.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 1966214..1966405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 1966558..1967415 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275437.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 1967415..1967927 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204255.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 1968562..1969866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1969996..1970856 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1971116..1973221 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980838.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene pnp CDS complement(1973469..1974035) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(1974186..1974749) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217107.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1974865..1976163) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951148.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene aroA CDS 1976468..1976803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 1976818..1977081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1977146..1978573) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 1979225..1979428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(1979344..1979700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 1979585..1980034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 note possible pseudo, frameshifted CDS 1980317..1980745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 1980903..1981304 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 1981442..1981690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(1981908..1982258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 1982441..1982962 product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(1983571..1984110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1984170..1985018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 note possible pseudo, internal stop codon, frameshifted CDS 1985188..1985883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(1985965..1986525) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 1986746..1987363 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene gmk CDS 1987415..1987621 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rpoZ CDS 1987650..1989815 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222147.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 1990136..1990348 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene rpsU CDS 1990770..1991213 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167435453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(1991292..1993505) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224958.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 1993686..1994336 product GrxB family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(1994436..1994771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 1995108..1995881 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 1996146..1997561 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(1998073..2000001) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene dnaK CDS complement(2000429..2001004) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689277.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene grpE CDS 2001187..2002005 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214372.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene cysE CDS complement(2002069..2002944) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 2003423..2004592 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene metK CDS 2004695..2005015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 2005034..2006530 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 2006710..2007765 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010360712.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene ftsN CDS 2007778..2008407 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 2008794..2009618 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689465.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2009690..2013181) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225580.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene smc CDS 2013662..2014558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2014582..2019990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2020413..2021969 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706387.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(2022307..2022780) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951218.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2023085..2023483) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2023929..2024885) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162817181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene gshB CDS complement(2024972..2026633) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951028.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene recN CDS complement(2026834..2028222) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392249.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2028491..2029819) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene gudD CDS complement(2029929..2030369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(2030719..2031489) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037586615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2031637..2032584) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 2032867..2034132 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene clpX CDS 2034387..2036972 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689681.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene acnB CDS complement(2037076..2037630) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966373.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 2037799..2038308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2038666..2039553 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225209.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 2039723..2040667 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2040864..2041667 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225093.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2042014..2042289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 note possible pseudo, frameshifted CDS 2042473..2043783 product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2044050..2044199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 2044271..2044420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(2044572..2046941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2047315..2049126) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene typA CDS 2049523..2049987 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene bfr CDS 2050009..2050482 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene bfr CDS complement(2050734..2050919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2050961..2051863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 note possible pseudo, frameshifted CDS 2052111..2052260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2052263..2053468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2053524..2054315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2054345..2054560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2054557..2054823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2054820..2055659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 note possible pseudo, internal stop codon CDS 2055687..2055932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 note possible pseudo, internal stop codon CDS complement(2056006..2057913) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222546.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2058052..2058360) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene grxD CDS 2058532..2059272 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene recO CDS 2059317..2060045 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224937.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene pdxJ CDS 2060409..2060786 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene acpS CDS 2061083..2061886 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216566.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2061890..2062315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216567.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2062340..2062465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 2063031..2064170 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224938.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(2064241..2065200) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(2065300..2066370) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene leuB CDS complement(2066454..2066915) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(2066976..2067617) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene leuD CDS complement(2067710..2067847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(2068073..2068279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2068599..2068820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688807.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2069061..2070467) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene leuC CDS 2070711..2072063 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene gshA CDS 2072331..2075144 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216981.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene gyrA CDS 2075520..2075795 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2075812..2077170 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691602.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2077334..2079010 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene ettA CDS complement(2079188..2079445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2079708..2080256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 note possible pseudo, frameshifted CDS 2080554..2080970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2081104..2081616 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(2081749..2082492) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 2082686..2083465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2083580..2085145) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223072.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene guaA CDS complement(2085266..2085607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2085787..2086224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2086290..2086736) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229688.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene smpB CDS complement(2086841..2087062) product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380890.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2087165..2087368) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2087651..2087965 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221161.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene clpS CDS 2087966..2090227 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701038.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene clpA tmRNA complement(2090287..2090648) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 2090843..2091346 product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 2091579..2092511 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258190.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2092586..2092825 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219546.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(2093049..2093267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2093264..2093863) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2093826..2094179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 2094646..2094897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 2095280..2095741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2096014..2097084) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217196.