>Feature sequence001 <1 178 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agaggtcagtcatttgggatagcctttgaagc 970 386 gene locus_tag LOCUS_00010 gene cas4 970 386 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042183.1 protein_id gnl|my_center|LOCUS_00010 1250 957 gene locus_tag LOCUS_00020 1250 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2251 1259 gene locus_tag LOCUS_00030 gene cas1 2251 1259 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_00030 6518 2256 gene locus_tag LOCUS_00040 6518 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7571 6612 gene locus_tag LOCUS_00050 7571 6612 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_00050 9077 7671 gene locus_tag LOCUS_00060 9077 7671 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_00060 10285 9224 gene locus_tag LOCUS_00070 10285 9224 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_00070 13853 10368 gene locus_tag LOCUS_00080 13853 10368 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268160.1 protein_id gnl|my_center|LOCUS_00080 >Feature sequence002 1465 491 gene locus_tag LOCUS_00090 gene cysB 1465 491 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_00090 1698 2474 gene locus_tag LOCUS_00100 1698 2474 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463393.1 protein_id gnl|my_center|LOCUS_00100 2619 5318 gene locus_tag LOCUS_00110 2619 5318 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_00110 7745 5604 gene locus_tag LOCUS_00120 gene dinG 7745 5604 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764917.1 protein_id gnl|my_center|LOCUS_00120 8512 7742 gene locus_tag LOCUS_00130 8512 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10247 8514 gene locus_tag LOCUS_00140 10247 8514 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_00140 11142 10405 gene locus_tag LOCUS_00150 11142 10405 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_00150 11237 11644 gene locus_tag LOCUS_00160 11237 11644 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114776.1 protein_id gnl|my_center|LOCUS_00160 12958 11825 gene locus_tag LOCUS_00170 12958 11825 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119670.1 protein_id gnl|my_center|LOCUS_00170 16968 13033 gene locus_tag LOCUS_00180 gene hrpA 16968 13033 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 protein_id gnl|my_center|LOCUS_00180 18721 17039 gene locus_tag LOCUS_00190 gene fadD1 18721 17039 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_00190 18913 18752 gene locus_tag LOCUS_00200 18913 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19228 19773 gene locus_tag LOCUS_00210 19228 19773 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740134.1 protein_id gnl|my_center|LOCUS_00210 20767 19784 gene locus_tag LOCUS_00220 20767 19784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21263 20760 gene locus_tag LOCUS_00230 21263 20760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21778 21260 gene locus_tag LOCUS_00240 21778 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22441 21800 gene locus_tag LOCUS_00250 22441 21800 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_00250 22874 22796 gene locus_tag LOCUS_t00010 22874 22796 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23502 22894 gene locus_tag LOCUS_00260 23502 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26278 23492 gene locus_tag LOCUS_00270 26278 23492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_00270 28089 26275 gene locus_tag LOCUS_00280 28089 26275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28601 28095 gene locus_tag LOCUS_00290 28601 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29999 28821 gene locus_tag LOCUS_00300 29999 28821 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_00300 30865 30023 gene locus_tag LOCUS_00310 30865 30023 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_00310 33447 30955 gene locus_tag LOCUS_00320 33447 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34084 33704 gene locus_tag LOCUS_00330 34084 33704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34534 34088 gene locus_tag LOCUS_00340 34534 34088 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 protein_id gnl|my_center|LOCUS_00340 34823 34539 gene locus_tag LOCUS_00350 34823 34539 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_00350 35947 34820 gene locus_tag LOCUS_00360 gene rnd 35947 34820 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 protein_id gnl|my_center|LOCUS_00360 36583 35981 gene locus_tag LOCUS_00370 gene recR 36583 35981 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408165.1 protein_id gnl|my_center|LOCUS_00370 36909 36586 gene locus_tag LOCUS_00380 36909 36586 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_00380 38823 36973 gene locus_tag LOCUS_00390 gene dnaX 38823 36973 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114673.1 protein_id gnl|my_center|LOCUS_00390 41699 39210 gene locus_tag LOCUS_00400 41699 39210 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104757.1 protein_id gnl|my_center|LOCUS_00400 41979 42794 gene locus_tag LOCUS_00410 41979 42794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42794 43741 gene locus_tag LOCUS_00420 42794 43741 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_00420 43947 46061 gene locus_tag LOCUS_00430 gene prsK 43947 46061 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_00430 46209 47585 gene locus_tag LOCUS_00440 gene prsR 46209 47585 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_00440 47618 50299 gene locus_tag LOCUS_00450 gene prsT 47618 50299 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_00450 50300 52942 gene locus_tag LOCUS_00460 50300 52942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 52909 53553 gene locus_tag LOCUS_00470 52909 53553 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787337.1 protein_id gnl|my_center|LOCUS_00470 53550 54917 gene locus_tag LOCUS_00480 53550 54917 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_00480 54914 55933 gene locus_tag LOCUS_00490 54914 55933 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942595.1 protein_id gnl|my_center|LOCUS_00490 58042 56870 gene locus_tag LOCUS_00500 58042 56870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58275 59228 gene locus_tag LOCUS_00510 58275 59228 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_00510 59246 60115 gene locus_tag LOCUS_00520 59246 60115 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_00520 61551 60091 gene locus_tag LOCUS_00530 61551 60091 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626578.1 protein_id gnl|my_center|LOCUS_00530 62684 61557 gene locus_tag LOCUS_00540 62684 61557 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_00540 64604 62697 gene locus_tag LOCUS_00550 64604 62697 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_00550 65769 64606 gene locus_tag LOCUS_00560 65769 64606 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_00560 67121 65766 gene locus_tag LOCUS_00570 67121 65766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68376 67114 gene locus_tag LOCUS_00580 68376 67114 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_00580 69245 68373 gene locus_tag LOCUS_00590 69245 68373 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 69478 69242 gene locus_tag LOCUS_00600 69478 69242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70617 69490 gene locus_tag LOCUS_00610 70617 69490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72464 70638 gene locus_tag LOCUS_00620 72464 70638 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_00620 73471 72461 gene locus_tag LOCUS_00630 73471 72461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 75079 73517 gene locus_tag LOCUS_00640 75079 73517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 75930 75076 gene locus_tag LOCUS_00650 75930 75076 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_00650 77207 75960 gene locus_tag LOCUS_00660 77207 75960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 78165 77257 gene locus_tag LOCUS_00670 78165 77257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 79688 78165 gene locus_tag LOCUS_00680 79688 78165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80463 79819 gene locus_tag LOCUS_00690 80463 79819 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00690 81885 80473 gene locus_tag LOCUS_00700 81885 80473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 82338 82994 gene locus_tag LOCUS_00710 82338 82994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 84566 83082 gene locus_tag LOCUS_00720 gene prpD 84566 83082 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_00720 85870 84812 gene locus_tag LOCUS_00730 85870 84812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_00730 85973 86611 gene locus_tag LOCUS_00740 85973 86611 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083342.1 protein_id gnl|my_center|LOCUS_00740 86693 87751 gene locus_tag LOCUS_00750 86693 87751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 87936 88505 gene locus_tag LOCUS_00760 gene folE 87936 88505 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 protein_id gnl|my_center|LOCUS_00760 88525 89247 gene locus_tag LOCUS_00770 gene folM 88525 89247 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_00770 89655 89131 gene locus_tag LOCUS_00780 89655 89131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 90500 89712 gene locus_tag LOCUS_00790 90500 89712 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_00790 90593 91030 gene locus_tag LOCUS_00800 90593 91030 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170853.1 protein_id gnl|my_center|LOCUS_00800 91033 91965 gene locus_tag LOCUS_00810 91033 91965 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_00810 92163 94367 gene locus_tag LOCUS_00820 92163 94367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 94435 94761 gene locus_tag LOCUS_00830 94435 94761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 94847 95269 gene locus_tag LOCUS_00840 gene zntR 94847 95269 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215702.1 protein_id gnl|my_center|LOCUS_00840 95266 97998 gene locus_tag LOCUS_00850 gene copA 95266 97998 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816861.1 protein_id gnl|my_center|LOCUS_00850 97995 98117 gene locus_tag LOCUS_00860 97995 98117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 98127 98564 gene locus_tag LOCUS_00870 98127 98564 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_00870 98661 100643 gene locus_tag LOCUS_00880 gene rnr 98661 100643 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958002.1 protein_id gnl|my_center|LOCUS_00880 100713 100907 gene locus_tag LOCUS_00890 100713 100907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 101266 100949 gene locus_tag LOCUS_00900 101266 100949 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035952.1 protein_id gnl|my_center|LOCUS_00900 101511 101266 gene locus_tag LOCUS_00910 101511 101266 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_00910 102765 101587 gene locus_tag LOCUS_00920 102765 101587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 104650 102749 gene locus_tag LOCUS_00930 104650 102749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 105483 104647 gene locus_tag LOCUS_00940 105483 104647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 106484 105576 gene locus_tag LOCUS_00950 106484 105576 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_00950 106813 107967 gene locus_tag LOCUS_00960 106813 107967 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_00960 108031 108435 gene locus_tag LOCUS_00970 108031 108435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 108755 109954 gene locus_tag LOCUS_00980 108755 109954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 protein_id gnl|my_center|LOCUS_00980 110448 112391 gene locus_tag LOCUS_00990 110448 112391 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204897.1 protein_id gnl|my_center|LOCUS_00990 112512 114032 gene locus_tag LOCUS_01000 112512 114032 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 protein_id gnl|my_center|LOCUS_01000 114029 114880 gene locus_tag LOCUS_01010 114029 114880 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 protein_id gnl|my_center|LOCUS_01010 115772 115434 gene locus_tag LOCUS_01020 115772 115434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 116194 115841 gene locus_tag LOCUS_01030 116194 115841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 116168 117649 gene locus_tag LOCUS_01040 116168 117649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 117897 118718 gene locus_tag LOCUS_01050 117897 118718 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532203.1 protein_id gnl|my_center|LOCUS_01050 118732 120357 gene locus_tag LOCUS_01060 118732 120357 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_01060 120907 120641 gene locus_tag LOCUS_01070 120907 120641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 121076 121828 gene locus_tag LOCUS_01080 121076 121828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 122798 121977 gene locus_tag LOCUS_01090 122798 121977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 123150 125993 gene locus_tag LOCUS_01100 123150 125993 CDS product ImpA family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481876.1 protein_id gnl|my_center|LOCUS_01100 126148 126861 gene locus_tag LOCUS_01110 126148 126861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127649 126906 gene locus_tag LOCUS_01120 127649 126906 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088322.1 protein_id gnl|my_center|LOCUS_01120 127874 129256 gene locus_tag LOCUS_01130 gene dbpA 127874 129256 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071179.1 protein_id gnl|my_center|LOCUS_01130 129427 130035 gene locus_tag LOCUS_01140 129427 130035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 130178 131743 gene locus_tag LOCUS_01150 130178 131743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 131853 131671 gene locus_tag LOCUS_01160 131853 131671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132718 131936 gene locus_tag LOCUS_01170 132718 131936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 132864 133664 gene locus_tag LOCUS_01180 132864 133664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 134148 133690 gene locus_tag LOCUS_01190 134148 133690 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_01190 134720 134223 gene locus_tag LOCUS_01200 134720 134223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 135400 134897 gene locus_tag LOCUS_01210 135400 134897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224149.1 protein_id gnl|my_center|LOCUS_01210 136346 135354 gene locus_tag LOCUS_01220 136346 135354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 136646 137698 gene locus_tag LOCUS_01230 136646 137698 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence003 936 310 gene locus_tag LOCUS_01240 gene rnhB 936 310 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_01240 2159 933 gene locus_tag LOCUS_01250 gene lpxB 2159 933 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103595.1 protein_id gnl|my_center|LOCUS_01250 2957 2166 gene locus_tag LOCUS_01260 gene lpxA 2957 2166 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_01260 3400 2957 gene locus_tag LOCUS_01270 gene fabZ 3400 2957 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 protein_id gnl|my_center|LOCUS_01270 4506 3481 gene locus_tag LOCUS_01280 gene lpxD 4506 3481 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_01280 5147 4647 gene locus_tag LOCUS_01290 5147 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 7526 5202 gene locus_tag LOCUS_01300 gene bamA 7526 5202 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_01300 8941 7592 gene locus_tag LOCUS_01310 gene rseP 8941 7592 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_01310 9792 8977 gene locus_tag LOCUS_01320 9792 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01320 10150 9803 gene locus_tag LOCUS_01330 10150 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01330 11045 10203 gene locus_tag LOCUS_01340 gene cdsA 11045 10203 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_01340 11880 11089 gene locus_tag LOCUS_01350 gene uppS 11880 11089 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113863.1 protein_id gnl|my_center|LOCUS_01350 12505 11948 gene locus_tag LOCUS_01360 gene frr 12505 11948 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_01360 13304 12576 gene locus_tag LOCUS_01370 gene pyrH 13304 12576 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_01370 14377 13508 gene locus_tag LOCUS_01380 gene tsf 14377 13508 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 protein_id gnl|my_center|LOCUS_01380 15235 14465 gene locus_tag LOCUS_01390 gene rpsB 15235 14465 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_01390 15516 16286 gene locus_tag LOCUS_01400 gene map 15516 16286 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765976.1 protein_id gnl|my_center|LOCUS_01400 16312 18978 gene locus_tag LOCUS_01410 16312 18978 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_01410 19006 20205 gene locus_tag LOCUS_01420 gene dapC 19006 20205 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_01420 20411 20752 gene locus_tag LOCUS_01430 20411 20752 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208548.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence004 269 1285 gene locus_tag LOCUS_01440 269 1285 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_01440 1608 1333 gene locus_tag LOCUS_01450 1608 1333 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 protein_id gnl|my_center|LOCUS_01450 1779 2801 gene locus_tag LOCUS_01460 1779 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_01460 2862 4922 gene locus_tag LOCUS_01470 2862 4922 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_01470 6560 5028 gene locus_tag LOCUS_01480 6560 5028 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 protein_id gnl|my_center|LOCUS_01480 7692 6835 gene locus_tag LOCUS_01490 gene hslO 7692 6835 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_01490 8143 7739 gene locus_tag LOCUS_01500 gene hslR 8143 7739 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 protein_id gnl|my_center|LOCUS_01500 8877 8197 gene locus_tag LOCUS_01510 gene yrfG 8877 8197 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_01510 9341 8961 gene locus_tag LOCUS_01520 9341 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10229 9414 gene locus_tag LOCUS_01530 gene mutM 10229 9414 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_01530 10407 11579 gene locus_tag LOCUS_01540 10407 11579 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104496.1 protein_id gnl|my_center|LOCUS_01540 12103 11561 gene locus_tag LOCUS_01550 gene rsmD 12103 11561 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743199.1 protein_id gnl|my_center|LOCUS_01550 12363 13523 gene locus_tag LOCUS_01560 12363 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 13546 14235 gene locus_tag LOCUS_01570 gene ftsE 13546 14235 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_01570 14225 15229 gene locus_tag LOCUS_01580 gene ftsX 14225 15229 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_01580 15483 16346 gene locus_tag LOCUS_01590 gene rpoH 15483 16346 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_01590 16430 17335 gene locus_tag LOCUS_01600 16430 17335 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_01600 17337 18119 gene locus_tag LOCUS_01610 gene hyi 17337 18119 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_01610 18211 18891 gene locus_tag LOCUS_01620 18211 18891 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_01620 18878 20302 gene locus_tag LOCUS_01630 18878 20302 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968992.1 protein_id gnl|my_center|LOCUS_01630 20555 20322 gene locus_tag LOCUS_01640 20555 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 >Feature sequence005 <1 1622 gene locus_tag LOCUS_01650 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:PAS domain S-box protein >Feature sequence006 492 55 gene locus_tag LOCUS_01660 492 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 1294 569 gene locus_tag LOCUS_01670 1294 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1558 1788 gene locus_tag LOCUS_01680 1558 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1921 1845 gene locus_tag LOCUS_t00020 1921 1845 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3046 2039 gene locus_tag LOCUS_01690 3046 2039 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_01690 3815 3066 gene locus_tag LOCUS_01700 3815 3066 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_01700 4613 3897 gene locus_tag LOCUS_01710 4613 3897 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_01710 5763 4684 gene locus_tag LOCUS_01720 5763 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 6638 5763 gene locus_tag LOCUS_01730 gene dapA 6638 5763 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_01730 7877 6795 gene locus_tag LOCUS_01740 7877 6795 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267087.1 protein_id gnl|my_center|LOCUS_01740 8132 7878 gene locus_tag LOCUS_01750 8132 7878 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_01750 8311 9777 gene locus_tag LOCUS_01760 8311 9777 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_01760 10870 9809 gene locus_tag LOCUS_01770 gene nadA 10870 9809 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence007 2131 4239 gene locus_tag LOCUS_01780 2131 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4248 5132 gene locus_tag LOCUS_01790 4248 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5116 5457 gene locus_tag LOCUS_01800 5116 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 5489 10660 gene locus_tag LOCUS_01810 5489 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 10694 11422 gene locus_tag LOCUS_01820 10694 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 11710 11414 gene locus_tag LOCUS_01830 11710 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 12664 13854 gene locus_tag LOCUS_01840 12664 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 14281 14205 gene locus_tag LOCUS_t00030 14281 14205 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14678 14884 gene locus_tag LOCUS_01850 14678 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 15032 15517 gene locus_tag LOCUS_01860 gene bfr 15032 15517 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395745.1 protein_id gnl|my_center|LOCUS_01860 15632 16990 gene locus_tag LOCUS_01870 15632 16990 CDS product phosphohexose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506571.1 protein_id gnl|my_center|LOCUS_01870 18119 17004 gene locus_tag LOCUS_01880 18119 17004 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_01880 18453 18121 gene locus_tag LOCUS_01890 18453 18121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 18637 19044 gene locus_tag LOCUS_01900 18637 19044 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 protein_id gnl|my_center|LOCUS_01900 21150 19096 gene locus_tag LOCUS_01910 gene rep 21150 19096 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 protein_id gnl|my_center|LOCUS_01910 21341 23077 gene locus_tag LOCUS_01920 21341 23077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 23171 25480 gene locus_tag LOCUS_01930 23171 25480 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099617780.1 protein_id gnl|my_center|LOCUS_01930 25526 27082 gene locus_tag LOCUS_01940 gene gshA 25526 27082 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_01940 27260 27472 gene locus_tag LOCUS_01950 27260 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 28073 27612 gene locus_tag LOCUS_01960 28073 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 28166 28669 gene locus_tag LOCUS_01970 28166 28669 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_01970 28776 29267 gene locus_tag LOCUS_01980 gene rsd 28776 29267 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 protein_id gnl|my_center|LOCUS_01980 30167 29424 gene locus_tag LOCUS_01990 30167 29424 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736691.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence008 467 126 gene locus_tag LOCUS_02000 467 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 865 470 gene locus_tag LOCUS_02010 865 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 1500 1168 gene locus_tag LOCUS_02020 1500 1168 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_02020 3221 1635 gene locus_tag LOCUS_02030 3221 1635 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202677.1 protein_id gnl|my_center|LOCUS_02030 3398 4033 gene locus_tag LOCUS_02040 3398 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4020 4463 gene locus_tag LOCUS_02050 4020 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_02050 5712 4600 gene locus_tag LOCUS_02060 5712 4600 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085824.1 protein_id gnl|my_center|LOCUS_02060 5839 6303 gene locus_tag LOCUS_02070 5839 6303 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968030.1 protein_id gnl|my_center|LOCUS_02070 6379 7242 gene locus_tag LOCUS_02080 6379 7242 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704173.1 protein_id gnl|my_center|LOCUS_02080 8577 7243 gene locus_tag LOCUS_02090 8577 7243 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 protein_id gnl|my_center|LOCUS_02090 8724 9407 gene locus_tag LOCUS_02100 8724 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 10707 9409 gene locus_tag LOCUS_02110 10707 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence009 349 900 gene locus_tag LOCUS_02120 349 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1424 981 gene locus_tag LOCUS_02130 1424 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2476 1568 gene locus_tag LOCUS_02140 2476 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3035 2844 gene locus_tag LOCUS_02150 3035 2844 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_02150 3262 3885 gene locus_tag LOCUS_02160 3262 3885 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_02160 4669 3929 gene locus_tag LOCUS_02170 4669 3929 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_02170 5521 4784 gene locus_tag LOCUS_02180 gene anr 5521 4784 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_02180 7262 5730 gene locus_tag LOCUS_02190 7262 5730 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206178.1 protein_id gnl|my_center|LOCUS_02190 8257 7334 gene locus_tag LOCUS_02200 8257 7334 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070390.1 protein_id gnl|my_center|LOCUS_02200 8634 10292 gene locus_tag LOCUS_02210 8634 10292 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083948.1 protein_id gnl|my_center|LOCUS_02210 10952 10305 gene locus_tag LOCUS_02220 10952 10305 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085111.1 protein_id gnl|my_center|LOCUS_02220 11141 11446 gene locus_tag LOCUS_02230 11141 11446 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008544592.1 protein_id gnl|my_center|LOCUS_02230 11443 12297 gene locus_tag LOCUS_02240 11443 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 13783 12227 gene locus_tag LOCUS_02250 13783 12227 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242442.1 protein_id gnl|my_center|LOCUS_02250 15269 13977 gene locus_tag LOCUS_02260 15269 13977 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206630.1 protein_id gnl|my_center|LOCUS_02260 15471 16007 gene locus_tag LOCUS_02270 15471 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 16849 16028 gene locus_tag LOCUS_02280 16849 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 17658 16897 gene locus_tag LOCUS_02290 17658 16897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_02290 19142 17655 gene locus_tag LOCUS_02300 19142 17655 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_02300 19333 20460 gene locus_tag LOCUS_02310 19333 20460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 21283 20474 gene locus_tag LOCUS_02320 21283 20474 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_02320 22370 21273 gene locus_tag LOCUS_02330 gene astA 22370 21273 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262693.1 protein_id gnl|my_center|LOCUS_02330 22487 22924 gene locus_tag LOCUS_02340 22487 22924 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 protein_id gnl|my_center|LOCUS_02340 23043 23744 gene locus_tag LOCUS_02350 23043 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 24666 23833 gene locus_tag LOCUS_02360 24666 23833 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_02360 25458 24844 gene locus_tag LOCUS_02370 25458 24844 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence010 172 921 gene locus_tag LOCUS_02380 172 921 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444791.1 protein_id gnl|my_center|LOCUS_02380 1113 2612 gene locus_tag LOCUS_02390 1113 2612 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_02390 5780 2721 gene locus_tag LOCUS_02400 5780 2721 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_02400 6904 5780 gene locus_tag LOCUS_02410 6904 5780 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_02410 7325 7068 gene locus_tag LOCUS_02420 7325 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02420 8625 7516 gene locus_tag LOCUS_02430 8625 7516 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 protein_id gnl|my_center|LOCUS_02430 9334 8666 gene locus_tag LOCUS_02440 9334 8666 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845178.1 protein_id gnl|my_center|LOCUS_02440 9727 10074 gene locus_tag LOCUS_02450 9727 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 10659 10901 gene locus_tag LOCUS_02460 10659 10901 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_02460 10905 11843 gene locus_tag LOCUS_02470 10905 11843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 12283 12083 gene locus_tag LOCUS_02480 12283 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 13826 14377 gene locus_tag LOCUS_02490 13826 14377 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence011 1605 100 gene locus_tag LOCUS_02500 gene ppx 1605 100 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_02500 2047 2373 gene locus_tag LOCUS_02510 gene trxA 2047 2373 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_02510 2435 3310 gene locus_tag LOCUS_02520 2435 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4521 5255 gene locus_tag LOCUS_02530 4521 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5385 5960 gene locus_tag LOCUS_02540 gene mobA 5385 5960 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052189.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence012 835 611 gene locus_tag LOCUS_02550 835 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02550 1824 862 gene locus_tag LOCUS_02560 1824 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2634 1837 gene locus_tag LOCUS_02570 2634 1837 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_02570 <4121 2631 gene locus_tag LOCUS_02580 <4121 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705444.1:bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase >Feature sequence013 937 146 gene locus_tag LOCUS_02590 gene ybgF 937 146 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104810.1 protein_id gnl|my_center|LOCUS_02590 1541 948 gene locus_tag LOCUS_02600 gene pal 1541 948 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314369.1 protein_id gnl|my_center|LOCUS_02600 2932 1604 gene locus_tag LOCUS_02610 gene tolB 2932 1604 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 protein_id gnl|my_center|LOCUS_02610 3879 2929 gene locus_tag LOCUS_02620 3879 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4319 3876 gene locus_tag LOCUS_02630 gene tolR 4319 3876 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_02630 5029 4337 gene locus_tag LOCUS_02640 gene tolQ 5029 4337 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_02640 5504 5052 gene locus_tag LOCUS_02650 gene ybgC 5504 5052 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_02650 6523 5501 gene locus_tag LOCUS_02660 gene ruvB 6523 5501 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_02660 7224 6607 gene locus_tag LOCUS_02670 gene ruvA 7224 6607 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_02670 7760 7239 gene locus_tag LOCUS_02680 gene ruvC 7760 7239 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 protein_id gnl|my_center|LOCUS_02680 8517 7768 gene locus_tag LOCUS_02690 8517 7768 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086107.1 protein_id gnl|my_center|LOCUS_02690 10372 8567 gene locus_tag LOCUS_02700 gene aspS 10372 8567 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_02700 10542 11171 gene locus_tag LOCUS_02710 gene fabR 10542 11171 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368907.1 protein_id gnl|my_center|LOCUS_02710 11615 11175 gene locus_tag LOCUS_02720 11615 11175 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117900.1 protein_id gnl|my_center|LOCUS_02720 12961 11615 gene locus_tag LOCUS_02730 12961 11615 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528109.1 protein_id gnl|my_center|LOCUS_02730 13969 12986 gene locus_tag LOCUS_02740 gene galE 13969 12986 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_02740 14520 14005 gene locus_tag LOCUS_02750 gene tadA 14520 14005 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092697.1 protein_id gnl|my_center|LOCUS_02750 16104 14527 gene locus_tag LOCUS_02760 gene guaA 16104 14527 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 protein_id gnl|my_center|LOCUS_02760 17684 16221 gene locus_tag LOCUS_02770 gene guaB 17684 16221 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_02770 17855 19231 gene locus_tag LOCUS_02780 gene xseA 17855 19231 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703163.1 protein_id gnl|my_center|LOCUS_02780 19352 21226 gene locus_tag LOCUS_02790 19352 21226 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_02790 21501 21710 gene locus_tag LOCUS_02800 21501 21710 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707209.1 protein_id gnl|my_center|LOCUS_02800 23465 21783 gene locus_tag LOCUS_02810 gene leuA 23465 21783 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706534.1 protein_id gnl|my_center|LOCUS_02810 23711 24199 gene locus_tag LOCUS_02820 23711 24199 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_02820 24847 24233 gene locus_tag LOCUS_02830 24847 24233 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_02830 25294 24875 gene locus_tag LOCUS_02840 25294 24875 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_02840 25477 27204 gene locus_tag LOCUS_02850 25477 27204 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207562.1 protein_id gnl|my_center|LOCUS_02850 27246 27815 gene locus_tag LOCUS_02860 27246 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 28639 27890 gene locus_tag LOCUS_02870 28639 27890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 28550 28921 gene locus_tag LOCUS_02880 28550 28921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 29342 29124 gene locus_tag LOCUS_02890 29342 29124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 31263 29347 gene locus_tag LOCUS_02900 gene htpG 31263 29347 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_02900 31816 31382 gene locus_tag LOCUS_02910 31816 31382 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_02910 32286 31813 gene locus_tag LOCUS_02920 32286 31813 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_02920 32399 33691 gene locus_tag LOCUS_02930 32399 33691 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_02930 33851 34399 gene locus_tag LOCUS_02940 33851 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072911.1 protein_id gnl|my_center|LOCUS_02940 34396 35583 gene locus_tag LOCUS_02950 34396 35583 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_02950 35948 36862 gene locus_tag LOCUS_02960 35948 36862 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765281.1 protein_id gnl|my_center|LOCUS_02960 39481 36989 gene locus_tag LOCUS_02970 39481 36989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_02970 40188 39478 gene locus_tag LOCUS_02980 40188 39478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_02980 40286 40960 gene locus_tag LOCUS_02990 gene tesA 40286 40960 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_02990 41925 40912 gene locus_tag LOCUS_03000 41925 40912 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_03000 41982 42057 gene locus_tag LOCUS_t00040 41982 42057 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 43405 42107 gene locus_tag LOCUS_03010 43405 42107 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104764.1 protein_id gnl|my_center|LOCUS_03010 43548 44048 gene locus_tag LOCUS_03020 43548 44048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 44050 44754 gene locus_tag LOCUS_03030 44050 44754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 46974 44800 gene locus_tag LOCUS_03040 gene rlmKL 46974 44800 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_03040 47239 47448 gene locus_tag LOCUS_03050 gene rmf 47239 47448 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103238.1 protein_id gnl|my_center|LOCUS_03050 48694 47660 gene locus_tag LOCUS_03060 48694 47660 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_03060 49088 50278 gene locus_tag LOCUS_03070 49088 50278 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_03070 52276 50261 gene locus_tag LOCUS_03080 gene uvrB 52276 50261 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_03080 52492 53676 gene locus_tag LOCUS_03090 52492 53676 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence014 481 227 gene locus_tag LOCUS_03100 481 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 580 1950 gene locus_tag LOCUS_03110 580 1950 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135179751.1 protein_id gnl|my_center|LOCUS_03110 3490 1982 gene locus_tag LOCUS_03120 3490 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3932 4333 gene locus_tag LOCUS_03130 3932 4333 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481510.1 protein_id gnl|my_center|LOCUS_03130 7653 4336 gene locus_tag LOCUS_03140 7653 4336 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 protein_id gnl|my_center|LOCUS_03140 7780 8781 gene locus_tag LOCUS_03150 7780 8781 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_03150 9061 8807 gene locus_tag LOCUS_03160 9061 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9176 9760 gene locus_tag LOCUS_03170 9176 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10490 9906 gene locus_tag LOCUS_03180 10490 9906 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_03180 10600 12360 gene locus_tag LOCUS_03190 10600 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 12326 13465 gene locus_tag LOCUS_03200 12326 13465 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_03200 13526 14227 gene locus_tag LOCUS_03210 13526 14227 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_03210 14231 15703 gene locus_tag LOCUS_03220 14231 15703 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_03220 15800 16996 gene locus_tag LOCUS_03230 gene msrB 15800 16996 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825088.1 protein_id gnl|my_center|LOCUS_03230 17117 18037 gene locus_tag LOCUS_03240 17117 18037 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_03240 18997 18101 gene locus_tag LOCUS_03250 18997 18101 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_03250 19435 19007 gene locus_tag LOCUS_03260 19435 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence015 444 265 gene locus_tag LOCUS_03270 444 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 971 444 gene locus_tag LOCUS_03280 971 444 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_03280 1607 1023 gene locus_tag LOCUS_03290 1607 1023 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103566.1 protein_id gnl|my_center|LOCUS_03290 1718 2260 gene locus_tag LOCUS_03300 1718 2260 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence016 825 337 gene locus_tag LOCUS_03310 825 337 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241230.1 protein_id gnl|my_center|LOCUS_03310 953 1393 gene locus_tag LOCUS_03320 953 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1733 1398 gene locus_tag LOCUS_03330 1733 1398 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635217.1 protein_id gnl|my_center|LOCUS_03330 2221 1733 gene locus_tag LOCUS_03340 2221 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence017 1601 67 gene locus_tag LOCUS_r00010 1601 67 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence018 1171 611 gene locus_tag LOCUS_03350 1171 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1274 2590 gene locus_tag LOCUS_03360 gene pabB 1274 2590 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_03360 3330 2725 gene locus_tag LOCUS_03370 gene thrH 3330 2725 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_03370 3559 4284 gene locus_tag LOCUS_03380 3559 4284 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_03380 <5059 4506 gene locus_tag LOCUS_03390 <5059 4506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_213035039.1:IS30 family transposase >Feature sequence019 479 225 gene locus_tag LOCUS_03400 479 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03400 1480 905 gene locus_tag LOCUS_03410 1480 905 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105229.1 protein_id gnl|my_center|LOCUS_03410 2153 1515 gene locus_tag LOCUS_03420 gene ureG 2153 1515 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_03420 3024 2338 gene locus_tag LOCUS_03430 3024 2338 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_03430 3478 3002 gene locus_tag LOCUS_03440 gene ureE 3478 3002 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_03440 <4060 3491 gene locus_tag LOCUS_03450 <4060 3491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206084.1:urease subunit alpha >Feature sequence020 1051 32 gene locus_tag LOCUS_03460 1051 32 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_03460 1348 1085 gene locus_tag LOCUS_03470 1348 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence021 49 804 gene locus_tag LOCUS_03480 49 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 828 1514 gene locus_tag LOCUS_03490 828 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 1736 1903 gene locus_tag LOCUS_03500 1736 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1923 3011 gene locus_tag LOCUS_03510 1923 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3151 3771 gene locus_tag LOCUS_03520 3151 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3798 4157 gene locus_tag LOCUS_03530 3798 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4171 4554 gene locus_tag LOCUS_03540 4171 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4547 5365 gene locus_tag LOCUS_03550 4547 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence022 <1 762 gene locus_tag LOCUS_03560 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063970.1:diaminobutyrate--2-oxoglutarate transaminase >Feature sequence023 143 769 gene locus_tag LOCUS_03570 143 769 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186606.1 protein_id gnl|my_center|LOCUS_03570 1348 926 gene locus_tag LOCUS_03580 1348 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence024 1001 171 gene locus_tag LOCUS_03590 1001 171 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_03590 2959 998 gene locus_tag LOCUS_03600 gene atuF 2959 998 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_03600 3790 2972 gene locus_tag LOCUS_03610 gene atuE 3790 2972 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_03610 4961 3804 gene locus_tag LOCUS_03620 gene atuD 4961 3804 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_03620 6769 5153 gene locus_tag LOCUS_03630 gene atuC 6769 5153 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_03630 7649 6786 gene locus_tag LOCUS_03640 7649 6786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_03640 9457 7646 gene locus_tag LOCUS_03650 9457 7646 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_03650 9580 10188 gene locus_tag LOCUS_03660 gene atuR 9580 10188 CDS product atu genes transcriptional repressor AtuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 protein_id gnl|my_center|LOCUS_03660 10573 11631 gene locus_tag LOCUS_03670 10573 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_03670 11694 12716 gene locus_tag LOCUS_03680 gene adeT1 11694 12716 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_03680 12742 14793 gene locus_tag LOCUS_03690 12742 14793 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence025 154 79 gene locus_tag LOCUS_t00050 154 79 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 248 174 gene locus_tag LOCUS_t00060 248 174 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 343 260 gene locus_tag LOCUS_t00070 343 260 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 451 376 gene locus_tag LOCUS_t00080 451 376 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1146 481 gene locus_tag LOCUS_03700 1146 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 1331 1143 gene locus_tag LOCUS_03710 1331 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 1368 1703 gene locus_tag LOCUS_03720 1368 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2824 1856 gene locus_tag LOCUS_03730 gene birA 2824 1856 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 protein_id gnl|my_center|LOCUS_03730 5353 2969 gene locus_tag LOCUS_03740 5353 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5910 5368 gene locus_tag LOCUS_03750 5910 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113522.1 protein_id gnl|my_center|LOCUS_03750 6969 5920 gene locus_tag LOCUS_03760 6969 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113521.1 protein_id gnl|my_center|LOCUS_03760 8081 6969 gene locus_tag LOCUS_03770 8081 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106143.1 protein_id gnl|my_center|LOCUS_03770 8497 8315 gene locus_tag LOCUS_03780 8497 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence026 730 1425 gene locus_tag LOCUS_03790 730 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4251 1597 gene locus_tag LOCUS_03800 4251 1597 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918503.1 protein_id gnl|my_center|LOCUS_03800 4593 5198 gene locus_tag LOCUS_03810 4593 5198 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_03810 5198 6310 gene locus_tag LOCUS_03820 5198 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6545 7897 gene locus_tag LOCUS_03830 6545 7897 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_03830 7916 8893 gene locus_tag LOCUS_03840 7916 8893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_03840 8906 9769 gene locus_tag LOCUS_03850 8906 9769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367094.1 protein_id gnl|my_center|LOCUS_03850 10013 11224 gene locus_tag LOCUS_03860 10013 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 11239 13749 gene locus_tag LOCUS_03870 gene nirB 11239 13749 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104464.1 protein_id gnl|my_center|LOCUS_03870 13915 14283 gene locus_tag LOCUS_03880 gene nirD 13915 14283 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268220.1 protein_id gnl|my_center|LOCUS_03880 >Feature sequence027 231 359 gene locus_tag LOCUS_03890 231 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1198 734 gene locus_tag LOCUS_03900 1198 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1857 1201 gene locus_tag LOCUS_03910 1857 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence028 194 1030 gene locus_tag LOCUS_03920 194 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1763 1149 gene locus_tag LOCUS_03930 1763 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1926 2888 gene locus_tag LOCUS_03940 1926 2888 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_03940 2885 4885 gene locus_tag LOCUS_03950 gene tgpA 2885 4885 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_03950 4882 5907 gene locus_tag LOCUS_03960 4882 5907 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_03960 5947 6297 gene locus_tag LOCUS_03970 5947 6297 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_03970 6357 7235 gene locus_tag LOCUS_03980 6357 7235 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_03980 7216 8160 gene locus_tag LOCUS_03990 7216 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8157 9266 gene locus_tag LOCUS_04000 8157 9266 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405642.1 protein_id gnl|my_center|LOCUS_04000 9339 10247 gene locus_tag LOCUS_04010 gene prmB 9339 10247 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_04010 10258 11355 gene locus_tag LOCUS_04020 gene aroC 10258 11355 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_04020 11309 12520 gene locus_tag LOCUS_04030 11309 12520 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_04030 13400 12531 gene locus_tag LOCUS_04040 13400 12531 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038431.1 protein_id gnl|my_center|LOCUS_04040 13543 14976 gene locus_tag LOCUS_04050 gene leuC 13543 14976 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_04050 14989 15642 gene locus_tag LOCUS_04060 gene leuD 14989 15642 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114814.1 protein_id gnl|my_center|LOCUS_04060 15675 16748 gene locus_tag LOCUS_04070 gene leuB 15675 16748 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_04070 16840 17964 gene locus_tag LOCUS_04080 gene asd 16840 17964 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552957.1 protein_id gnl|my_center|LOCUS_04080 18288 21596 gene locus_tag LOCUS_04090 gene fimV 18288 21596 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_04090 21691 22539 gene locus_tag LOCUS_04100 gene truA 21691 22539 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_04100 22533 23207 gene locus_tag LOCUS_04110 22533 23207 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_04110 23490 24389 gene locus_tag LOCUS_04120 23490 24389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04120 24411 25226 gene locus_tag LOCUS_04130 gene trpA 24411 25226 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence029 >Feature sequence030 151 1800 gene locus_tag LOCUS_04140 gene gcbA 151 1800 CDS product diguanylate cyclase GcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_04140 2027 2473 gene locus_tag LOCUS_04150 gene aroQ 2027 2473 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_04150 2486 2935 gene locus_tag LOCUS_04160 gene accB 2486 2935 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_04160 2951 4297 gene locus_tag LOCUS_04170 gene accC 2951 4297 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 protein_id gnl|my_center|LOCUS_04170 4299 5195 gene locus_tag LOCUS_04180 gene prmA 4299 5195 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_04180 5260 6543 gene locus_tag LOCUS_04190 5260 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 6694 7692 gene locus_tag LOCUS_04200 gene dusB 6694 7692 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_04200 7689 8000 gene locus_tag LOCUS_04210 gene fis 7689 8000 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121116.1 protein_id gnl|my_center|LOCUS_04210 8096 9676 gene locus_tag LOCUS_04220 gene purH 8096 9676 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 protein_id gnl|my_center|LOCUS_04220 9687 10979 gene locus_tag LOCUS_04230 gene purD 9687 10979 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_04230 11021 11962 gene locus_tag LOCUS_04240 11021 11962 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_04240 11973 13184 gene locus_tag LOCUS_04250 11973 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04250 13184 13531 gene locus_tag LOCUS_04260 13184 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 14271 13528 gene locus_tag LOCUS_04270 14271 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 15790 14492 gene locus_tag LOCUS_04280 gene egtB 15790 14492 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_04280 16321 15866 gene locus_tag LOCUS_04290 gene cadR 16321 15866 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence031 1188 589 gene locus_tag LOCUS_04300 gene cysC 1188 589 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261127.