>Feature sequence001 498 609 gene locus_tag LOCUS_r00010 498 609 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 645 721 gene locus_tag LOCUS_t00010 645 721 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 790 866 gene locus_tag LOCUS_t00020 790 866 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1962 1072 gene locus_tag LOCUS_00010 gene ilvY 1962 1072 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455228.1 protein_id gnl|my_center|LOCUS_00010 2105 3589 gene locus_tag LOCUS_00020 gene ilvC 2105 3589 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_00020 4306 4055 gene locus_tag LOCUS_00030 4306 4055 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455224.1 protein_id gnl|my_center|LOCUS_00030 7560 4438 gene locus_tag LOCUS_00040 gene vmeD 7560 4438 CDS product multidrug efflux RND transporter permease subunit VmeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478703.1 protein_id gnl|my_center|LOCUS_00040 8678 7572 gene locus_tag LOCUS_00050 gene vmeC 8678 7572 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_00050 9278 8697 gene locus_tag LOCUS_00060 9278 8697 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 protein_id gnl|my_center|LOCUS_00060 9449 11464 gene locus_tag LOCUS_00070 gene rep 9449 11464 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 protein_id gnl|my_center|LOCUS_00070 11950 11537 gene locus_tag LOCUS_00080 11950 11537 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 protein_id gnl|my_center|LOCUS_00080 12312 12388 gene locus_tag LOCUS_t00030 12312 12388 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12422 12497 gene locus_tag LOCUS_t00040 12422 12497 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12574 12650 gene locus_tag LOCUS_t00050 12574 12650 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12698 12773 gene locus_tag LOCUS_t00060 12698 12773 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12838 12914 gene locus_tag LOCUS_t00070 12838 12914 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13977 13252 gene locus_tag LOCUS_00090 13977 13252 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478741.1 protein_id gnl|my_center|LOCUS_00090 14664 16379 gene locus_tag LOCUS_00100 14664 16379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478686.1 protein_id gnl|my_center|LOCUS_00100 16479 18038 gene locus_tag LOCUS_00110 16479 18038 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478744.1 protein_id gnl|my_center|LOCUS_00110 18185 19162 gene locus_tag LOCUS_00120 18185 19162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455219.1 protein_id gnl|my_center|LOCUS_00120 19165 20121 gene locus_tag LOCUS_00130 19165 20121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 protein_id gnl|my_center|LOCUS_00130 20270 21196 gene locus_tag LOCUS_00140 20270 21196 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105603.1 protein_id gnl|my_center|LOCUS_00140 21330 22337 gene locus_tag LOCUS_00150 21330 22337 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478719.1 protein_id gnl|my_center|LOCUS_00150 22392 23318 gene locus_tag LOCUS_00160 22392 23318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455215.1 protein_id gnl|my_center|LOCUS_00160 23522 23899 gene locus_tag LOCUS_00170 23522 23899 CDS product multidrug transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478736.1 protein_id gnl|my_center|LOCUS_00170 23902 24117 gene locus_tag LOCUS_00180 23902 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 26328 24532 gene locus_tag LOCUS_00190 gene edd 26328 24532 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478701.1 protein_id gnl|my_center|LOCUS_00190 26846 26325 gene locus_tag LOCUS_00200 26846 26325 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478642.1 protein_id gnl|my_center|LOCUS_00200 26999 28375 gene locus_tag LOCUS_00210 26999 28375 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478622.1 protein_id gnl|my_center|LOCUS_00210 28385 28996 gene locus_tag LOCUS_00220 28385 28996 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379148.1 protein_id gnl|my_center|LOCUS_00220 30463 29108 gene locus_tag LOCUS_00230 gene gorA 30463 29108 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 protein_id gnl|my_center|LOCUS_00230 31408 30737 gene locus_tag LOCUS_00240 31408 30737 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263640.1 protein_id gnl|my_center|LOCUS_00240 32426 31587 gene locus_tag LOCUS_00250 32426 31587 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478729.1 protein_id gnl|my_center|LOCUS_00250 32832 34874 gene locus_tag LOCUS_00260 gene prlC 32832 34874 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_00260 35424 34960 gene locus_tag LOCUS_00270 gene asnC 35424 34960 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465258.1 protein_id gnl|my_center|LOCUS_00270 35541 38675 gene locus_tag LOCUS_00280 35541 38675 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478687.1 protein_id gnl|my_center|LOCUS_00280 38763 39542 gene locus_tag LOCUS_00290 38763 