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene bioB CDS complement(2097314..2097739) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2097802..2098011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 note possible pseudo, internal stop codon CDS 2098015..2098401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 note possible pseudo, internal stop codon, frameshifted CDS 2098418..2098582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 note possible pseudo, frameshifted CDS 2098984..2099418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 note possible pseudo, internal stop codon, frameshifted CDS 2099482..2099658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 note possible pseudo, frameshifted CDS 2099658..2099936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 note possible pseudo, internal stop codon CDS 2099940..2100329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 note possible pseudo, internal stop codon CDS 2100343..2101317 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2101754..2101891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2101984..2103354 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207319.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 2103356..2104888 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207318.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 2105064..2105813 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene surE CDS 2105980..2106867 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020996850.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 2107212..2107841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(2108052..2113289) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235238.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2113484..2115274) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704087.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2115504..2116643 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2116691..2117209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 2117472..2119337 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene ilvD CDS 2119423..2119557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2119669..2120400 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2120630..2122255) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225042.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2122372..2124045) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2124194..2125294) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232768.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene mnmA CDS complement(2125430..2126923) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687377.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene rng CDS 2127178..2127435 product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene grxC CDS 2127467..2127901 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene secB CDS complement(2127959..2129347) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042593394.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2129423..2131360) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2131463..2132638) product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2132963..2133400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2133480..2134313) product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687434.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(2134372..2134884) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225585.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene ybeY CDS 2134961..2135938 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene hemC CDS 2136223..2136882 product opacity family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2137088..2139802) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225125.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene pepN CDS complement(2140164..2141429) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2141777..2142637) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2142717..2143568) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2143720..2144505 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 2144977..2146140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2146178..2148382 product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095715.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2148442..2149686 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095714.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 2149927..2152128 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2152268..2153083 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene hpnC CDS 2153193..2154062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS 2154152..2156164 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2156327..2158450 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene recG CDS complement(2158710..2159498) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2159572..2159844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 note possible pseudo, frameshifted CDS complement(2159727..2160566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 note possible pseudo, frameshifted CDS complement(2160563..2161546) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2161885..2162919) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2163210..2164289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2164863..2167001) product ferric-rhodotorulic acid/ferric-coprogen receptor FhuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene fhuE CDS 2166989..2167183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2167200..2168006 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 tRNA complement(2168117..2168193) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS 2168309..2169160 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813574.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2169430..2170329 product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 2170400..2171194 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700931.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2171283..2171903 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2172096..2173562 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2173666..2174991) product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2175240..2176580) product 4-hydroxybenzoate transporter PcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101875.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(2176772..2177608) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367002.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(2177880..2178818) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene secF CDS complement(2178822..2180675) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene secD CDS complement(2180824..2181084) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene yajC CDS 2181269..2182309 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222843.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2182607..2183587 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980817.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 2183771..2184634 product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980965.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene tehB CDS 2184766..2185299 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687524.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2185427..2186809) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(2186826..2188055) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 2188361..2188969 product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2189155..2190147) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene holA CDS complement(2190149..2190622) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687653.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene lptE CDS complement(2190844..2191629) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene pgeF CDS complement(2191751..2192041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2192098..2192298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2192493..2192747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2193026..2194570) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene purF CDS complement(2194695..2195216) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(2195209..2196270) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219588.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene ftsN CDS complement(2196346..2197620) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225490.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene folC CDS complement(2197756..2198211) product transcriptional regulator FolI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225489.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2198295..2198654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2198727..2199455) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357138.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2199468..2199911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2199941..2200510) product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(2200525..2201304) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene rsmA CDS complement(2201434..2202621) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695921.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2202776..2203174) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 tRNA complement(2203317..2203401) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 2203558..2204223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222408.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2204216..2204812 product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220947.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene ribA CDS complement(2204900..2205355) product PilX family type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455782.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2205366..2205857) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244085.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2205914..2206861) product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2206867..2207421) product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149323756.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene pilV CDS complement(2207533..2208186) product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951044.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(2208414..2209820) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225362.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene dnaB CDS 2209976..2210557 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2210736..2212364) product FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene mnmC CDS 2212447..2213085 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 2213436..2214266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2214487..2215104) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976400.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2215356..2217230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222668.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2217328..2217906 product outer membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219458.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 2217909..2218790 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene ispE tRNA 2218769..2218844 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 2218858..2218933 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 2218941..2219016 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 2219152..2220186 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 2220253..2220825 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687901.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2221022..2221864) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219495.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene htpX CDS complement(2222061..2223506) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(2223510..2224205) product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688414.