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence032 180 626 gene locus_tag LOCUS_04310 180 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1348 695 gene locus_tag LOCUS_04320 1348 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266258.1 protein_id gnl|my_center|LOCUS_04320 2237 1599 gene locus_tag LOCUS_04330 gene pyrE 2237 1599 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_04330 2310 3116 gene locus_tag LOCUS_04340 2310 3116 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_04340 4053 3334 gene locus_tag LOCUS_04350 gene rph 4053 3334 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_04350 4210 5076 gene locus_tag LOCUS_04360 4210 5076 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_04360 5159 5794 gene locus_tag LOCUS_04370 gene gmk 5159 5794 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_04370 5937 6176 gene locus_tag LOCUS_04380 5937 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 6331 8490 gene locus_tag LOCUS_04390 gene spoT 6331 8490 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_04390 8575 8961 gene locus_tag LOCUS_04400 8575 8961 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367486.1 protein_id gnl|my_center|LOCUS_04400 9806 8958 gene locus_tag LOCUS_04410 9806 8958 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102980.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence033 583 200 gene locus_tag LOCUS_04420 gene mapZ 583 200 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_04420 930 682 gene locus_tag LOCUS_04430 930 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04430 2069 888 gene locus_tag LOCUS_04440 2069 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04440 3730 2069 gene locus_tag LOCUS_04450 gene ettA 3730 2069 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_04450 3960 5216 gene locus_tag LOCUS_04460 3960 5216 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419083.1 protein_id gnl|my_center|LOCUS_04460 5273 5791 gene locus_tag LOCUS_04470 gene nrdR 5273 5791 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_04470 5805 6938 gene locus_tag LOCUS_04480 gene ribD 5805 6938 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103235.1 protein_id gnl|my_center|LOCUS_04480 6944 8056 gene locus_tag LOCUS_04490 gene ribBA 6944 8056 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_04490 8088 8567 gene locus_tag LOCUS_04500 gene ribE 8088 8567 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_04500 8564 9046 gene locus_tag LOCUS_04510 gene nusB 8564 9046 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_04510 9048 10004 gene locus_tag LOCUS_04520 gene thiL 9048 10004 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269044.1 protein_id gnl|my_center|LOCUS_04520 9997 10524 gene locus_tag LOCUS_04530 9997 10524 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_04530 10844 10638 gene locus_tag LOCUS_04540 10844 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 10997 11647 gene locus_tag LOCUS_04550 10997 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 13292 11772 gene locus_tag LOCUS_04560 13292 11772 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_04560 14325 13402 gene locus_tag LOCUS_04570 14325 13402 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930452.1 protein_id gnl|my_center|LOCUS_04570 14427 15449 gene locus_tag LOCUS_04580 14427 15449 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_04580 16447 15479 gene locus_tag LOCUS_04590 16447 15479 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344609.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence034 1360 380 gene locus_tag LOCUS_04600 1360 380 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_04600 3024 1357 gene locus_tag LOCUS_04610 3024 1357 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_04610 3189 3575 gene locus_tag LOCUS_04620 3189 3575 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706662.1 protein_id gnl|my_center|LOCUS_04620 4292 3594 gene locus_tag LOCUS_04630 4292 3594 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_04630 4813 4325 gene locus_tag LOCUS_04640 4813 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5489 5118 gene locus_tag LOCUS_04650 5489 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6210 5593 gene locus_tag LOCUS_04660 6210 5593 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_04660 7022 6261 gene locus_tag LOCUS_04670 7022 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 7582 7022 gene locus_tag LOCUS_04680 7582 7022 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350422.1 protein_id gnl|my_center|LOCUS_04680 8122 9483 gene locus_tag LOCUS_04690 8122 9483 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence035 5311 4148 gene locus_tag LOCUS_04700 5311 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5501 5725 gene locus_tag LOCUS_04710 5501 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 6254 5814 gene locus_tag LOCUS_04720 6254 5814 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_04720 7450 6464 gene locus_tag LOCUS_04730 7450 6464 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229250.1 protein_id gnl|my_center|LOCUS_04730 8574 7519 gene locus_tag LOCUS_04740 8574 7519 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_04740 9096 8590 gene locus_tag LOCUS_04750 9096 8590 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_04750 9539 9096 gene locus_tag LOCUS_04760 9539 9096 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240481.1 protein_id gnl|my_center|LOCUS_04760 9640 10212 gene locus_tag LOCUS_04770 9640 10212 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396060.1 protein_id gnl|my_center|LOCUS_04770 10859 10272 gene locus_tag LOCUS_04780 10859 10272 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942588.1 protein_id gnl|my_center|LOCUS_04780 11752 11132 gene locus_tag LOCUS_04790 11752 11132 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039104.1 protein_id gnl|my_center|LOCUS_04790 12232 11756 gene locus_tag LOCUS_04800 12232 11756 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_04800 12381 13355 gene locus_tag LOCUS_04810 12381 13355 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_04810 13352 14164 gene locus_tag LOCUS_04820 13352 14164 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_04820 14164 15303 gene locus_tag LOCUS_04830 14164 15303 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256104.1 protein_id gnl|my_center|LOCUS_04830 15300 16430 gene locus_tag LOCUS_04840 15300 16430 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_04840 18284 16434 gene locus_tag LOCUS_04850 18284 16434 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_04850 19493 18435 gene locus_tag LOCUS_04860 19493 18435 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958298.1 protein_id gnl|my_center|LOCUS_04860 22391 19623 gene locus_tag LOCUS_04870 22391 19623 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_04870 22893 23939 gene locus_tag LOCUS_04880 22893 23939 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_04880 23932 27153 gene locus_tag LOCUS_04890 23932 27153 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_04890 27178 29661 gene locus_tag LOCUS_04900 27178 29661 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_04900 30113 29658 gene locus_tag LOCUS_04910 30113 29658 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_04910 30219 30935 gene locus_tag LOCUS_04920 30219 30935 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_04920 32038 31187 gene locus_tag LOCUS_04930 32038 31187 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_04930 33587 32100 gene locus_tag LOCUS_04940 33587 32100 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_04940 35230 33674 gene locus_tag LOCUS_04950 gene nhaB 35230 33674 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_04950 37121 35289 gene locus_tag LOCUS_04960 gene glmS 37121 35289 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105589.1 protein_id gnl|my_center|LOCUS_04960 38519 37131 gene locus_tag LOCUS_04970 gene glmU 38519 37131 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 protein_id gnl|my_center|LOCUS_04970 39064 38645 gene locus_tag LOCUS_04980 39064 38645 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_04980 40491 39103 gene locus_tag LOCUS_04990 gene atpD 40491 39103 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_04990 41424 40549 gene locus_tag LOCUS_05000 gene atpG 41424 40549 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_05000 43040 41496 gene locus_tag LOCUS_05010 gene atpA 43040 41496 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_05010 43608 43069 gene locus_tag LOCUS_05020 43608 43069 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_05020 44091 43621 gene locus_tag LOCUS_05030 44091 43621 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_05030 44410 44183 gene locus_tag LOCUS_05040 44410 44183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 45312 44458 gene locus_tag LOCUS_05050 gene atpB 45312 44458 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114072.1 protein_id gnl|my_center|LOCUS_05050 46861 45989 gene locus_tag LOCUS_05060 46861 45989 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_05060 47705 46914 gene locus_tag LOCUS_05070 47705 46914 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_05070 48358 47693 gene locus_tag LOCUS_05080 gene rsmG 48358 47693 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_05080 50246 48360 gene locus_tag LOCUS_05090 gene mnmG 50246 48360 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_05090 51841 50516 gene locus_tag LOCUS_05100 51841 50516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 52073 53332 gene locus_tag LOCUS_05110 52073 53332 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530988.1 protein_id gnl|my_center|LOCUS_05110 53920 53384 gene locus_tag LOCUS_05120 53920 53384 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263584.1 protein_id gnl|my_center|LOCUS_05120 54188 55324 gene locus_tag LOCUS_05130 54188 55324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05130 55273 56007 gene locus_tag LOCUS_05140 55273 56007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05140 56198 57133 gene locus_tag LOCUS_05150 gene thpD 56198 57133 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230318.1 protein_id gnl|my_center|LOCUS_05150 58040 57231 gene locus_tag LOCUS_05160 58040 57231 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_05160 59425 58064 gene locus_tag LOCUS_05170 gene mnmE 59425 58064 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205962.1 protein_id gnl|my_center|LOCUS_05170 61185 59482 gene locus_tag LOCUS_05180 gene yidC 61185 59482 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_05180 61460 61194 gene locus_tag LOCUS_05190 gene yidD 61460 61194 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551313.1 protein_id gnl|my_center|LOCUS_05190 61852 61457 gene locus_tag LOCUS_05200 gene rnpA 61852 61457 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 protein_id gnl|my_center|LOCUS_05200 62645 64126 gene locus_tag LOCUS_05210 gene dnaA 62645 64126 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401422.1 protein_id gnl|my_center|LOCUS_05210 64172 65275 gene locus_tag LOCUS_05220 gene dnaN 64172 65275 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_05220 65374 66678 gene locus_tag LOCUS_05230 65374 66678 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207121.1 protein_id gnl|my_center|LOCUS_05230 66778 67890 gene locus_tag LOCUS_05240 gene recF 66778 67890 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_05240 67914 70328 gene locus_tag LOCUS_05250 gene gyrB 67914 70328 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 protein_id gnl|my_center|LOCUS_05250 71487 70738 gene locus_tag LOCUS_05260 71487 70738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_05260 72906 71587 gene locus_tag LOCUS_05270 72906 71587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 73156 73080 gene locus_tag LOCUS_t00090 73156 73080 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 73796 73239 gene locus_tag LOCUS_05280 gene gmhB 73796 73239 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 protein_id gnl|my_center|LOCUS_05280 75884 73800 gene locus_tag LOCUS_05290 gene glyS 75884 73800 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291805.1 protein_id gnl|my_center|LOCUS_05290 76834 75881 gene locus_tag LOCUS_05300 gene glyQ 76834 75881 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_05300 78409 76961 gene locus_tag LOCUS_05310 78409 76961 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_05310 79809 78436 gene locus_tag LOCUS_05320 gene trkA 79809 78436 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_05320 81131 79806 gene locus_tag LOCUS_05330 gene rsmB 81131 79806 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_05330 82066 81131 gene locus_tag LOCUS_05340 gene fmt 82066 81131 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_05340 82701 82162 gene locus_tag LOCUS_05350 gene def 82701 82162 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_05350 83166 84188 gene locus_tag LOCUS_05360 83166 84188 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_05360 84261 85415 gene locus_tag LOCUS_05370 gene dprA 84261 85415 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_05370 85588 86067 gene locus_tag LOCUS_05380 85588 86067 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_05380 86085 87005 gene locus_tag LOCUS_05390 gene hemF 86085 87005 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_05390 87002 87823 gene locus_tag LOCUS_05400 gene aroE 87002 87823 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_05400 87861 88634 gene locus_tag LOCUS_05410 gene pomA 87861 88634 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362404.1 protein_id gnl|my_center|LOCUS_05410 88639 89481 gene locus_tag LOCUS_05420 88639 89481 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707084.1 protein_id gnl|my_center|LOCUS_05420 89648 89965 gene locus_tag LOCUS_05430 89648 89965 CDS product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768817.1 protein_id gnl|my_center|LOCUS_05430 90447 89992 gene locus_tag LOCUS_05440 90447 89992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 91213 90656 gene locus_tag LOCUS_05450 91213 90656 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_05450 91343 93388 gene locus_tag LOCUS_05460 gene prlC 91343 93388 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_05460 93460 93717 gene locus_tag LOCUS_05470 93460 93717 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266148.1 protein_id gnl|my_center|LOCUS_05470 94308 93922 gene locus_tag LOCUS_05480 94308 93922 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_05480 94806 94369 gene locus_tag LOCUS_05490 94806 94369 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_05490 95677 94817 gene locus_tag LOCUS_05500 95677 94817 CDS product DUF3034 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052844658.1 protein_id gnl|my_center|LOCUS_05500 98058 95674 gene locus_tag LOCUS_05510 98058 95674 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_05510 98672 98055 gene locus_tag LOCUS_05520 98672 98055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 99483 98818 gene locus_tag LOCUS_05530 99483 98818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115620.1 protein_id gnl|my_center|LOCUS_05530 100093 99566 gene locus_tag LOCUS_05540 100093 99566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 100893 100072 gene locus_tag LOCUS_05550 100893 100072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 101134 102261 gene locus_tag LOCUS_05560 gene coxB 101134 102261 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_05560 102365 103957 gene locus_tag LOCUS_05570 gene ctaD 102365 103957 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_05570 104027 104917 gene locus_tag LOCUS_05580 104027 104917 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_05580 105128 104925 gene locus_tag LOCUS_05590 105128 104925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 105180 105923 gene locus_tag LOCUS_05600 105180 105923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_05600 105916 106527 gene locus_tag LOCUS_05610 105916 106527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_05610 106566 107561 gene locus_tag LOCUS_05620 106566 107561 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_05620 107609 108505 gene locus_tag LOCUS_05630 gene cyoE 107609 108505 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_05630 108511 108702 gene locus_tag LOCUS_05640 108511 108702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 108783 109997 gene locus_tag LOCUS_05650 108783 109997 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389341.1 protein_id gnl|my_center|LOCUS_05650 111232 110003 gene locus_tag LOCUS_05660 111232 110003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence036 892 446 gene locus_tag LOCUS_05670 892 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1575 895 gene locus_tag LOCUS_05680 1575 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence037 1141 170 gene locus_tag LOCUS_05690 1141 170 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768828.1 protein_id gnl|my_center|LOCUS_05690 1304 2266 gene locus_tag LOCUS_05700 1304 2266 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_05700 2263 2694 gene locus_tag LOCUS_05710 2263 2694 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096721.1 protein_id gnl|my_center|LOCUS_05710 2691 3482 gene locus_tag LOCUS_05720 2691 3482 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768839.1 protein_id gnl|my_center|LOCUS_05720 3479 4747 gene locus_tag LOCUS_05730 3479 4747 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_05730 4744 5631 gene locus_tag LOCUS_05740 4744 5631 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_05740 5619 6878 gene locus_tag LOCUS_05750 5619 6878 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266739.1 protein_id gnl|my_center|LOCUS_05750 6875 7399 gene locus_tag LOCUS_05760 6875 7399 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266738.1 protein_id gnl|my_center|LOCUS_05760 7396 8130 gene locus_tag LOCUS_05770 7396 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8267 9079 gene locus_tag LOCUS_05780 gene xthA 8267 9079 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence038 522 3158 gene locus_tag LOCUS_05790 gene alaS 522 3158 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_05790 3300 4535 gene locus_tag LOCUS_05800 3300 4535 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_05800 4764 4961 gene locus_tag LOCUS_05810 gene csrA 4764 4961 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 protein_id gnl|my_center|LOCUS_05810 5077 5167 gene locus_tag LOCUS_t00100 5077 5167 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5179 5255 gene locus_tag LOCUS_t00110 5179 5255 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5522 5598 gene locus_tag LOCUS_t00120 5522 5598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6248 6508 gene locus_tag LOCUS_05820 6248 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6551 8341 gene locus_tag LOCUS_05830 gene oadA 6551 8341 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_05830 8355 9677 gene locus_tag LOCUS_05840 8355 9677 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427751.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence039 1179 121 gene locus_tag LOCUS_05850 gene bioB 1179 121 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103330.1 protein_id gnl|my_center|LOCUS_05850 1327 1992 gene locus_tag LOCUS_05860 1327 1992 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence040 962 759 gene locus_tag LOCUS_05870 962 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence041 1197 1 gene locus_tag LOCUS_05880 gene tuf 1197 1 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115146.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence042 456 701 gene locus_tag LOCUS_05890 456 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 698 1105 gene locus_tag LOCUS_05900 698 1105 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence043 <2230 814 gene locus_tag LOCUS_05910 <2230 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214185119.1:excinuclease ABC subunit UvrA >Feature sequence044 2125 179 gene locus_tag LOCUS_05920 2125 179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_05920 2167 2697 gene locus_tag LOCUS_05930 2167 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2697 3068 gene locus_tag LOCUS_05940 2697 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence045 <1 1761 gene locus_tag LOCUS_05950 <1 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941340.1:DUF748 domain-containing protein >Feature sequence046 605 1492 gene locus_tag LOCUS_05960 605 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3112 1697 gene locus_tag LOCUS_05970 3112 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3757 3398 gene locus_tag LOCUS_tm00010 3757 3398 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5199 3850 gene locus_tag LOCUS_05980 5199 3850 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_05980 5930 5436 gene locus_tag LOCUS_05990 gene smpB 5930 5436 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_05990 6094 7512 gene locus_tag LOCUS_06000 6094 7512 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 protein_id gnl|my_center|LOCUS_06000 7521 7964 gene locus_tag LOCUS_06010 7521 7964 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_06010 7961 8260 gene locus_tag LOCUS_06020 7961 8260 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105028.1 protein_id gnl|my_center|LOCUS_06020 8601 8275 gene locus_tag LOCUS_06030 8601 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 8740 9153 gene locus_tag LOCUS_06040 gene fur 8740 9153 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 protein_id gnl|my_center|LOCUS_06040 10885 9206 gene locus_tag LOCUS_06050 gene recN 10885 9206 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_06050 11078 11593 gene locus_tag LOCUS_06060 11078 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 11811 13736 gene locus_tag LOCUS_06070 gene dnaK 11811 13736 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 protein_id gnl|my_center|LOCUS_06070 13933 15069 gene locus_tag LOCUS_06080 gene dnaJ 13933 15069 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_06080 15079 15882 gene locus_tag LOCUS_06090 gene dapB 15079 15882 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_06090 16091 17239 gene locus_tag LOCUS_06100 gene carA 16091 17239 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_06100 17311 20526 gene locus_tag LOCUS_06110 gene carB 17311 20526 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_06110 20532 21011 gene locus_tag LOCUS_06120 gene greA 20532 21011 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707083.1 protein_id gnl|my_center|LOCUS_06120 21407 21102 gene locus_tag LOCUS_06130 gene yhbY 21407 21102 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_06130 21538 22158 gene locus_tag LOCUS_06140 gene rlmE 21538 22158 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_06140 22328 24268 gene locus_tag LOCUS_06150 gene ftsH 22328 24268 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_06150 24355 25182 gene locus_tag LOCUS_06160 gene folP 24355 25182 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_06160 25179 26525 gene locus_tag LOCUS_06170 gene glmM 25179 26525 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_06170 26586 27335 gene locus_tag LOCUS_06180 gene tpiA 26586 27335 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_06180 27347 27778 gene locus_tag LOCUS_06190 gene secG 27347 27778 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_06190 27786 27870 gene locus_tag LOCUS_t00130 27786 27870 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28192 28653 gene locus_tag LOCUS_06200 gene rimP 28192 28653 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_06200 28696 30189 gene locus_tag LOCUS_06210 gene nusA 28696 30189 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_06210 30209 32767 gene locus_tag LOCUS_06220 gene infB 30209 32767 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_06220 32872 33294 gene locus_tag LOCUS_06230 gene rbfA 32872 33294 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_06230 33291 34202 gene locus_tag LOCUS_06240 gene truB 33291 34202 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 protein_id gnl|my_center|LOCUS_06240 34340 34609 gene locus_tag LOCUS_06250 gene rpsO 34340 34609 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_06250 34954 37071 gene locus_tag LOCUS_06260 gene pnp 34954 37071 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_06260 38080 37211 gene locus_tag LOCUS_06270 38080 37211 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_06270 39909 38050 gene locus_tag LOCUS_06280 39909 38050 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_06280 40444 39983 gene locus_tag LOCUS_06290 40444 39983 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_06290 40713 41501 gene locus_tag LOCUS_06300 40713 41501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 41661 42104 gene locus_tag LOCUS_06310 41661 42104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401233.1 protein_id gnl|my_center|LOCUS_06310 42958 42257 gene locus_tag LOCUS_06320 42958 42257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523163.1 protein_id gnl|my_center|LOCUS_06320 43723 42968 gene locus_tag LOCUS_06330 gene livG 43723 42968 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704139.1 protein_id gnl|my_center|LOCUS_06330 44999 43728 gene locus_tag LOCUS_06340 44999 43728 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017410832.1 protein_id gnl|my_center|LOCUS_06340 45922 44999 gene locus_tag LOCUS_06350 gene livH 45922 44999 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704141.1 protein_id gnl|my_center|LOCUS_06350 46978 46058 gene locus_tag LOCUS_06360 46978 46058 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268692.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06360 46868 47197 gene locus_tag LOCUS_06370 46868 47197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 48301 47318 gene locus_tag LOCUS_06380 48301 47318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464201.1 protein_id gnl|my_center|LOCUS_06380 48570 49160 gene locus_tag LOCUS_06390 48570 49160 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_06390 49286 50854 gene locus_tag LOCUS_06400 49286 50854 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_06400 53436 51007 gene locus_tag LOCUS_06410 gene lon 53436 51007 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_06410 53595 54458 gene locus_tag LOCUS_06420 gene trxA 53595 54458 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_06420 54644 54964 gene locus_tag LOCUS_06430 54644 54964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480013.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence047 3082 233 gene locus_tag LOCUS_06440 3082 233 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818824.1 protein_id gnl|my_center|LOCUS_06440 3601 3149 gene locus_tag LOCUS_06450 3601 3149 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_06450 5072 3591 gene locus_tag LOCUS_06460 5072 3591 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_06460 5213 6319 gene locus_tag LOCUS_06470 gene lptF 5213 6319 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_06470 6312 7373 gene locus_tag LOCUS_06480 gene lptG 6312 7373 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence048 973 524 gene locus_tag LOCUS_06490 973 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1275 970 gene locus_tag LOCUS_06500 1275 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence049 >Feature sequence050 39 788 gene locus_tag LOCUS_06510 39 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1167 1796 gene locus_tag LOCUS_06520 1167 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence051 619 1119 gene locus_tag LOCUS_06530 619 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1205 1375 gene locus_tag LOCUS_06540 1205 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1552 2094 gene locus_tag LOCUS_06550 1552 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 >Feature sequence052 483 301 gene locus_tag LOCUS_06560 483 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2738 2385 gene locus_tag LOCUS_06570 2738 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3855 3724 gene locus_tag LOCUS_06580 3855 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence053 >Feature sequence054 >Feature sequence055 470 105 gene locus_tag LOCUS_06590 470 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1172 1011 gene locus_tag LOCUS_06600 1172 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 1401 1718 gene locus_tag LOCUS_06610 1401 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence056 >Feature sequence057 188 886 gene locus_tag LOCUS_06620 gene aat 188 886 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767399.1 protein_id gnl|my_center|LOCUS_06620 972 1694 gene locus_tag LOCUS_06630 972 1694 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767401.1 protein_id gnl|my_center|LOCUS_06630 1982 2200 gene locus_tag LOCUS_06640 gene infA 1982 2200 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 protein_id gnl|my_center|LOCUS_06640 4556 2286 gene locus_tag LOCUS_06650 gene clpA 4556 2286 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_06650 4937 4575 gene locus_tag LOCUS_06660 gene clpS 4937 4575 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405085.1 protein_id gnl|my_center|LOCUS_06660 5290 5547 gene locus_tag LOCUS_06670 gene cspD 5290 5547 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080268799.1 protein_id gnl|my_center|LOCUS_06670 6889 5630 gene locus_tag LOCUS_06680 gene icd 6889 5630 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_06680 7023 7628 gene locus_tag LOCUS_06690 7023 7628 CDS product rRNA large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763288.1 protein_id gnl|my_center|LOCUS_06690 7625 8077 gene locus_tag LOCUS_06700 7625 8077 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_06700 8152 9291 gene locus_tag LOCUS_06710 gene mnmA 8152 9291 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_06710 9319 9960 gene locus_tag LOCUS_06720 gene hflD 9319 9960 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459996.1 protein_id gnl|my_center|LOCUS_06720 10016 11386 gene locus_tag LOCUS_06730 gene purB 10016 11386 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_06730 11386 12543 gene locus_tag LOCUS_06740 11386 12543 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405098.1 protein_id gnl|my_center|LOCUS_06740 12540 13511 gene locus_tag LOCUS_06750 12540 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 14510 13500 gene locus_tag LOCUS_06760 14510 13500 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_06760 14697 15464 gene locus_tag LOCUS_06770 14697 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15517 17484 gene locus_tag LOCUS_06780 15517 17484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 17948 17505 gene locus_tag LOCUS_06790 17948 17505 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 protein_id gnl|my_center|LOCUS_06790 18430 17948 gene locus_tag LOCUS_06800 18430 17948 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387781.1 protein_id gnl|my_center|LOCUS_06800 18608 19822 gene locus_tag LOCUS_06810 18608 19822 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210282.1 protein_id gnl|my_center|LOCUS_06810 19832 20302 gene locus_tag LOCUS_06820 19832 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_06820 20375 21253 gene locus_tag LOCUS_06830 gene htpX 20375 21253 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_06830 22485 21307 gene locus_tag LOCUS_06840 gene pdxB 22485 21307 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267266.1 protein_id gnl|my_center|LOCUS_06840 23885 22482 gene locus_tag LOCUS_06850 gene rhlB 23885 22482 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_06850 24477 23878 gene locus_tag LOCUS_06860 gene epmC 24477 23878 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089220.1 protein_id gnl|my_center|LOCUS_06860 24672 26468 gene locus_tag LOCUS_06870 24672 26468 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269005.1 protein_id gnl|my_center|LOCUS_06870 26465 27331 gene locus_tag LOCUS_06880 26465 27331 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_06880 27645 27361 gene locus_tag LOCUS_06890 27645 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 27738 27977 gene locus_tag LOCUS_06900 gene tusA 27738 27977 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371482.1 protein_id gnl|my_center|LOCUS_06900 29035 27971 gene locus_tag LOCUS_06910 gene rlmM 29035 27971 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103806.1 protein_id gnl|my_center|LOCUS_06910 29684 29028 gene locus_tag LOCUS_06920 29684 29028 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_06920 29913 31343 gene locus_tag LOCUS_06930 gene ccoN 29913 31343 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_06930 31361 31969 gene locus_tag LOCUS_06940 gene ccoO 31361 31969 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_06940 31975 32160 gene locus_tag LOCUS_06950 31975 32160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 32157 33056 gene locus_tag LOCUS_06960 gene ccoP 32157 33056 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268424.1 protein_id gnl|my_center|LOCUS_06960 33157 34590 gene locus_tag LOCUS_06970 gene ccoG 33157 34590 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_06970 34609 35127 gene locus_tag LOCUS_06980 34609 35127 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_06980 35250 37598 gene locus_tag LOCUS_06990 35250 37598 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268428.1 protein_id gnl|my_center|LOCUS_06990 37602 37841 gene locus_tag LOCUS_07000 gene ccoS 37602 37841 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_07000 37838 38536 gene locus_tag LOCUS_07010 37838 38536 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_07010 38746 39252 gene locus_tag LOCUS_07020 38746 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_07020 40120 39242 gene locus_tag LOCUS_07030 gene ttcA 40120 39242 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_07030 40242 40868 gene locus_tag LOCUS_07040 40242 40868 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_07040 40878 41924 gene locus_tag LOCUS_07050 40878 41924 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_07050 43091 42012 gene locus_tag LOCUS_07060 43091 42012 CDS product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113576.1 protein_id gnl|my_center|LOCUS_07060 44782 43139 gene locus_tag LOCUS_07070 44782 43139 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 protein_id gnl|my_center|LOCUS_07070 45828 44818 gene locus_tag LOCUS_07080 45828 44818 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120313.1 protein_id gnl|my_center|LOCUS_07080 46708 45908 gene locus_tag LOCUS_07090 46708 45908 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098072.1 protein_id gnl|my_center|LOCUS_07090 48090 46894 gene locus_tag LOCUS_07100 48090 46894 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 protein_id gnl|my_center|LOCUS_07100 50035 48173 gene locus_tag LOCUS_07110 50035 48173 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267217.1 protein_id gnl|my_center|LOCUS_07110 50619 50251 gene locus_tag LOCUS_07120 50619 50251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 53181 50761 gene locus_tag LOCUS_07130 gene lon 53181 50761 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_07130 54572 53397 gene locus_tag LOCUS_07140 gene clpX 54572 53397 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_07140 55523 54888 gene locus_tag LOCUS_07150 gene clpP 55523 54888 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_07150 56974 55670 gene locus_tag LOCUS_07160 gene tig 56974 55670 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 protein_id gnl|my_center|LOCUS_07160 57300 57216 gene locus_tag LOCUS_t00140 57300 57216 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 57549 57474 gene locus_tag LOCUS_t00150 57549 57474 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 57777 57701 gene locus_tag LOCUS_t00160 57777 57701 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57888 57812 gene locus_tag LOCUS_t00170 57888 57812 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 58147 58959 gene locus_tag LOCUS_07170 gene folD 58147 58959 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_07170 61389 59233 gene locus_tag LOCUS_07180 61389 59233 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_07180 62870 61482 gene locus_tag LOCUS_07190 gene cysS 62870 61482 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_07190 64549 62873 gene locus_tag LOCUS_07200 64549 62873 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_07200 64677 65186 gene locus_tag LOCUS_07210 64677 65186 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_07210 65183 65908 gene locus_tag LOCUS_07220 gene lpxH 65183 65908 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_07220 66742 65972 gene locus_tag LOCUS_07230 66742 65972 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388288.1 protein_id gnl|my_center|LOCUS_07230 66862 67749 gene locus_tag LOCUS_07240 66862 67749 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_07240 68383 67766 gene locus_tag LOCUS_07250 gene miaE 68383 67766 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_07250 68716 71286 gene locus_tag LOCUS_07260 gene acnB 68716 71286 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480203.1 protein_id gnl|my_center|LOCUS_07260 72852 71380 gene locus_tag LOCUS_07270 gene putP 72852 71380 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence058 2071 1025 gene locus_tag LOCUS_07280 2071 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 2414 2028 gene locus_tag LOCUS_07290 2414 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07290 >Feature sequence059 363 1370 gene locus_tag LOCUS_07300 363 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1388 1669 gene locus_tag LOCUS_07310 1388 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1662 2300 gene locus_tag LOCUS_07320 1662 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2586 2383 gene locus_tag LOCUS_07330 2586 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3523 2561 gene locus_tag LOCUS_07340 3523 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4590 3775 gene locus_tag LOCUS_07350 4590 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07350 5027 4635 gene locus_tag LOCUS_07360 5027 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 <5895 5206 gene locus_tag LOCUS_07370 <5895 5206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211985.1:UDP-N-acetyl-D-mannosamine dehydrogenase >Feature sequence060 <1 562 gene locus_tag LOCUS_07380 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187436542.1:IS256 family transposase <1972 1427 gene locus_tag LOCUS_07390 <1972 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222411.1:IS30-like element IS1655 family transposase >Feature sequence061 585 1082 gene locus_tag LOCUS_07400 585 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07400 >Feature sequence062 723 2570 gene locus_tag LOCUS_07410 723 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2609 3031 gene locus_tag LOCUS_07420 2609 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07420 3227 3790 gene locus_tag LOCUS_07430 3227 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 >Feature sequence063 572 1057 gene locus_tag LOCUS_07440 572 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1259 1549 gene locus_tag LOCUS_07450 1259 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence064 60 272 gene locus_tag LOCUS_07460 60 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence065 >Feature sequence066 >Feature sequence067 73 432 gene locus_tag LOCUS_07470 73 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 441 1523 gene locus_tag LOCUS_07480 441 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence068 1094 471 gene locus_tag LOCUS_07490 1094 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3229 1169 gene locus_tag LOCUS_07500 3229 1169 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_07500 3369 4400 gene locus_tag LOCUS_07510 3369 4400 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_07510 4872 4796 gene locus_tag LOCUS_t00180 4872 4796 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6203 5166 gene locus_tag LOCUS_07520 6203 5166 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066032.1 protein_id gnl|my_center|LOCUS_07520 6528 7433 gene locus_tag LOCUS_07530 6528 7433 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_07530 9265 7709 gene locus_tag LOCUS_07540 9265 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9971 9345 gene locus_tag LOCUS_07550 gene fixJ 9971 9345 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_07550 10067 10654 gene locus_tag LOCUS_07560 10067 10654 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_07560 13042 10664 gene locus_tag LOCUS_07570 13042 10664 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478132.1 protein_id gnl|my_center|LOCUS_07570 13718 13374 gene locus_tag LOCUS_07580 13718 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 13837 14208 gene locus_tag LOCUS_07590 13837 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15050 14583 gene locus_tag LOCUS_07600 15050 14583 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222817.1 protein_id gnl|my_center|LOCUS_07600 16112 15054 gene locus_tag LOCUS_07610 gene recA 16112 15054 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_07610 16713 16219 gene locus_tag LOCUS_07620 gene pncC 16713 16219 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_07620 16866 19457 gene locus_tag LOCUS_07630 gene mutS 16866 19457 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_07630 19718 20041 gene locus_tag LOCUS_07640 19718 20041 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736188.1 protein_id gnl|my_center|LOCUS_07640 21145 20114 gene locus_tag LOCUS_07650 21145 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 22222 21272 gene locus_tag LOCUS_07660 22222 21272 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038480.1 protein_id gnl|my_center|LOCUS_07660 23199 22351 gene locus_tag LOCUS_07670 23199 22351 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_07670 23391 24572 gene locus_tag LOCUS_07680 23391 24572 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_07680 24707 27325 gene locus_tag LOCUS_07690 24707 27325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 27520 28266 gene locus_tag LOCUS_07700 27520 28266 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_07700 28375 29655 gene locus_tag LOCUS_07710 28375 29655 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_07710 30760 29693 gene locus_tag LOCUS_07720 30760 29693 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_07720 30955 30767 gene locus_tag LOCUS_07730 30955 30767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 30902 31483 gene locus_tag LOCUS_07740 30902 31483 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337380.1 protein_id gnl|my_center|LOCUS_07740 31487 32254 gene locus_tag LOCUS_07750 gene djlA 31487 32254 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_07750 32380 33831 gene locus_tag LOCUS_07760 32380 33831 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087162.1 protein_id gnl|my_center|LOCUS_07760 35706 33832 gene locus_tag LOCUS_07770 35706 33832 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_07770 35801 36388 gene locus_tag LOCUS_07780 35801 36388 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_07780 36453 38345 gene locus_tag LOCUS_07790 36453 38345 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464433.1 protein_id gnl|my_center|LOCUS_07790 38376 39113 gene locus_tag LOCUS_07800 38376 39113 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 protein_id gnl|my_center|LOCUS_07800 39180 40169 gene locus_tag LOCUS_07810 39180 40169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 41378 40251 gene locus_tag LOCUS_07820 41378 40251 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804110.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence069 541 714 gene locus_tag LOCUS_07830 541 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 716 1198 gene locus_tag LOCUS_07840 716 1198 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268606.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07840 >Feature sequence070 <1 1235 gene locus_tag LOCUS_07850 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768493.1:lipopolysaccharide biosynthesis protein 1219 1362 gene locus_tag LOCUS_07860 1219 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence071 1591 8 gene locus_tag LOCUS_07870 1591 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2568 1681 gene locus_tag LOCUS_07880 2568 1681 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_07880 3469 3263 gene locus_tag LOCUS_07890 3469 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence072 123 425 gene locus_tag LOCUS_07900 123 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 533 1054 gene locus_tag LOCUS_07910 533 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1055 1255 gene locus_tag LOCUS_07920 1055 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence073 467 90 gene locus_tag LOCUS_07930 467 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 742 464 gene locus_tag LOCUS_07940 742 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence074 493 612 gene locus_tag LOCUS_07950 493 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence075 1106 210 gene locus_tag LOCUS_07960 1106 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1533 1090 gene locus_tag LOCUS_07970 1533 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence076 223 540 gene locus_tag LOCUS_07980 223 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 544 1464 gene locus_tag LOCUS_07990 gene cas1e 544 1464 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118669.