39542 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478714.1 protein_id gnl|my_center|LOCUS_00290 40059 40658 gene locus_tag LOCUS_00300 40059 40658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478648.1 protein_id gnl|my_center|LOCUS_00300 41611 40733 gene locus_tag LOCUS_00310 41611 40733 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467602.1 protein_id gnl|my_center|LOCUS_00310 42107 41682 gene locus_tag LOCUS_00320 gene uspA 42107 41682 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467601.1 protein_id gnl|my_center|LOCUS_00320 42318 42845 gene locus_tag LOCUS_00330 gene ftnA 42318 42845 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 protein_id gnl|my_center|LOCUS_00330 42936 43259 gene locus_tag LOCUS_00340 gene uspB 42936 43259 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394407.1 protein_id gnl|my_center|LOCUS_00340 43407 44600 gene locus_tag LOCUS_00350 43407 44600 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478661.1 protein_id gnl|my_center|LOCUS_00350 45092 44652 gene locus_tag LOCUS_00360 45092 44652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 47682 45235 gene locus_tag LOCUS_00370 47682 45235 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478689.1 protein_id gnl|my_center|LOCUS_00370 48787 47882 gene locus_tag LOCUS_00380 48787 47882 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478651.1 protein_id gnl|my_center|LOCUS_00380 48957 50489 gene locus_tag LOCUS_00390 gene rmuC 48957 50489 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_00390 50568 51347 gene locus_tag LOCUS_00400 gene ubiE 50568 51347 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456853.1 protein_id gnl|my_center|LOCUS_00400 51359 51994 gene locus_tag LOCUS_00410 51359 51994 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 protein_id gnl|my_center|LOCUS_00410 51991 53625 gene locus_tag LOCUS_00420 gene ubiB 51991 53625 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478626.1 protein_id gnl|my_center|LOCUS_00420 53674 53922 gene locus_tag LOCUS_00430 gene tatA 53674 53922 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456852.1 protein_id gnl|my_center|LOCUS_00430 53926 54324 gene locus_tag LOCUS_00440 gene tatB 53926 54324 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 protein_id gnl|my_center|LOCUS_00440 54393 55142 gene locus_tag LOCUS_00450 gene tatC 54393 55142 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459771.1 protein_id gnl|my_center|LOCUS_00450 55414 55863 gene locus_tag LOCUS_00460 55414 55863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 56692 55928 gene locus_tag LOCUS_00470 56692 55928 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478755.1 protein_id gnl|my_center|LOCUS_00470 56879 57940 gene locus_tag LOCUS_00480 gene hemB 56879 57940 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489689.1 protein_id gnl|my_center|LOCUS_00480 58066 58500 gene locus_tag LOCUS_00490 58066 58500 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459779.1 protein_id gnl|my_center|LOCUS_00490 59105 61897 gene locus_tag LOCUS_00500 gene polA 59105 61897 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 protein_id gnl|my_center|LOCUS_00500 63314 62655 gene locus_tag LOCUS_00510 gene yihA 63314 62655 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456829.1 protein_id gnl|my_center|LOCUS_00510 63474 64091 gene locus_tag LOCUS_00520 63474 64091 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_00520 64835 65473 gene locus_tag LOCUS_00530 64835 65473 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_00530 65473 66015 gene locus_tag LOCUS_00540 gene yihI 65473 66015 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478647.1 protein_id gnl|my_center|LOCUS_00540 66023 66511 gene locus_tag LOCUS_00550 66023 66511 CDS product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478692.1 protein_id gnl|my_center|LOCUS_00550 66695 68086 gene locus_tag LOCUS_00560 gene hemN 66695 68086 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478618.1 protein_id gnl|my_center|LOCUS_00560 69158 68154 gene locus_tag LOCUS_00570 gene add 69158 68154 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478706.1 protein_id gnl|my_center|LOCUS_00570 70641 69271 gene locus_tag LOCUS_00580 70641 69271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 71816 70569 gene locus_tag LOCUS_00590 71816 70569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 73317 71914 gene locus_tag LOCUS_00600 gene glnG 73317 71914 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456831.1 protein_id gnl|my_center|LOCUS_00600 74424 73378 gene locus_tag LOCUS_00610 gene glnL 74424 73378 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478632.1 protein_id gnl|my_center|LOCUS_00610 75133 74546 gene locus_tag LOCUS_00620 75133 74546 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456803.1 protein_id gnl|my_center|LOCUS_00620 76741 75332 gene locus_tag LOCUS_00630 gene glnA 76741 75332 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 protein_id