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(2224202..2224981) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222289.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2225802..2227220 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2227289..2228824 product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980938.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2228855..2229394 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2229638..2230411 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2230494..2231552) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2231622..2232158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 2232290..2232910 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650349.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2233131..2233541 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 2233558..2234523 product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688626.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 2234992..2235561 product Raf kinase inhibitor-like protein YbcL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386867.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene ybcL CDS complement(2235684..2236265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2236615..2237301) product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2237712..2238416) product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2238567..2240090) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2240201..2240827) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene plsY CDS 2240880..2241236 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene folB CDS 2241499..2242041 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225264.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2242530..2243195 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185849.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2243338..2243970) product multidrug efflux system transcriptional repressor MtrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693763.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene mtrR CDS 2244200..2245471 product multidrug efflux RND transporter periplasmic adaptor subunit MtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951249.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene mtrC CDS 2245486..2248683 product multidrug efflux RND transporter permease subunit MtrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224969.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene mtrD CDS 2248739..2250169 product multidrug efflux transporter outer membrane subunit MtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244265.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene mtrE CDS 2250285..2251700 product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700891.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene dacB CDS 2251911..2253428 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene putP CDS complement(2253543..2254679) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225338.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene bamC CDS complement(2254698..2255573) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene dapA CDS 2255959..2256873 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene ubiA CDS 2257197..2257646 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene ptsN CDS 2257650..2258597 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687702.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 gene hprK CDS 2258594..2259448 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene rapZ CDS 2259542..2260486 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene ylqF CDS 2260620..2260949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 2261023..2261988 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2262057..2262665 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235622.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 2262784..2264307 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene istA CDS 2264297..2265022 product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene istB CDS 2265332..2266027 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042061.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2266097..2266411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2266408..2266884 product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2266923..2267354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2267365..2267706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(2267788..2268744) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene xerC CDS complement(2268823..2269497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 2269556..2269717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 2269733..2270212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(2270257..2274798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(2274826..2276361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2276372..2277358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2277380..2278396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(2278428..2279639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2279647..2280609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2280683..2281204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(2281210..2281794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2281840..2284329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2284395..2284805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2285118..2285300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2285318..2285455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(2285509..2285997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(2286054..2286503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(2286646..2287161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2287167..2288267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2288854..2290371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2290387..2291058) product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2291073..2291282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2291299..2292036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2292033..2292650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2292643..2294259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2294252..2295184) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2295576..2295926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2296083..2296634) product YniB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2296675..2298717) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244151.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene uvrB CDS complement(2298832..2299317) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene purE CDS complement(2299399..2300112) product tol-pal system YbgF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2300114..2300782) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(2300795..2300980) product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 2301220..2302557 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244079.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2302917..2303204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2303697..2305430) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2305461..2308295) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690680.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene uvrA CDS complement(2308499..2308741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 note possible pseudo, frameshifted CDS complement(2309257..2309739) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 gene ribH CDS complement(2309854..2310177) product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002238889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 2310424..2311143 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225498.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene rnc CDS 2311257..2311862 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 2311890..2312816 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244050.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene era CDS complement(2312906..2314336) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2314475..2315137) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120867.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2315774..2316706) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2316856..2317704 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2318231..2318956) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050488755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2319246..2319815) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136345632.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2319879..2320184) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970803.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 2320286..2321761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2322016..2322912) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2323133..2323849) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225332.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene tadA CDS complement(2324514..2325449) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene miaA CDS complement(2325541..2325873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2326164..2326460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 2326543..2326875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2327009..2327716) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687861.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(2327985..2329391) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212772.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene trkA CDS complement(2329661..2331112) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(2331568..2332827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(2332820..2334451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(2334451..2335089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2335783..2337306 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222179.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(2337388..2338137) product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 2338466..2340229 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420501.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene cysI CDS complement(2340478..2341908) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene gatB CDS complement(2341935..2342531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2342518..2342691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(2342735..2343901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2343991..2344707) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262697.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene dam CDS complement(2344785..2346233) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene gatA CDS complement(2346303..2346593) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2346675..2346965) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688831.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene gatC CDS 2347270..2348307 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2348320..2349168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2349176..2349676 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene mreD CDS 2349688..2351736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2351733..2352860 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene rodA CDS 2352861..2353517 product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688829.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(2353665..2355140) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 2355536..2356591 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene adhP CDS 2356851..2358053 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene trpB CDS 2358174..2358668 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074188.