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence077 889 656 gene locus_tag LOCUS_08000 889 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2313 1744 gene locus_tag LOCUS_08010 2313 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence078 344 120 gene locus_tag LOCUS_08020 344 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 533 390 gene locus_tag LOCUS_08030 533 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 1118 810 gene locus_tag LOCUS_08040 1118 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08040 >Feature sequence079 156 231 gene locus_tag LOCUS_t00190 156 231 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1147 422 gene locus_tag LOCUS_08050 gene pyrF 1147 422 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420156.1 protein_id gnl|my_center|LOCUS_08050 2349 1180 gene locus_tag LOCUS_08060 gene lapB 2349 1180 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_08060 2651 2349 gene locus_tag LOCUS_08070 2651 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 3069 2773 gene locus_tag LOCUS_08080 gene ihfB 3069 2773 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_08080 4896 3208 gene locus_tag LOCUS_08090 gene rpsA 4896 3208 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_08090 5708 5025 gene locus_tag LOCUS_08100 gene cmk 5708 5025 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554563.1 protein_id gnl|my_center|LOCUS_08100 7945 5705 gene locus_tag LOCUS_08110 7945 5705 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_08110 9057 7942 gene locus_tag LOCUS_08120 gene hisC 9057 7942 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08120 10194 9097 gene locus_tag LOCUS_08130 gene pheA 10194 9097 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_08130 11279 10197 gene locus_tag LOCUS_08140 gene serC 11279 10197 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_08140 13880 11313 gene locus_tag LOCUS_08150 gene gyrA 13880 11313 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281282.1 protein_id gnl|my_center|LOCUS_08150 14860 14006 gene locus_tag LOCUS_08160 gene purU 14860 14006 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363851.1 protein_id gnl|my_center|LOCUS_08160 15860 15036 gene locus_tag LOCUS_08170 15860 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 17851 15965 gene locus_tag LOCUS_08180 17851 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 19074 18061 gene locus_tag LOCUS_08190 19074 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 19736 19326 gene locus_tag LOCUS_08200 gene arfB 19736 19326 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_08200 20251 19736 gene locus_tag LOCUS_08210 20251 19736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_08210 20339 22018 gene locus_tag LOCUS_08220 20339 22018 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_08220 22915 22049 gene locus_tag LOCUS_08230 22915 22049 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_08230 23024 23959 gene locus_tag LOCUS_08240 23024 23959 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173631.1 protein_id gnl|my_center|LOCUS_08240 24962 23982 gene locus_tag LOCUS_08250 gene lpxO 24962 23982 CDS product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035636.1 protein_id gnl|my_center|LOCUS_08250 25392 25096 gene locus_tag LOCUS_08260 25392 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 26333 25446 gene locus_tag LOCUS_08270 26333 25446 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 protein_id gnl|my_center|LOCUS_08270 28609 26516 gene locus_tag LOCUS_08280 gene foxA 28609 26516 CDS product ferrioxamine B receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127727.1 protein_id gnl|my_center|LOCUS_08280 29716 28727 gene locus_tag LOCUS_08290 gene foxR 29716 28727 CDS product ferrioxamine uptake transcriptional regulator FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074609.1 protein_id gnl|my_center|LOCUS_08290 29995 31425 gene locus_tag LOCUS_08300 29995 31425 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_08300 31409 32617 gene locus_tag LOCUS_08310 31409 32617 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_08310 32614 35763 gene locus_tag LOCUS_08320 32614 35763 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_08320 36557 35811 gene locus_tag LOCUS_08330 36557 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 39011 36837 gene locus_tag LOCUS_08340 gene katG 39011 36837 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481286.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence080 375 79 gene locus_tag LOCUS_08350 375 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 596 372 gene locus_tag LOCUS_08360 596 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1264 764 gene locus_tag LOCUS_08370 1264 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence081 935 621 gene locus_tag LOCUS_08380 935 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1239 1072 gene locus_tag LOCUS_08390 1239 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence082 >Feature sequence083 1023 1376 gene locus_tag LOCUS_08400 1023 1376 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_08400 1376 2377 gene locus_tag LOCUS_08410 1376 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence084 >Feature sequence085 154 378 gene locus_tag LOCUS_08420 154 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 375 587 gene locus_tag LOCUS_08430 375 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 577 813 gene locus_tag LOCUS_08440 577 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence086 327 536 gene locus_tag LOCUS_08450 327 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 698 955 gene locus_tag LOCUS_08460 698 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 966 1436 gene locus_tag LOCUS_08470 966 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence087 835 536 gene locus_tag LOCUS_08480 835 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 >Feature sequence088 683 447 gene locus_tag LOCUS_08490 683 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 888 655 gene locus_tag LOCUS_08500 888 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 1577 885 gene locus_tag LOCUS_08510 1577 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 1959 1615 gene locus_tag LOCUS_08520 1959 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08520 >Feature sequence089 1902 610 gene locus_tag LOCUS_08530 1902 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08530 >Feature sequence090 1659 241 gene locus_tag LOCUS_08540 1659 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2039 4270 gene locus_tag LOCUS_08550 2039 4270 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_08550 4933 4559 gene locus_tag LOCUS_08560 4933 4559 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420339.1 protein_id gnl|my_center|LOCUS_08560 4977 5522 gene locus_tag LOCUS_08570 4977 5522 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838224.1 protein_id gnl|my_center|LOCUS_08570 5563 6009 gene locus_tag LOCUS_08580 5563 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7767 6211 gene locus_tag LOCUS_08590 7767 6211 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_08590 9341 7764 gene locus_tag LOCUS_08600 9341 7764 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_08600 10951 9338 gene locus_tag LOCUS_08610 10951 9338 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_08610 11093 11521 gene locus_tag LOCUS_08620 11093 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13058 11730 gene locus_tag LOCUS_08630 13058 11730 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477179.1 protein_id gnl|my_center|LOCUS_08630 14469 13315 gene locus_tag LOCUS_08640 14469 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence091 32 1069 gene locus_tag LOCUS_08650 gene cas7e 32 1069 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_08650 1080 1802 gene locus_tag LOCUS_08660 gene cas5e 1080 1802 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence092 >Feature sequence093 427 140 gene locus_tag LOCUS_08670 427 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08670 878 408 gene locus_tag LOCUS_08680 878 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08680 >Feature sequence094 582 91 gene locus_tag LOCUS_08690 582 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 <1533 557 gene locus_tag LOCUS_08700 <1533 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256572.1:XRE family transcriptional regulator >Feature sequence095 400 26 gene locus_tag LOCUS_08710 400 26 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_08710 1277 465 gene locus_tag LOCUS_08720 1277 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence096 523 95 gene locus_tag LOCUS_08730 523 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1295 597 gene locus_tag LOCUS_08740 1295 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence097 1022 600 gene locus_tag LOCUS_08750 1022 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1516 1091 gene locus_tag LOCUS_08760 1516 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1806 1537 gene locus_tag LOCUS_08770 1806 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2126 1839 gene locus_tag LOCUS_08780 2126 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence098 248 952 gene locus_tag LOCUS_08790 248 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 946 1299 gene locus_tag LOCUS_08800 946 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence099 461 1030 gene locus_tag LOCUS_08810 461 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence100 473 276 gene locus_tag LOCUS_08820 473 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 684 433 gene locus_tag LOCUS_08830 684 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 964 638 gene locus_tag LOCUS_08840 964 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence101 263 508 gene locus_tag LOCUS_08850 263 508 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408502.1 protein_id gnl|my_center|LOCUS_08850 869 1114 gene locus_tag LOCUS_08860 869 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1108 1485 gene locus_tag LOCUS_08870 1108 1485 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_08870 1591 2367 gene locus_tag LOCUS_08880 gene yaaA 1591 2367 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_08880 2380 2583 gene locus_tag LOCUS_08890 2380 2583 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689742.1 protein_id gnl|my_center|LOCUS_08890 2855 3784 gene locus_tag LOCUS_08900 gene rdgC 2855 3784 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_08900 6733 4001 gene locus_tag LOCUS_08910 6733 4001 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016415173.1 protein_id gnl|my_center|LOCUS_08910 7054 7980 gene locus_tag LOCUS_08920 7054 7980 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence102 431 607 gene locus_tag LOCUS_08930 431 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence103 1785 865 gene locus_tag LOCUS_08940 1785 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence104 >Feature sequence105 >Feature sequence106 144 1310 gene locus_tag LOCUS_08950 144 1310 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence107 171 479 gene locus_tag LOCUS_08960 171 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence108 446 778 gene locus_tag LOCUS_08970 446 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 862 1008 gene locus_tag LOCUS_08980 862 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence109 >Feature sequence110 1356 148 gene locus_tag LOCUS_08990 gene tyrS 1356 148 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113167.1 protein_id gnl|my_center|LOCUS_08990 1673 3139 gene locus_tag LOCUS_09000 1673 3139 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_09000 3129 4229 gene locus_tag LOCUS_09010 3129 4229 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_09010 4603 4250 gene locus_tag LOCUS_09020 gene erpA 4603 4250 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 protein_id gnl|my_center|LOCUS_09020 5127 4672 gene locus_tag LOCUS_09030 5127 4672 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_09030 5870 5133 gene locus_tag LOCUS_09040 5870 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6923 5883 gene locus_tag LOCUS_09050 gene argC 6923 5883 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_09050 7065 8852 gene locus_tag LOCUS_09060 7065 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8857 9279 gene locus_tag LOCUS_09070 gene hemJ 8857 9279 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316309.1 protein_id gnl|my_center|LOCUS_09070 9293 10075 gene locus_tag LOCUS_09080 9293 10075 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_09080 10081 10713 gene locus_tag LOCUS_09090 gene thiE 10081 10713 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_09090 10713 11999 gene locus_tag LOCUS_09100 gene hemL 10713 11999 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_09100 12676 12155 gene locus_tag LOCUS_09110 12676 12155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 14976 12676 gene locus_tag LOCUS_09120 gene mrcB 14976 12676 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_09120 15048 16646 gene locus_tag LOCUS_09130 15048 16646 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_09130 16674 17027 gene locus_tag LOCUS_09140 16674 17027 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246096.1 protein_id gnl|my_center|LOCUS_09140 17725 17009 gene locus_tag LOCUS_09150 gene sfsA 17725 17009 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_09150 18003 18443 gene locus_tag LOCUS_09160 gene dksA 18003 18443 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_09160 18504 19403 gene locus_tag LOCUS_09170 gene gluQRS 18504 19403 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_09170 19467 19643 gene locus_tag LOCUS_09180 19467 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_09180 19633 22575 gene locus_tag LOCUS_09190 gene cbrA 19633 22575 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_09190 22593 24008 gene locus_tag LOCUS_09200 gene cbrB 22593 24008 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_09200 26703 24691 gene locus_tag LOCUS_09210 gene fhuB 26703 24691 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 protein_id gnl|my_center|LOCUS_09210 27622 26696 gene locus_tag LOCUS_09220 27622 26696 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707922.1 protein_id gnl|my_center|LOCUS_09220 27866 27627 gene locus_tag LOCUS_09230 27866 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 28492 27854 gene locus_tag LOCUS_09240 28492 27854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 28553 29905 gene locus_tag LOCUS_09250 28553 29905 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_09250 29902 30405 gene locus_tag LOCUS_09260 gene folK 29902 30405 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_09260 30444 31238 gene locus_tag LOCUS_09270 gene panB 30444 31238 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805455.1 protein_id gnl|my_center|LOCUS_09270 31235 32083 gene locus_tag LOCUS_09280 gene panC 31235 32083 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_09280 32096 33751 gene locus_tag LOCUS_09290 gene pgi 32096 33751 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073376.1 protein_id gnl|my_center|LOCUS_09290 34370 33813 gene locus_tag LOCUS_09300 gene folK 34370 33813 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_09300 34726 34367 gene locus_tag LOCUS_09310 gene folB 34726 34367 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099587.1 protein_id gnl|my_center|LOCUS_09310 35796 34768 gene locus_tag LOCUS_09320 gene tsaD 35796 34768 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 protein_id gnl|my_center|LOCUS_09320 36283 35954 gene locus_tag LOCUS_09330 36283 35954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 37261 36395 gene locus_tag LOCUS_09340 gene nhaR 37261 36395 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_09340 37489 37704 gene locus_tag LOCUS_09350 gene rpsU 37489 37704 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_09350 37821 38612 gene locus_tag LOCUS_09360 37821 38612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 38603 39529 gene locus_tag LOCUS_09370 38603 39529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 39704 41533 gene locus_tag LOCUS_09380 gene rpoD 39704 41533 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_09380 41600 41676 gene locus_tag LOCUS_t00200 41600 41676 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41843 43072 gene locus_tag LOCUS_09390 41843 43072 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_09390 43083 43343 gene locus_tag LOCUS_09400 43083 43343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 43333 43611 gene locus_tag LOCUS_09410 43333 43611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 43709 44725 gene locus_tag LOCUS_09420 43709 44725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 44866 45078 gene locus_tag LOCUS_09430 44866 45078 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019830047.1 protein_id gnl|my_center|LOCUS_09430 45075 46043 gene locus_tag LOCUS_09440 45075 46043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 46043 47596 gene locus_tag LOCUS_09450 46043 47596 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481742.1 protein_id gnl|my_center|LOCUS_09450 47586 48212 gene locus_tag LOCUS_09460 47586 48212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 48666 49166 gene locus_tag LOCUS_09470 48666 49166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 49675 49265 gene locus_tag LOCUS_09480 49675 49265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 50542 49976 gene locus_tag LOCUS_09490 50542 49976 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_09490 51001 50549 gene locus_tag LOCUS_09500 51001 50549 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228480.1 protein_id gnl|my_center|LOCUS_09500 54368 51174 gene locus_tag LOCUS_09510 54368 51174 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704238.1 protein_id gnl|my_center|LOCUS_09510 55811 54441 gene locus_tag LOCUS_09520 55811 54441 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_09520 58365 56389 gene locus_tag LOCUS_09530 58365 56389 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence111 1497 133 gene locus_tag LOCUS_09540 1497 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1964 1794 gene locus_tag LOCUS_09550 1964 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2080 4740 gene locus_tag LOCUS_09560 gene aceE 2080 4740 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_09560 4751 6406 gene locus_tag LOCUS_09570 gene aceF 4751 6406 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_09570 8068 6896 gene locus_tag LOCUS_09580 gene dcaP 8068 6896 CDS product outer membrane trimeric porin-like protein DcaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733488.1 protein_id gnl|my_center|LOCUS_09580 8267 9736 gene locus_tag LOCUS_09590 8267 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 9805 10368 gene locus_tag LOCUS_09600 9805 10368 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267085.1 protein_id gnl|my_center|LOCUS_09600 10392 11009 gene locus_tag LOCUS_09610 10392 11009 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123659.1 protein_id gnl|my_center|LOCUS_09610 11120 12331 gene locus_tag LOCUS_09620 gene aruC 11120 12331 CDS product bifunctional succinylornithine transaminase/acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112608.1 protein_id gnl|my_center|LOCUS_09620 12337 13401 gene locus_tag LOCUS_09630 gene astA 12337 13401 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212031.1 protein_id gnl|my_center|LOCUS_09630 13398 14876 gene locus_tag LOCUS_09640 gene astD 13398 14876 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193383.1 protein_id gnl|my_center|LOCUS_09640 14893 16236 gene locus_tag LOCUS_09650 gene astB 14893 16236 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085956.1 protein_id gnl|my_center|LOCUS_09650 17092 16451 gene locus_tag LOCUS_09660 17092 16451 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840010.1 protein_id gnl|my_center|LOCUS_09660 16994 17182 gene locus_tag LOCUS_09670 16994 17182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 17229 18287 gene locus_tag LOCUS_09680 17229 18287 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268241.1 protein_id gnl|my_center|LOCUS_09680 18284 21298 gene locus_tag LOCUS_09690 18284 21298 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_09690 21443 22537 gene locus_tag LOCUS_09700 21443 22537 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 protein_id gnl|my_center|LOCUS_09700 23770 22763 gene locus_tag LOCUS_09710 gene astE 23770 22763 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112605.1 protein_id gnl|my_center|LOCUS_09710 24497 23775 gene locus_tag LOCUS_09720 24497 23775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 protein_id gnl|my_center|LOCUS_09720 25205 24501 gene locus_tag LOCUS_09730 25205 24501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705576.1 protein_id gnl|my_center|LOCUS_09730 26015 25263 gene locus_tag LOCUS_09740 26015 25263 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 protein_id gnl|my_center|LOCUS_09740 26958 26167 gene locus_tag LOCUS_09750 26958 26167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 protein_id gnl|my_center|LOCUS_09750 27325 27513 gene locus_tag LOCUS_09760 27325 27513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 27995 27522 gene locus_tag LOCUS_09770 27995 27522 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_09770 28152 29363 gene locus_tag LOCUS_09780 28152 29363 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940937.1 protein_id gnl|my_center|LOCUS_09780 29323 29529 gene locus_tag LOCUS_09790 29323 29529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 29598 30134 gene locus_tag LOCUS_09800 29598 30134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 30152 30955 gene locus_tag LOCUS_09810 30152 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 31131 31346 gene locus_tag LOCUS_09820 31131 31346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 31990 31445 gene locus_tag LOCUS_09830 31990 31445 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_09830 32203 32589 gene locus_tag LOCUS_09840 32203 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 33085 32843 gene locus_tag LOCUS_09850 33085 32843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 33358 33897 gene locus_tag LOCUS_09860 33358 33897 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_09860 33930 34340 gene locus_tag LOCUS_09870 33930 34340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 35005 36363 gene locus_tag LOCUS_09880 35005 36363 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 protein_id gnl|my_center|LOCUS_09880 36473 37525 gene locus_tag LOCUS_09890 36473 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 38066 38218 gene locus_tag LOCUS_09900 38066 38218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 38211 40493 gene locus_tag LOCUS_09910 38211 40493 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263389.1 protein_id gnl|my_center|LOCUS_09910 40608 40778 gene locus_tag LOCUS_09920 40608 40778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 41287 41487 gene locus_tag LOCUS_09930 41287 41487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 43185 43610 gene locus_tag LOCUS_09940 43185 43610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 44401 43670 gene locus_tag LOCUS_09950 44401 43670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 46392 44398 gene locus_tag LOCUS_09960 gene pglZ 46392 44398 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_09960 49217 46389 gene locus_tag LOCUS_09970 49217 46389 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_09970 50985 49210 gene locus_tag LOCUS_09980 50985 49210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 53784 51004 gene locus_tag LOCUS_09990 53784 51004 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280509.1 protein_id gnl|my_center|LOCUS_09990 57559 53834 gene locus_tag LOCUS_10000 57559 53834 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_10000 58038 57571 gene locus_tag LOCUS_10010 gene brxF 58038 57571 CDS product BREX-3 system P-loop-containing protein BrxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870233.1 protein_id gnl|my_center|LOCUS_10010 58955 58047 gene locus_tag LOCUS_10020 58955 58047 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_10020 59911 60939 gene locus_tag LOCUS_10030 59911 60939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 60929 61279 gene locus_tag LOCUS_10040 60929 61279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 61330 61602 gene locus_tag LOCUS_10050 61330 61602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 61888 61673 gene locus_tag LOCUS_10060 61888 61673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 62156 61902 gene locus_tag LOCUS_10070 62156 61902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 62561 62887 gene locus_tag LOCUS_10080 62561 62887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 63377 63302 gene locus_tag LOCUS_t00210 63377 63302 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 63981 63700 gene locus_tag LOCUS_10090 63981 63700 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096100.1 protein_id gnl|my_center|LOCUS_10090 65333 64254 gene locus_tag LOCUS_10100 gene mutY 65333 64254 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269294.1 protein_id gnl|my_center|LOCUS_10100 67516 65336 gene locus_tag LOCUS_10110 67516 65336 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_10110 67779 68240 gene locus_tag LOCUS_10120 67779 68240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 68325 68918 gene locus_tag LOCUS_10130 gene hisB 68325 68918 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_10130 68980 69624 gene locus_tag LOCUS_10140 gene hisH 68980 69624 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767120.1 protein_id gnl|my_center|LOCUS_10140 69650 70393 gene locus_tag LOCUS_10150 gene hisA 69650 70393 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_10150 70390 71163 gene locus_tag LOCUS_10160 gene hisF 70390 71163 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551458.1 protein_id gnl|my_center|LOCUS_10160 72221 71382 gene locus_tag LOCUS_10170 72221 71382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 73639 72218 gene locus_tag LOCUS_10180 gene cptA 73639 72218 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_10180 74937 73780 gene locus_tag LOCUS_10190 74937 73780 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_10190 76502 74955 gene locus_tag LOCUS_10200 gene gpmM 76502 74955 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703792.1 protein_id gnl|my_center|LOCUS_10200 76653 77072 gene locus_tag LOCUS_10210 76653 77072 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_10210 77207 77704 gene locus_tag LOCUS_10220 gene secB 77207 77704 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621582.1 protein_id gnl|my_center|LOCUS_10220 78313 77849 gene locus_tag LOCUS_10230 gene trmL 78313 77849 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932342.1 protein_id gnl|my_center|LOCUS_10230 79491 78313 gene locus_tag LOCUS_10240 79491 78313 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_10240 80681 79557 gene locus_tag LOCUS_10250 80681 79557 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_10250 83434 80750 gene locus_tag LOCUS_10260 83434 80750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 84753 83500 gene locus_tag LOCUS_10270 84753 83500 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976357.1 protein_id gnl|my_center|LOCUS_10270 85006 84794 gene locus_tag LOCUS_10280 85006 84794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 85237 85770 gene locus_tag LOCUS_10290 85237 85770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 85774 86964 gene locus_tag LOCUS_10300 85774 86964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 87663 87202 gene locus_tag LOCUS_10310 87663 87202 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_10310 88205 87663 gene locus_tag LOCUS_10320 gene sufT 88205 87663 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_10320 88570 88214 gene locus_tag LOCUS_10330 gene sufA 88570 88214 CDS product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096957.1 protein_id gnl|my_center|LOCUS_10330 89831 88584 gene locus_tag LOCUS_10340 89831 88584 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707892.1 protein_id gnl|my_center|LOCUS_10340 91123 89837 gene locus_tag LOCUS_10350 gene sufD 91123 89837 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_10350 91903 91136 gene locus_tag LOCUS_10360 gene sufC 91903 91136 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384245.1 protein_id gnl|my_center|LOCUS_10360 93413 91968 gene locus_tag LOCUS_10370 gene sufB 93413 91968 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_10370 94147 93704 gene locus_tag LOCUS_10380 94147 93704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 94270 95190 gene locus_tag LOCUS_10390 94270 95190 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886296.1 protein_id gnl|my_center|LOCUS_10390 95335 96201 gene locus_tag LOCUS_10400 95335 96201 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_10400 96214 96633 gene locus_tag LOCUS_10410 96214 96633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 96716 98008 gene locus_tag LOCUS_10420 96716 98008 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266171.1 protein_id gnl|my_center|LOCUS_10420 98005 99774 gene locus_tag LOCUS_10430 98005 99774 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_10430 99857 100315 gene locus_tag LOCUS_10440 99857 100315 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818374.1 protein_id gnl|my_center|LOCUS_10440 100312 100722 gene locus_tag LOCUS_10450 100312 100722 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_10450 102239 100725 gene locus_tag LOCUS_10460 102239 100725 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_10460 102487 104166 gene locus_tag LOCUS_10470 102487 104166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 104260 105537 gene locus_tag LOCUS_10480 104260 105537 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_10480 107489 105582 gene locus_tag LOCUS_10490 gene pqqU 107489 105582 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_10490 107445 107666 gene locus_tag LOCUS_10500 107445 107666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 109195 107663 gene locus_tag LOCUS_10510 109195 107663 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267236.1 protein_id gnl|my_center|LOCUS_10510 110240 109248 gene locus_tag LOCUS_10520 gene moaA 110240 109248 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 protein_id gnl|my_center|LOCUS_10520 111432 110359 gene locus_tag LOCUS_10530 111432 110359 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_10530 112589 111486 gene locus_tag LOCUS_10540 112589 111486 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223975.1 protein_id gnl|my_center|LOCUS_10540 112849 113499 gene locus_tag LOCUS_10550 gene fabR 112849 113499 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368907.1 protein_id gnl|my_center|LOCUS_10550 114984 113584 gene locus_tag LOCUS_10560 114984 113584 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_10560 115920 115177 gene locus_tag LOCUS_10570 115920 115177 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10570 116111 115809 gene locus_tag LOCUS_10580 116111 115809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10580 116287 117399 gene locus_tag LOCUS_10590 116287 117399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 117989 117372 gene locus_tag LOCUS_10600 117989 117372 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768608.1 protein_id gnl|my_center|LOCUS_10600 118091 118960 gene locus_tag LOCUS_10610 118091 118960 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120877.1 protein_id gnl|my_center|LOCUS_10610 120903 118963 gene locus_tag LOCUS_10620 120903 118963 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_10620 121005 121964 gene locus_tag LOCUS_10630 gene ilvA 121005 121964 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259722.1 protein_id gnl|my_center|LOCUS_10630 122192 121998 gene locus_tag LOCUS_10640 122192 121998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 122191 123267 gene locus_tag LOCUS_10650 122191 123267 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528679.1 protein_id gnl|my_center|LOCUS_10650 124091 123321 gene locus_tag LOCUS_10660 124091 123321 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 protein_id gnl|my_center|LOCUS_10660 125713 124175 gene locus_tag LOCUS_10670 125713 124175 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_10670 127008 125710 gene locus_tag LOCUS_10680 127008 125710 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269137.1 protein_id gnl|my_center|LOCUS_10680 128997 127075 gene locus_tag LOCUS_10690 128997 127075 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_10690 129888 129226 gene locus_tag LOCUS_10700 129888 129226 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_10700 129906 130127 gene locus_tag LOCUS_10710 129906 130127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 130144 131673 gene locus_tag LOCUS_10720 130144 131673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 131735 132484 gene locus_tag LOCUS_10730 131735 132484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 132704 133657 gene locus_tag LOCUS_10740 132704 133657 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_10740 133707 134264 gene locus_tag LOCUS_10750 133707 134264 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522352.1 protein_id gnl|my_center|LOCUS_10750 134317 135654 gene locus_tag LOCUS_10760 134317 135654 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_10760 136630 135656 gene locus_tag LOCUS_10770 136630 135656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 138063 136834 gene locus_tag LOCUS_10780 138063 136834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 protein_id gnl|my_center|LOCUS_10780 141432 138256 gene locus_tag LOCUS_10790 141432 138256 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_10790 142697 141429 gene locus_tag LOCUS_10800 142697 141429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 143486 142746 gene locus_tag LOCUS_10810 143486 142746 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_10810 144841 143492 gene locus_tag LOCUS_10820 144841 143492 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_10820 145040 145531 gene locus_tag LOCUS_10830 145040 145531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 146291 145545 gene locus_tag LOCUS_10840 146291 145545 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976231.1 protein_id gnl|my_center|LOCUS_10840 146975 146304 gene locus_tag LOCUS_10850 146975 146304 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937417.1 protein_id gnl|my_center|LOCUS_10850 147824 147060 gene locus_tag LOCUS_10860 gene glnH 147824 147060 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937418.1 protein_id gnl|my_center|LOCUS_10860 148242 149096 gene locus_tag LOCUS_10870 148242 149096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 149112 150761 gene locus_tag LOCUS_10880 149112 150761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence112 205 390 gene locus_tag LOCUS_10890 205 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1754 357 gene locus_tag LOCUS_10900 1754 357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_10900 1985 2956 gene locus_tag LOCUS_10910 1985 2956 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_10910 3252 4292 gene locus_tag LOCUS_10920 3252 4292 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_10920 5416 4280 gene locus_tag LOCUS_10930 5416 4280 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_10930 5592 6620 gene locus_tag LOCUS_10940 5592 6620 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_10940 7441 6608 gene locus_tag LOCUS_10950 7441 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9065 7761 gene locus_tag LOCUS_10960 gene rmuC 9065 7761 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_10960 9682 10032 gene locus_tag LOCUS_10970 9682 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 10146 11003 gene locus_tag LOCUS_10980 10146 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 11000 12514 gene locus_tag LOCUS_10990 11000 12514 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_10990 12511 13503 gene locus_tag LOCUS_11000 12511 13503 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_11000 15145 13553 gene locus_tag LOCUS_11010 15145 13553 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 protein_id gnl|my_center|LOCUS_11010 15471 17120 gene locus_tag LOCUS_11020 15471 17120 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064121.1 protein_id gnl|my_center|LOCUS_11020 18043 17222 gene locus_tag LOCUS_11030 18043 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 19050 18190 gene locus_tag LOCUS_11040 19050 18190 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_11040 19255 19331 gene locus_tag LOCUS_t00220 19255 19331 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20529 19366 gene locus_tag LOCUS_11050 20529 19366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 21251 20706 gene locus_tag LOCUS_11060 21251 20706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 21530 22504 gene locus_tag LOCUS_11070 21530 22504 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_11070 22586 24760 gene locus_tag LOCUS_11080 22586 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 24823 26628 gene locus_tag LOCUS_11090 24823 26628 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_11090 26625 27977 gene locus_tag LOCUS_11100 26625 27977 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 protein_id gnl|my_center|LOCUS_11100 28093 28512 gene locus_tag LOCUS_11110 28093 28512 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088599.1 protein_id gnl|my_center|LOCUS_11110 30172 28592 gene locus_tag LOCUS_11120 30172 28592 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224279.1 protein_id gnl|my_center|LOCUS_11120 30814 30449 gene locus_tag LOCUS_11130 30814 30449 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_11130 31097 30795 gene locus_tag LOCUS_11140 gene ihfA 31097 30795 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_11140 33474 31102 gene locus_tag LOCUS_11150 gene pheT 33474 31102 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_11150 34521 33523 gene locus_tag LOCUS_11160 gene pheS 34521 33523 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_11160 35008 34655 gene locus_tag LOCUS_11170 gene rplT 35008 34655 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_11170 35228 35037 gene locus_tag LOCUS_11180 gene rpmI 35228 35037 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090673.1 protein_id gnl|my_center|LOCUS_11180 35769 35341 gene locus_tag LOCUS_11190 gene infC 35769 35341 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846037.1 protein_id gnl|my_center|LOCUS_11190 37808 35883 gene locus_tag LOCUS_11200 gene thrS 37808 35883 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 protein_id gnl|my_center|LOCUS_11200 40521 37930 gene locus_tag LOCUS_11210 40521 37930 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261091.1 protein_id gnl|my_center|LOCUS_11210 41603 40623 gene locus_tag LOCUS_11220 41603 40623 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_11220 44217 41824 gene locus_tag LOCUS_11230 44217 41824 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_11230 45317 44265 gene locus_tag LOCUS_11240 45317 44265 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_11240 45213 45479 gene locus_tag LOCUS_11250 45213 45479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 46965 45571 gene locus_tag LOCUS_11260 46965 45571 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_11260 49792 47147 gene locus_tag LOCUS_11270 gene pepN 49792 47147 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_11270 50744 49863 gene locus_tag LOCUS_11280 50744 49863 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_11280 51013 50759 gene locus_tag LOCUS_11290 51013 50759 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118245.1 protein_id gnl|my_center|LOCUS_11290 51281 51039 gene locus_tag LOCUS_11300 51281 51039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 52246 51386 gene locus_tag LOCUS_11310 52246 51386 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_11310 53242 52250 gene locus_tag LOCUS_11320 53242 52250 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104727.1 protein_id gnl|my_center|LOCUS_11320 54129 53245 gene locus_tag LOCUS_11330 54129 53245 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_11330 54238 55152 gene locus_tag LOCUS_11340 54238 55152 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_11340 56554 55307 gene locus_tag LOCUS_11350 56554 55307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_11350 57202 56780 gene locus_tag LOCUS_11360 57202 56780 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552310.1 protein_id gnl|my_center|LOCUS_11360 57421 57239 gene locus_tag LOCUS_11370 57421 57239 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_11370 57576 58079 gene locus_tag LOCUS_11380 gene tpx 57576 58079 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084387.1 protein_id gnl|my_center|LOCUS_11380 58640 58167 gene locus_tag LOCUS_11390 58640 58167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence113 2135 51 gene locus_tag LOCUS_11400 gene fimX 2135 51 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_11400 4158 2359 gene locus_tag LOCUS_11410 gene fimW 4158 2359 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_11410 5541 4474 gene locus_tag LOCUS_11420 gene epmB 5541 4474 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940510.1 protein_id gnl|my_center|LOCUS_11420 5587 6159 gene locus_tag LOCUS_11430 gene efp 5587 6159 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262737.1 protein_id gnl|my_center|LOCUS_11430 6182 7141 gene locus_tag LOCUS_11440 gene epmA 6182 7141 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946344.1 protein_id gnl|my_center|LOCUS_11440 8334 7480 gene locus_tag LOCUS_11450 gene asd 8334 7480 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063853.1 protein_id gnl|my_center|LOCUS_11450 8561 9412 gene locus_tag LOCUS_11460 gene motA 8561 9412 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763001.1 protein_id gnl|my_center|LOCUS_11460 9492 10442 gene locus_tag LOCUS_11470 gene motB 9492 10442 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763003.1 protein_id gnl|my_center|LOCUS_11470 11280 10432 gene locus_tag LOCUS_11480 gene rsgA 11280 10432 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 protein_id gnl|my_center|LOCUS_11480 11164 11415 gene locus_tag LOCUS_11490 11164 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 11477 12022 gene locus_tag LOCUS_11500 gene orn 11477 12022 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694199.1 protein_id gnl|my_center|LOCUS_11500 13093 12023 gene locus_tag LOCUS_11510 gene queG 13093 12023 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_11510 13206 14771 gene locus_tag LOCUS_11520 13206 14771 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_11520 14776 15294 gene locus_tag LOCUS_11530 gene tsaE 14776 15294 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_11530 15291 16649 gene locus_tag LOCUS_11540 15291 16649 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence114 343 1116 gene locus_tag LOCUS_11550 343 1116 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_11550 1155 2042 gene locus_tag LOCUS_11560 1155 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2146 2634 gene locus_tag LOCUS_11570 2146 2634 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083098.1 protein_id gnl|my_center|LOCUS_11570 2680 3069 gene locus_tag LOCUS_11580 2680 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3365 3066 gene locus_tag LOCUS_11590 3365 3066 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_11590 4708 3362 gene locus_tag LOCUS_11600 4708 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4832 5470 gene locus_tag LOCUS_11610 gene ccmA 4832 5470 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_11610 5467 6195 gene locus_tag LOCUS_11620 gene ccmB 5467 6195 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_11620 6221 6955 gene locus_tag LOCUS_11630 6221 6955 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_11630 6963 7175 gene locus_tag LOCUS_11640 6963 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7175 7618 gene locus_tag LOCUS_11650 gene ccmE 7175 7618 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268403.1 protein_id gnl|my_center|LOCUS_11650 7648 9654 gene locus_tag LOCUS_11660 7648 9654 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_11660 9654 10190 gene locus_tag LOCUS_11670 gene dsbE 9654 10190 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_11670 10190 10657 gene locus_tag LOCUS_11680 10190 10657 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_11680 10721 11986 gene locus_tag LOCUS_11690 gene ccmI 10721 11986 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_11690 13738 11987 gene locus_tag LOCUS_11700 13738 11987 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267197.1 protein_id gnl|my_center|LOCUS_11700 15540 13732 gene locus_tag LOCUS_11710 15540 13732 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_11710 16540 15533 gene locus_tag LOCUS_11720 16540 15533 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_11720 16899 16540 gene locus_tag LOCUS_11730 16899 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 17950 17024 gene locus_tag LOCUS_11740 17950 17024 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376303.1 protein_id gnl|my_center|LOCUS_11740 18918 17956 gene locus_tag LOCUS_11750 18918 17956 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003342804.1 protein_id gnl|my_center|LOCUS_11750 19102 23979 gene locus_tag LOCUS_11760 gene gdhB 19102 23979 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_11760 24004 24765 gene locus_tag LOCUS_11770 gene can 24004 24765 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence115 2 169 gene locus_tag LOCUS_11780 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1159 230 gene locus_tag LOCUS_11790 1159 230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_11790 2249 1161 gene locus_tag LOCUS_11800 2249 1161 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_11800 4102 2297 gene locus_tag LOCUS_11810 4102 2297 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_11810 5904 4177 gene locus_tag LOCUS_11820 5904 4177 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_11820 6851 6075 gene locus_tag LOCUS_11830 gene gloB 6851 6075 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173058.1 protein_id gnl|my_center|LOCUS_11830 6943 7749 gene locus_tag LOCUS_11840 6943 7749 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104690.1 protein_id gnl|my_center|LOCUS_11840 7746 8195 gene locus_tag LOCUS_11850 gene rnhA 7746 8195 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_11850 8252 8959 gene locus_tag LOCUS_11860 gene dnaQ 8252 8959 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770771.1 protein_id gnl|my_center|LOCUS_11860 9142 10845 gene locus_tag LOCUS_11870 gene fimL 9142 10845 CDS product type IV pilus/biofilm regulator FimL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_11870 10886 11563 gene locus_tag LOCUS_11880 10886 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_11880 11964 11650 gene locus_tag LOCUS_11890 11964 11650 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_11890 12195 13259 gene locus_tag LOCUS_11900 gene sohB 12195 13259 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_11900 13294 14286 gene locus_tag LOCUS_11910 13294 14286 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_11910 14888 14385 gene locus_tag LOCUS_11920 14888 14385 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_11920 16533 14881 gene locus_tag LOCUS_11930 16533 14881 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_11930 17188 16958 gene locus_tag LOCUS_11940 17188 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 20900 17205 gene locus_tag LOCUS_11950 gene metH 20900 17205 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_11950 21080 21667 gene locus_tag LOCUS_11960 gene nfuA 21080 21667 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_11960 21821 23017 gene locus_tag LOCUS_11970 21821 23017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082818.1 protein_id gnl|my_center|LOCUS_11970 23046 23381 gene locus_tag LOCUS_11980 23046 23381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 24413 23361 gene locus_tag LOCUS_11990 24413 23361 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_11990 24770 24429 gene locus_tag LOCUS_12000 24770 24429 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 protein_id gnl|my_center|LOCUS_12000 25054 24770 gene locus_tag LOCUS_12010 25054 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 25401 25054 gene locus_tag LOCUS_12020 25401 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 25823 25401 gene locus_tag LOCUS_12030 gene tusD 25823 25401 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268263.1 protein_id gnl|my_center|LOCUS_12030 26628 25903 gene locus_tag LOCUS_12040 26628 25903 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_12040 26949 26859 gene locus_tag LOCUS_t00230 26949 26859 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27265 27903 gene locus_tag LOCUS_12050 gene uvrY 27265 27903 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090351.1 protein_id gnl|my_center|LOCUS_12050 27887 29740 gene locus_tag LOCUS_12060 gene uvrC 27887 29740 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_12060 29744 30304 gene locus_tag LOCUS_12070 gene pgsA 29744 30304 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_12070 30823 30750 gene locus_tag LOCUS_t00240 30823 30750 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 30968 30894 gene locus_tag LOCUS_t00250 30968 30894 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31517 31095 gene locus_tag LOCUS_12080 31517 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 31866 31525 gene locus_tag LOCUS_12090 31866 31525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 32057 32470 gene locus_tag LOCUS_12100 32057 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 32526 33761 gene locus_tag LOCUS_12110 32526 33761 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_12110 35407 33779 gene locus_tag LOCUS_12120 gene cydC 35407 33779 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929715.1 protein_id gnl|my_center|LOCUS_12120 36995 35400 gene locus_tag LOCUS_12130 gene cydD 36995 35400 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064910.1 protein_id gnl|my_center|LOCUS_12130 38074 36998 gene locus_tag LOCUS_12140 gene cydB 38074 36998 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 protein_id gnl|my_center|LOCUS_12140 39519 38077 gene locus_tag LOCUS_12150 39519 38077 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393706.1 protein_id gnl|my_center|LOCUS_12150 39790 40413 gene locus_tag LOCUS_12160 39790 40413 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_12160 40470 40554 gene locus_tag LOCUS_t00260 40470 40554 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42453 40831 gene locus_tag LOCUS_12170 gene ctpH 42453 40831 CDS product methyl-accepting chemotaxis protein CtpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895626.1 protein_id gnl|my_center|LOCUS_12170 42994 42572 gene locus_tag LOCUS_12180 42994 42572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 43866 43105 gene locus_tag LOCUS_12190 43866 43105 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810400.1 protein_id gnl|my_center|LOCUS_12190 44789 43863 gene locus_tag LOCUS_12200 44789 43863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_12200 45000 45377 gene locus_tag LOCUS_12210 45000 45377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 46006 45398 gene locus_tag LOCUS_12220 46006 45398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 47611 46136 gene locus_tag LOCUS_12230 47611 46136 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125173.1 protein_id gnl|my_center|LOCUS_12230 48263 47613 gene locus_tag LOCUS_12240 gene phnC 48263 47613 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391686.1 protein_id gnl|my_center|LOCUS_12240 49183 48263 gene locus_tag LOCUS_12250 49183 48263 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_12250 49232 50215 gene locus_tag LOCUS_12260 49232 50215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 52446 50176 gene locus_tag LOCUS_12270 gene selD 52446 50176 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891662.1 protein_id gnl|my_center|LOCUS_12270 53252 52455 gene locus_tag LOCUS_12280 53252 52455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 53601 53281 gene locus_tag LOCUS_12290 53601 53281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 53690 53869 gene locus_tag LOCUS_12300 53690 53869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 55471 53927 gene locus_tag LOCUS_12310 55471 53927 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_12310 55683 57572 gene locus_tag LOCUS_12320 55683 57572 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706983.1 protein_id gnl|my_center|LOCUS_12320 58496 57597 gene locus_tag LOCUS_12330 58496 57597 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704173.1 protein_id gnl|my_center|LOCUS_12330 58547 58729 gene locus_tag LOCUS_12340 58547 58729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 58782 59336 gene locus_tag LOCUS_12350 58782 59336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 61190 59337 gene locus_tag LOCUS_12360 gene recQ 61190 59337 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402551.1 protein_id gnl|my_center|LOCUS_12360 61331 62515 gene locus_tag LOCUS_12370 61331 62515 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_12370 62518 63180 gene locus_tag LOCUS_12380 62518 63180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_12380 63956 63351 gene locus_tag LOCUS_12390 63956 63351 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203008.1 protein_id gnl|my_center|LOCUS_12390 64855 63992 gene locus_tag LOCUS_12400 64855 63992 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532094.1 protein_id gnl|my_center|LOCUS_12400 64932 65507 gene locus_tag LOCUS_12410 64932 65507 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_12410 66774 65512 gene locus_tag LOCUS_12420 66774 65512 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268280.1 protein_id gnl|my_center|LOCUS_12420 67501 66839 gene locus_tag LOCUS_12430 67501 66839 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_12430 67770 68300 gene locus_tag LOCUS_12440 67770 68300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 68327 70066 gene locus_tag LOCUS_12450 68327 70066 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_12450 70063 70812 gene locus_tag LOCUS_12460 70063 70812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 71047 71505 gene locus_tag LOCUS_12470 71047 71505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 71545 72018 gene locus_tag LOCUS_12480 71545 72018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 72424 72672 gene locus_tag LOCUS_12490 72424 72672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 74953 72902 gene locus_tag LOCUS_12500 74953 72902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 75586 75023 gene locus_tag LOCUS_12510 75586 75023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 <78041 75651 gene locus_tag LOCUS_12520 <78041 75651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114304.1:ExeM/NucH family extracellular endonuclease >Feature sequence116 1160 639 gene locus_tag LOCUS_12530 gene ectA 1160 639 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence117 1175 654 gene locus_tag LOCUS_12540 gene ectA 1175 654 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810598.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence118 <1 869 gene locus_tag LOCUS_12550 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113248.1:8-amino-7-oxononanoate synthase 880 1614 gene locus_tag LOCUS_12560 gene bioH 880 1614 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_12560 1611 2399 gene locus_tag LOCUS_12570 gene bioC 1611 2399 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_12570 2430 2777 gene locus_tag LOCUS_12580 2430 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12580 2738 3121 gene locus_tag LOCUS_12590 2738 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12590 3173 3424 gene locus_tag LOCUS_12600 3173 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3457 4227 gene locus_tag LOCUS_12610 3457 4227 CDS product putative metalloprotease CJM1_0395 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704306.1 protein_id gnl|my_center|LOCUS_12610 4446 6290 gene locus_tag LOCUS_12620 4446 6290 CDS product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_12620 6997 6362 gene locus_tag LOCUS_12630 gene bfiR 6997 6362 CDS product two-component system response regulator BfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_12630 8842 7046 gene locus_tag LOCUS_12640 gene bfiS 8842 7046 CDS product two-component system sensor histidine kinase BfiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114718.1 protein_id gnl|my_center|LOCUS_12640 8989 10617 gene locus_tag LOCUS_12650 8989 10617 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_12650 10729 12108 gene locus_tag LOCUS_12660 10729 12108 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_12660 12345 14135 gene locus_tag LOCUS_12670 12345 14135 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_12670 14927 14235 gene locus_tag LOCUS_12680 14927 14235 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765647.1 protein_id gnl|my_center|LOCUS_12680 16404 15403 gene locus_tag LOCUS_12690 gene holA 16404 15403 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_12690 16942 16385 gene locus_tag LOCUS_12700 gene lptE 16942 16385 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100322.1 protein_id gnl|my_center|LOCUS_12700 19546 16952 gene locus_tag LOCUS_12710 gene leuS 19546 16952 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210333.1 protein_id gnl|my_center|LOCUS_12710 19722 20285 gene locus_tag LOCUS_12720 19722 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence119 4410 505 gene locus_tag LOCUS_12730 gene purL 4410 505 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_12730 4745 6328 gene locus_tag LOCUS_12740 gene mltF 4745 6328 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_12740 6837 6349 gene locus_tag LOCUS_12750 gene recX 6837 6349 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 protein_id gnl|my_center|LOCUS_12750 7048 9687 gene locus_tag LOCUS_12760 7048 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 9963 9697 gene locus_tag LOCUS_12770 9963 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 10172 11380 gene locus_tag LOCUS_12780 10172 11380 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_12780 11407 13557 gene locus_tag LOCUS_12790 11407 13557 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_12790 13779 15968 gene locus_tag LOCUS_12800 13779 15968 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_12800 15990 16739 gene locus_tag LOCUS_12810 15990 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 18181 16730 gene locus_tag LOCUS_12820 gene sbcB 18181 16730 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_12820 19091 18255 gene locus_tag LOCUS_12830 19091 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence120 1468 1094 gene locus_tag LOCUS_12840 1468 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2388 1813 gene locus_tag LOCUS_12850 2388 1813 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368916.1 protein_id gnl|my_center|LOCUS_12850 3062 2430 gene locus_tag LOCUS_12860 gene ureG 3062 2430 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_12860 3951 3247 gene locus_tag LOCUS_12870 3951 3247 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_12870 4402 3923 gene locus_tag LOCUS_12880 gene ureE 4402 3923 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_12880 4320 4637 gene locus_tag LOCUS_12890 4320 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 5878 4541 gene locus_tag LOCUS_12900 5878 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 6521 6006 gene locus_tag LOCUS_12910 6521 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence121 266 964 gene locus_tag LOCUS_12920 266 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1061 1438 gene locus_tag LOCUS_12930 1061 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1615 2208 gene locus_tag LOCUS_12940 1615 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2949 2497 gene locus_tag LOCUS_12950 2949 2497 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200892.1 protein_id gnl|my_center|LOCUS_12950 3081 3728 gene locus_tag LOCUS_12960 3081 3728 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_12960 4206 4835 gene locus_tag LOCUS_12970 4206 4835 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence122 2041 221 gene locus_tag LOCUS_12980 2041 221 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088443.1 protein_id gnl|my_center|LOCUS_12980 2922 2074 gene locus_tag LOCUS_12990 2922 2074 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 protein_id gnl|my_center|LOCUS_12990 2983 3783 gene locus_tag LOCUS_13000 2983 3783 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_13000 4152 4436 gene locus_tag LOCUS_13010 4152 4436 CDS product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704941.1 protein_id gnl|my_center|LOCUS_13010 4426 5040 gene locus_tag LOCUS_13020 4426 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5882 5133 gene locus_tag LOCUS_13030 5882 5133 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102821.1 protein_id gnl|my_center|LOCUS_13030 6140 5910 gene locus_tag LOCUS_13040 6140 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6603 6250 gene locus_tag LOCUS_13050 6603 6250 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940910.1 protein_id gnl|my_center|LOCUS_13050 7483 7019 gene locus_tag LOCUS_13060 7483 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence123 191 2032 gene locus_tag LOCUS_13070 191 2032 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150913023.1 protein_id gnl|my_center|LOCUS_13070 2892 2053 gene locus_tag LOCUS_13080 2892 2053 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132585.1 protein_id gnl|my_center|LOCUS_13080 2845 3024 gene locus_tag LOCUS_13090 2845 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3870 3049 gene locus_tag LOCUS_13100 3870 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_13100 6272 3870 gene locus_tag LOCUS_13110 6272 3870 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993482.1 protein_id gnl|my_center|LOCUS_13110 7846 6272 gene locus_tag LOCUS_13120 7846 6272 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 protein_id gnl|my_center|LOCUS_13120 8276 9670 gene locus_tag LOCUS_13130 8276 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 10698 9904 gene locus_tag LOCUS_13140 10698 9904 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence124 1070 288 gene locus_tag LOCUS_13150 gene suhB 1070 288 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_13150 1221 2051 gene locus_tag LOCUS_13160 gene trmJ 1221 2051 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705633.1 protein_id gnl|my_center|LOCUS_13160 2055 2840 gene locus_tag LOCUS_13170 gene cysE 2055 2840 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266905.1 protein_id gnl|my_center|LOCUS_13170 2948 3436 gene locus_tag LOCUS_13180 gene iscR 2948 3436 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_13180 3463 4620 gene locus_tag LOCUS_13190 gene iscS 3463 4620 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775265.1 protein_id gnl|my_center|LOCUS_13190 4703 5131 gene locus_tag LOCUS_13200 gene ndk 4703 5131 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963851.1 protein_id gnl|my_center|LOCUS_13200 5194 6306 gene locus_tag LOCUS_13210 gene rlmN 5194 6306 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_13210 6415 7218 gene locus_tag LOCUS_13220 gene pilF 6415 7218 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_13220 7215 8297 gene locus_tag LOCUS_13230 gene rodZ 7215 8297 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098278.1 protein_id gnl|my_center|LOCUS_13230 8329 9450 gene locus_tag LOCUS_13240 gene ispG 8329 9450 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_13240 9574 10845 gene locus_tag LOCUS_13250 gene hisS 9574 10845 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266910.1 protein_id gnl|my_center|LOCUS_13250 10857 11507 gene locus_tag LOCUS_13260 10857 11507 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 protein_id gnl|my_center|LOCUS_13260 11507 12670 gene locus_tag LOCUS_13270 gene bamB 11507 12670 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_13270 12674 14101 gene locus_tag LOCUS_13280 gene der 12674 14101 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_13280 16310 14178 gene locus_tag LOCUS_13290 gene pta 16310 14178 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_13290 17527 16337 gene locus_tag LOCUS_13300 17527 16337 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889226.1 protein_id gnl|my_center|LOCUS_13300 20035 17603 gene locus_tag LOCUS_13310 20035 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 20358 20283 gene locus_tag LOCUS_t00270 20358 20283 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20666 20484 gene locus_tag LOCUS_13320 20666 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 21941 21039 gene locus_tag LOCUS_13330 21941 21039 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_13330 22337 21951 gene locus_tag LOCUS_13340 22337 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 22437 23042 gene locus_tag LOCUS_13350 22437 23042 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_13350 23257 24033 gene locus_tag LOCUS_13360 23257 24033 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245388.1 protein_id gnl|my_center|LOCUS_13360 24139 24213 gene locus_tag LOCUS_t00280 24139 24213 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24341 25165 gene locus_tag LOCUS_13370 24341 25165 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104598.1 protein_id gnl|my_center|LOCUS_13370 25183 27102 gene locus_tag LOCUS_13380 25183 27102 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_13380 27217 27915 gene locus_tag LOCUS_13390 27217 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_13390 28387 27956 gene locus_tag LOCUS_13400 28387 27956 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_13400 28519 28968 gene locus_tag LOCUS_13410 28519 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 29867 29022 gene locus_tag LOCUS_13420 29867 29022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 30268 32415 gene locus_tag LOCUS_13430 gene fadB 30268 32415 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_13430 32451 33626 gene locus_tag LOCUS_13440 gene fadA 32451 33626 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113978.1 protein_id gnl|my_center|LOCUS_13440 33858 36506 gene locus_tag LOCUS_13450 gene topA 33858 36506 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091201.1 protein_id gnl|my_center|LOCUS_13450 37554 36682 gene locus_tag LOCUS_13460 37554 36682 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_13460 38930 37659 gene locus_tag LOCUS_13470 gene gltA 38930 37659 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_13470 39599 39979 gene locus_tag LOCUS_13480 gene sdhC 39599 39979 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423585.1 protein_id gnl|my_center|LOCUS_13480 39967 40317 gene locus_tag LOCUS_13490 gene sdhD 39967 40317 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316551.1 protein_id gnl|my_center|LOCUS_13490 40321 42093 gene locus_tag LOCUS_13500 gene sdhA 40321 42093 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 protein_id gnl|my_center|LOCUS_13500 42105 42809 gene locus_tag LOCUS_13510 42105 42809 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_13510 43115 45949 gene locus_tag LOCUS_13520 43115 45949 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_13520 45975 47228 gene locus_tag LOCUS_13530 gene odhB 45975 47228 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_13530 47260 48702 gene locus_tag LOCUS_13540 gene lpdA 47260 48702 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_13540 48789 49769 gene locus_tag LOCUS_13550 48789 49769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 49652 49957 gene locus_tag LOCUS_13560 49652 49957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 49954 50826 gene locus_tag LOCUS_13570 gene sucD 49954 50826 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 protein_id gnl|my_center|LOCUS_13570 51004 52218 gene locus_tag LOCUS_13580 51004 52218 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_13580 52230 53093 gene locus_tag LOCUS_13590 52230 53093 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_13590 53106 53759 gene locus_tag LOCUS_13600 gene scpB 53106 53759 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404130.1 protein_id gnl|my_center|LOCUS_13600 53805 54764 gene locus_tag LOCUS_13610 gene rluB 53805 54764 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113439.1 protein_id gnl|my_center|LOCUS_13610 55793 54816 gene locus_tag LOCUS_13620 55793 54816 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_13620 56031 56762 gene locus_tag LOCUS_13630 56031 56762 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_13630 56780 60277 gene locus_tag LOCUS_13640 gene smc 56780 60277 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_13640 60428 61456 gene locus_tag LOCUS_13650 gene zipA 60428 61456 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_13650 61466 63496 gene locus_tag LOCUS_13660 gene ligA 61466 63496 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705145.1 protein_id gnl|my_center|LOCUS_13660 63627 66389 gene locus_tag LOCUS_13670 63627 66389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 66953 66399 gene locus_tag LOCUS_13680 66953 66399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 68972 67107 gene locus_tag LOCUS_13690 gene mnmC 68972 67107 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268624.1 protein_id gnl|my_center|LOCUS_13690 69321 70052 gene locus_tag LOCUS_13700 69321 70052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence125 283 690 gene locus_tag LOCUS_13710 gene flgB 283 690 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 protein_id gnl|my_center|LOCUS_13710 737 1186 gene locus_tag LOCUS_13720 gene flgC 737 1186 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554316.1 protein_id gnl|my_center|LOCUS_13720 1211 1903 gene locus_tag LOCUS_13730 gene flgD 1211 1903 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_13730 1936 3897 gene locus_tag LOCUS_13740 1936 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4042 4794 gene locus_tag LOCUS_13750 4042 4794 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767027.1 protein_id gnl|my_center|LOCUS_13750 4875 5660 gene locus_tag LOCUS_13760 gene flgG 4875 5660 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082164.1 protein_id gnl|my_center|LOCUS_13760 5694 6371 gene locus_tag LOCUS_13770 gene flgH 5694 6371 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244381.1 protein_id gnl|my_center|LOCUS_13770 6368 7465 gene locus_tag LOCUS_13780 6368 7465 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_13780 7474 8487 gene locus_tag LOCUS_13790 gene flgJ 7474 8487 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_13790 8494 10527 gene locus_tag LOCUS_13800 gene flgK 8494 10527 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_13800 10569 12131 gene locus_tag LOCUS_13810 10569 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 12209 12295 gene locus_tag LOCUS_t00290 12209 12295 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12587 13573 gene locus_tag LOCUS_13820 12587 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 14343 14666 gene locus_tag LOCUS_13830 14343 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 14842 15759 gene locus_tag LOCUS_13840 14842 15759 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_13840 15864 17051 gene locus_tag LOCUS_13850 15864 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 17143 17439 gene locus_tag LOCUS_13860 17143 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 17630 18436 gene locus_tag LOCUS_13870 17630 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 18632 19573 gene locus_tag LOCUS_13880 18632 19573 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_13880 20545 20832 gene locus_tag LOCUS_13890 20545 20832 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_13890 21809 20979 gene locus_tag LOCUS_13900 21809 20979 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172953.1 protein_id gnl|my_center|LOCUS_13900 22046 22732 gene locus_tag LOCUS_13910 22046 22732 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_13910 22868 24187 gene locus_tag LOCUS_13920 22868 24187 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_13920 24307 25038 gene locus_tag LOCUS_13930 24307 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 25640 25062 gene locus_tag LOCUS_13940 25640 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13940 26017 25622 gene locus_tag LOCUS_13950 26017 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13950 26198 26761 gene locus_tag LOCUS_13960 26198 26761 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172525.1 protein_id gnl|my_center|LOCUS_13960 28444 27080 gene locus_tag LOCUS_13970 28444 27080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 28609 29682 gene locus_tag LOCUS_13980 gene queA 28609 29682 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_13980 29679 30809 gene locus_tag LOCUS_13990 gene tgt 29679 30809 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_13990 30865 31227 gene locus_tag LOCUS_14000 gene yajC 30865 31227 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_14000 31365 33242 gene locus_tag LOCUS_14010 gene secD 31365 33242 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266904.1 protein_id gnl|my_center|LOCUS_14010 33235 34188 gene locus_tag LOCUS_14020 gene secF 33235 34188 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262436.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence126 117 190 gene locus_tag LOCUS_t00300 117 190 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 350 216 gene locus_tag LOCUS_14030 350 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1284 889 gene locus_tag LOCUS_14040 1284 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1824 1327 gene locus_tag LOCUS_14050 1824 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2751 1909 gene locus_tag LOCUS_14060 2751 1909 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_14060 3683 2916 gene locus_tag LOCUS_14070 3683 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4438 4920 gene locus_tag LOCUS_14080 4438 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5137 4946 gene locus_tag LOCUS_14090 5137 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence127 1150 320 gene locus_tag LOCUS_14100 1150 320 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_14100 4994 1152 gene locus_tag LOCUS_14110 4994 1152 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268867.1 protein_id gnl|my_center|LOCUS_14110 6558 5077 gene locus_tag LOCUS_14120 gene rng 6558 5077 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_14120 7165 6551 gene locus_tag LOCUS_14130 7165 6551 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_14130 7648 7169 gene locus_tag LOCUS_14140 gene mreD 7648 7169 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_14140 8586 7645 gene locus_tag LOCUS_14150 8586 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9680 8637 gene locus_tag LOCUS_14160 gene mreB 9680 8637 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_14160 9892 10179 gene locus_tag LOCUS_14170 gene gatC 9892 10179 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_14170 10224 11669 gene locus_tag LOCUS_14180 gene gatA 10224 11669 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_14180 11733 13184 gene locus_tag LOCUS_14190 gene gatB 11733 13184 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_14190 13358 14266 gene locus_tag LOCUS_14200 gene cysD 13358 14266 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_14200 14392 16053 gene locus_tag LOCUS_14210 gene cysN 14392 16053 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_14210 16057 17073 gene locus_tag LOCUS_14220 16057 17073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17922 17221 gene locus_tag LOCUS_14230 gene trmH 17922 17221 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418334.1 protein_id gnl|my_center|LOCUS_14230 18059 19399 gene locus_tag LOCUS_14240 gene miaB 18059 19399 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368786.1 protein_id gnl|my_center|LOCUS_14240 19410 20387 gene locus_tag LOCUS_14250 19410 20387 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_14250 20384 20857 gene locus_tag LOCUS_14260 gene ybeY 20384 20857 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191149949.1 protein_id gnl|my_center|LOCUS_14260 20854 21705 gene locus_tag LOCUS_14270 20854 21705 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_14270 21692 23233 gene locus_tag LOCUS_14280 gene lnt 21692 23233 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence128 495 623 gene locus_tag LOCUS_14290 495 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 706 849 gene locus_tag LOCUS_14300 706 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1214 1029 gene locus_tag LOCUS_14310 1214 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1485 1988 gene locus_tag LOCUS_14320 1485 1988 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 protein_id gnl|my_center|LOCUS_14320 3334 2018 gene locus_tag LOCUS_14330 3334 2018 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205898.1 protein_id gnl|my_center|LOCUS_14330 3957 4808 gene locus_tag LOCUS_14340 3957 4808 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816527.1 protein_id gnl|my_center|LOCUS_14340 4868 5182 gene locus_tag LOCUS_14350 4868 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 6083 5193 gene locus_tag LOCUS_14360 gene mdrR1 6083 5193 CDS product transcriptional regulator MdrR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895665.1 protein_id gnl|my_center|LOCUS_14360 6199 7116 gene locus_tag LOCUS_14370 6199 7116 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927237.1 protein_id gnl|my_center|LOCUS_14370 7361 9085 gene locus_tag LOCUS_14380 7361 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 9254 9099 gene locus_tag LOCUS_14390 9254 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 10095 9211 gene locus_tag LOCUS_14400 10095 9211 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_14400 10184 10933 gene locus_tag LOCUS_14410 10184 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 11827 11003 gene locus_tag LOCUS_14420 11827 11003 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_14420 12352 11960 gene locus_tag LOCUS_14430 12352 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 12674 12399 gene locus_tag LOCUS_14440 12674 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 12869 13708 gene locus_tag LOCUS_14450 gene gcvA 12869 13708 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 protein_id gnl|my_center|LOCUS_14450 13940 13731 gene locus_tag LOCUS_14460 13940 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 14306 15634 gene locus_tag LOCUS_14470 14306 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 15656 18244 gene locus_tag LOCUS_14480 15656 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 18468 19874 gene locus_tag LOCUS_14490 18468 19874 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_14490 20140 20346 gene locus_tag LOCUS_14500 20140 20346 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_14500 20774 20418 gene locus_tag LOCUS_14510 20774 20418 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_14510 21057 20767 gene locus_tag LOCUS_14520 21057 20767 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_14520 23313 21121 gene locus_tag LOCUS_14530 23313 21121 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 protein_id gnl|my_center|LOCUS_14530 23579 24121 gene locus_tag LOCUS_14540 23579 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 25489 24158 gene locus_tag LOCUS_14550 25489 24158 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 protein_id gnl|my_center|LOCUS_14550 26158 25595 gene locus_tag LOCUS_14560 26158 25595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 26959 26309 gene locus_tag LOCUS_14570 26959 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 27102 27929 gene locus_tag LOCUS_14580 27102 27929 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_14580 28025 28411 gene locus_tag LOCUS_14590 28025 28411 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_14590 28404 30074 gene locus_tag LOCUS_14600 28404 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 30071 31834 gene locus_tag LOCUS_14610 30071 31834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 31958 35134 gene locus_tag LOCUS_14620 31958 35134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 35334 36095 gene locus_tag LOCUS_14630 35334 36095 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_14630 36109 37260 gene locus_tag LOCUS_14640 36109 37260 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_14640 37282 38463 gene locus_tag LOCUS_14650 37282 38463 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_14650 39538 38531 gene locus_tag LOCUS_14660 39538 38531 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_14660 39679 41334 gene locus_tag LOCUS_14670 39679 41334 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_14670 41423 41602 gene locus_tag LOCUS_14680 41423 41602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 42466 41579 gene locus_tag LOCUS_14690 gene mmsB 42466 41579 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 protein_id gnl|my_center|LOCUS_14690 43586 42513 gene locus_tag LOCUS_14700 43586 42513 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063762.1 protein_id gnl|my_center|LOCUS_14700 44381 43602 gene locus_tag LOCUS_14710 44381 43602 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477237.1 protein_id gnl|my_center|LOCUS_14710 45909 44407 gene locus_tag LOCUS_14720 45909 44407 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_14720 46044 46946 gene locus_tag LOCUS_14730 gene mmsR 46044 46946 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_14730 47315 47049 gene locus_tag LOCUS_14740 47315 47049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 47419 48318 gene locus_tag LOCUS_14750 47419 48318 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531163.1 protein_id gnl|my_center|LOCUS_14750 48757 48485 gene locus_tag LOCUS_14760 48757 48485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 49332 48826 gene locus_tag LOCUS_14770 49332 48826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 49538 49335 gene locus_tag LOCUS_14780 49538 49335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 49809 50198 gene locus_tag LOCUS_14790 49809 50198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 50205 50528 gene locus_tag LOCUS_14800 50205 50528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 50467 50793 gene locus_tag LOCUS_14810 50467 50793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 50790 50924 gene locus_tag LOCUS_14820 50790 50924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14820 50943 51587 gene locus_tag LOCUS_14830 50943 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14830 51479 52261 gene locus_tag LOCUS_14840 51479 52261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14840 52389 52532 gene locus_tag LOCUS_14850 52389 52532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 52802 52575 gene locus_tag LOCUS_14860 52802 52575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 53846 52953 gene locus_tag LOCUS_14870 53846 52953 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_14870 55127 54078 gene locus_tag LOCUS_14880 55127 54078 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082059.1 protein_id gnl|my_center|LOCUS_14880 55892 55257 gene locus_tag LOCUS_14890 55892 55257 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_14890 56052 57227 gene locus_tag LOCUS_14900 gene zigA 56052 57227 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_14900 57479 58075 gene locus_tag LOCUS_14910 57479 58075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence129 512 219 gene locus_tag LOCUS_14920 512 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 618 1853 gene locus_tag LOCUS_14930 618 1853 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_14930 2970 2062 gene locus_tag LOCUS_14940 2970 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3244 3555 gene locus_tag LOCUS_14950 3244 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3741 3568 gene locus_tag LOCUS_14960 3741 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3947 5410 gene locus_tag LOCUS_14970 3947 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5635 6258 gene locus_tag LOCUS_14980 5635 6258 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_14980 6252 6497 gene locus_tag LOCUS_14990 6252 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6607 7146 gene locus_tag LOCUS_15000 gene mntP 6607 7146 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318883.1 protein_id gnl|my_center|LOCUS_15000 8111 7158 gene locus_tag LOCUS_15010 8111 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 8852 8229 gene locus_tag LOCUS_15020 8852 8229 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_15020 9413 8946 gene locus_tag LOCUS_15030 9413 8946 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_15030 10465 9413 gene locus_tag LOCUS_15040 10465 9413 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_15040 11301 10516 gene locus_tag LOCUS_15050 gene pstB 11301 10516 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938383.1 protein_id gnl|my_center|LOCUS_15050 12175 11312 gene locus_tag LOCUS_15060 gene pstA 12175 11312 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_15060 13025 12165 gene locus_tag LOCUS_15070 gene pstC 13025 12165 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_15070 13888 13034 gene locus_tag LOCUS_15080 13888 13034 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_15080 14439 13984 gene locus_tag LOCUS_15090 14439 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 14952 14707 gene locus_tag LOCUS_15100 14952 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 14869 15165 gene locus_tag LOCUS_15110 14869 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 15769 15215 gene locus_tag LOCUS_15120 15769 15215 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_15120 15877 16479 gene locus_tag LOCUS_15130 15877 16479 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261712.1 protein_id gnl|my_center|LOCUS_15130 16804 19854 gene locus_tag LOCUS_15140 16804 19854 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_15140 19855 21324 gene locus_tag LOCUS_15150 19855 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275264.1 protein_id gnl|my_center|LOCUS_15150 21553 22347 gene locus_tag LOCUS_15160 21553 22347 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_15160 22344 23723 gene locus_tag LOCUS_15170 22344 23723 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_15170 23737 24267 gene locus_tag LOCUS_15180 23737 24267 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_15180 24279 24695 gene locus_tag LOCUS_15190 24279 24695 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_15190 24695 25327 gene locus_tag LOCUS_15200 24695 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 25333 26670 gene locus_tag LOCUS_15210 25333 26670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 26793 28103 gene locus_tag LOCUS_15220 26793 28103 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_15220 28202 29119 gene locus_tag LOCUS_15230 28202 29119 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477210.1 protein_id gnl|my_center|LOCUS_15230 29219 29145 gene locus_tag LOCUS_t00310 29219 29145 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 31169 29517 gene locus_tag LOCUS_15240 31169 29517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 31486 31166 gene locus_tag LOCUS_15250 31486 31166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 31946 31488 gene locus_tag LOCUS_15260 31946 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 33671 34195 gene locus_tag LOCUS_15270 33671 34195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875932.1 protein_id gnl|my_center|LOCUS_15270 34377 35552 gene locus_tag LOCUS_15280 34377 35552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 35605 35883 gene locus_tag LOCUS_15290 35605 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 35901 36137 gene locus_tag LOCUS_15300 35901 36137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence130 589 1311 gene locus_tag LOCUS_15310 589 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1647 1297 gene locus_tag LOCUS_15320 1647 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2953 2105 gene locus_tag LOCUS_15330 2953 2105 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706052.1 protein_id gnl|my_center|LOCUS_15330 4595 3756 gene locus_tag LOCUS_15340 4595 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4829 4647 gene locus_tag LOCUS_15350 4829 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6415 4865 gene locus_tag LOCUS_15360 6415 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6951 6505 gene locus_tag LOCUS_15370 gene pilA 6951 6505 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_15370 7514 9232 gene locus_tag LOCUS_15380 gene pilB 7514 9232 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_15380 9238 10461 gene locus_tag LOCUS_15390 9238 10461 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_15390 10680 11558 gene locus_tag LOCUS_15400 10680 11558 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_15400 11750 12367 gene locus_tag LOCUS_15410 gene coaE 11750 12367 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 protein_id gnl|my_center|LOCUS_15410 12593 13642 gene locus_tag LOCUS_15420 12593 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 13639 14364 gene locus_tag LOCUS_15430 gene tsaA 13639 14364 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_15430 14545 16386 gene locus_tag LOCUS_15440 14545 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 16450 16665 gene locus_tag LOCUS_15450 gene yacG 16450 16665 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381207.1 protein_id gnl|my_center|LOCUS_15450 16643 16822 gene locus_tag LOCUS_15460 16643 16822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 17660 17106 gene locus_tag LOCUS_15470 17660 17106 CDS product YfaZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071735.1 protein_id gnl|my_center|LOCUS_15470 18017 20233 gene locus_tag LOCUS_15480 18017 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence131 116 295 gene locus_tag LOCUS_15490 116 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2440 335 gene locus_tag LOCUS_15500 gene fusA 2440 335 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028885.1 protein_id gnl|my_center|LOCUS_15500 2929 2459 gene locus_tag LOCUS_15510 gene rpsG 2929 2459 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_15510 3438 3064 gene locus_tag LOCUS_15520 gene rpsL 3438 3064 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_15520 7771 3566 gene locus_tag LOCUS_15530 gene rpoC 7771 3566 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_15530 11930 7848 gene locus_tag LOCUS_15540 gene rpoB 11930 7848 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_15540 12550 12170 gene locus_tag LOCUS_15550 gene rplL 12550 12170 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 protein_id gnl|my_center|LOCUS_15550 13120 12590 gene locus_tag LOCUS_15560 gene rplJ 13120 12590 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 protein_id gnl|my_center|LOCUS_15560 14063 13365 gene locus_tag LOCUS_15570 gene rplA 14063 13365 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317112.1 protein_id gnl|my_center|LOCUS_15570 14496 14065 gene locus_tag LOCUS_15580 gene rplK 14496 14065 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_15580 15132 14599 gene locus_tag LOCUS_15590 gene nusG 15132 14599 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_15590 15513 15145 gene locus_tag LOCUS_15600 gene secE 15513 15145 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_15600 15623 15548 gene locus_tag LOCUS_t00320 15623 15548 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 990 238 gene locus_tag LOCUS_15610 990 238 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_15610 1884 1222 gene locus_tag LOCUS_15620 gene mupP 1884 1222 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268565.1 protein_id gnl|my_center|LOCUS_15620 2609 1881 gene locus_tag LOCUS_15630 2609 1881 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_15630 3964 2621 gene locus_tag LOCUS_15640 3964 2621 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_15640 4968 3937 gene locus_tag LOCUS_15650 gene mtnA 4968 3937 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_15650 7908 5074 gene locus_tag LOCUS_15660 7908 5074 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 protein_id gnl|my_center|LOCUS_15660 8214 7930 gene locus_tag LOCUS_15670 8214 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8535 10520 gene locus_tag LOCUS_15680 8535 10520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 protein_id gnl|my_center|LOCUS_15680 10839 11441 gene locus_tag LOCUS_15690 10839 11441 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_15690 12826 11534 gene locus_tag LOCUS_15700 gene pepQ 12826 11534 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211547.1 protein_id gnl|my_center|LOCUS_15700 13733 12816 gene locus_tag LOCUS_15710 13733 12816 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_15710 14800 13781 gene locus_tag LOCUS_15720 14800 13781 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_15720 15795 14797 gene locus_tag LOCUS_15730 15795 14797 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_15730 16737 15799 gene locus_tag LOCUS_15740 16737 15799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262868.1 protein_id gnl|my_center|LOCUS_15740 17783 16734 gene locus_tag LOCUS_15750 17783 16734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 protein_id gnl|my_center|LOCUS_15750 19472 17904 gene locus_tag LOCUS_15760 19472 17904 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 protein_id gnl|my_center|LOCUS_15760 20261 19611 gene locus_tag LOCUS_15770 gene rnt 20261 19611 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300258.1 protein_id gnl|my_center|LOCUS_15770 21313 20273 gene locus_tag LOCUS_15780 gene pyrC 21313 20273 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_15780 21433 22338 gene locus_tag LOCUS_15790 21433 22338 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268722.1 protein_id gnl|my_center|LOCUS_15790 22579 23790 gene locus_tag LOCUS_15800 22579 23790 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_15800 24395 24126 gene locus_tag LOCUS_15810 24395 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 24285 25208 gene locus_tag LOCUS_15820 24285 25208 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_15820 27666 25195 gene locus_tag LOCUS_15830 gene qqaR 27666 25195 CDS product N-acyl homoserine lactone acylase QqaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_15830 30582 27883 gene locus_tag LOCUS_15840 30582 27883 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071198.1 protein_id gnl|my_center|LOCUS_15840 33701 30804 gene locus_tag LOCUS_15850 33701 30804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 34742 33969 gene locus_tag LOCUS_15860 34742 33969 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_15860 34903 36423 gene locus_tag LOCUS_15870 34903 36423 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_15870 36693 37799 gene locus_tag LOCUS_15880 36693 37799 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_15880 37796 38806 gene locus_tag LOCUS_15890 37796 38806 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 protein_id gnl|my_center|LOCUS_15890 38824 39648 gene locus_tag LOCUS_15900 38824 39648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 39970 39614 gene locus_tag LOCUS_15910 gene dksA 39970 39614 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939427.1 protein_id gnl|my_center|LOCUS_15910 40611 40195 gene locus_tag LOCUS_15920 40611 40195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 41336 40728 gene locus_tag LOCUS_15930 41336 40728 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169439.1 protein_id gnl|my_center|LOCUS_15930 41414 42352 gene locus_tag LOCUS_15940 41414 42352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 42413 43072 gene locus_tag LOCUS_15950 gene psrA 42413 43072 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_15950 43171 43674 gene locus_tag LOCUS_15960 gene elsL 43171 43674 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_15960 43715 44938 gene locus_tag LOCUS_15970 43715 44938 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_15970 44935 45699 gene locus_tag LOCUS_15980 44935 45699 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_15980 46484 45693 gene locus_tag LOCUS_15990 46484 45693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 50026 46493 gene locus_tag LOCUS_16000 gene mfd 50026 46493 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_16000 50382 51854 gene locus_tag LOCUS_16010 50382 51854 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315085.1 protein_id gnl|my_center|LOCUS_16010 52165 53520 gene locus_tag LOCUS_16020 52165 53520 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_16020 53524 54729 gene locus_tag LOCUS_16030 53524 54729 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_16030 54722 55525 gene locus_tag LOCUS_16040 54722 55525 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_16040 55528 56193 gene locus_tag LOCUS_16050 gene nqrD 55528 56193 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_16050 56193 56801 gene locus_tag LOCUS_16060 gene nqrE 56193 56801 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_16060 56834 58060 gene locus_tag LOCUS_16070 gene nqrF 56834 58060 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_16070 58070 59104 gene locus_tag LOCUS_16080 58070 59104 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227821.1 protein_id gnl|my_center|LOCUS_16080 59115 59351 gene locus_tag LOCUS_16090 gene nqrM 59115 59351 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_16090 59583 60974 gene locus_tag LOCUS_16100 gene sthA 59583 60974 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_16100 61860 61105 gene locus_tag LOCUS_16110 61860 61105 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383089.1 protein_id gnl|my_center|LOCUS_16110 62990 61884 gene locus_tag LOCUS_16120 gene aroF 62990 61884 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_16120 63457 63002 gene locus_tag LOCUS_16130 63457 63002 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 protein_id gnl|my_center|LOCUS_16130 64425 63460 gene locus_tag LOCUS_16140 gene tal 64425 63460 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693444.1 protein_id gnl|my_center|LOCUS_16140 65479 64529 gene locus_tag LOCUS_16150 gene dusA 65479 64529 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_16150 67127 65925 gene locus_tag LOCUS_16160 67127 65925 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_16160 67295 68209 gene locus_tag LOCUS_16170 67295 68209 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_16170 69118 68225 gene locus_tag LOCUS_16180 gene znuA 69118 68225 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 protein_id gnl|my_center|LOCUS_16180 69282 70766 gene locus_tag LOCUS_16190 gene gltX 69282 70766 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738107.1 protein_id gnl|my_center|LOCUS_16190 70841 70916 gene locus_tag LOCUS_t00330 70841 70916 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 70924 70999 gene locus_tag LOCUS_t00340 70924 70999 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72110 71250 gene locus_tag LOCUS_16200 72110 71250 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_16200 73310 72210 gene locus_tag LOCUS_16210 73310 72210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 74709 73369 gene locus_tag LOCUS_16220 74709 73369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 75396 74839 gene locus_tag LOCUS_16230 75396 74839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 75576 76037 gene locus_tag LOCUS_16240 75576 76037 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665953.1 protein_id gnl|my_center|LOCUS_16240 76062 78986 gene locus_tag LOCUS_16250 76062 78986 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_16250 79841 79026 gene locus_tag LOCUS_16260 79841 79026 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120310.1 protein_id gnl|my_center|LOCUS_16260 80092 82470 gene locus_tag LOCUS_16270 gene ppsA 80092 82470 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_16270 82470 83030 gene locus_tag LOCUS_16280 gene rraA 82470 83030 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_16280 83393 83091 gene locus_tag LOCUS_16290 gene pilZ 83393 83091 CDS product cyclic di-GMP-binding protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104055.1 protein_id gnl|my_center|LOCUS_16290 84341 83670 gene locus_tag LOCUS_16300 84341 83670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 84740 84441 gene locus_tag LOCUS_16310 84740 84441 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_16310 84851 85744 gene locus_tag LOCUS_16320 84851 85744 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767709.1 protein_id gnl|my_center|LOCUS_16320 86453 85917 gene locus_tag LOCUS_16330 86453 85917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 89657 86523 gene locus_tag LOCUS_16340 89657 86523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16340 90257 91261 gene locus_tag LOCUS_16350 gene rluC 90257 91261 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005157930.1 protein_id gnl|my_center|LOCUS_16350 91277 91924 gene locus_tag LOCUS_16360 91277 91924 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_16360 91959 92996 gene locus_tag LOCUS_16370 gene sppA 91959 92996 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267147.1 protein_id gnl|my_center|LOCUS_16370 93616 93017 gene locus_tag LOCUS_16380 93616 93017 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_16380 93744 94292 gene locus_tag LOCUS_16390 93744 94292 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_16390 94394 94573 gene locus_tag LOCUS_16400 gene rpmF 94394 94573 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300935.1 protein_id gnl|my_center|LOCUS_16400 94616 95617 gene locus_tag LOCUS_16410 gene plsX 94616 95617 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071533934.1 protein_id gnl|my_center|LOCUS_16410 95813 96694 gene locus_tag LOCUS_16420 gene fabD 95813 96694 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 protein_id gnl|my_center|LOCUS_16420 96722 97465 gene locus_tag LOCUS_16430 gene fabG 96722 97465 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 protein_id gnl|my_center|LOCUS_16430 97608 97841 gene locus_tag LOCUS_16440 gene acpP 97608 97841 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_16440 97945 99195 gene locus_tag LOCUS_16450 gene fabF 97945 99195 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_16450 99203 100027 gene locus_tag LOCUS_16460 gene pabC 99203 100027 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_16460 100024 101067 gene locus_tag LOCUS_16470 gene mltG 100024 101067 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_16470 101071 101712 gene locus_tag LOCUS_16480 gene tmk 101071 101712 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770616.1 protein_id gnl|my_center|LOCUS_16480 101773 102555 gene locus_tag LOCUS_16490 101773 102555 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468852.1 protein_id gnl|my_center|LOCUS_16490 102841 106020 gene locus_tag LOCUS_16500 gene putA 102841 106020 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704727.