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2358776..2359996) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 2360250..2361632 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225218.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 gene mpl CDS 2361749..2362381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2362452..2362613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(2362732..2363496) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene gloB CDS complement(2363578..2364609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2364726..2365250) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2365365..2369351) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene purL CDS 2369588..2371504 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2371565..2371921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 2371925..2372476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688633.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2372563..2373537) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225293.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2373644..2375215 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2375553..2376167) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2376356..2376763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2376901..2377101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 2377204..2378832 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002260424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2378918..2380699) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene nrdD CDS complement(2380811..2381305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2381669..2383489 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(2383664..2384914) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(2385076..2385432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2385594..2385812 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213659.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2386081..2389698) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene recB CDS complement(2389854..2390759) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357322.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2390922..2392019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2392095..2392364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 2392845..2393510 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene can CDS 2393597..2395087 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene cls CDS 2395522..2396004 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688513.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2396242..2396580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 2396984..2397124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2397108..2399387 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene nrdA CDS 2399511..2400668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 2400732..2401886 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357909.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene nrdB CDS 2402010..2402312 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 gene yfaE CDS 2402388..2402726 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 2402934..2403419 product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691328.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2403664..2404176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(2404246..2404533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213502.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 2404746..2405990 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2405983..2406663 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene lolD CDS 2406932..2408278 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 2408271..2408951 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225197.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene lolD CDS complement(2409011..2411170) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222365.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2411463..2411672) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217091.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 2411893..2413065 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 2413385..2414149 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307174.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 2414160..2415038 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 2415032..2416996 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene fhuB CDS complement(2417146..2417547) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217207.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2417763..2418722 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2419054..2420385 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951131.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene tilS CDS 2420456..2421055 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene rpoE CDS 2421059..2421628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(2421746..2422108) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2422208..2422888) product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225261.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 2423037..2426138 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 2426224..2426805 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 2427028..2428068 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107879069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2428248..2429291 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107879069.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2429339..2429812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(2429873..2430109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2430110..2430526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 note possible pseudo, frameshifted CDS complement(2430914..2431432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 2432092..2433150 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695315.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene dinB CDS 2433288..2434019 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(2434124..2435734) product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(2435923..2436501) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095516.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene mog CDS complement(2436578..2437612) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691202.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene ruvB CDS complement(2437683..2437988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217140.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2438282..2438653 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951100.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene rbfA CDS 2438709..2439620 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 gene truB CDS 2439901..2441688 product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2441749..2442672) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973550.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 2442892..2443383 product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene ftnA CDS complement(2443500..2444609) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2444916..2445548) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222336.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene pdxH CDS 2445665..2446117 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene dut CDS complement(2446263..2447453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2447823..2449574) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225198.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene recD CDS complement(2449698..2450363) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2450398..2451186) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2451614..2452132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229590.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 2452238..2452831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 2452985..2453932 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213296.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene trxB CDS 2454019..2456010 product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244147.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 2456101..2457291 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene hemW CDS 2457444..2458103 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688932.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene cmk CDS 2458260..2459945 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237993.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene rpsA CDS 2459957..2460262 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2460935..2462077 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220874.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene zapE CDS 2462154..2462579 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene ndk CDS 2462798..2463892 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene rlmN CDS 2463896..2464648 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688950.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene pilW CDS 2464652..2465524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 2465526..2466791 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227267.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene ispG CDS 2466919..2468220 product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2468204..2469868 product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222140.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene pqiB CDS 2469868..2470386 product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222138.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 2470618..2471844 product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2471913..2473256) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2473583..2474725) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2474770..2475501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2475569..2477044) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene trpE CDS complement(2477199..2477624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2477721..2478611) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene argB CDS 2478863..2479993 product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 2480336..2481190 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene lgt CDS 2481259..2481924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 2482105..2483058 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene ttcA CDS 2483188..2483670 product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688359.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 2483995..2485158 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230674.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2485281..2485751) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214937.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2485962..2486267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 rRNA complement(2486708..2486816) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2486930..2489814) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(2490148..2490223) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA complement(2490252..2490328) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 rRNA complement(2490419..2491954) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS 2492355..2493539 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene coaBC CDS complement(2493720..2494907) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene moeA CDS complement(2494904..2495488) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691204.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(2495485..2495949) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene moaE CDS complement(2495951..2496199) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene moaD