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence133 1587 850 gene locus_tag LOCUS_16510 1587 850 CDS product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_16510 3089 1605 gene locus_tag LOCUS_16520 3089 1605 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530451.1 protein_id gnl|my_center|LOCUS_16520 4829 3165 gene locus_tag LOCUS_16530 gene betA 4829 3165 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220180.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence134 105 530 gene locus_tag LOCUS_16540 105 530 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037208.1 protein_id gnl|my_center|LOCUS_16540 2097 703 gene locus_tag LOCUS_16550 2097 703 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_16550 2314 3411 gene locus_tag LOCUS_16560 2314 3411 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_16560 4086 3430 gene locus_tag LOCUS_16570 gene lipB 4086 3430 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 protein_id gnl|my_center|LOCUS_16570 4355 4086 gene locus_tag LOCUS_16580 4355 4086 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_16580 5534 4365 gene locus_tag LOCUS_16590 5534 4365 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_16590 6487 5651 gene locus_tag LOCUS_16600 6487 5651 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_16600 7478 6489 gene locus_tag LOCUS_16610 gene mltB 7478 6489 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_16610 8719 7577 gene locus_tag LOCUS_16620 gene mrdB 8719 7577 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_16620 10616 8712 gene locus_tag LOCUS_16630 gene mrdA 10616 8712 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_16630 11098 10628 gene locus_tag LOCUS_16640 gene rlmH 11098 10628 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_16640 11451 11101 gene locus_tag LOCUS_16650 gene rsfS 11451 11101 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_16650 12202 11552 gene locus_tag LOCUS_16660 gene nadD 12202 11552 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_16660 13465 12209 gene locus_tag LOCUS_16670 13465 12209 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_16670 13651 14658 gene locus_tag LOCUS_16680 13651 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 14651 15649 gene locus_tag LOCUS_16690 14651 15649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 15649 17106 gene locus_tag LOCUS_16700 15649 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 18340 17075 gene locus_tag LOCUS_16710 18340 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 18874 18410 gene locus_tag LOCUS_16720 18874 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 20040 18958 gene locus_tag LOCUS_16730 20040 18958 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_16730 20085 20429 gene locus_tag LOCUS_16740 20085 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 20662 20904 gene locus_tag LOCUS_16750 20662 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 21749 20961 gene locus_tag LOCUS_16760 21749 20961 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_16760 22264 21746 gene locus_tag LOCUS_16770 22264 21746 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_16770 23123 22284 gene locus_tag LOCUS_16780 gene thyA 23123 22284 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816222.1 protein_id gnl|my_center|LOCUS_16780 23908 23120 gene locus_tag LOCUS_16790 gene lgt 23908 23120 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_16790 24713 23919 gene locus_tag LOCUS_16800 24713 23919 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_16800 24728 25546 gene locus_tag LOCUS_16810 24728 25546 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_16810 25607 25861 gene locus_tag LOCUS_16820 gene xseB 25607 25861 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 protein_id gnl|my_center|LOCUS_16820 25858 26754 gene locus_tag LOCUS_16830 25858 26754 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_16830 26940 28874 gene locus_tag LOCUS_16840 gene dxs 26940 28874 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103240.1 protein_id gnl|my_center|LOCUS_16840 29009 29554 gene locus_tag LOCUS_16850 29009 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 30255 29635 gene locus_tag LOCUS_16860 gene ribA 30255 29635 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379129.1 protein_id gnl|my_center|LOCUS_16860 30828 30352 gene locus_tag LOCUS_16870 gene moaC 30828 30352 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_16870 31811 30828 gene locus_tag LOCUS_16880 31811 30828 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_16880 33071 31815 gene locus_tag LOCUS_16890 gene argJ 33071 31815 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_16890 35812 33050 gene locus_tag LOCUS_16900 gene secA 35812 33050 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_16900 37053 36115 gene locus_tag LOCUS_16910 37053 36115 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_16910 37228 37674 gene locus_tag LOCUS_16920 37228 37674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 38604 37684 gene locus_tag LOCUS_16930 gene lpxC 38604 37684 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_16930 39927 38770 gene locus_tag LOCUS_16940 gene ftsZ 39927 38770 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555041.1 protein_id gnl|my_center|LOCUS_16940 41287 40040 gene locus_tag LOCUS_16950 gene ftsA 41287 40040 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_16950 42130 41297 gene locus_tag LOCUS_16960 42130 41297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 43082 42123 gene locus_tag LOCUS_16970 43082 42123 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_16970 44530 43079 gene locus_tag LOCUS_16980 gene murC 44530 43079 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268845.1 protein_id gnl|my_center|LOCUS_16980 45605 44523 gene locus_tag LOCUS_16990 gene murG 45605 44523 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766568.1 protein_id gnl|my_center|LOCUS_16990 46788 45595 gene locus_tag LOCUS_17000 gene ftsW 46788 45595 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 protein_id gnl|my_center|LOCUS_17000 46564 46472 gene locus_tag LOCUS_t00350 46564 46472 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48128 46785 gene locus_tag LOCUS_17010 gene murD 48128 46785 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_17010 49228 48143 gene locus_tag LOCUS_17020 gene mraY 49228 48143 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_17020 50595 49213 gene locus_tag LOCUS_17030 50595 49213 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105004.1 protein_id gnl|my_center|LOCUS_17030 52076 50592 gene locus_tag LOCUS_17040 52076 50592 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_17040 53782 52079 gene locus_tag LOCUS_17050 53782 52079 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427469.1 protein_id gnl|my_center|LOCUS_17050 54250 53864 gene locus_tag LOCUS_17060 54250 53864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 55200 54247 gene locus_tag LOCUS_17070 gene rsmH 55200 54247 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 protein_id gnl|my_center|LOCUS_17070 55649 55197 gene locus_tag LOCUS_17080 gene mraZ 55649 55197 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_17080 57308 56451 gene locus_tag LOCUS_17090 gene rsmI 57308 56451 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_17090 57499 59328 gene locus_tag LOCUS_17100 57499 59328 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_17100 59333 59716 gene locus_tag LOCUS_17110 59333 59716 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766552.1 protein_id gnl|my_center|LOCUS_17110 59748 60335 gene locus_tag LOCUS_17120 59748 60335 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094149.1 protein_id gnl|my_center|LOCUS_17120 60792 60355 gene locus_tag LOCUS_17130 60792 60355 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 protein_id gnl|my_center|LOCUS_17130 61455 60853 gene locus_tag LOCUS_17140 61455 60853 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_17140 62356 61601 gene locus_tag LOCUS_17150 62356 61601 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_17150 63588 62356 gene locus_tag LOCUS_17160 63588 62356 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_17160 64184 63588 gene locus_tag LOCUS_17170 gene petA 64184 63588 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_17170 64812 64420 gene locus_tag LOCUS_17180 gene rpsI 64812 64420 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_17180 65253 64825 gene locus_tag LOCUS_17190 gene rplM 65253 64825 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_17190 66205 65447 gene locus_tag LOCUS_17200 66205 65447 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 protein_id gnl|my_center|LOCUS_17200 67824 66238 gene locus_tag LOCUS_17210 gene prfC 67824 66238 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071441.1 protein_id gnl|my_center|LOCUS_17210 68443 67940 gene locus_tag LOCUS_17220 gene rimI 68443 67940 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_17220 68979 68440 gene locus_tag LOCUS_17230 68979 68440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 69499 69347 gene locus_tag LOCUS_17240 69499 69347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence135 470 1285 gene locus_tag LOCUS_17250 470 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1273 4683 gene locus_tag LOCUS_17260 1273 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4664 5686 gene locus_tag LOCUS_17270 4664 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5757 6914 gene locus_tag LOCUS_17280 5757 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 7024 7524 gene locus_tag LOCUS_17290 7024 7524 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_17290 7521 8489 gene locus_tag LOCUS_17300 7521 8489 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818125.1 protein_id gnl|my_center|LOCUS_17300 8486 9547 gene locus_tag LOCUS_17310 8486 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 9540 10079 gene locus_tag LOCUS_17320 9540 10079 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209757.1 protein_id gnl|my_center|LOCUS_17320 10487 10062 gene locus_tag LOCUS_17330 10487 10062 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318084.1 protein_id gnl|my_center|LOCUS_17330 11027 10533 gene locus_tag LOCUS_17340 11027 10533 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_17340 11255 11061 gene locus_tag LOCUS_17350 11255 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 11185 12090 gene locus_tag LOCUS_17360 11185 12090 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120883.1 protein_id gnl|my_center|LOCUS_17360 12340 13200 gene locus_tag LOCUS_17370 12340 13200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 13477 14067 gene locus_tag LOCUS_17380 gene betI 13477 14067 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199591.1 protein_id gnl|my_center|LOCUS_17380 14096 15022 gene locus_tag LOCUS_17390 14096 15022 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463665.1 protein_id gnl|my_center|LOCUS_17390 15093 15935 gene locus_tag LOCUS_17400 gene choW 15093 15935 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096692.1 protein_id gnl|my_center|LOCUS_17400 15937 17127 gene locus_tag LOCUS_17410 gene choV 15937 17127 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269186.1 protein_id gnl|my_center|LOCUS_17410 17175 19121 gene locus_tag LOCUS_17420 17175 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17420 19028 19471 gene locus_tag LOCUS_17430 19028 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 20161 19562 gene locus_tag LOCUS_17440 20161 19562 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_17440 20689 20249 gene locus_tag LOCUS_17450 20689 20249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 20827 21267 gene locus_tag LOCUS_17460 20827 21267 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975605.1 protein_id gnl|my_center|LOCUS_17460 21303 22028 gene locus_tag LOCUS_17470 21303 22028 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_17470 22090 22335 gene locus_tag LOCUS_17480 22090 22335 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435988.1 protein_id gnl|my_center|LOCUS_17480 22336 22737 gene locus_tag LOCUS_17490 22336 22737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 22777 24180 gene locus_tag LOCUS_17500 22777 24180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 25688 24234 gene locus_tag LOCUS_17510 25688 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 25849 27675 gene locus_tag LOCUS_17520 25849 27675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_17520 27967 30714 gene locus_tag LOCUS_17530 gene acnA 27967 30714 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_17530 30824 31393 gene locus_tag LOCUS_17540 30824 31393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 31393 31722 gene locus_tag LOCUS_17550 31393 31722 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_17550 31729 32100 gene locus_tag LOCUS_17560 31729 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 32324 33493 gene locus_tag LOCUS_17570 32324 33493 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 protein_id gnl|my_center|LOCUS_17570 33480 35528 gene locus_tag LOCUS_17580 33480 35528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17580 35541 35936 gene locus_tag LOCUS_17590 35541 35936 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259628.1 protein_id gnl|my_center|LOCUS_17590 35942 36760 gene locus_tag LOCUS_17600 35942 36760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_17600 37585 36761 gene locus_tag LOCUS_17610 37585 36761 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022262.1 protein_id gnl|my_center|LOCUS_17610 37654 38895 gene locus_tag LOCUS_17620 37654 38895 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_17620 39319 38837 gene locus_tag LOCUS_17630 39319 38837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 40607 39390 gene locus_tag LOCUS_17640 gene oprF 40607 39390 CDS product outer membrane porin OprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087843.1 protein_id gnl|my_center|LOCUS_17640 43088 40800 gene locus_tag LOCUS_17650 gene pcrA 43088 40800 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_17650 43190 43573 gene locus_tag LOCUS_17660 43190 43573 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404838.1 protein_id gnl|my_center|LOCUS_17660 43576 45657 gene locus_tag LOCUS_17670 43576 45657 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_17670 45778 46449 gene locus_tag LOCUS_17680 45778 46449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 47744 46635 gene locus_tag LOCUS_17690 47744 46635 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_17690 47883 48194 gene locus_tag LOCUS_17700 47883 48194 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513613.1 protein_id gnl|my_center|LOCUS_17700 49614 48214 gene locus_tag LOCUS_17710 gene ppnN 49614 48214 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_17710 49720 51168 gene locus_tag LOCUS_17720 gene thiI 49720 51168 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096011.1 protein_id gnl|my_center|LOCUS_17720 52351 51344 gene locus_tag LOCUS_17730 52351 51344 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807202.1 protein_id gnl|my_center|LOCUS_17730 52592 54043 gene locus_tag LOCUS_17740 52592 54043 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139973.1 protein_id gnl|my_center|LOCUS_17740 54209 56377 gene locus_tag LOCUS_17750 gene uvrD 54209 56377 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_17750 56479 57636 gene locus_tag LOCUS_17760 gene dctP 56479 57636 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_17760 58087 57674 gene locus_tag LOCUS_17770 58087 57674 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_17770 59488 58103 gene locus_tag LOCUS_17780 59488 58103 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_17780 60042 59485 gene locus_tag LOCUS_17790 60042 59485 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_17790 60372 61418 gene locus_tag LOCUS_17800 60372 61418 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_17800 61536 62924 gene locus_tag LOCUS_17810 gene pstC 61536 62924 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_17810 62917 64191 gene locus_tag LOCUS_17820 gene pstA 62917 64191 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_17820 64206 65075 gene locus_tag LOCUS_17830 gene pstB 64206 65075 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 protein_id gnl|my_center|LOCUS_17830 65101 65823 gene locus_tag LOCUS_17840 gene phoU 65101 65823 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948570.1 protein_id gnl|my_center|LOCUS_17840 66251 65886 gene locus_tag LOCUS_17850 66251 65886 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767882.1 protein_id gnl|my_center|LOCUS_17850 67572 66280 gene locus_tag LOCUS_17860 gene ubiF 67572 66280 CDS product 3-demethoxyubiquinol 3-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184591.1 protein_id gnl|my_center|LOCUS_17860 68142 67636 gene locus_tag LOCUS_17870 68142 67636 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_17870 69179 68346 gene locus_tag LOCUS_17880 69179 68346 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_17880 70452 69313 gene locus_tag LOCUS_17890 gene mnmH 70452 69313 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_17890 70525 71190 gene locus_tag LOCUS_17900 70525 71190 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence136 440 51 gene locus_tag LOCUS_17910 440 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 427 648 gene locus_tag LOCUS_17920 427 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 995 690 gene locus_tag LOCUS_17930 995 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 1077 3788 gene locus_tag LOCUS_17940 gene polA 1077 3788 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_17940 5673 3853 gene locus_tag LOCUS_17950 gene btuB 5673 3853 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 protein_id gnl|my_center|LOCUS_17950 5675 5839 gene locus_tag LOCUS_17960 5675 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6194 6577 gene locus_tag LOCUS_17970 6194 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence137 947 1363 gene locus_tag LOCUS_17980 947 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1635 1387 gene locus_tag LOCUS_17990 1635 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1655 2023 gene locus_tag LOCUS_18000 1655 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2333 2070 gene locus_tag LOCUS_18010 2333 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4026 2461 gene locus_tag LOCUS_18020 4026 2461 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_18020 5203 4097 gene locus_tag LOCUS_18030 5203 4097 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397356.1 protein_id gnl|my_center|LOCUS_18030 6255 5209 gene locus_tag LOCUS_18040 6255 5209 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102644.1 protein_id gnl|my_center|LOCUS_18040 7679 6267 gene locus_tag LOCUS_18050 7679 6267 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_18050 9043 7748 gene locus_tag LOCUS_18060 9043 7748 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101418.1 protein_id gnl|my_center|LOCUS_18060 10360 9230 gene locus_tag LOCUS_18070 10360 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 10943 10575 gene locus_tag LOCUS_18080 10943 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 11089 11985 gene locus_tag LOCUS_18090 11089 11985 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_18090 12057 13115 gene locus_tag LOCUS_18100 12057 13115 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_18100 13112 13771 gene locus_tag LOCUS_18110 13112 13771 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 protein_id gnl|my_center|LOCUS_18110 14236 13952 gene locus_tag LOCUS_18120 14236 13952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 15644 14415 gene locus_tag LOCUS_18130 gene serA 15644 14415 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_18130 15821 17218 gene locus_tag LOCUS_18140 15821 17218 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_18140 18809 17505 gene locus_tag LOCUS_18150 18809 17505 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208265.1 protein_id gnl|my_center|LOCUS_18150 19510 18845 gene locus_tag LOCUS_18160 19510 18845 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_18160 20053 19511 gene locus_tag LOCUS_18170 20053 19511 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446416.1 protein_id gnl|my_center|LOCUS_18170 21358 20063 gene locus_tag LOCUS_18180 21358 20063 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_18180 21514 22080 gene locus_tag LOCUS_18190 21514 22080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 22195 23175 gene locus_tag LOCUS_18200 22195 23175 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105383.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence138 556 5013 gene locus_tag LOCUS_18210 gene gltB 556 5013 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_18210 5071 6489 gene locus_tag LOCUS_18220 5071 6489 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_18220 6520 7584 gene locus_tag LOCUS_18230 gene hemE 6520 7584 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence139 296 2464 gene locus_tag LOCUS_18240 296 2464 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_18240 2650 4557 gene locus_tag LOCUS_18250 2650 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4671 6356 gene locus_tag LOCUS_18260 gene argS 4671 6356 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 protein_id gnl|my_center|LOCUS_18260 6371 7051 gene locus_tag LOCUS_18270 6371 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7144 7671 gene locus_tag LOCUS_18280 gene hslV 7144 7671 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_18280 7681 9018 gene locus_tag LOCUS_18290 gene hslU 7681 9018 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 protein_id gnl|my_center|LOCUS_18290 10453 9221 gene locus_tag LOCUS_18300 10453 9221 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839947.1 protein_id gnl|my_center|LOCUS_18300 12848 10536 gene locus_tag LOCUS_18310 gene ptsP 12848 10536 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_18310 13368 12862 gene locus_tag LOCUS_18320 13368 12862 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_18320 13539 14198 gene locus_tag LOCUS_18330 13539 14198 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_18330 14198 15247 gene locus_tag LOCUS_18340 14198 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 15358 16230 gene locus_tag LOCUS_18350 15358 16230 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_18350 16758 16303 gene locus_tag LOCUS_18360 gene gcvH 16758 16303 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_18360 17406 16783 gene locus_tag LOCUS_18370 17406 16783 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_18370 18211 17393 gene locus_tag LOCUS_18380 gene cpdA 18211 17393 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 protein_id gnl|my_center|LOCUS_18380 18843 18376 gene locus_tag LOCUS_18390 18843 18376 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_18390 19472 18843 gene locus_tag LOCUS_18400 19472 18843 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_18400 21593 19716 gene locus_tag LOCUS_18410 gene thiC 21593 19716 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_18410 22110 23492 gene locus_tag LOCUS_18420 22110 23492 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_18420 25010 23748 gene locus_tag LOCUS_18430 gene waaA 25010 23748 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_18430 25164 26138 gene locus_tag LOCUS_18440 25164 26138 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_18440 26793 26896 gene locus_tag LOCUS_t00360 26793 26896 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27072 28178 gene locus_tag LOCUS_18450 27072 28178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_18450 28175 29203 gene locus_tag LOCUS_18460 28175 29203 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207636.1 protein_id gnl|my_center|LOCUS_18460 29196 29879 gene locus_tag LOCUS_18470 29196 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 29914 31785 gene locus_tag LOCUS_18480 29914 31785 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925712.1 protein_id gnl|my_center|LOCUS_18480 31798 32607 gene locus_tag LOCUS_18490 31798 32607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 32650 33399 gene locus_tag LOCUS_18500 32650 33399 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324116.1 protein_id gnl|my_center|LOCUS_18500 33554 34309 gene locus_tag LOCUS_18510 33554 34309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 34353 35282 gene locus_tag LOCUS_18520 34353 35282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 36216 35305 gene locus_tag LOCUS_18530 36216 35305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 37475 36213 gene locus_tag LOCUS_18540 37475 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 38425 37472 gene locus_tag LOCUS_18550 38425 37472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 39301 38426 gene locus_tag LOCUS_18560 39301 38426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 39540 40430 gene locus_tag LOCUS_18570 39540 40430 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_18570 41164 40445 gene locus_tag LOCUS_18580 41164 40445 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_18580 42103 41219 gene locus_tag LOCUS_18590 gene ilvE 42103 41219 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_18590 45047 42240 gene locus_tag LOCUS_18600 gene glnE 45047 42240 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_18600 45225 46379 gene locus_tag LOCUS_18610 45225 46379 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993980.1 protein_id gnl|my_center|LOCUS_18610 47372 46533 gene locus_tag LOCUS_18620 47372 46533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 48531 47497 gene locus_tag LOCUS_18630 48531 47497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 49464 49018 gene locus_tag LOCUS_18640 gene dtd 49464 49018 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_18640 50513 49548 gene locus_tag LOCUS_18650 gene pip 50513 49548 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_18650 52457 50646 gene locus_tag LOCUS_18660 gene typA 52457 50646 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_18660 52939 54345 gene locus_tag LOCUS_18670 gene glnA 52939 54345 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 protein_id gnl|my_center|LOCUS_18670 54549 55082 gene locus_tag LOCUS_18680 54549 55082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 55349 56419 gene locus_tag LOCUS_18690 gene ntrB 55349 56419 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_18690 56416 57861 gene locus_tag LOCUS_18700 gene ntrC 56416 57861 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence140 349 273 gene locus_tag LOCUS_t00370 349 273 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 445 1635 gene locus_tag LOCUS_18710 445 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1893 2573 gene locus_tag LOCUS_18720 1893 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5439 2839 gene locus_tag LOCUS_18730 5439 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7080 5479 gene locus_tag LOCUS_18740 7080 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 7914 7180 gene locus_tag LOCUS_18750 7914 7180 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806896.1 protein_id gnl|my_center|LOCUS_18750 10188 8017 gene locus_tag LOCUS_18760 10188 8017 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_18760 10233 10562 gene locus_tag LOCUS_18770 gene bolA 10233 10562 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208644.1 protein_id gnl|my_center|LOCUS_18770 10596 11219 gene locus_tag LOCUS_18780 10596 11219 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_18780 11858 11220 gene locus_tag LOCUS_18790 11858 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 12631 11987 gene locus_tag LOCUS_18800 12631 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 12879 15245 gene locus_tag LOCUS_18810 12879 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 15328 15633 gene locus_tag LOCUS_18820 15328 15633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence141 1145 819 gene locus_tag LOCUS_18830 1145 819 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720474.1 protein_id gnl|my_center|LOCUS_18830 1459 1157 gene locus_tag LOCUS_18840 1459 1157 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_18840 2239 1463 gene locus_tag LOCUS_18850 2239 1463 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_18850 3059 2361 gene locus_tag LOCUS_18860 gene urtE 3059 2361 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_18860 3883 3059 gene locus_tag LOCUS_18870 gene urtD 3883 3059 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_18870 5022 3880 gene locus_tag LOCUS_18880 gene urtC 5022 3880 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_18880 6607 5024 gene locus_tag LOCUS_18890 gene urtB 6607 5024 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_18890 7999 6689 gene locus_tag LOCUS_18900 gene urtA 7999 6689 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_18900 9220 8348 gene locus_tag LOCUS_18910 9220 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 9425 9258 gene locus_tag LOCUS_18920 9425 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 11132 9516 gene locus_tag LOCUS_18930 11132 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 12366 11302 gene locus_tag LOCUS_18940 12366 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 14431 12377 gene locus_tag LOCUS_18950 14431 12377 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222260.1 protein_id gnl|my_center|LOCUS_18950 14572 15387 gene locus_tag LOCUS_18960 14572 15387 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705927.1 protein_id gnl|my_center|LOCUS_18960 15595 18405 gene locus_tag LOCUS_18970 15595 18405 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_18970 18407 18775 gene locus_tag LOCUS_18980 18407 18775 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_18980 18772 20292 gene locus_tag LOCUS_18990 18772 20292 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_18990 20289 20777 gene locus_tag LOCUS_19000 20289 20777 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 protein_id gnl|my_center|LOCUS_19000 20774 21043 gene locus_tag LOCUS_19010 20774 21043 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_19010 21096 21428 gene locus_tag LOCUS_19020 21096 21428 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_19020 21616 23925 gene locus_tag LOCUS_19030 21616 23925 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_19030 23922 24341 gene locus_tag LOCUS_19040 23922 24341 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_19040 24382 24729 gene locus_tag LOCUS_19050 24382 24729 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_19050 24726 26240 gene locus_tag LOCUS_19060 24726 26240 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_19060 26237 26710 gene locus_tag LOCUS_19070 26237 26710 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_19070 26720 26986 gene locus_tag LOCUS_19080 26720 26986 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883000.1 protein_id gnl|my_center|LOCUS_19080 26983 27381 gene locus_tag LOCUS_19090 gene mnhG 26983 27381 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942974.1 protein_id gnl|my_center|LOCUS_19090 27592 29241 gene locus_tag LOCUS_19100 27592 29241 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_19100 29693 29247 gene locus_tag LOCUS_19110 29693 29247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 30345 29680 gene locus_tag LOCUS_19120 30345 29680 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 protein_id gnl|my_center|LOCUS_19120 31658 30405 gene locus_tag LOCUS_19130 31658 30405 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040091.1 protein_id gnl|my_center|LOCUS_19130 32080 31718 gene locus_tag LOCUS_19140 32080 31718 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 protein_id gnl|my_center|LOCUS_19140 32450 32100 gene locus_tag LOCUS_19150 32450 32100 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207714.1 protein_id gnl|my_center|LOCUS_19150 33006 32464 gene locus_tag LOCUS_19160 33006 32464 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463686.1 protein_id gnl|my_center|LOCUS_19160 33629 33021 gene locus_tag LOCUS_19170 33629 33021 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_19170 33695 34858 gene locus_tag LOCUS_19180 33695 34858 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268677.1 protein_id gnl|my_center|LOCUS_19180 35146 36846 gene locus_tag LOCUS_19190 gene ilvG 35146 36846 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038423.1 protein_id gnl|my_center|LOCUS_19190 36843 37106 gene locus_tag LOCUS_19200 36843 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 38451 37108 gene locus_tag LOCUS_19210 38451 37108 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_19210 39052 38501 gene locus_tag LOCUS_19220 39052 38501 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_19220 39542 39847 gene locus_tag LOCUS_19230 39542 39847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 40451 39903 gene locus_tag LOCUS_19240 gene gloA 40451 39903 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 protein_id gnl|my_center|LOCUS_19240 40640 41302 gene locus_tag LOCUS_19250 40640 41302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 41464 42570 gene locus_tag LOCUS_19260 41464 42570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 42668 43720 gene locus_tag LOCUS_19270 42668 43720 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_19270 43717 45960 gene locus_tag LOCUS_19280 43717 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 46029 46973 gene locus_tag LOCUS_19290 46029 46973 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_19290 48072 47089 gene locus_tag LOCUS_19300 48072 47089 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728485.1 protein_id gnl|my_center|LOCUS_19300 48948 48220 gene locus_tag LOCUS_19310 48948 48220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 49111 50076 gene locus_tag LOCUS_19320 49111 50076 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_19320 51520 50090 gene locus_tag LOCUS_19330 51520 50090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 52348 51938 gene locus_tag LOCUS_19340 52348 51938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 52818 52345 gene locus_tag LOCUS_19350 52818 52345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 53236 52892 gene locus_tag LOCUS_19360 53236 52892 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809467.1 protein_id gnl|my_center|LOCUS_19360 54219 53233 gene locus_tag LOCUS_19370 54219 53233 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_19370 55444 54380 gene locus_tag LOCUS_19380 gene fba 55444 54380 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_19380 56628 55468 gene locus_tag LOCUS_19390 56628 55468 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084960.1 protein_id gnl|my_center|LOCUS_19390 57753 56743 gene locus_tag LOCUS_19400 gene epd 57753 56743 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071211.1 protein_id gnl|my_center|LOCUS_19400 59754 57754 gene locus_tag LOCUS_19410 gene tkt 59754 57754 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_19410 59971 61011 gene locus_tag LOCUS_19420 59971 61011 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_19420 61018 62208 gene locus_tag LOCUS_19430 gene metK 61018 62208 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555698.1 protein_id gnl|my_center|LOCUS_19430 62449 63843 gene locus_tag LOCUS_19440 gene ahcY 62449 63843 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_19440 63906 64775 gene locus_tag LOCUS_19450 gene metF 63906 64775 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_19450 64901 65794 gene locus_tag LOCUS_19460 64901 65794 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_19460 65916 66716 gene locus_tag LOCUS_19470 gene cmrA 65916 66716 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730038.1 protein_id gnl|my_center|LOCUS_19470 66783 67289 gene locus_tag LOCUS_19480 66783 67289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 67763 67290 gene locus_tag LOCUS_19490 67763 67290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 67853 68779 gene locus_tag LOCUS_19500 67853 68779 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456728.1 protein_id gnl|my_center|LOCUS_19500 68779 69306 gene locus_tag LOCUS_19510 68779 69306 CDS product DUF6064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976182.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19510 69505 70509 gene locus_tag LOCUS_19520 69505 70509 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186428.1 protein_id gnl|my_center|LOCUS_19520 70737 70498 gene locus_tag LOCUS_19530 70737 70498 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 protein_id gnl|my_center|LOCUS_19530 70973 72256 gene locus_tag LOCUS_19540 70973 72256 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_19540 72327 72545 gene locus_tag LOCUS_19550 72327 72545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence142 1862 270 gene locus_tag LOCUS_19560 1862 270 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_19560 4129 2045 gene locus_tag LOCUS_19570 4129 2045 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_19570 5265 4144 gene locus_tag LOCUS_19580 gene adeT1 5265 4144 CDS product putative multidrug efflux protein AdeT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_19580 5481 6800 gene locus_tag LOCUS_19590 5481 6800 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_19590 6803 7936 gene locus_tag LOCUS_19600 6803 7936 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141711.1 protein_id gnl|my_center|LOCUS_19600 8083 9999 gene locus_tag LOCUS_19610 8083 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 10544 10071 gene locus_tag LOCUS_19620 10544 10071 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_19620 10754 11071 gene locus_tag LOCUS_19630 10754 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 11835 11173 gene locus_tag LOCUS_19640 11835 11173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_19640 12473 11907 gene locus_tag LOCUS_19650 12473 11907 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_19650 12683 13897 gene locus_tag LOCUS_19660 12683 13897 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 protein_id gnl|my_center|LOCUS_19660 14124 15233 gene locus_tag LOCUS_19670 14124 15233 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366371.1 protein_id gnl|my_center|LOCUS_19670 15242 16087 gene locus_tag LOCUS_19680 gene fghA 15242 16087 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766011.1 protein_id gnl|my_center|LOCUS_19680 18636 16180 gene locus_tag LOCUS_19690 gene hrpB 18636 16180 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_19690 18750 19529 gene locus_tag LOCUS_19700 18750 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 20074 19694 gene locus_tag LOCUS_19710 20074 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 20204 21265 gene locus_tag LOCUS_19720 20204 21265 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_19720 21389 22528 gene locus_tag LOCUS_19730 21389 22528 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929848.1 protein_id gnl|my_center|LOCUS_19730 22781 23419 gene locus_tag LOCUS_19740 22781 23419 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_19740 24643 23609 gene locus_tag LOCUS_19750 24643 23609 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268074.1 protein_id gnl|my_center|LOCUS_19750 24939 25703 gene locus_tag LOCUS_19760 24939 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 25711 26031 gene locus_tag LOCUS_19770 25711 26031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 26108 27760 gene locus_tag LOCUS_19780 26108 27760 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_19780 28156 29451 gene locus_tag LOCUS_19790 28156 29451 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969860.1 protein_id gnl|my_center|LOCUS_19790 29504 30304 gene locus_tag LOCUS_19800 gene suhB 29504 30304 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370312.1 protein_id gnl|my_center|LOCUS_19800 31379 30585 gene locus_tag LOCUS_19810 31379 30585 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_19810 31626 31426 gene locus_tag LOCUS_19820 gene thiS 31626 31426 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_19820 32042 31623 gene locus_tag LOCUS_19830 32042 31623 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_19830 32829 32026 gene locus_tag LOCUS_19840 32829 32026 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_19840 33637 32831 gene locus_tag LOCUS_19850 gene rsmA 33637 32831 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 protein_id gnl|my_center|LOCUS_19850 34628 33630 gene locus_tag LOCUS_19860 gene pdxA 34628 33630 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269132.1 protein_id gnl|my_center|LOCUS_19860 36043 34628 gene locus_tag LOCUS_19870 36043 34628 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 protein_id gnl|my_center|LOCUS_19870 38402 36033 gene locus_tag LOCUS_19880 gene lptD 38402 36033 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_19880 38569 39579 gene locus_tag LOCUS_19890 38569 39579 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_19890 39576 40253 gene locus_tag LOCUS_19900 39576 40253 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_19900 40250 40996 gene locus_tag LOCUS_19910 40250 40996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 42263 41304 gene locus_tag LOCUS_19920 42263 41304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 42332 43003 gene locus_tag LOCUS_19930 gene rpe 42332 43003 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304938.1 protein_id gnl|my_center|LOCUS_19930 43000 43686 gene locus_tag LOCUS_19940 43000 43686 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402021.1 protein_id gnl|my_center|LOCUS_19940 43910 45397 gene locus_tag LOCUS_19950 gene trpE 43910 45397 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_19950 45409 46011 gene locus_tag LOCUS_19960 45409 46011 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_19960 46024 47052 gene locus_tag LOCUS_19970 gene trpD 46024 47052 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_19970 47061 47867 gene locus_tag LOCUS_19980 gene trpC 47061 47867 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 protein_id gnl|my_center|LOCUS_19980 48150 48500 gene locus_tag LOCUS_19990 48150 48500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 48588 48893 gene locus_tag LOCUS_20000 48588 48893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 49469 49233 gene locus_tag LOCUS_20010 49469 49233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 49649 50272 gene locus_tag LOCUS_20020 49649 50272 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_20020 51007 51747 gene locus_tag LOCUS_20030 51007 51747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 51946 52458 gene locus_tag LOCUS_20040 51946 52458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 52549 52770 gene locus_tag LOCUS_20050 52549 52770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence143 521 120 gene locus_tag LOCUS_20060 gene fliS 521 120 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_20060 2546 561 gene locus_tag LOCUS_20070 2546 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3451 3008 gene locus_tag LOCUS_20080 3451 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 4995 3532 gene locus_tag LOCUS_20090 4995 3532 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337967.1 protein_id gnl|my_center|LOCUS_20090 5440 5679 gene locus_tag LOCUS_20100 5440 5679 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_20100 5873 6106 gene locus_tag LOCUS_20110 5873 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 6483 8018 gene locus_tag LOCUS_20120 6483 8018 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_20120 8916 8593 gene locus_tag LOCUS_20130 8916 8593 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_20130 9334 8906 gene locus_tag LOCUS_20140 9334 8906 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_20140 9894 11894 gene locus_tag LOCUS_20150 9894 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 12417 12154 gene locus_tag LOCUS_20160 12417 12154 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_20160 12664 12410 gene locus_tag LOCUS_20170 12664 12410 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 protein_id gnl|my_center|LOCUS_20170 13802 13149 gene locus_tag LOCUS_20180 13802 13149 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_20180 14643 13777 gene locus_tag LOCUS_20190 14643 13777 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_20190 14660 14736 gene locus_tag LOCUS_t00380 14660 14736 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14912 16153 gene locus_tag LOCUS_20200 14912 16153 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence144 1529 87 gene locus_tag LOCUS_20210 gene fleQ 1529 87 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_20210 1944 1633 gene locus_tag LOCUS_20220 1944 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2087 2566 gene locus_tag LOCUS_20230 2087 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2677 2940 gene locus_tag LOCUS_20240 2677 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109483.1 protein_id gnl|my_center|LOCUS_20240 3533 3009 gene locus_tag LOCUS_20250 3533 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4185 3574 gene locus_tag LOCUS_20260 gene lexA 4185 3574 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403693.1 protein_id gnl|my_center|LOCUS_20260 4572 4300 gene locus_tag LOCUS_20270 4572 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 4736 5743 gene locus_tag LOCUS_20280 4736 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 5719 6435 gene locus_tag LOCUS_20290 5719 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 10296 6628 gene locus_tag LOCUS_20300 10296 6628 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113331.1 protein_id gnl|my_center|LOCUS_20300 11963 10296 gene locus_tag LOCUS_20310 11963 10296 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402770.1 protein_id gnl|my_center|LOCUS_20310 11962 12153 gene locus_tag LOCUS_20320 11962 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 12849 12199 gene locus_tag LOCUS_20330 12849 12199 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_20330 13134 14441 gene locus_tag LOCUS_20340 13134 14441 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_20340 14456 15664 gene locus_tag LOCUS_20350 14456 15664 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_20350 15867 16871 gene locus_tag LOCUS_20360 15867 16871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838772.1 protein_id gnl|my_center|LOCUS_20360 18244 16925 gene locus_tag LOCUS_20370 18244 16925 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_20370 18489 19898 gene locus_tag LOCUS_20380 18489 19898 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_20380 20118 20043 gene locus_tag LOCUS_t00390 20118 20043 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20201 20125 gene locus_tag LOCUS_t00400 20201 20125 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 20288 20213 gene locus_tag LOCUS_t00410 20288 20213 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20719 20513 gene locus_tag LOCUS_20390 20719 20513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 21732 20890 gene locus_tag LOCUS_20400 21732 20890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 22712 21834 gene locus_tag LOCUS_20410 22712 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 22934 23362 gene locus_tag LOCUS_20420 gene purE 22934 23362 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020895.1 protein_id gnl|my_center|LOCUS_20420 23381 24499 gene locus_tag LOCUS_20430 23381 24499 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_20430 24647 25231 gene locus_tag LOCUS_20440 gene sodB 24647 25231 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072792.1 protein_id gnl|my_center|LOCUS_20440 25470 27551 gene locus_tag LOCUS_20450 25470 27551 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104985.1 protein_id gnl|my_center|LOCUS_20450 27569 28156 gene locus_tag LOCUS_20460 27569 28156 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_20460 28171 30129 gene locus_tag LOCUS_20470 28171 30129 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_20470 32267 30309 gene locus_tag LOCUS_20480 gene xcpQ 32267 30309 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_20480 33173 32331 gene locus_tag LOCUS_20490 33173 32331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 33972 33181 gene locus_tag LOCUS_20500 33972 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 35852 34194 gene locus_tag LOCUS_20510 gene groL 35852 34194 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_20510 36207 35917 gene locus_tag LOCUS_20520 36207 35917 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304675.1 protein_id gnl|my_center|LOCUS_20520 36890 36384 gene locus_tag LOCUS_20530 gene fxsA 36890 36384 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_20530 37007 37768 gene locus_tag LOCUS_20540 37007 37768 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence145 1110 244 gene locus_tag LOCUS_20550 1110 244 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071167.1 protein_id gnl|my_center|LOCUS_20550 4921 1166 gene locus_tag LOCUS_20560 4921 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5013 6083 gene locus_tag LOCUS_20570 5013 6083 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_20570 7364 6051 gene locus_tag LOCUS_20580 gene argA 7364 6051 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 protein_id gnl|my_center|LOCUS_20580 8535 7381 gene locus_tag LOCUS_20590 gene argE 8535 7381 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_20590 9811 8537 gene locus_tag LOCUS_20600 9811 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 9969 10436 gene locus_tag LOCUS_20610 9969 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 11361 10441 gene locus_tag LOCUS_20620 gene argB 11361 10441 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_20620 14061 11431 gene locus_tag LOCUS_20630 14061 11431 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 protein_id gnl|my_center|LOCUS_20630 14605 14144 gene locus_tag LOCUS_20640 gene dut 14605 14144 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_20640 15812 14616 gene locus_tag LOCUS_20650 gene coaBC 15812 14616 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_20650 16017 16691 gene locus_tag LOCUS_20660 gene radC 16017 16691 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053959.1 protein_id gnl|my_center|LOCUS_20660 16894 17130 gene locus_tag LOCUS_20670 gene rpmB 16894 17130 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 protein_id gnl|my_center|LOCUS_20670 17142 17297 gene locus_tag LOCUS_20680 gene rpmG 17142 17297 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_20680 18250 17390 gene locus_tag LOCUS_20690 18250 17390 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_20690 18901 18275 gene locus_tag LOCUS_20700 gene dsbA 18901 18275 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_20700 19252 21294 gene locus_tag LOCUS_20710 gene betT 19252 21294 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131041.1 protein_id gnl|my_center|LOCUS_20710 21312 23018 gene locus_tag LOCUS_20720 gene betA 21312 23018 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214391123.1 protein_id gnl|my_center|LOCUS_20720 24533 23070 gene locus_tag LOCUS_20730 24533 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 25380 24772 gene locus_tag LOCUS_20740 25380 24772 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_20740 25525 26178 gene locus_tag LOCUS_20750 gene yihA 25525 26178 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_20750 27152 26481 gene locus_tag LOCUS_20760 27152 26481 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269213.1 protein_id gnl|my_center|LOCUS_20760 27385 28830 gene locus_tag LOCUS_20770 27385 28830 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 protein_id gnl|my_center|LOCUS_20770 28931 29416 gene locus_tag LOCUS_20780 gene coaD 28931 29416 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 protein_id gnl|my_center|LOCUS_20780 29471 31159 gene locus_tag LOCUS_20790 gene ggt 29471 31159 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_20790 32458 31160 gene locus_tag LOCUS_20800 32458 31160 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888826.1 protein_id gnl|my_center|LOCUS_20800 33330 32464 gene locus_tag LOCUS_20810 33330 32464 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_20810 35471 33351 gene locus_tag LOCUS_20820 gene ppk1 35471 33351 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768431.1 protein_id gnl|my_center|LOCUS_20820 36503 35496 gene locus_tag LOCUS_20830 gene hemB 36503 35496 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096352.1 protein_id gnl|my_center|LOCUS_20830 36893 37540 gene locus_tag LOCUS_20840 36893 37540 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_20840 37527 39230 gene locus_tag LOCUS_20850 37527 39230 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268974.1 protein_id gnl|my_center|LOCUS_20850 39230 39568 gene locus_tag LOCUS_20860 39230 39568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 39666 41321 gene locus_tag LOCUS_20870 gene panP 39666 41321 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942351.1 protein_id gnl|my_center|LOCUS_20870 41824 41558 gene locus_tag LOCUS_20880 41824 41558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 41965 43038 gene locus_tag LOCUS_20890 41965 43038 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_20890 43087 43548 gene locus_tag LOCUS_20900 43087 43548 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102319.1 protein_id gnl|my_center|LOCUS_20900 43703 46249 gene locus_tag LOCUS_20910 43703 46249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 47116 46250 gene locus_tag LOCUS_20920 gene tesB 47116 46250 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268943.1 protein_id gnl|my_center|LOCUS_20920 48383 47226 gene locus_tag LOCUS_20930 48383 47226 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_20930 48594 48427 gene locus_tag LOCUS_20940 48594 48427 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098330.1 protein_id gnl|my_center|LOCUS_20940 48819 49391 gene locus_tag LOCUS_20950 48819 49391 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_20950 49399 49968 gene locus_tag LOCUS_20960 49399 49968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 50022 50909 gene locus_tag LOCUS_20970 gene ubiA 50022 50909 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401244.1 protein_id gnl|my_center|LOCUS_20970 51009 51701 gene locus_tag LOCUS_20980 gene phoB 51009 51701 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 protein_id gnl|my_center|LOCUS_20980 51886 53196 gene locus_tag LOCUS_20990 gene phoR 51886 53196 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence146 235 1533 gene locus_tag LOCUS_21000 235 1533 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 protein_id gnl|my_center|LOCUS_21000 3143 1611 gene locus_tag LOCUS_21010 3143 1611 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_21010 4512 3154 gene locus_tag LOCUS_21020 4512 3154 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_21020 5092 4502 gene locus_tag LOCUS_21030 5092 4502 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_21030 6139 5180 gene locus_tag LOCUS_21040 6139 5180 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403641.1 protein_id gnl|my_center|LOCUS_21040 7895 6492 gene locus_tag LOCUS_21050 7895 6492 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083712.1 protein_id gnl|my_center|LOCUS_21050 9877 7904 gene locus_tag LOCUS_21060 9877 7904 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_21060 10810 9911 gene locus_tag LOCUS_21070 10810 9911 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947556.1 protein_id gnl|my_center|LOCUS_21070 12810 10807 gene locus_tag LOCUS_21080 12810 10807 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_21080 13606 12803 gene locus_tag LOCUS_21090 13606 12803 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477148.1 protein_id gnl|my_center|LOCUS_21090 15216 13609 gene locus_tag LOCUS_21100 gene liuB 15216 13609 CDS product methylcrotonyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100387.1 protein_id gnl|my_center|LOCUS_21100 16382 15213 gene locus_tag LOCUS_21110 gene liuA 16382 15213 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_21110 16858 16418 gene locus_tag LOCUS_21120 gene liuR 16858 16418 CDS product liu genes transcriptional regulator LiuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_21120 17647 17012 gene locus_tag LOCUS_21130 17647 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 17869 19350 gene locus_tag LOCUS_21140 gene xcpR 17869 19350 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_21140 19356 20579 gene locus_tag LOCUS_21150 gene xcpS 19356 20579 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_21150 20637 21074 gene locus_tag LOCUS_21160 gene xcpT 20637 21074 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_21160 21093 21641 gene locus_tag LOCUS_21170 gene gspH 21093 21641 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070567.1 protein_id gnl|my_center|LOCUS_21170 21646 22032 gene locus_tag LOCUS_21180 gene xcpV 21646 22032 CDS product GspI family T2SS minor pseudopilin variant XcpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103528.1 protein_id gnl|my_center|LOCUS_21180 22085 22783 gene locus_tag LOCUS_21190 gene xcpW 22085 22783 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_21190 22770 23765 gene locus_tag LOCUS_21200 gene xcpX 22770 23765 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_21200 23835 25139 gene locus_tag LOCUS_21210 gene xcpY 23835 25139 CDS product GspL family type II secretion system protein XcpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103522.1 protein_id gnl|my_center|LOCUS_21210 25142 25666 gene locus_tag LOCUS_21220 25142 25666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 25671 26330 gene locus_tag LOCUS_21230 25671 26330 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003139068.1 protein_id gnl|my_center|LOCUS_21230 26377 27744 gene locus_tag LOCUS_21240 gene gorA 26377 27744 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_21240 29754 27805 gene locus_tag LOCUS_21250 29754 27805 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114254.1 protein_id gnl|my_center|LOCUS_21250 30739 29747 gene locus_tag LOCUS_21260 30739 29747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 32673 30751 gene locus_tag LOCUS_21270 32673 30751 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_21270 33009 33686 gene locus_tag LOCUS_21280 33009 33686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 33746 34648 gene locus_tag LOCUS_21290 33746 34648 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_21290 35504 34650 gene locus_tag LOCUS_21300 35504 34650 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704900.1 protein_id gnl|my_center|LOCUS_21300 36543 35506 gene locus_tag LOCUS_21310 36543 35506 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531243.1 protein_id gnl|my_center|LOCUS_21310 37387 36533 gene locus_tag LOCUS_21320 37387 36533 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_21320 38466 37378 gene locus_tag LOCUS_21330 38466 37378 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence147 402 1313 gene locus_tag LOCUS_21340 402 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1310 1516 gene locus_tag LOCUS_21350 1310 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1578 2495 gene locus_tag LOCUS_21360 1578 2495 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_21360 3525 2485 gene locus_tag LOCUS_21370 3525 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 5181 3805 gene locus_tag LOCUS_21380 5181 3805 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_21380 7051 5201 gene locus_tag LOCUS_21390 7051 5201 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266754.1 protein_id gnl|my_center|LOCUS_21390 8651 7458 gene locus_tag LOCUS_21400 8651 7458 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence148 2712 361 gene locus_tag LOCUS_21410 2712 361 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_21410 3071 4036 gene locus_tag LOCUS_21420 3071 4036 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385797.1 protein_id gnl|my_center|LOCUS_21420 4125 5159 gene locus_tag LOCUS_21430 4125 5159 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393024.1 protein_id gnl|my_center|LOCUS_21430 5172 6230 gene locus_tag LOCUS_21440 5172 6230 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 protein_id gnl|my_center|LOCUS_21440 6481 7074 gene locus_tag LOCUS_21450 6481 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 7113 7829 gene locus_tag LOCUS_21460 7113 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 7822 9138 gene locus_tag LOCUS_21470 7822 9138 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 protein_id gnl|my_center|LOCUS_21470 9225 10418 gene locus_tag LOCUS_21480 9225 10418 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_21480 11421 10441 gene locus_tag LOCUS_21490 11421 10441 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388516.1 protein_id gnl|my_center|LOCUS_21490 13409 11538 gene locus_tag LOCUS_21500 13409 11538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_21500 13598 14047 gene locus_tag LOCUS_21510 13598 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 <16023 14464 gene locus_tag LOCUS_21520 <16023 14464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705728.1:type VI secretion system tip protein TssI/VgrG >Feature sequence149 590 306 gene locus_tag LOCUS_21530 590 306 CDS product type VI secretion system PAAR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262395.1 protein_id gnl|my_center|LOCUS_21530 4243 623 gene locus_tag LOCUS_21540 gene tssM 4243 623 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 protein_id gnl|my_center|LOCUS_21540 5670 4240 gene locus_tag LOCUS_21550 gene tssA 5670 4240 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705724.1 protein_id gnl|my_center|LOCUS_21550 6347 5715 gene locus_tag LOCUS_21560 gene vasI 6347 5715 CDS product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033927781.1 protein_id gnl|my_center|LOCUS_21560 7927 6347 gene locus_tag LOCUS_21570 gene vasH 7927 6347 CDS product sigma-54 dependent T6SS transcriptional regulator VasH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084793.1 protein_id gnl|my_center|LOCUS_21570 10544 7950 gene locus_tag LOCUS_21580 gene tssH 10544 7950 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705721.1 protein_id gnl|my_center|LOCUS_21580 11344 10559 gene locus_tag LOCUS_21590 gene icmH 11344 10559 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634228.1 protein_id gnl|my_center|LOCUS_21590 12681 11347 gene locus_tag LOCUS_21600 gene tssK 12681 11347 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458007.1 protein_id gnl|my_center|LOCUS_21600 13226 12681 gene locus_tag LOCUS_21610 gene tssJ 13226 12681 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705718.1 protein_id gnl|my_center|LOCUS_21610 14467 13223 gene locus_tag LOCUS_21620 gene tagH 14467 13223 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776432.1 protein_id gnl|my_center|LOCUS_21620 15488 14472 gene locus_tag LOCUS_21630 gene tssG 15488 14472 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 protein_id gnl|my_center|LOCUS_21630 17230 15452 gene locus_tag LOCUS_21640 gene tssF 17230 15452 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 protein_id gnl|my_center|LOCUS_21640 17667 17227 gene locus_tag LOCUS_21650 gene tssE 17667 17227 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705714.1 protein_id gnl|my_center|LOCUS_21650 19152 17671 gene locus_tag LOCUS_21660 gene tssC 19152 17671 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108140.1 protein_id gnl|my_center|LOCUS_21660 19778 19272 gene locus_tag LOCUS_21670 gene tssB 19778 19272 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031391.1 protein_id gnl|my_center|LOCUS_21670 20094 20360 gene locus_tag LOCUS_21680 20094 20360 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_21680 20485 20784 gene locus_tag LOCUS_21690 20485 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 21254 20787 gene locus_tag LOCUS_21700 21254 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 21896 21411 gene locus_tag LOCUS_21710 gene greB 21896 21411 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174758.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence150 1125 46 gene locus_tag LOCUS_21720 gene modC 1125 46 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158969.1 protein_id gnl|my_center|LOCUS_21720 1813 1118 gene locus_tag LOCUS_21730 gene modB 1813 1118 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 protein_id gnl|my_center|LOCUS_21730 2573 1803 gene locus_tag LOCUS_21740 gene modA 2573 1803 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210756.1 protein_id gnl|my_center|LOCUS_21740 3487 3125 gene locus_tag LOCUS_21750 3487 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3642 4385 gene locus_tag LOCUS_21760 gene cysZ 3642 4385 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_21760 4438 7260 gene locus_tag LOCUS_21770 gene rapA 4438 7260 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948005.1 protein_id gnl|my_center|LOCUS_21770 7433 9883 gene locus_tag LOCUS_21780 gene fadE 7433 9883 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368121.1 protein_id gnl|my_center|LOCUS_21780 10091 11323 gene locus_tag LOCUS_21790 10091 11323 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206666.1 protein_id gnl|my_center|LOCUS_21790 11360 11746 gene locus_tag LOCUS_21800 gene crcB 11360 11746 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_21800 12065 12271 gene locus_tag LOCUS_21810 12065 12271 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_21810 14063 12408 gene locus_tag LOCUS_21820 14063 12408 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263455.1 protein_id gnl|my_center|LOCUS_21820 14181 15452 gene locus_tag LOCUS_21830 14181 15452 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339050.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence151 202 903 gene locus_tag LOCUS_21840 202 903 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_21840 1019 1633 gene locus_tag LOCUS_21850 1019 1633 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_21850 2322 1651 gene locus_tag LOCUS_21860 2322 1651 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 protein_id gnl|my_center|LOCUS_21860 2403 3260 gene locus_tag LOCUS_21870 2403 3260 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112168.1 protein_id gnl|my_center|LOCUS_21870 3312 4235 gene locus_tag LOCUS_21880 3312 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095418.1 protein_id gnl|my_center|LOCUS_21880 4246 5733 gene locus_tag LOCUS_21890 4246 5733 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095417.1 protein_id gnl|my_center|LOCUS_21890 8282 5697 gene locus_tag LOCUS_21900 8282 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 8474 10150 gene locus_tag LOCUS_21910 gene ilvD 8474 10150 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_21910 10163 10627 gene locus_tag LOCUS_21920 10163 10627 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268700.1 protein_id gnl|my_center|LOCUS_21920 10635 11546 gene locus_tag LOCUS_21930 gene pbpG 10635 11546 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267664.1 protein_id gnl|my_center|LOCUS_21930 11546 12049 gene locus_tag LOCUS_21940 11546 12049 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_21940 12911 12204 gene locus_tag LOCUS_21950 gene rsuA 12911 12204 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208832.1 protein_id gnl|my_center|LOCUS_21950 13948 12914 gene locus_tag LOCUS_21960 13948 12914 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448174.1 protein_id gnl|my_center|LOCUS_21960 14683 14009 gene locus_tag LOCUS_21970 14683 14009 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_21970 14900 15634 gene locus_tag LOCUS_21980 14900 15634 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_21980 15696 17219 gene locus_tag LOCUS_21990 15696 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 17293 17688 gene locus_tag LOCUS_22000 17293 17688 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_22000 18863 17694 gene locus_tag LOCUS_22010 18863 17694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 19492 18947 gene locus_tag LOCUS_22020 gene nudE 19492 18947 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017765235.1 protein_id gnl|my_center|LOCUS_22020 20683 19493 gene locus_tag LOCUS_22030 20683 19493 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence152 460 1836 gene locus_tag LOCUS_22040 460 1836 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_22040 2475 2074 gene locus_tag LOCUS_22050 2475 2074 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769424.1 protein_id gnl|my_center|LOCUS_22050 3688 2582 gene locus_tag LOCUS_22060 3688 2582 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_22060 3960 4850 gene locus_tag LOCUS_22070 3960 4850 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_22070 5767 4949 gene locus_tag LOCUS_22080 5767 4949 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_22080 6909 5866 gene locus_tag LOCUS_22090 6909 5866 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121430.1 protein_id gnl|my_center|LOCUS_22090 8024 7089 gene locus_tag LOCUS_22100 8024 7089 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_22100 9755 8130 gene locus_tag LOCUS_22110 9755 8130 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190494.1 protein_id gnl|my_center|LOCUS_22110 9937 10335 gene locus_tag LOCUS_22120 9937 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 11262 10372 gene locus_tag LOCUS_22130 11262 10372 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_22130 11584 12024 gene locus_tag LOCUS_22140 11584 12024 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381003.1 protein_id gnl|my_center|LOCUS_22140 12063 13457 gene locus_tag LOCUS_22150 12063 13457 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_22150 13636 14625 gene locus_tag LOCUS_22160 13636 14625 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_22160 14693 16105 gene locus_tag LOCUS_22170 14693 16105 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037468799.1 protein_id gnl|my_center|LOCUS_22170 16199 16996 gene locus_tag LOCUS_22180 16199 16996 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_22180 17101 17730 gene locus_tag LOCUS_22190 17101 17730 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_22190 18243 17722 gene locus_tag LOCUS_22200 18243 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 18351 19007 gene locus_tag LOCUS_22210 18351 19007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_22210 19007 20272 gene locus_tag LOCUS_22220 19007 20272 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864646.1 protein_id gnl|my_center|LOCUS_22220 20710 20297 gene locus_tag LOCUS_22230 20710 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 22941 20779 gene locus_tag LOCUS_22240 22941 20779 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404623.1 protein_id gnl|my_center|LOCUS_22240 23081 24055 gene locus_tag LOCUS_22250 23081 24055 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 protein_id gnl|my_center|LOCUS_22250 24424 24137 gene locus_tag LOCUS_22260 24424 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 25265 24627 gene locus_tag LOCUS_22270 25265 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 26983 25262 gene locus_tag LOCUS_22280 26983 25262 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170818.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence153 1097 441 gene locus_tag LOCUS_22290 1097 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2407 2153 gene locus_tag LOCUS_22300 2407 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3376 2531 gene locus_tag LOCUS_22310 3376 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4929 3373 gene locus_tag LOCUS_22320 4929 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 6410 4965 gene locus_tag LOCUS_22330 6410 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 6872 7330 gene locus_tag LOCUS_22340 6872 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 protein_id gnl|my_center|LOCUS_22340 7317 7553 gene locus_tag LOCUS_22350 7317 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 8507 7656 gene locus_tag LOCUS_22360 8507 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 9930 9109 gene locus_tag LOCUS_22370 9930 9109 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_22370 11448 9952 gene locus_tag LOCUS_22380 11448 9952 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416069.1 protein_id gnl|my_center|LOCUS_22380 11601 12611 gene locus_tag LOCUS_22390 11601 12611 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416068.1 protein_id gnl|my_center|LOCUS_22390 13559 12645 gene locus_tag LOCUS_22400 13559 12645 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_22400 14277 13546 gene locus_tag LOCUS_22410 14277 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 15813 14506 gene locus_tag LOCUS_22420 15813 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 16208 15810 gene locus_tag LOCUS_22430 16208 15810 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642555.1 protein_id gnl|my_center|LOCUS_22430 16402 17739 gene locus_tag LOCUS_22440 16402 17739 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626009.1 protein_id gnl|my_center|LOCUS_22440 17774 18052 gene locus_tag LOCUS_22450 17774 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 18533 18135 gene locus_tag LOCUS_22460 18533 18135 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_22460 18788 19810 gene locus_tag LOCUS_22470 18788 19810 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_22470 19938 20564 gene locus_tag LOCUS_22480 19938 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 20577 21269 gene locus_tag LOCUS_22490 20577 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 22018 21275 gene locus_tag LOCUS_22500 22018 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_22500 22936 22091 gene locus_tag LOCUS_22510 22936 22091 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262037.1 protein_id gnl|my_center|LOCUS_22510 23082 23921 gene locus_tag LOCUS_22520 23082 23921 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_22520 24088 24843 gene locus_tag LOCUS_22530 24088 24843 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_22530 26631 24925 gene locus_tag LOCUS_22540 26631 24925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 27876 26962 gene locus_tag LOCUS_22550 27876 26962 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072210.1 protein_id gnl|my_center|LOCUS_22550 28186 28638 gene locus_tag LOCUS_22560 28186 28638 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 protein_id gnl|my_center|LOCUS_22560 <29176 28672 gene locus_tag LOCUS_22570 <29176 28672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087882.1:PleD family two-component system response regulator >Feature sequence154 1246 461 gene locus_tag LOCUS_22580 gene motD 1246 461 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_22580 1996 1259 gene locus_tag LOCUS_22590 1996 1259 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_22590 3159 1996 gene locus_tag LOCUS_22600 3159 1996 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268432.1 protein_id gnl|my_center|LOCUS_22600 5407 3221 gene locus_tag LOCUS_22610 5407 3221 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_22610 6226 5426 gene locus_tag LOCUS_22620 6226 5426 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766975.1 protein_id gnl|my_center|LOCUS_22620 6630 6244 gene locus_tag LOCUS_22630 gene cheY 6630 6244 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_22630 7548 6886 gene locus_tag LOCUS_22640 gene fliA 7548 6886 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_22640 8496 7684 gene locus_tag LOCUS_22650 gene fleN 8496 7684 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_22650 9826 8546 gene locus_tag LOCUS_22660 gene flhF 9826 8546 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114281.1 protein_id gnl|my_center|LOCUS_22660 12050 9882 gene locus_tag LOCUS_22670 gene flhA 12050 9882 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_22670 12248 12886 gene locus_tag LOCUS_22680 gene upp 12248 12886 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930157.1 protein_id gnl|my_center|LOCUS_22680 12889 14121 gene locus_tag LOCUS_22690 12889 14121 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266747.1 protein_id gnl|my_center|LOCUS_22690 14265 15113 gene locus_tag LOCUS_22700 14265 15113 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_22700 16574 15120 gene locus_tag LOCUS_22710 16574 15120 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_22710 17788 16652 gene locus_tag LOCUS_22720 gene flhB 17788 16652 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_22720 18598 17810 gene locus_tag LOCUS_22730 gene fliR 18598 17810 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_22730 18870 18601 gene locus_tag LOCUS_22740 gene fliQ 18870 18601 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_22740 19640 18879 gene locus_tag LOCUS_22750 gene fliP 19640 18879 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083052.1 protein_id gnl|my_center|LOCUS_22750 20110 19640 gene locus_tag LOCUS_22760 gene fliO 20110 19640 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083051.1 protein_id gnl|my_center|LOCUS_22760 20667 20110 gene locus_tag LOCUS_22770 gene fliN 20667 20110 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083049.1 protein_id gnl|my_center|LOCUS_22770 21661 20660 gene locus_tag LOCUS_22780 gene fliM 21661 20660 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_22780 22223 21714 gene locus_tag LOCUS_22790 gene fliL 22223 21714 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_22790 23542 22343 gene locus_tag LOCUS_22800 23542 22343 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895568.1 protein_id gnl|my_center|LOCUS_22800 23967 23620 gene locus_tag LOCUS_22810 gene htpB 23967 23620 CDS product two-component system sensor histidine kinase HtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_22810 25714 23939 gene locus_tag LOCUS_22820 gene hsbR 25714 23939 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_22820 26022 25717 gene locus_tag LOCUS_22830 gene hsbA 26022 25717 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_22830 26575 26126 gene locus_tag LOCUS_22840 26575 26126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 27918 26572 gene locus_tag LOCUS_22850 gene fliI 27918 26572 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_22850 28804 27899 gene locus_tag LOCUS_22860 gene fliH 28804 27899 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_22860 29838 28804 gene locus_tag LOCUS_22870 gene fliG 29838 28804 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268442.1 protein_id gnl|my_center|LOCUS_22870 31570 29831 gene locus_tag LOCUS_22880 gene fliF 31570 29831 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_22880 32032 31586 gene locus_tag LOCUS_22890 gene fliE 32032 31586 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507679.1 protein_id gnl|my_center|LOCUS_22890 33842 32415 gene locus_tag LOCUS_22900 gene fleR 33842 32415 CDS product sigma-54-dependent response regulator transcription factor FleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_22900 35117 33855 gene locus_tag LOCUS_22910 gene fleS 35117 33855 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence155 620 4027 gene locus_tag LOCUS_22920 620 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence156 66 236 gene locus_tag LOCUS_22930 66 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 619 963 gene locus_tag LOCUS_22940 619 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22940 1340 1152 gene locus_tag LOCUS_22950 1340 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2158 1394 gene locus_tag LOCUS_22960 gene cysQ 2158 1394 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_22960 2453 2378 gene locus_tag LOCUS_t00420 2453 2378 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2946 2500 gene locus_tag LOCUS_22970 gene pilA 2946 2500 CDS product type 4a pilus biogenesis protein PilA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112842.1 protein_id gnl|my_center|LOCUS_22970 4427 3030 gene locus_tag LOCUS_22980 gene vpsL 4427 3030 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889848.1 protein_id gnl|my_center|LOCUS_22980 4762 4424 gene locus_tag LOCUS_22990 4762 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 5693 5097 gene locus_tag LOCUS_23000 5693 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7056 5698 gene locus_tag LOCUS_23010 7056 5698 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965385.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence157 501 40 gene locus_tag LOCUS_23020 gene moaE 501 40 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705489.1 protein_id gnl|my_center|LOCUS_23020 764 504 gene locus_tag LOCUS_23030 gene moaD 764 504 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367604.1 protein_id gnl|my_center|LOCUS_23030 1981 761 gene locus_tag LOCUS_23040 1981 761 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 protein_id gnl|my_center|LOCUS_23040 2554 1982 gene locus_tag LOCUS_23050 gene moaB 2554 1982 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 protein_id gnl|my_center|LOCUS_23050 2935 4197 gene locus_tag LOCUS_23060 gene rho 2935 4197 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_23060 4292 5764 gene locus_tag LOCUS_23070 gene ubiD 4292 5764 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_23070 5754 6755 gene locus_tag LOCUS_23080 5754 6755 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_23080 8424 7189 gene locus_tag LOCUS_23090 8424 7189 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_23090 9563 8421 gene locus_tag LOCUS_23100 9563 8421 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 protein_id gnl|my_center|LOCUS_23100 10225 9572 gene locus_tag LOCUS_23110 gene hemD 10225 9572 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211464.1 protein_id gnl|my_center|LOCUS_23110 11288 10347 gene locus_tag LOCUS_23120 gene hemC 11288 10347 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_23120 12091 11336 gene locus_tag LOCUS_23130 12091 11336 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_23130 13158 12088 gene locus_tag LOCUS_23140 gene algZ 13158 12088 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_23140 13231 14628 gene locus_tag LOCUS_23150 gene argH 13231 14628 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_23150 17133 14668 gene locus_tag LOCUS_23160 17133 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 17230 20076 gene locus_tag LOCUS_23170 17230 20076 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266242.1 protein_id gnl|my_center|LOCUS_23170 20296 21546 gene locus_tag LOCUS_23180 gene lysA 20296 21546 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_23180 21553 22515 gene locus_tag LOCUS_23190 gene dapF 21553 22515 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103038.1 protein_id gnl|my_center|LOCUS_23190 22544 23293 gene locus_tag LOCUS_23200 22544 23293 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_23200 23305 24231 gene locus_tag LOCUS_23210 gene xerC 23305 24231 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_23210 24295 25974 gene locus_tag LOCUS_23220 24295 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 25971 29141 gene locus_tag LOCUS_23230 25971 29141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 29514 29143 gene locus_tag LOCUS_23240 29514 29143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 29717 30331 gene locus_tag LOCUS_23250 29717 30331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_23250 30334 32583 gene locus_tag LOCUS_23260 gene plpD 30334 32583 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_23260 33346 32666 gene locus_tag LOCUS_23270 33346 32666 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765300.1 protein_id gnl|my_center|LOCUS_23270 35052 33622 gene locus_tag LOCUS_23280 gene cls 35052 33622 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 protein_id gnl|my_center|LOCUS_23280 36089 35049 gene locus_tag LOCUS_23290 36089 35049 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_23290 36829 36383 gene locus_tag LOCUS_23300 36829 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 36902 37711 gene locus_tag LOCUS_23310 36902 37711 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_23310 37836 38930 gene locus_tag LOCUS_23320 37836 38930 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_23320 38923 39366 gene locus_tag LOCUS_23330 38923 39366 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769671.1 protein_id gnl|my_center|LOCUS_23330 39485 40432 gene locus_tag LOCUS_23340 39485 40432 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051773499.1 protein_id gnl|my_center|LOCUS_23340 42300 40444 gene locus_tag LOCUS_23350 42300 40444 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 protein_id gnl|my_center|LOCUS_23350 43175 42351 gene locus_tag LOCUS_23360 gene tcdA 43175 42351 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707894.1 protein_id gnl|my_center|LOCUS_23360 45318 43543 gene locus_tag LOCUS_23370 45318 43543 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103343.1 protein_id gnl|my_center|LOCUS_23370 45460 46182 gene locus_tag LOCUS_23380 45460 46182 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_23380 46851 46198 gene locus_tag LOCUS_23390 gene chrR 46851 46198 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_23390 47447 46848 gene locus_tag LOCUS_23400 47447 46848 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_23400 49473 47557 gene locus_tag LOCUS_23410 gene speA 49473 47557 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071982.1 protein_id gnl|my_center|LOCUS_23410 49563 50423 gene locus_tag LOCUS_23420 gene speE 49563 50423 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_23420 50531 50743 gene locus_tag LOCUS_23430 50531 50743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 52388 50913 gene locus_tag LOCUS_23440 52388 50913 CDS product IS1182-like element ISPsy27 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266183.1 protein_id gnl|my_center|LOCUS_23440 53700 52435 gene locus_tag LOCUS_23450 53700 52435 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_23450 54106 53768 gene locus_tag LOCUS_23460 gene glnK 54106 53768 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_23460 54400 54651 gene locus_tag LOCUS_23470 54400 54651 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198021.1 protein_id gnl|my_center|LOCUS_23470 54727 56247 gene locus_tag LOCUS_23480 54727 56247 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_23480 56309 57025 gene locus_tag LOCUS_23490 gene trmB 56309 57025 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 protein_id gnl|my_center|LOCUS_23490 58402 57260 gene locus_tag LOCUS_23500 gene hemW 58402 57260 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_23500 59009 58395 gene locus_tag LOCUS_23510 59009 58395 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369727.1 protein_id gnl|my_center|LOCUS_23510 59468 59019 gene locus_tag LOCUS_23520 59468 59019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 60072 59479 gene locus_tag LOCUS_23530 gene metW 60072 59479 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 protein_id gnl|my_center|LOCUS_23530 61217 60069 gene locus_tag LOCUS_23540 61217 60069 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266425.1 protein_id gnl|my_center|LOCUS_23540 63249 61285 gene locus_tag LOCUS_23550 63249 61285 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_23550 63976 63392 gene locus_tag LOCUS_23560 63976 63392 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_23560 64888 64052 gene locus_tag LOCUS_23570 gene proC 64888 64052 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_23570 65678 64983 gene locus_tag LOCUS_23580 65678 64983 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_23580 65869 66903 gene locus_tag LOCUS_23590 gene pilT 65869 66903 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_23590 66923 68044 gene locus_tag LOCUS_23600 gene pilU 66923 68044 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_23600 68333 69757 gene locus_tag LOCUS_23610 68333 69757 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054987912.1 protein_id gnl|my_center|LOCUS_23610 69887 70855 gene locus_tag LOCUS_23620 69887 70855 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_23620 70852 71640 gene locus_tag LOCUS_23630 70852 71640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642350.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence158 140 1069 gene locus_tag LOCUS_23640 gene cysD 140 1069 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094311.1 protein_id gnl|my_center|LOCUS_23640 3570 1120 gene locus_tag LOCUS_23650 3570 1120 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993482.1 protein_id gnl|my_center|LOCUS_23650 5156 3567 gene locus_tag LOCUS_23660 5156 3567 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292956.1 protein_id gnl|my_center|LOCUS_23660 6162 5272 gene locus_tag LOCUS_23670 6162 5272 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_23670 6383 6213 gene locus_tag LOCUS_23680 6383 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 7139 6474 gene locus_tag LOCUS_23690 7139 6474 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_23690 7768 7151 gene locus_tag LOCUS_23700 7768 7151 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_23700 8515 7832 gene locus_tag LOCUS_23710 8515 7832 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_23710 11197 9104 gene locus_tag LOCUS_23720 gene recD 11197 9104 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 protein_id gnl|my_center|LOCUS_23720 14844 11194 gene locus_tag LOCUS_23730 gene recB 14844 11194 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103276.1 protein_id gnl|my_center|LOCUS_23730 18317 14841 gene locus_tag LOCUS_23740 gene recC 18317 14841 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_23740 18483 19511 gene locus_tag LOCUS_23750 18483 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 20160 19486 gene locus_tag LOCUS_23760 20160 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 21429 20446 gene locus_tag LOCUS_23770 21429 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 21550 22017 gene locus_tag LOCUS_23780 21550 22017 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_23780 22467 22030 gene locus_tag LOCUS_23790 22467 22030 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_23790 23606 22467 gene locus_tag LOCUS_23800 23606 22467 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_23800 23690 24295 gene locus_tag LOCUS_23810 23690 24295 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_23810 25089 24301 gene locus_tag LOCUS_23820 gene speD 25089 24301 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_23820 25605 25183 gene locus_tag LOCUS_23830 25605 25183 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_23830 25806 26447 gene locus_tag LOCUS_23840 gene crp 25806 26447 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_23840 27385 26522 gene locus_tag LOCUS_23850 27385 26522 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence159 1864 650 gene locus_tag LOCUS_23860 1864 650 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_23860 3129 1861 gene locus_tag LOCUS_23870 gene ubiH 3129 1861 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105379.1 protein_id gnl|my_center|LOCUS_23870 4457 3141 gene locus_tag LOCUS_23880 gene pepP 4457 3141 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_23880 5071 4475 gene locus_tag LOCUS_23890 5071 4475 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802891.1 protein_id gnl|my_center|LOCUS_23890 5246 5452 gene locus_tag LOCUS_23900 5246 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 5452 5760 gene locus_tag LOCUS_23910 5452 5760 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_23910 6038 6727 gene locus_tag LOCUS_23920 6038 6727 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105381.1 protein_id gnl|my_center|LOCUS_23920 7020 6871 gene locus_tag LOCUS_23930 7020 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 8967 7279 gene locus_tag LOCUS_23940 gene ilvA 8967 7279 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_23940 8966 9643 gene locus_tag LOCUS_23950 gene rpiA 8966 9643 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_23950 9982 11121 gene locus_tag LOCUS_23960 9982 11121 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_23960 11262 11789 gene locus_tag LOCUS_23970 gene ppa 11262 11789 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093248.1 protein_id gnl|my_center|LOCUS_23970 12891 11842 gene locus_tag LOCUS_23980 12891 11842 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence160 1870 239 gene locus_tag LOCUS_23990 1870 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23990 2450 1812 gene locus_tag LOCUS_24000 2450 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24000 3894 2521 gene locus_tag LOCUS_24010 3894 2521 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263062.1 protein_id gnl|my_center|LOCUS_24010 5621 3891 gene locus_tag LOCUS_24020 5621 3891 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211648.1 protein_id gnl|my_center|LOCUS_24020 6603 5626 gene locus_tag LOCUS_24030 gene iucB 6603 5626 CDS product N(6)-hydroxylysine O-acetyltransferase IucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287501.1 protein_id gnl|my_center|LOCUS_24030 8348 6609 gene locus_tag LOCUS_24040 8348 6609 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263059.1 protein_id gnl|my_center|LOCUS_24040 8515 9699 gene locus_tag LOCUS_24050 8515 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 10390 9665 gene locus_tag LOCUS_24060 10390 9665 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_24060 11157 10387 gene locus_tag LOCUS_24070 gene tatC 11157 10387 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765541.1 protein_id gnl|my_center|LOCUS_24070 11515 11180 gene locus_tag LOCUS_24080 gene tatB 11515 11180 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 protein_id gnl|my_center|LOCUS_24080 11781 11527 gene locus_tag LOCUS_24090 gene tatA 11781 11527 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 protein_id gnl|my_center|LOCUS_24090 12204 11851 gene locus_tag LOCUS_24100 12204 11851 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_24100 12611 12201 gene locus_tag LOCUS_24110 gene hisI 12611 12201 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_24110 14267 12642 gene locus_tag LOCUS_24120 gene ubiB 14267 12642 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_24120 14890 14264 gene locus_tag LOCUS_24130 14890 14264 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_24130 15663 14890 gene locus_tag LOCUS_24140 gene ubiE 15663 14890 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_24140 15837 16118 gene locus_tag LOCUS_24150 15837 16118 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036767.1 protein_id gnl|my_center|LOCUS_24150 17172 16249 gene locus_tag LOCUS_24160 17172 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 17577 18953 gene locus_tag LOCUS_24170 17577 18953 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_24170 19032 20408 gene locus_tag LOCUS_24180 19032 20408 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_24180 20424 20900 gene locus_tag LOCUS_24190 20424 20900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 21882 20944 gene locus_tag LOCUS_24200 21882 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 22008 22652 gene locus_tag LOCUS_24210 gene msrA 22008 22652 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_24210 22805 23227 gene locus_tag LOCUS_24220 gene msrB 22805 23227 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence161 1190 93 gene locus_tag LOCUS_24230 gene zapE 1190 93 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_24230 1436 1885 gene locus_tag LOCUS_24240 1436 1885 CDS product DUF1043 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620321.1 protein_id gnl|my_center|LOCUS_24240 1889 2638 gene locus_tag LOCUS_24250 1889 2638 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_24250 3982 2903 gene locus_tag LOCUS_24260 gene hisC 3982 2903 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_24260 5307 3979 gene locus_tag LOCUS_24270 gene hisD 5307 3979 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_24270 5983 5345 gene locus_tag LOCUS_24280 gene hisG 5983 5345 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766526.1 protein_id gnl|my_center|LOCUS_24280 7258 5996 gene locus_tag LOCUS_24290 gene murA 7258 5996 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_24290 7513 7274 gene locus_tag LOCUS_24300 7513 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 7923 7594 gene locus_tag LOCUS_24310 7923 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 8573 7920 gene locus_tag LOCUS_24320 8573 7920 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_24320 9060 8611 gene locus_tag LOCUS_24330 gene mlaD 9060 8611 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_24330 9842 9060 gene locus_tag LOCUS_24340 gene mlaE 9842 9060 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_24340 10651 9839 gene locus_tag LOCUS_24350 10651 9839 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 protein_id gnl|my_center|LOCUS_24350 10915 11883 gene locus_tag LOCUS_24360 10915 11883 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_24360 11890 12864 gene locus_tag LOCUS_24370 gene kdsD 11890 12864 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_24370 12896 13441 gene locus_tag LOCUS_24380 12896 13441 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413390.1 protein_id gnl|my_center|LOCUS_24380 13452 14045 gene locus_tag LOCUS_24390 13452 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 14020 14568 gene locus_tag LOCUS_24400 gene lptA 14020 14568 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689542.1 protein_id gnl|my_center|LOCUS_24400 14568 15293 gene locus_tag LOCUS_24410 gene lptB 14568 15293 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_24410 15533 17023 gene locus_tag LOCUS_24420 15533 17023 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_24420 17143 17451 gene locus_tag LOCUS_24430 gene hpf 17143 17451 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_24430 17481 17948 gene locus_tag LOCUS_24440 gene ptsN 17481 17948 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_24440 17959 18852 gene locus_tag LOCUS_24450 gene rapZ 17959 18852 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_24450 18849 19118 gene locus_tag LOCUS_24460 18849 19118 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_24460 19782 19246 gene locus_tag LOCUS_24470 gene yjgA 19782 19246 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 protein_id gnl|my_center|LOCUS_24470 21153 19792 gene locus_tag LOCUS_24480 gene mgtE 21153 19792 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073704.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence162 2382 1378 gene locus_tag LOCUS_24490 2382 1378 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_24490 3508 2447 gene locus_tag LOCUS_24500 gene arsB 3508 2447 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_24500 4271 3510 gene locus_tag LOCUS_24510 4271 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 4401 4652 gene locus_tag LOCUS_24520 4401 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24520 5465 4653 gene locus_tag LOCUS_24530 gene znuB 5465 4653 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_24530 6210 5455 gene locus_tag LOCUS_24540 gene znuC 6210 5455 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266293.1 protein_id gnl|my_center|LOCUS_24540 6733 6200 gene locus_tag LOCUS_24550 gene zur 6733 6200 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_24550 7237 6773 gene locus_tag LOCUS_24560 7237 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 8301 7249 gene locus_tag LOCUS_24570 8301 7249 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_24570 15557 8298 gene locus_tag LOCUS_24580 gene chpA 15557 8298 CDS product chemotaxis signal transduction system protein ChpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114893.1 protein_id gnl|my_center|LOCUS_24580 16468 15569 gene locus_tag LOCUS_24590 gene pilK 16468 15569 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_24590 18612 16498 gene locus_tag LOCUS_24600 gene pilJ 18612 16498 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_24600 19315 18770 gene locus_tag LOCUS_24610 19315 18770 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_24610 19698 19336 gene locus_tag LOCUS_24620 gene pilH 19698 19336 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_24620 20124 19732 gene locus_tag LOCUS_24630 gene pilG 20124 19732 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_24630 20458 21402 gene locus_tag LOCUS_24640 gene gshB 20458 21402 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_24640 21421 22290 gene locus_tag LOCUS_24650 21421 22290 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_24650 22292 22891 gene locus_tag LOCUS_24660 22292 22891 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_24660 22884 23171 gene locus_tag LOCUS_24670 22884 23171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24670 23171 23308 gene locus_tag LOCUS_24680 23171 23308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 23633 24160 gene locus_tag LOCUS_24690 gene pyrR 23633 24160 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_24690 24157 25167 gene locus_tag LOCUS_24700 24157 25167 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736952.1 protein_id gnl|my_center|LOCUS_24700 25164 26498 gene locus_tag LOCUS_24710 25164 26498 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266429.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence163 870 94 gene locus_tag LOCUS_24720 870 94 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_24720 1099 1920 gene locus_tag LOCUS_24730 1099 1920 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706380.1 protein_id gnl|my_center|LOCUS_24730 1917 3359 gene locus_tag LOCUS_24740 1917 3359 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216936.1 protein_id gnl|my_center|LOCUS_24740 3356 4030 gene locus_tag LOCUS_24750 3356 4030 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_24750 4027 6843 gene locus_tag LOCUS_24760 4027 6843 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_24760 7367 8440 gene locus_tag LOCUS_24770 7367 8440 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970762.1 protein_id gnl|my_center|LOCUS_24770 8543 9181 gene locus_tag LOCUS_24780 8543 9181 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975850.1 protein_id gnl|my_center|LOCUS_24780 9181 10545 gene locus_tag LOCUS_24790 9181 10545 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_24790 10686 11324 gene locus_tag LOCUS_24800 10686 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 11621 12175 gene locus_tag LOCUS_24810 11621 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 12178 14067 gene locus_tag LOCUS_24820 12178 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence164 3148 26 gene locus_tag LOCUS_24830 3148 26 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453944.1 protein_id gnl|my_center|LOCUS_24830 4566 3157 gene locus_tag LOCUS_24840 4566 3157 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_24840 5263 4571 gene locus_tag LOCUS_24850 gene imuA 5263 4571 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962596.1 protein_id gnl|my_center|LOCUS_24850 5402 5743 gene locus_tag LOCUS_24860 5402 5743 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 protein_id gnl|my_center|LOCUS_24860 5744 5908 gene locus_tag LOCUS_24870 5744 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 6210 6022 gene locus_tag LOCUS_24880 6210 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 7008 6256 gene locus_tag LOCUS_24890 7008 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 7298 7642 gene locus_tag LOCUS_24900 7298 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 7775 8446 gene locus_tag LOCUS_24910 7775 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 8534 9928 gene locus_tag LOCUS_24920 8534 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 10015 10386 gene locus_tag LOCUS_24930 10015 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 10410 11195 gene locus_tag LOCUS_24940 10410 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24940 11386 13113 gene locus_tag LOCUS_24950 11386 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 13362 13958 gene locus_tag LOCUS_24960 13362 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 14315 14061 gene locus_tag LOCUS_24970 gene yoeB 14315 14061 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_24970 14563 14312 gene locus_tag LOCUS_24980 gene yefM 14563 14312 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_24980 14707 14892 gene locus_tag LOCUS_24990 14707 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 14978 15220 gene locus_tag LOCUS_25000 14978 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 15217 15480 gene locus_tag LOCUS_25010 15217 15480 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence165 4446 199 gene locus_tag LOCUS_25020 4446 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 5054 4638 gene locus_tag LOCUS_25030 5054 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 5811 5044 gene locus_tag LOCUS_25040 5811 5044 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262979.1 protein_id gnl|my_center|LOCUS_25040 6293 5811 gene locus_tag LOCUS_25050 6293 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 6718 6290 gene locus_tag LOCUS_25060 6718 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 7220 6741 gene locus_tag LOCUS_25070 7220 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 7752 7258 gene locus_tag LOCUS_25080 7752 7258 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 protein_id gnl|my_center|LOCUS_25080 8330 7794 gene locus_tag LOCUS_25090 8330 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 9559 8333 gene locus_tag LOCUS_25100 gene mshG 9559 8333 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_25100 11322 9562 gene locus_tag LOCUS_25110 gene mshE 11322 9562 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_25110 12484 11330 gene locus_tag LOCUS_25120 12484 11330 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819183.1 protein_id gnl|my_center|LOCUS_25120 13314 12481 gene locus_tag LOCUS_25130 13314 12481 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_25130 15043 13316 gene locus_tag LOCUS_25140 gene mshL 15043 13316 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_25140 15383 15069 gene locus_tag LOCUS_25150 15383 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 16056 15385 gene locus_tag LOCUS_25160 16056 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 16669 16046 gene locus_tag LOCUS_25170 16669 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 17589 16675 gene locus_tag LOCUS_25180 17589 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 18018 17809 gene locus_tag LOCUS_25190 18018 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 19764 18406 gene locus_tag LOCUS_25200 19764 18406 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_25200 19922 20686 gene locus_tag LOCUS_25210 gene pomA 19922 20686 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362404.1 protein_id gnl|my_center|LOCUS_25210 20714 21649 gene locus_tag LOCUS_25220 20714 21649 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 protein_id gnl|my_center|LOCUS_25220 21667 24531 gene locus_tag LOCUS_25230 gene uvrA 21667 24531 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_25230 24895 24644 gene locus_tag LOCUS_25240 24895 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 26075 25071 gene locus_tag LOCUS_25250 gene rpoA 26075 25071 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_25250 26733 26113 gene locus_tag LOCUS_25260 gene rpsD 26733 26113 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383146.1 protein_id gnl|my_center|LOCUS_25260 27141 26752 gene locus_tag LOCUS_25270 gene rpsK 27141 26752 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_25270 27511 27155 gene locus_tag LOCUS_25280 gene rpsM 27511 27155 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_25280 29111 27795 gene locus_tag LOCUS_25290 gene secY 29111 27795 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555469.1 protein_id gnl|my_center|LOCUS_25290 29563 29129 gene locus_tag LOCUS_25300 gene rplO 29563 29129 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 protein_id gnl|my_center|LOCUS_25300 29750 29565 gene locus_tag LOCUS_25310 gene rpmD 29750 29565 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140434.1 protein_id gnl|my_center|LOCUS_25310 30255 29755 gene locus_tag LOCUS_25320 gene rpsE 30255 29755 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317099.1 protein_id gnl|my_center|LOCUS_25320 30593 30267 gene locus_tag LOCUS_25330 gene rplR 30593 30267 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555473.1 protein_id gnl|my_center|LOCUS_25330 31157 30624 gene locus_tag LOCUS_25340 gene rplF 31157 30624 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_25340 31559 31167 gene locus_tag LOCUS_25350 gene rpsH 31559 31167 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_25350 31948 31643 gene locus_tag LOCUS_25360 gene rpsN 31948 31643 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_25360 32500 31961 gene locus_tag LOCUS_25370 gene rplE 32500 31961 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 protein_id gnl|my_center|LOCUS_25370 32836 32516 gene locus_tag LOCUS_25380 gene rplX 32836 32516 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 protein_id gnl|my_center|LOCUS_25380 33221 32853 gene locus_tag LOCUS_25390 gene rplN 33221 32853 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_25390 33546 33280 gene locus_tag LOCUS_25400 gene rpsQ 33546 33280 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555480.1 protein_id gnl|my_center|LOCUS_25400 33739 33548 gene locus_tag LOCUS_25410 gene rpmC 33739 33548 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647192.1 protein_id gnl|my_center|LOCUS_25410 34152 33739 gene locus_tag LOCUS_25420 gene rplP 34152 33739 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_25420 34848 34165 gene locus_tag LOCUS_25430 gene rpsC 34848 34165 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_25430 35192 34860 gene locus_tag LOCUS_25440 gene rplV 35192 34860 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 protein_id gnl|my_center|LOCUS_25440 35484 35209 gene locus_tag LOCUS_25450 gene rpsS 35484 35209 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027275662.1 protein_id gnl|my_center|LOCUS_25450 36335 35508 gene locus_tag LOCUS_25460 gene rplB 36335 35508 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489461.1 protein_id gnl|my_center|LOCUS_25460 36646 36353 gene locus_tag LOCUS_25470 gene rplW 36646 36353 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_25470 37248 36643 gene locus_tag LOCUS_25480 gene rplD 37248 36643 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093737.1 protein_id gnl|my_center|LOCUS_25480 37898 37260 gene locus_tag LOCUS_25490 gene rplC 37898 37260 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218932.1 protein_id gnl|my_center|LOCUS_25490 38285 37974 gene locus_tag LOCUS_25500 gene rpsJ 38285 37974 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence166 205 807 gene locus_tag LOCUS_25510 205 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 993 1562 gene locus_tag LOCUS_25520 993 1562 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082253.1 protein_id gnl|my_center|LOCUS_25520 1720 2031 gene locus_tag LOCUS_25530 1720 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2116 2718 gene locus_tag LOCUS_25540 2116 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2732 4153 gene locus_tag LOCUS_25550 2732 4153 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_25550 4177 5973 gene locus_tag LOCUS_25560 gene oadA 4177 5973 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269402.1 protein_id gnl|my_center|LOCUS_25560 6764 6000 gene locus_tag LOCUS_25570 6764 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 6957 7250 gene locus_tag LOCUS_25580 6957 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 7378 8271 gene locus_tag LOCUS_25590 7378 8271 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_25590 8845 8231 gene locus_tag LOCUS_25600 8845 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8898 9164 gene locus_tag LOCUS_25610 8898 9164 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_25610 9261 9950 gene locus_tag LOCUS_25620 9261 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_25620 10022 10735 gene locus_tag LOCUS_25630 10022 10735 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480275.1 protein_id gnl|my_center|LOCUS_25630 10725 11042 gene locus_tag LOCUS_25640 10725 11042 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460963.1 protein_id gnl|my_center|LOCUS_25640 13885 11024 gene locus_tag LOCUS_25650 13885 11024 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196173418.1 protein_id gnl|my_center|LOCUS_25650 15038 14064 gene locus_tag LOCUS_25660 15038 14064 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162840014.1 protein_id gnl|my_center|LOCUS_25660 15141 16952 gene locus_tag LOCUS_25670 15141 16952 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_25670 17019 17801 gene locus_tag LOCUS_25680 17019 17801 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110142.1 protein_id gnl|my_center|LOCUS_25680 17864 18238 gene locus_tag LOCUS_25690 17864 18238 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_25690 18379 19329 gene locus_tag LOCUS_25700 18379 19329 CDS product IS5-like element IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310555.1 protein_id gnl|my_center|LOCUS_25700 19562 19810 gene locus_tag LOCUS_25710 19562 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 20352 19912 gene locus_tag LOCUS_25720 20352 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence167 1267 680 gene locus_tag LOCUS_25730 1267 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2115 1750 gene locus_tag LOCUS_25740 2115 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3230 2262 gene locus_tag LOCUS_25750 3230 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 5359 3233 gene locus_tag LOCUS_25760 5359 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 6153 5359 gene locus_tag LOCUS_25770 6153 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 <8239 6150 gene locus_tag LOCUS_25780 <8239 6150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705728.1:type VI secretion system tip protein TssI/VgrG >Feature sequence168 1183 227 gene locus_tag LOCUS_25790 gene trxB 1183 227 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_25790 2324 1413 gene locus_tag LOCUS_25800 2324 1413 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_25800 3247 2333 gene locus_tag LOCUS_25810 3247 2333 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_25810 4296 3244 gene locus_tag LOCUS_25820 4296 3244 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_25820 4730 4386 gene locus_tag LOCUS_25830 4730 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 5418 4771 gene locus_tag LOCUS_25840 5418 4771 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105196.1 protein_id gnl|my_center|LOCUS_25840 5567 6808 gene locus_tag LOCUS_25850 5567 6808 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_25850 6825 7511 gene locus_tag LOCUS_25860 gene lolD 6825 7511 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_25860 8050 7508 gene locus_tag LOCUS_25870 8050 7508 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_25870 8260 10566 gene locus_tag LOCUS_25880 8260 10566 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267142.1 protein_id gnl|my_center|LOCUS_25880 10600 11226 gene locus_tag LOCUS_25890 10600 11226 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_25890 11232 11654 gene locus_tag LOCUS_25900 11232 11654 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_25900 11686 13437 gene locus_tag LOCUS_25910 gene msbA 11686 13437 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_25910 13434 14261 gene locus_tag LOCUS_25920 13434 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25920 14150 14452 gene locus_tag LOCUS_25930 14150 14452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25930 14445 14636 gene locus_tag LOCUS_25940 14445 14636 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381112.1 protein_id gnl|my_center|LOCUS_25940 14671 15447 gene locus_tag LOCUS_25950 gene kdsB 14671 15447 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_25950 15452 15937 gene locus_tag LOCUS_25960 15452 15937 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_25960 15934 16983 gene locus_tag LOCUS_25970 gene murB 15934 16983 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770641.1 protein_id gnl|my_center|LOCUS_25970 17856 17158 gene locus_tag LOCUS_25980 17856 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_25980 20025 17887 gene locus_tag LOCUS_25990 20025 17887 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 protein_id gnl|my_center|LOCUS_25990 20663 21493 gene locus_tag LOCUS_26000 20663 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 22350 21556 gene locus_tag LOCUS_26010 22350 21556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 protein_id gnl|my_center|LOCUS_26010 23251 22355 gene locus_tag LOCUS_26020 23251 22355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389858.1 protein_id gnl|my_center|LOCUS_26020 24247 23279 gene locus_tag LOCUS_26030 24247 23279 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389859.1 protein_id gnl|my_center|LOCUS_26030 24725 24357 gene locus_tag LOCUS_26040 24725 24357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 25012 26682 gene locus_tag LOCUS_26050 25012 26682 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_26050 26785 27261 gene locus_tag LOCUS_26060 26785 27261 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_26060 28962 27271 gene locus_tag LOCUS_26070 28962 27271 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_26070 30053 29034 gene locus_tag LOCUS_26080 30053 29034 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252071.1 protein_id gnl|my_center|LOCUS_26080 30286 30531 gene locus_tag LOCUS_26090 30286 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 30528 31154 gene locus_tag LOCUS_26100 30528 31154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 31391 32641 gene locus_tag LOCUS_26110 31391 32641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 33796 32651 gene locus_tag LOCUS_26120 33796 32651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 33985 34926 gene locus_tag LOCUS_26130 33985 34926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_26130 34923 35696 gene locus_tag LOCUS_26140 34923 35696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_26140 35707 36513 gene locus_tag LOCUS_26150 gene queF 35707 36513 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114774.1 protein_id gnl|my_center|LOCUS_26150 37925 36507 gene locus_tag LOCUS_26160 37925 36507 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_26160 38238 37927 gene locus_tag LOCUS_26170 38238 37927 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_26170 38378 38938 gene locus_tag LOCUS_26180 38378 38938 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence169 293 826 gene locus_tag LOCUS_26190 293 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_26190 830 1090 gene locus_tag LOCUS_26200 830 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1150 1857 gene locus_tag LOCUS_26210 1150 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 2094 4127 gene locus_tag LOCUS_26220 gene bifA 2094 4127 CDS product cyclic-di-GMP phosphodiesterase BifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_26220 4892 4140 gene locus_tag LOCUS_26230 4892 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 5375 4965 gene locus_tag LOCUS_26240 5375 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 5558 5731 gene locus_tag LOCUS_26250 5558 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 5777 6082 gene locus_tag LOCUS_26260 5777 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 6165 6494 gene locus_tag LOCUS_26270 6165 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 6726 7481 gene locus_tag LOCUS_26280 6726 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 7478 7654 gene locus_tag LOCUS_26290 7478 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 8207 7710 gene locus_tag LOCUS_26300 8207 7710 CDS product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453587.1 protein_id gnl|my_center|LOCUS_26300 8531 8295 gene locus_tag LOCUS_26310 8531 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 11527 8765 gene locus_tag LOCUS_26320 11527 8765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 13465 11594 gene locus_tag LOCUS_26330 13465 11594 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096330.1 protein_id gnl|my_center|LOCUS_26330 13997 13551 gene locus_tag LOCUS_26340 13997 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 14759 14358 gene locus_tag LOCUS_26350 14759 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 15113 14763 gene locus_tag LOCUS_26360 15113 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 15328 15110 gene locus_tag LOCUS_26370 15328 15110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 15540 15325 gene locus_tag LOCUS_26380 15540 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence170 <1 1101 gene locus_tag LOCUS_26390 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089372.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme 1766 1116 gene locus_tag LOCUS_26400 1766 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_26400 2988 2113 gene locus_tag LOCUS_26410 gene asd 2988 2113 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_26410 3126 3662 gene locus_tag LOCUS_26420 3126 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3788 4582 gene locus_tag LOCUS_26430 3788 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 6359 4602 gene locus_tag LOCUS_26440 6359 4602 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 protein_id gnl|my_center|LOCUS_26440 7114 6617 gene locus_tag LOCUS_26450 7114 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 7355 8266 gene locus_tag LOCUS_26460 7355 8266 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_26460 9300 8263 gene locus_tag LOCUS_26470 9300 8263 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence171 164 424 gene locus_tag LOCUS_26480 gene rpmA 164 424 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 protein_id gnl|my_center|LOCUS_26480 583 1770 gene locus_tag LOCUS_26490 gene cgtA 583 1770 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 protein_id gnl|my_center|LOCUS_26490 2124 1771 gene locus_tag LOCUS_26500 2124 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2023 2916 gene locus_tag LOCUS_26510 gene proB 2023 2916 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381304.1 protein_id gnl|my_center|LOCUS_26510 3300 3034 gene locus_tag LOCUS_26520 gene rpsT 3300 3034 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_26520 3665 3426 gene locus_tag LOCUS_26530 3665 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3625 5118 gene locus_tag LOCUS_26540 gene murJ 3625 5118 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957545.1 protein_id gnl|my_center|LOCUS_26540 5360 6343 gene locus_tag LOCUS_26550 gene ribF 5360 6343 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_26550 6389 9211 gene locus_tag LOCUS_26560 gene ileS 6389 9211 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 protein_id gnl|my_center|LOCUS_26560 9211 9720 gene locus_tag LOCUS_26570 gene lspA 9211 9720 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460289.1 protein_id gnl|my_center|LOCUS_26570 9717 10169 gene locus_tag LOCUS_26580 gene fkpB 9717 10169 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_26580 10185 11144 gene locus_tag LOCUS_26590 gene ispH 10185 11144 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_26590 11359 11943 gene locus_tag LOCUS_26600 11359 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 11970 12476 gene locus_tag LOCUS_26610 11970 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12549 13544 gene locus_tag LOCUS_26620 12549 13544 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 protein_id gnl|my_center|LOCUS_26620 13553 14050 gene locus_tag LOCUS_26630 13553 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 14060 14449 gene locus_tag LOCUS_26640 14060 14449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 14465 17662 gene locus_tag LOCUS_26650 14465 17662 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_26650 17671 18117 gene locus_tag LOCUS_26660 17671 18117 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207809.1 protein_id gnl|my_center|LOCUS_26660 18570 18118 gene locus_tag LOCUS_26670 18570 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 20319 18898 gene locus_tag LOCUS_26680 gene pilR 20319 18898 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_26680 21955 20336 gene locus_tag LOCUS_26690 21955 20336 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_26690 22046 23698 gene locus_tag LOCUS_26700 22046 23698 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_26700 24763 23918 gene locus_tag LOCUS_26710 24763 23918 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371138.1 protein_id gnl|my_center|LOCUS_26710 24876 25850 gene locus_tag LOCUS_26720 gene rluD 24876 25850 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_26720 25847 26578 gene locus_tag LOCUS_26730 gene pgeF 25847 26578 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_26730 26676 29252 gene locus_tag LOCUS_26740 gene clpB 26676 29252 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_26740 29780 29313 gene locus_tag LOCUS_26750 29780 29313 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_26750 30282 32000 gene locus_tag LOCUS_26760 30282 32000 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 protein_id gnl|my_center|LOCUS_26760 32006 32497 gene locus_tag LOCUS_26770 gene ilvN 32006 32497 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_26770 32543 33559 gene locus_tag LOCUS_26780 gene ilvC 32543 33559 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614924.1 protein_id gnl|my_center|LOCUS_26780 33708 34526 gene locus_tag LOCUS_26790 gene pssA 33708 34526 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence172 826 473 gene locus_tag LOCUS_26800 826 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1237 2514 gene locus_tag LOCUS_26810 1237 2514 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527918.1 protein_id gnl|my_center|LOCUS_26810 4170 2560 gene locus_tag LOCUS_26820 4170 2560 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_26820 4079 4279 gene locus_tag LOCUS_26830 4079 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 4296 5036 gene locus_tag LOCUS_26840 4296 5036 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_26840 5569 5099 gene locus_tag LOCUS_26850 5569 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 5906 5580 gene locus_tag LOCUS_26860 5906 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 6801 6088 gene locus_tag LOCUS_26870 6801 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 6950 7882 gene locus_tag LOCUS_26880 6950 7882 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_26880 7927 8757 gene locus_tag LOCUS_26890 gene cheR 7927 8757 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_26890 9114 9202 gene locus_tag LOCUS_t00430 9114 9202 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence173 1031 150 gene locus_tag LOCUS_26900 1031 150 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092000.1 protein_id gnl|my_center|LOCUS_26900 1300 3156 gene locus_tag LOCUS_26910 1300 3156 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266362.1 protein_id gnl|my_center|LOCUS_26910 4246 3191 gene locus_tag LOCUS_26920 4246 3191 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036633.1 protein_id gnl|my_center|LOCUS_26920 4415 5554 gene locus_tag LOCUS_26930 4415 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 6029 5595 gene locus_tag LOCUS_26940 6029 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 7134 6217 gene locus_tag LOCUS_26950 gene estB 7134 6217 CDS product esterase EstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_26950 7371 8735 gene locus_tag LOCUS_26960 7371 8735 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_26960 8852 9505 gene locus_tag LOCUS_26970 8852 9505 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_26970 10355 9573 gene locus_tag LOCUS_26980 10355 9573 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 protein_id gnl|my_center|LOCUS_26980 11051 10383 gene locus_tag LOCUS_26990 11051 10383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_26990 12055 11048 gene locus_tag LOCUS_27000 12055 11048 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097002.1 protein_id gnl|my_center|LOCUS_27000 12903 12211 gene locus_tag LOCUS_27010 12903 12211 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327108.1 protein_id gnl|my_center|LOCUS_27010 13454 12900 gene locus_tag LOCUS_27020 13454 12900 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_27020 13744 15237 gene locus_tag LOCUS_27030 13744 15237 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_27030 15250 15495 gene locus_tag LOCUS_27040 15250 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 15482 16660 gene locus_tag LOCUS_27050 15482 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 16657 17751 gene locus_tag LOCUS_27060 16657 17751 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_27060 18502 17921 gene locus_tag LOCUS_27070 18502 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 20141 18660 gene locus_tag LOCUS_27080 20141 18660 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_27080 20292 21047 gene locus_tag LOCUS_27090 20292 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 21980 21096 gene locus_tag LOCUS_27100 21980 21096 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975006.1 protein_id gnl|my_center|LOCUS_27100 24331 21977 gene locus_tag LOCUS_27110 24331 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 24531 25304 gene locus_tag LOCUS_27120 24531 25304 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_27120 25291 25686 gene locus_tag LOCUS_27130 25291 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 25691 26104 gene locus_tag LOCUS_27140 25691 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence174 65 1894 gene locus_tag LOCUS_27150 65 1894 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_27150 3071 1986 gene locus_tag LOCUS_27160 3071 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 3660 3064 gene locus_tag LOCUS_27170 3660 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 4759 3770 gene locus_tag LOCUS_27180 4759 3770 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_27180 5469 4756 gene locus_tag LOCUS_27190 5469 4756 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_27190 6245 5466 gene locus_tag LOCUS_27200 6245 5466 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071239.1 protein_id gnl|my_center|LOCUS_27200 6407 7096 gene locus_tag LOCUS_27210 6407 7096 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_27210 7689 7093 gene locus_tag LOCUS_27220 7689 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 8444 7824 gene locus_tag LOCUS_27230 gene ycaC 8444 7824 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082476.1 protein_id gnl|my_center|LOCUS_27230 9404 8532 gene locus_tag LOCUS_27240 9404 8532 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809214.1 protein_id gnl|my_center|LOCUS_27240 9527 10450 gene locus_tag LOCUS_27250 9527 10450 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508781.1 protein_id gnl|my_center|LOCUS_27250 10861 10469 gene locus_tag LOCUS_27260 10861 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 11345 11055 gene locus_tag LOCUS_27270 11345 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 11301 11984 gene locus_tag LOCUS_27280 11301 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 12578 12102 gene locus_tag LOCUS_27290 12578 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 12848 12636 gene locus_tag LOCUS_27300 12848 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 12955 14049 gene locus_tag LOCUS_27310 12955 14049 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_27310 14068 14607 gene locus_tag LOCUS_27320 14068 14607 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_27320 14815 15021 gene locus_tag LOCUS_27330 14815 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 15374 17341 gene locus_tag LOCUS_27340 15374 17341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence175 <1 554 gene locus_tag LOCUS_27350 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_213035039.1:IS30 family transposase 773 1339 gene locus_tag LOCUS_27360 gene dcd 773 1339 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_27360 1355 1960 gene locus_tag LOCUS_27370 1355 1960 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 protein_id gnl|my_center|LOCUS_27370 1957 3219 gene locus_tag LOCUS_27380 1957 3219 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_27380 3904 3197 gene locus_tag LOCUS_27390 3904 3197 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_27390 4716 4033 gene locus_tag LOCUS_27400 gene purN 4716 4033 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_27400 5768 4713 gene locus_tag LOCUS_27410 gene purM 5768 4713 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 protein_id gnl|my_center|LOCUS_27410 6103 7302 gene locus_tag LOCUS_27420 6103 7302 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268587.1 protein_id gnl|my_center|LOCUS_27420 7312 7866 gene locus_tag LOCUS_27430 7312 7866 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_27430 7863 8600 gene locus_tag LOCUS_27440 gene hda 7863 8600 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369632.1 protein_id gnl|my_center|LOCUS_27440 8621 9412 gene locus_tag LOCUS_27450 8621 9412 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_27450 9423 9758 gene locus_tag LOCUS_27460 9423 9758 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 protein_id gnl|my_center|LOCUS_27460 10310 9747 gene locus_tag LOCUS_27470 10310 9747 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_27470 12552 10360 gene locus_tag LOCUS_27480 12552 10360 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_27480 13561 12746 gene locus_tag LOCUS_27490 gene nadC 13561 12746 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_27490 13860 16151 gene locus_tag LOCUS_27500 13860 16151 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_27500 16247 16870 gene locus_tag LOCUS_27510 gene ampD 16247 16870 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_27510 16867 17754 gene locus_tag LOCUS_27520 gene cbiB 16867 17754 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_27520 17992 20022 gene locus_tag LOCUS_27530 17992 20022 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 protein_id gnl|my_center|LOCUS_27530 20597 20049 gene locus_tag LOCUS_27540 20597 20049 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence176 1117 1974 gene locus_tag LOCUS_27550 1117 1974 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_27550 2892 2020 gene locus_tag LOCUS_27560 2892 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2985 3905 gene locus_tag LOCUS_27570 2985 3905 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205322.1 protein_id gnl|my_center|LOCUS_27570 4392 3916 gene locus_tag LOCUS_27580 4392 3916 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_27580 5148 4438 gene locus_tag LOCUS_27590 5148 4438 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417513.1 protein_id gnl|my_center|LOCUS_27590 5270 5725 gene locus_tag LOCUS_27600 5270 5725 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612345.1 protein_id gnl|my_center|LOCUS_27600 6046 5744 gene locus_tag LOCUS_27610 6046 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 6189 6788 gene locus_tag LOCUS_27620 6189 6788 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_27620 7492 6842 gene locus_tag LOCUS_27630 7492 6842 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549852.1 protein_id gnl|my_center|LOCUS_27630 7944 7489 gene locus_tag LOCUS_27640 7944 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 8112 8552 gene locus_tag LOCUS_27650 8112 8552 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_27650 8638 10431 gene locus_tag LOCUS_27660 8638 10431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_27660 11183 10434 gene locus_tag LOCUS_27670 11183 10434 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922379.1 protein_id gnl|my_center|LOCUS_27670 11398 11183 gene locus_tag LOCUS_27680 11398 11183 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_27680 11515 12630 gene locus_tag LOCUS_27690 11515 12630 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_27690 13700 12612 gene locus_tag LOCUS_27700 13700 12612 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402542.1 protein_id gnl|my_center|LOCUS_27700 15886 13697 gene locus_tag LOCUS_27710 15886 13697 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336818.1 protein_id gnl|my_center|LOCUS_27710 16548 15886 gene locus_tag LOCUS_27720 16548 15886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035200935.1 protein_id gnl|my_center|LOCUS_27720 16973 16560 gene locus_tag LOCUS_27730 16973 16560 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_27730 18005 17013 gene locus_tag LOCUS_27740 18005 17013 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_27740 18271 19080 gene locus_tag LOCUS_27750 gene dkgB 18271 19080 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705535.1 protein_id gnl|my_center|LOCUS_27750 19891 19121 gene locus_tag LOCUS_27760 19891 19121 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_27760 20143 21627 gene locus_tag LOCUS_27770 gene dacB 20143 21627 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408519.1 protein_id gnl|my_center|LOCUS_27770 22434 21664 gene locus_tag LOCUS_27780 22434 21664 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_27780 23159 22473 gene locus_tag LOCUS_27790 23159 22473 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_27790 24223 23159 gene locus_tag LOCUS_27800 24223 23159 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_27800 25041 24223 gene locus_tag LOCUS_27810 25041 24223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236296.1 protein_id gnl|my_center|LOCUS_27810 26269 25058 gene locus_tag LOCUS_27820 26269 25058 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190545.1 protein_id gnl|my_center|LOCUS_27820 26368 27279 gene locus_tag LOCUS_27830 26368 27279 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_27830 27850 27494 gene locus_tag LOCUS_27840 27850 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 28636 27860 gene locus_tag LOCUS_27850 28636 27860 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_27850 28819 29583 gene locus_tag LOCUS_27860 28819 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27860 29499 29969 gene locus_tag LOCUS_27870 29499 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27870 31210 30227 gene locus_tag LOCUS_27880 31210 30227 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_27880 31459 32688 gene locus_tag LOCUS_27890 31459 32688 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251218.1 protein_id gnl|my_center|LOCUS_27890 32740 32925 gene locus_tag LOCUS_27900 32740 32925 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038881.1 protein_id gnl|my_center|LOCUS_27900 32940 33515 gene locus_tag LOCUS_27910 32940 33515 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706311.1 protein_id gnl|my_center|LOCUS_27910 34626 33535 gene locus_tag LOCUS_27920 34626 33535 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661226.1 protein_id gnl|my_center|LOCUS_27920 35756 35091 gene locus_tag LOCUS_27930 35756 35091 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_27930 37841 35895 gene locus_tag LOCUS_27940 gene acs 37841 35895 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707110.1 protein_id gnl|my_center|LOCUS_27940 39648 38110 gene locus_tag LOCUS_27950 39648 38110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 41253 39964 gene locus_tag LOCUS_27960 41253 39964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 41432 43438 gene locus_tag LOCUS_27970 41432 43438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 43435 45711 gene locus_tag LOCUS_27980 43435 45711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 46550 45720 gene locus_tag LOCUS_27990 46550 45720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 46905 47639 gene locus_tag LOCUS_28000 46905 47639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 48457 47645 gene locus_tag LOCUS_28010 gene murI 48457 47645 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070599.1 protein_id gnl|my_center|LOCUS_28010 49245 48454 gene locus_tag LOCUS_28020 gene nudC 49245 48454 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762586.1 protein_id gnl|my_center|LOCUS_28020 49461 51926 gene locus_tag LOCUS_28030 gene plsB 49461 51926 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113856.1 protein_id gnl|my_center|LOCUS_28030 52754 51936 gene locus_tag LOCUS_28040 52754 51936 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765943.1 protein_id gnl|my_center|LOCUS_28040 53167 52754 gene locus_tag LOCUS_28050 53167 52754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 53939 53241 gene locus_tag LOCUS_28060 gene tsaB 53939 53241 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_28060 54602 53946 gene locus_tag LOCUS_28070 gene adk 54602 53946 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_28070 56109 54727 gene locus_tag LOCUS_28080 56109 54727 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_28080 58761 56119 gene locus_tag LOCUS_28090 gene ppc 58761 56119 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 protein_id gnl|my_center|LOCUS_28090 58903 59139 gene locus_tag LOCUS_28100 58903 59139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 59588 59244 gene locus_tag LOCUS_28110 59588 59244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 60644 59781 gene locus_tag LOCUS_28120 gene mazG 60644 59781 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_28120 62884 60647 gene locus_tag LOCUS_28130 gene relA 62884 60647 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_28130 64246 62912 gene locus_tag LOCUS_28140 gene rlmD 64246 62912 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242253.1 protein_id gnl|my_center|LOCUS_28140 65184 64291 gene locus_tag LOCUS_28150 gene cysM 65184 64291 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_28150 65449 68316 gene locus_tag LOCUS_28160 gene gacS 65449 68316 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_28160 69065 68319 gene locus_tag LOCUS_28170 gene pdxJ 69065 68319 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268754.1 protein_id gnl|my_center|LOCUS_28170 69783 69037 gene locus_tag LOCUS_28180 gene recO 69783 69037 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654053.1 protein_id gnl|my_center|LOCUS_28180 70690 69767 gene locus_tag LOCUS_28190 gene era 70690 69767 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_28190 71379 70690 gene locus_tag LOCUS_28200 gene rnc 71379 70690 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085565.1 protein_id gnl|my_center|LOCUS_28200 71756 71379 gene locus_tag LOCUS_28210 71756 71379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 72622 71813 gene locus_tag LOCUS_28220 gene lepB 72622 71813 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104912.1 protein_id gnl|my_center|LOCUS_28220 74436 72634 gene locus_tag LOCUS_28230 gene lepA 74436 72634 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_28230 76072 74645 gene locus_tag LOCUS_28240 gene mucD 76072 74645 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_28240 76640 76179 gene locus_tag LOCUS_28250 gene mucC 76640 76179 CDS product alginate biosynthesis regulator MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_28250 77632 76637 gene locus_tag LOCUS_28260 gene mucB 77632 76637 CDS product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 protein_id gnl|my_center|LOCUS_28260 78211 77654 gene locus_tag LOCUS_28270 78211 77654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 78838 78227 gene locus_tag LOCUS_28280 gene rpoE 78838 78227 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_28280 79059 80666 gene locus_tag LOCUS_28290 gene nadB 79059 80666 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_28290 80694 80948 gene locus_tag LOCUS_28300 80694 80948 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_28300 80932 81429 gene locus_tag LOCUS_28310 80932 81429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 81426 82388 gene locus_tag LOCUS_28320 81426 82388 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_28320 82741 83334 gene locus_tag LOCUS_28330 82741 83334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28330 84126 83380 gene locus_tag LOCUS_28340 gene ung 84126 83380 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 protein_id gnl|my_center|LOCUS_28340 85642 84131 gene locus_tag LOCUS_28350 gene lysS 85642 84131 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765916.1 protein_id gnl|my_center|LOCUS_28350 86578 85676 gene locus_tag LOCUS_28360 gene prfB 86578 85676 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895661.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28360 88587 86881 gene locus_tag LOCUS_28370 gene recJ 88587 86881 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_28370 90040 88637 gene locus_tag LOCUS_28380 gene thrC 90040 88637 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_28380 91370 90069 gene locus_tag LOCUS_28390 91370 90069 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_28390 92214 91480 gene locus_tag LOCUS_28400 gene dsbC 92214 91480 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_28400 93223 92312 gene locus_tag LOCUS_28410 gene xerD 93223 92312 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_28410 93737 93381 gene locus_tag LOCUS_28420 gene rplS 93737 93381 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_28420 94524 93763 gene locus_tag LOCUS_28430 gene trmD 94524 93763 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393426.1 protein_id gnl|my_center|LOCUS_28430 95030 94527 gene locus_tag LOCUS_28440 gene rimM 95030 94527 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_28440 95335 95093 gene locus_tag LOCUS_28450 gene rpsP 95335 95093 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_28450 96896 95496 gene locus_tag LOCUS_28460 gene ffh 96896 95496 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071565.1 protein_id gnl|my_center|LOCUS_28460 97050 97853 gene locus_tag LOCUS_28470 97050 97853 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_28470 97924 99219 gene locus_tag LOCUS_28480 97924 99219 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 protein_id gnl|my_center|LOCUS_28480 99671 101896 gene locus_tag LOCUS_28490 99671 101896 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266649.1 protein_id gnl|my_center|LOCUS_28490 101933 102751 gene locus_tag LOCUS_28500 101933 102751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 103147 102812 gene locus_tag LOCUS_28510 gene grxD 103147 102812 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_28510 103409 104608 gene locus_tag LOCUS_28520 103409 104608 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_28520 104644 105588 gene locus_tag LOCUS_28530 gene argF 104644 105588 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_28530 105585 106670 gene locus_tag LOCUS_28540 105585 106670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_28540 108168 106687 gene locus_tag LOCUS_28550 gene glpK 108168 106687 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_28550 110053 108482 gene locus_tag LOCUS_28560 110053 108482 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082362.1 protein_id gnl|my_center|LOCUS_28560 110833 110093 gene locus_tag LOCUS_28570 110833 110093 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_28570 111576 111112 gene locus_tag LOCUS_28580 111576 111112 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_28580 113775 111595 gene locus_tag LOCUS_28590 113775 111595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 114183 113866 gene locus_tag LOCUS_28600 114183 113866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 115365 114328 gene locus_tag LOCUS_28610 115365 114328 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_28610 115502 116698 gene locus_tag LOCUS_28620 115502 116698 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_28620 116667 117215 gene locus_tag LOCUS_28630 116667 117215 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208337.1 protein_id gnl|my_center|LOCUS_28630 118455 117373 gene locus_tag LOCUS_28640 gene dinB 118455 117373 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086018.1 protein_id gnl|my_center|LOCUS_28640 118635 119408 gene locus_tag LOCUS_28650 gene minC 118635 119408 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_28650 119466 120275 gene locus_tag LOCUS_28660 gene minD 119466 120275 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163000.1 protein_id gnl|my_center|LOCUS_28660 120282 120536 gene locus_tag LOCUS_28670 gene minE 120282 120536 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317453.1 protein_id gnl|my_center|LOCUS_28670 121556 120561 gene locus_tag LOCUS_28680 121556 120561 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 protein_id gnl|my_center|LOCUS_28680 121691 122398 gene locus_tag LOCUS_28690 121691 122398 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_28690 122451 122939 gene locus_tag LOCUS_28700 122451 122939 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_28700 123001 124386 gene locus_tag LOCUS_28710 123001 124386 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_28710 125695 124631 gene locus_tag LOCUS_28720 125695 124631 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_28720 126602 125697 gene locus_tag LOCUS_28730 gene rimK 126602 125697 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_28730 127159 126599 gene locus_tag LOCUS_28740 127159 126599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 127250 128647 gene locus_tag LOCUS_28750 gene phrB 127250 128647 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_28750 129802 129044 gene locus_tag LOCUS_28760 129802 129044 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_28760 130655 129792 gene locus_tag LOCUS_28770 gene prmC 130655 129792 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705084.1 protein_id gnl|my_center|LOCUS_28770 131733 130648 gene locus_tag LOCUS_28780 gene prfA 131733 130648 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103430.1 protein_id gnl|my_center|LOCUS_28780 133094 131730 gene locus_tag LOCUS_28790 gene hemA 133094 131730 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_28790 133269 135041 gene locus_tag LOCUS_28800 gene lbcA 133269 135041 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_28800 135044 135679 gene locus_tag LOCUS_28810 gene lolB 135044 135679 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 protein_id gnl|my_center|LOCUS_28810 135676 136533 gene locus_tag LOCUS_28820 gene ispE 135676 136533 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_28820 136553 136627 gene locus_tag LOCUS_t00440 136553 136627 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 136680 137624 gene locus_tag LOCUS_28830 136680 137624 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_28830 137781 138176 gene locus_tag LOCUS_28840 137781 138176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28840 138182 138445 gene locus_tag LOCUS_28850 138182 138445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28850 138469 139059 gene locus_tag LOCUS_28860 gene pth 138469 139059 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 protein_id gnl|my_center|LOCUS_28860 139135 140226 gene locus_tag LOCUS_28870 gene ychF 139135 140226 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099270.1 protein_id gnl|my_center|LOCUS_28870 140253 140969 gene locus_tag LOCUS_28880 140253 140969 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112468.1 protein_id gnl|my_center|LOCUS_28880 141493 140978 gene locus_tag LOCUS_28890 141493 140978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 141911 141987 gene locus_tag LOCUS_t00450 141911 141987 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 142182 142472 gene locus_tag LOCUS_28900 142182 142472 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943075.1 protein_id gnl|my_center|LOCUS_28900 142417 142680 gene locus_tag LOCUS_28910 142417 142680 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 protein_id gnl|my_center|LOCUS_28910 142888 142712 gene locus_tag LOCUS_28920 142888 142712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 143414 143836 gene locus_tag LOCUS_28930 143414 143836 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 protein_id gnl|my_center|LOCUS_28930 145960 143873 gene locus_tag LOCUS_28940 145960 143873 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348771.1 protein_id gnl|my_center|LOCUS_28940 146828 145968 gene locus_tag LOCUS_28950 146828 145968 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003038884.1 protein_id gnl|my_center|LOCUS_28950 147011 146832 gene locus_tag LOCUS_28960 147011 146832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 147275 148315 gene locus_tag LOCUS_28970 147275 148315 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_28970 148333 149412 gene locus_tag LOCUS_28980 gene pdhA 148333 149412 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483380.1 protein_id gnl|my_center|LOCUS_28980 149405 150412 gene locus_tag LOCUS_28990 149405 150412 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114485.1 protein_id gnl|my_center|LOCUS_28990 150439 151542 gene locus_tag LOCUS_29000 150439 151542 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706666.1 protein_id gnl|my_center|LOCUS_29000 151613 152620 gene locus_tag LOCUS_29010 151613 152620 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_29010 152805 153338 gene locus_tag LOCUS_29020 152805 153338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 153663 155024 gene locus_tag LOCUS_29030 153663 155024 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_29030 155046 155960 gene locus_tag LOCUS_29040 155046 155960 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193173633.1 protein_id gnl|my_center|LOCUS_29040 155988 157724 gene locus_tag LOCUS_29050 155988 157724 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219893520.1 protein_id gnl|my_center|LOCUS_29050 158234 158512 gene locus_tag LOCUS_29060 158234 158512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 158710 159381 gene locus_tag LOCUS_29070 158710 159381 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087476.1 protein_id gnl|my_center|LOCUS_29070 159431 159805 gene locus_tag LOCUS_29080 159431 159805 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206104.1 protein_id gnl|my_center|LOCUS_29080 159814 160038 gene locus_tag LOCUS_29090 159814 160038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 160121 160636 gene locus_tag LOCUS_29100 160121 160636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 160802 161356 gene locus_tag LOCUS_29110 160802 161356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 161632 161832 gene locus_tag LOCUS_29120 161632 161832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 162136 161897 gene locus_tag LOCUS_29130 162136 161897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 162966 162133 gene locus_tag LOCUS_29140 gene fdhD 162966 162133 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_29140 165827 162966 gene locus_tag LOCUS_29150 gene fdhF 165827 162966 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_29150 167416 165830 gene locus_tag LOCUS_29160 167416 165830 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_29160 167910 167413 gene locus_tag LOCUS_29170 167910 167413 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721449.1 protein_id gnl|my_center|LOCUS_29170 169053 167923 gene locus_tag LOCUS_29180 169053 167923 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_29180 169498 170880 gene locus_tag LOCUS_29190 169498 170880 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_29190 173664 171094 gene locus_tag LOCUS_29200 173664 171094 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531153.1 protein_id gnl|my_center|LOCUS_29200 173898 174938 gene locus_tag LOCUS_29210 gene lipA 173898 174938 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 protein_id gnl|my_center|LOCUS_29210 175060 176277 gene locus_tag LOCUS_29220 gene fabB 175060 176277 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_29220 177292 176414 gene locus_tag LOCUS_29230 gene rfbD 177292 176414 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_29230 177518 177874 gene locus_tag LOCUS_29240 177518 177874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 179161 178088 gene locus_tag LOCUS_29250 gene alr 179161 178088 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112284.1 protein_id gnl|my_center|LOCUS_29250 180610 179213 gene locus_tag LOCUS_29260 gene dnaB 180610 179213 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380723.1 protein_id gnl|my_center|LOCUS_29260 181317 180871 gene locus_tag LOCUS_29270 gene rplI 181317 180871 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_29270 182204 181338 gene locus_tag LOCUS_29280 182204 181338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_29280 182453 182223 gene locus_tag LOCUS_29290 gene rpsR 182453 182223 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_29290 182855 182508 gene locus_tag LOCUS_29300 gene rpsF 182855 182508 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004098001.1 protein_id gnl|my_center|LOCUS_29300 183771 183031 gene locus_tag LOCUS_29310 gene rlmB 183771 183031 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209161.1 protein_id gnl|my_center|LOCUS_29310 186303 183775 gene locus_tag LOCUS_29320 gene rnr 186303 183775 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_29320 186557 186471 gene locus_tag LOCUS_t00460 186557 186471 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 188563 186692 gene locus_tag LOCUS_29330 188563 186692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 189807 188668 gene locus_tag LOCUS_29340 189807 188668 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_29340 190822 190061 gene locus_tag LOCUS_29350 190822 190061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_29350 191475 190819 gene locus_tag LOCUS_29360 gene ubiX 191475 190819 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_29360 192841 191468 gene locus_tag LOCUS_29370 gene mpl 192841 191468 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_29370 193028 194290 gene locus_tag LOCUS_29380 193028 194290 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_29380 194659 194405 gene locus_tag LOCUS_29390 194659 194405 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418461.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence177 221 2758 gene locus_tag LOCUS_29400 221 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2755 3213 gene locus_tag LOCUS_29410 2755 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3221 5119 gene locus_tag LOCUS_29420 gene parE 3221 5119 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_29420 6581 5316 gene locus_tag LOCUS_29430 6581 5316 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550333.1 protein_id gnl|my_center|LOCUS_29430 7129 7683 gene locus_tag LOCUS_29440 7129 7683 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 protein_id gnl|my_center|LOCUS_29440 7735 8325 gene locus_tag LOCUS_29450 7735 8325 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_29450 8704 8423 gene locus_tag LOCUS_29460 8704 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 8938 11232 gene locus_tag LOCUS_29470 gene parC 8938 11232 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_29470 11225 12427 gene locus_tag LOCUS_29480 gene serB 11225 12427 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence178 183 809 gene locus_tag LOCUS_29490 183 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 854 3613 gene locus_tag LOCUS_29500 854 3613 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262338.1 protein_id gnl|my_center|LOCUS_29500 3877 4161 gene locus_tag LOCUS_29510 3877 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 5097 4327 gene locus_tag LOCUS_29520 5097 4327 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114186.1 protein_id gnl|my_center|LOCUS_29520 5814 5356 gene locus_tag LOCUS_29530 5814 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 <7302 5857 gene locus_tag LOCUS_29540 <7302 5857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027934.1:molybdopterin oxidoreductase family protein >Feature sequence179 935 150 gene locus_tag LOCUS_29550 935 150 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443274.1 protein_id gnl|my_center|LOCUS_29550 1039 1635 gene locus_tag LOCUS_29560 gene yfbR 1039 1635 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 protein_id gnl|my_center|LOCUS_29560 1708 3669 gene locus_tag LOCUS_29570 1708 3669 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 protein_id gnl|my_center|LOCUS_29570 4304 3684 gene locus_tag LOCUS_29580 4304 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 6010 5354 gene locus_tag LOCUS_29590 gene queE 6010 5354 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931061.1 protein_id gnl|my_center|LOCUS_29590 6687 6010 gene locus_tag LOCUS_29600 gene queC 6687 6010 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_29600 6843 7358 gene locus_tag LOCUS_29610 6843 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087459406.1 protein_id gnl|my_center|LOCUS_29610 7527 7360 gene locus_tag LOCUS_29620 7527 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 8299 8559 gene locus_tag LOCUS_29630 8299 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 9015 8602 gene locus_tag LOCUS_29640 9015 8602 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_29640 9627 9079 gene locus_tag LOCUS_29650 9627 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 13191 9646 gene locus_tag LOCUS_29660 13191 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 13346 14347 gene locus_tag LOCUS_29670 13346 14347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 14745 14491 gene locus_tag LOCUS_29680 14745 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 15027 15371 gene locus_tag LOCUS_29690 15027 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 16700 15417 gene locus_tag LOCUS_29700 16700 15417 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_29700 18352 16799 gene locus_tag LOCUS_29710 18352 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 18528 18872 gene locus_tag LOCUS_29720 18528 18872 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919100.1 protein_id gnl|my_center|LOCUS_29720 18869 20251 gene locus_tag LOCUS_29730 18869 20251 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919101.1 protein_id gnl|my_center|LOCUS_29730 20248 21522 gene locus_tag LOCUS_29740 20248 21522 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_29740 21688 22572 gene locus_tag LOCUS_29750 21688 22572 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262573.1 protein_id gnl|my_center|LOCUS_29750 22646 23038 gene locus_tag LOCUS_29760 22646 23038 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810601.1 protein_id gnl|my_center|LOCUS_29760 23028 24218 gene locus_tag LOCUS_29770 23028 24218 CDS product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064385.1 protein_id gnl|my_center|LOCUS_29770 25162 24212 gene locus_tag LOCUS_29780 25162 24212 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707446.1 protein_id gnl|my_center|LOCUS_29780 25272 26147 gene locus_tag LOCUS_29790 25272 26147 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707447.1 protein_id gnl|my_center|LOCUS_29790 26275 27771 gene locus_tag LOCUS_29800 26275 27771 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence180 157 957 gene locus_tag LOCUS_29810 157 957 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_29810 1311 997 gene locus_tag LOCUS_29820 1311 997 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626089.1 protein_id gnl|my_center|LOCUS_29820 1610 1329 gene locus_tag LOCUS_29830 1610 1329 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_29830 2572 1700 gene locus_tag LOCUS_29840 2572 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2736 2569 gene locus_tag LOCUS_29850 2736 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3214 2954 gene locus_tag LOCUS_29860 3214 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 3648 3241 gene locus_tag LOCUS_29870 3648 3241 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118845.1 protein_id gnl|my_center|LOCUS_29870 4042 3665 gene locus_tag LOCUS_29880 4042 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 4479 4144 gene locus_tag LOCUS_29890 4479 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence181 906 193 gene locus_tag LOCUS_29900 906 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 4102 992 gene locus_tag LOCUS_29910 4102 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 4649 4089 gene locus_tag LOCUS_29920 gene rfbC 4649 4089 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_29920 5547 4651 gene locus_tag LOCUS_29930 gene rfbA 5547 4651 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_29930 6440 5553 gene locus_tag LOCUS_29940 gene rfbD 6440 5553 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_29940 7371 6457 gene locus_tag LOCUS_29950 gene rfbB 7371 6457 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29950 7535 7362 gene locus_tag LOCUS_29960 7535 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29960 8510 7641 gene locus_tag LOCUS_29970 8510 7641 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535365.1 protein_id gnl|my_center|LOCUS_29970 9210 8503 gene locus_tag LOCUS_29980 9210 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 9983 9210 gene locus_tag LOCUS_29990 gene tagG 9983 9210 CDS product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 protein_id gnl|my_center|LOCUS_29990 10953 9976 gene locus_tag LOCUS_30000 10953 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 11816 11040 gene locus_tag LOCUS_30010 11816 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 12211 13737 gene locus_tag LOCUS_30020 12211 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 13846 14538 gene locus_tag LOCUS_30030 13846 14538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 16766 14532 gene locus_tag LOCUS_30040 16766 14532 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895558.1 protein_id gnl|my_center|LOCUS_30040 17272 16763 gene locus_tag LOCUS_30050 17272 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 17859 17269 gene locus_tag LOCUS_30060 17859 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 18052 17852 gene locus_tag LOCUS_30070 18052 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 18758 18102 gene locus_tag LOCUS_30080 18758 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 19980 18877 gene locus_tag LOCUS_30090 19980 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 20571 19981 gene locus_tag LOCUS_30100 20571 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 20995 20555 gene locus_tag LOCUS_30110 20995 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 21423 20992 gene locus_tag LOCUS_30120 21423 20992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 21882 21424 gene locus_tag LOCUS_30130 gene gspG 21882 21424 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 protein_id gnl|my_center|LOCUS_30130 23116 21920 gene locus_tag LOCUS_30140 23116 21920 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110091.1 protein_id gnl|my_center|LOCUS_30140 24852 23113 gene locus_tag LOCUS_30150 24852 23113 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence182 44 1072 gene locus_tag LOCUS_30160 gene dapD 44 1072 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266969.1 protein_id gnl|my_center|LOCUS_30160 1375 2502 gene locus_tag LOCUS_30170 gene dapE 1375 2502 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_30170 2851 2606 gene locus_tag LOCUS_30180 2851 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3177 2803 gene locus_tag LOCUS_30190 3177 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_30190 3109 3291 gene locus_tag LOCUS_30200 3109 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 4023 3454 gene locus_tag LOCUS_30210 4023 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 4234 4452 gene locus_tag LOCUS_30220 4234 4452 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 protein_id gnl|my_center|LOCUS_30220 6095 4689 gene locus_tag LOCUS_30230 6095 4689 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_30230 6805 6437 gene locus_tag LOCUS_30240 gene mvaT 6805 6437 CDS product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 protein_id gnl|my_center|LOCUS_30240 8487 7078 gene locus_tag LOCUS_30250 8487 7078 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942487.1 protein_id gnl|my_center|LOCUS_30250 10506 8563 gene locus_tag LOCUS_30260 10506 8563 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_30260 11040 10549 gene locus_tag LOCUS_30270 11040 10549 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236728.1 protein_id gnl|my_center|LOCUS_30270 12042 11119 gene locus_tag LOCUS_30280 12042 11119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_30280 12815 12039 gene locus_tag LOCUS_30290 12815 12039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379610.1 protein_id gnl|my_center|LOCUS_30290 13706 12819 gene locus_tag LOCUS_30300 13706 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 13807 14058 gene locus_tag LOCUS_30310 13807 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 14476 14787 gene locus_tag LOCUS_30320 14476 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 15995 14892 gene locus_tag LOCUS_30330 15995 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 16869 15982 gene locus_tag LOCUS_30340 16869 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 18149 16893 gene locus_tag LOCUS_30350 18149 16893 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122761.1 protein_id gnl|my_center|LOCUS_30350 19439 18333 gene locus_tag LOCUS_30360 19439 18333 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_30360 20024 19452 gene locus_tag LOCUS_30370 20024 19452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 21220 20237 gene locus_tag LOCUS_30380 21220 20237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_30380 22407 21217 gene locus_tag LOCUS_30390 22407 21217 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776663.1 protein_id gnl|my_center|LOCUS_30390 24761 22995 gene locus_tag LOCUS_30400 24761 22995 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence183 239 54 gene locus_tag LOCUS_30410 239 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 605 297 gene locus_tag LOCUS_30420 605 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30420 937 653 gene locus_tag LOCUS_30430 937 653 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537152.1 protein_id gnl|my_center|LOCUS_30430 1457 1020 gene locus_tag LOCUS_30440 1457 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 2240 1530 gene locus_tag LOCUS_30450 2240 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 3212 2331 gene locus_tag LOCUS_30460 3212 2331 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886416.1 protein_id gnl|my_center|LOCUS_30460 3643 3329 gene locus_tag LOCUS_30470 3643 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 4070 3768 gene locus_tag LOCUS_30480 4070 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 4480 4160 gene locus_tag LOCUS_30490 4480 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence184 2283 1189 gene locus_tag LOCUS_30500 gene aroB 2283 1189 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_30500 2813 2280 gene locus_tag LOCUS_30510 gene aroK 2813 2280 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_30510 5138 2997 gene locus_tag LOCUS_30520 gene pilQ 5138 2997 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_30520 5694 5149 gene locus_tag LOCUS_30530 gene pilP 5694 5149 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_30530 6312 5701 gene locus_tag LOCUS_30540 gene pilO 6312 5701 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_30540 6881 6309 gene locus_tag LOCUS_30550 gene pilN 6881 6309 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_30550 7987 6881 gene locus_tag LOCUS_30560 gene pilM 7987 6881 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_30560 8228 10684 gene locus_tag LOCUS_30570 8228 10684 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266375.1 protein_id gnl|my_center|LOCUS_30570 12177 10912 gene locus_tag LOCUS_30580 12177 10912 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_30580 12654 12436 gene locus_tag LOCUS_30590 gene rpmE 12654 12436 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 protein_id gnl|my_center|LOCUS_30590 12739 12867 gene locus_tag LOCUS_30600 12739 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence185 3622 3819 gene locus_tag LOCUS_30610 3622 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3835 4263 gene locus_tag LOCUS_30620 3835 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 4597 4286 gene locus_tag LOCUS_30630 4597 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4687 5688 gene locus_tag LOCUS_30640 4687 5688 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_30640 5820 6500 gene locus_tag LOCUS_30650 5820 6500 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038458.1 protein_id gnl|my_center|LOCUS_30650 6504 7466 gene locus_tag LOCUS_30660 6504 7466 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739770.1 protein_id gnl|my_center|LOCUS_30660 7492 9189 gene locus_tag LOCUS_30670 7492 9189 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 protein_id gnl|my_center|LOCUS_30670 9186 11447 gene locus_tag LOCUS_30680 9186 11447 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523967.1 protein_id gnl|my_center|LOCUS_30680 13765 11582 gene locus_tag LOCUS_30690 13765 11582 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_30690 14009 14251 gene locus_tag LOCUS_30700 14009 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 14266 14559 gene locus_tag LOCUS_30710 14266 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 14556 15320 gene locus_tag LOCUS_30720 gene tatC 14556 15320 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_30720 16162 15308 gene locus_tag LOCUS_30730 16162 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 16381 16734 gene locus_tag LOCUS_30740 16381 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 19122 16771 gene locus_tag LOCUS_30750 19122 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 19371 20117 gene locus_tag LOCUS_30760 19371 20117 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_30760 21746 20154 gene locus_tag LOCUS_30770 21746 20154 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_30770 22005 23585 gene locus_tag LOCUS_30780 22005 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 25351 23597 gene locus_tag LOCUS_30790 25351 23597 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070895.1 protein_id gnl|my_center|LOCUS_30790 25583 26503 gene locus_tag LOCUS_30800 25583 26503 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368464.1 protein_id gnl|my_center|LOCUS_30800 26507 27685 gene locus_tag LOCUS_30810 26507 27685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983970.1 protein_id gnl|my_center|LOCUS_30810 27682 28626 gene locus_tag LOCUS_30820 27682 28626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210802.1 protein_id gnl|my_center|LOCUS_30820 28619 29341 gene locus_tag LOCUS_30830 gene yehW 28619 29341 CDS product glycine betaine ABC transporter permease YehW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783112.1 protein_id gnl|my_center|LOCUS_30830 30455 29343 gene locus_tag LOCUS_30840 30455 29343 CDS product DUF2252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099477.1 protein_id gnl|my_center|LOCUS_30840 32467 30698 gene locus_tag LOCUS_30850 32467 30698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 33487 32597 gene locus_tag LOCUS_30860 33487 32597 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_30860 33598 35865 gene locus_tag LOCUS_30870 gene metE 33598 35865 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764814.1 protein_id gnl|my_center|LOCUS_30870 36429 36001 gene locus_tag LOCUS_30880 36429 36001 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_30880 37327 36518 gene locus_tag LOCUS_30890 37327 36518 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_30890 37546 38154 gene locus_tag LOCUS_30900 37546 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 39150 38179 gene locus_tag LOCUS_30910 39150 38179 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_30910 40127 39150 gene locus_tag LOCUS_30920 40127 39150 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_30920 40340 41752 gene locus_tag LOCUS_30930 40340 41752 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969573.1 protein_id gnl|my_center|LOCUS_30930 42850 41813 gene locus_tag LOCUS_30940 42850 41813 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250267.1 protein_id gnl|my_center|LOCUS_30940 43313 42852 gene locus_tag LOCUS_30950 43313 42852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 43710 43315 gene locus_tag LOCUS_30960 43710 43315 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156325.1 protein_id gnl|my_center|LOCUS_30960 44456 43722 gene locus_tag LOCUS_30970 44456 43722 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence186 989 48 gene locus_tag LOCUS_30980 989 48 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_30980 1739 990 gene locus_tag LOCUS_30990 1739 990 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_30990 2134 3825 gene locus_tag LOCUS_31000 2134 3825 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_31000 5369 3996 gene locus_tag LOCUS_31010 5369 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 6252 5509 gene locus_tag LOCUS_31020 6252 5509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_31020 6629 6381 gene locus_tag LOCUS_31030 6629 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 7307 6669 gene locus_tag LOCUS_31040 7307 6669 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403754.1 protein_id gnl|my_center|LOCUS_31040 7531 8631 gene locus_tag LOCUS_31050 7531 8631 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_31050 9123 8662 gene locus_tag LOCUS_31060 9123 8662 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_31060 9921 9349 gene locus_tag LOCUS_31070 9921 9349 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_31070 10055 11185 gene locus_tag LOCUS_31080 10055 11185 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_31080 11662 11210 gene locus_tag LOCUS_31090 gene sixA 11662 11210 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_31090 12763 11681 gene locus_tag LOCUS_31100 12763 11681 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769608.1 protein_id gnl|my_center|LOCUS_31100 11854 11782 gene locus_tag LOCUS_t00470 11854 11782 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13260 12772 gene locus_tag LOCUS_31110 13260 12772 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_31110 14449 13253 gene locus_tag LOCUS_31120 14449 13253 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_31120 14652 16127 gene locus_tag LOCUS_31130 14652 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence187 36 482 gene locus_tag LOCUS_31140 36 482 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401060.1 protein_id gnl|my_center|LOCUS_31140 705 1733 gene locus_tag LOCUS_31150 705 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1843 2436 gene locus_tag LOCUS_31160 1843 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 2470 3756 gene locus_tag LOCUS_31170 2470 3756 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 protein_id gnl|my_center|LOCUS_31170 3789 4229 gene locus_tag LOCUS_31180 3789 4229 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_31180 4804 4409 gene locus_tag LOCUS_31190 4804 4409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_31190 6019 4814 gene locus_tag LOCUS_31200 6019 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 7635 6061 gene locus_tag LOCUS_31210 7635 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 8266 8628 gene locus_tag LOCUS_31220 8266 8628 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460100.1 protein_id gnl|my_center|LOCUS_31220 8688 10412 gene locus_tag LOCUS_31230 8688 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_31230 10470 10823 gene locus_tag LOCUS_31240 10470 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 11342 12934 gene locus_tag LOCUS_31250 gene mqo 11342 12934 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083116.1 protein_id gnl|my_center|LOCUS_31250 12852 14015 gene locus_tag LOCUS_31260 12852 14015 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_31260 14015 14305 gene locus_tag LOCUS_31270 14015 14305 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_31270 14309 15706 gene locus_tag LOCUS_31280 14309 15706 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence188 944 120 gene locus_tag LOCUS_31290 944 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31290 1273 992 gene locus_tag LOCUS_31300 1273 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31300 >Feature sequence189 1541 165 gene locus_tag LOCUS_31310 1541 165 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_31310 3709 1634 gene locus_tag LOCUS_31320 gene recG 3709 1634 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 protein_id gnl|my_center|LOCUS_31320 >Feature sequence190 19 1407 gene locus_tag LOCUS_31330 gene folC 19 1407 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_31330 1496 2182 gene locus_tag LOCUS_31340 1496 2182 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_31340 2271 2816 gene locus_tag LOCUS_31350 2271 2816 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318487.1 protein_id gnl|my_center|LOCUS_31350 2873 4396 gene locus_tag LOCUS_31360 gene purF 2873 4396 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_31360 4436 5659 gene locus_tag LOCUS_31370 4436 5659 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_31370 5701 8232 gene locus_tag LOCUS_31380 gene ftsK 5701 8232 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_31380 8244 8885 gene locus_tag LOCUS_31390 gene lolA 8244 8885 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_31390 8887 10245 gene locus_tag LOCUS_31400 8887 10245 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_31400 10474 11757 gene locus_tag LOCUS_31410 gene serS 10474 11757 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_31410 11766 12524 gene locus_tag LOCUS_31420 11766 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 13641 12568 gene locus_tag LOCUS_31430 13641 12568 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_31430 13863 15710 gene locus_tag LOCUS_31440 13863 15710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 15710 16111 gene locus_tag LOCUS_31450 15710 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 17182 16142 gene locus_tag LOCUS_31460 17182 16142 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_31460 18087 17296 gene locus_tag LOCUS_31470 gene fabI 18087 17296 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087936.1 protein_id gnl|my_center|LOCUS_31470 <19630 18175 gene locus_tag LOCUS_31480 <19630 18175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770761.1:ABC transporter ATP-binding protein >Feature sequence191 1232 138 gene locus_tag LOCUS_31490 gene hemH 1232 138 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence192 670 1188 gene locus_tag LOCUS_31500 gene hcp1 670 1188 CDS product type VI secretion system effector Hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705044.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence193 892 287 gene locus_tag LOCUS_31510 892 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence194 696 1445 gene locus_tag LOCUS_31520 696 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1612 2586 gene locus_tag LOCUS_31530 1612 2586 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_31530 2779 2916 gene locus_tag LOCUS_31540 2779 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2930 3163 gene locus_tag LOCUS_31550 2930 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 3283 4170 gene locus_tag LOCUS_31560 3283 4170 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073019.1 protein_id gnl|my_center|LOCUS_31560 4400 4669 gene locus_tag LOCUS_31570 4400 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence195 194 84 gene locus_tag LOCUS_r00020 194 84 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3177 290 gene locus_tag LOCUS_r00030 3177 290 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3530 3455 gene locus_tag LOCUS_t00480 3530 3455 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence196 <1 657 gene locus_tag LOCUS_31580 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106411.1:DNA mismatch repair endonuclease MutL 662 1660 gene locus_tag LOCUS_31590 gene miaA 662 1660 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_31590 1711 1956 gene locus_tag LOCUS_31600 gene hfq 1711 1956 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_31600 1964 3262 gene locus_tag LOCUS_31610 gene hflX 1964 3262 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209152.1 protein_id gnl|my_center|LOCUS_31610 3382 4578 gene locus_tag LOCUS_31620 gene hflK 3382 4578 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105238.1 protein_id gnl|my_center|LOCUS_31620 4581 5459 gene locus_tag LOCUS_31630 gene hflC 4581 5459 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_31630 5679 6863 gene locus_tag LOCUS_31640 5679 6863 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_31640 6959 8254 gene locus_tag LOCUS_31650 6959 8254 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_31650 9536 8553 gene locus_tag LOCUS_31660 gene cmoB 9536 8553 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114185.1 protein_id gnl|my_center|LOCUS_31660 10319 9549 gene locus_tag LOCUS_31670 gene cmoA 10319 9549 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019583.1 protein_id gnl|my_center|LOCUS_31670 10698 10303 gene locus_tag LOCUS_31680 10698 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11697 10699 gene locus_tag LOCUS_31690 11697 10699 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 protein_id gnl|my_center|LOCUS_31690 12212 11757 gene locus_tag LOCUS_31700 12212 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 13388 12480 gene locus_tag LOCUS_31710 13388 12480 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_31710 13466 14569 gene locus_tag LOCUS_31720 13466 14569 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence197 2112 82 gene locus_tag LOCUS_31730 2112 82 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_31730 3482 2280 gene locus_tag LOCUS_31740 3482 2280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275407.1 protein_id gnl|my_center|LOCUS_31740 4537 3599 gene locus_tag LOCUS_31750 4537 3599 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_31750 6021 4534 gene locus_tag LOCUS_31760 6021 4534 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228753.1 protein_id gnl|my_center|LOCUS_31760 6635 6018 gene locus_tag LOCUS_31770 6635 6018 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107293.1 protein_id gnl|my_center|LOCUS_31770 6895 7710 gene locus_tag LOCUS_31780 6895 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 7857 9443 gene locus_tag LOCUS_31790 7857 9443 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_31790 9634 11040 gene locus_tag LOCUS_31800 9634 11040 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199295.1 protein_id gnl|my_center|LOCUS_31800 11231 12631 gene locus_tag LOCUS_31810 gene ccoG 11231 12631 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_31810 12801 14258 gene locus_tag LOCUS_31820 12801 14258 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 protein_id gnl|my_center|LOCUS_31820 14523 14918 gene locus_tag LOCUS_31830 14523 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 14915 17776 gene locus_tag LOCUS_31840 14915 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840