gnl|my_center|LOCUS_00630 77272 79101 gene locus_tag LOCUS_00640 gene typA 77272 79101 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456840.1 protein_id gnl|my_center|LOCUS_00640 79177 79728 gene locus_tag LOCUS_00650 79177 79728 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478713.1 protein_id gnl|my_center|LOCUS_00650 80465 79824 gene locus_tag LOCUS_00660 80465 79824 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_00660 80546 81445 gene locus_tag LOCUS_00670 80546 81445 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456793.1 protein_id gnl|my_center|LOCUS_00670 81399 81851 gene locus_tag LOCUS_00680 gene dtd 81399 81851 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478645.1 protein_id gnl|my_center|LOCUS_00680 81960 82877 gene locus_tag LOCUS_00690 81960 82877 CDS product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456791.1 protein_id gnl|my_center|LOCUS_00690 85046 82863 gene locus_tag LOCUS_00700 85046 82863 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478652.1 protein_id gnl|my_center|LOCUS_00700 86795 85167 gene locus_tag LOCUS_00710 gene pckA 86795 85167 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 protein_id gnl|my_center|LOCUS_00710 88007 87132 gene locus_tag LOCUS_00720 gene hslO 88007 87132 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465326.1 protein_id gnl|my_center|LOCUS_00720 88425 88039 gene locus_tag LOCUS_00730 gene hslR 88425 88039 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 protein_id gnl|my_center|LOCUS_00730 88676 89599 gene locus_tag LOCUS_00740 gene gspC 88676 89599 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465330.1 protein_id gnl|my_center|LOCUS_00740 89636 91660 gene locus_tag LOCUS_00750 gene gspD 89636 91660 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478663.1 protein_id gnl|my_center|LOCUS_00750 91660 93159 gene locus_tag LOCUS_00760 gene gspE 91660 93159 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 protein_id gnl|my_center|LOCUS_00760 93159 94379 gene locus_tag LOCUS_00770 gene gspF 93159 94379 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465194.1 protein_id gnl|my_center|LOCUS_00770 94440 94883 gene locus_tag LOCUS_00780 gene gspG 94440 94883 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465191.1 protein_id gnl|my_center|LOCUS_00780 94906 95514 gene locus_tag LOCUS_00790 gene gspH 94906 95514 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478669.1 protein_id gnl|my_center|LOCUS_00790 95555 95890 gene locus_tag LOCUS_00800 gene gspI 95555 95890 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478722.1 protein_id gnl|my_center|LOCUS_00800 95877 96554 gene locus_tag LOCUS_00810 gene gspJ 95877 96554 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465187.1 protein_id gnl|my_center|LOCUS_00810 96547 97557 gene locus_tag LOCUS_00820 gene gspK 96547 97557 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478666.1 protein_id gnl|my_center|LOCUS_00820 97526 98725 gene locus_tag LOCUS_00830 gene gspL 97526 98725 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478653.1 protein_id gnl|my_center|LOCUS_00830 98733 99224 gene locus_tag LOCUS_00840 98733 99224 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458943.1 protein_id gnl|my_center|LOCUS_00840 99226 99987 gene locus_tag LOCUS_00850 99226 99987 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 protein_id gnl|my_center|LOCUS_00850 101104 100277 gene locus_tag LOCUS_00860 gene cysQ 101104 100277 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 protein_id gnl|my_center|LOCUS_00860 101717 101148 gene locus_tag LOCUS_00870 gene nudE 101717 101148 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459019.1 protein_id gnl|my_center|LOCUS_00870 102453 101869 gene locus_tag LOCUS_00880 gene nfuA 102453 101869 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458964.1 protein_id gnl|my_center|LOCUS_00880 103353 104123 gene locus_tag LOCUS_00890 gene bioH 103353 104123 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 protein_id gnl|my_center|LOCUS_00890 104251 104715 gene locus_tag LOCUS_00900 104251 104715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459035.1 protein_id gnl|my_center|LOCUS_00900 107139 104821 gene locus_tag LOCUS_00910 107139 104821 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478620.1 protein_id gnl|my_center|LOCUS_00910 107352 109232 gene locus_tag LOCUS_00920 107352 109232 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459016.1 protein_id gnl|my_center|LOCUS_00920 109789 109304 gene locus_tag LOCUS_00930 gene greB 109789 109304 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260985.1 protein_id gnl|my_center|LOCUS_00930 110301 111020 gene locus_tag LOCUS_00940 gene ompR 110301 111020 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 protein_id gnl|my_center|LOCUS_00940 111146 112438 gene locus_tag LOCUS_00950 gene envZ 111146 112438 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459014.1 protein_id gnl|my_center|LOCUS_00950 113907 112516 gene locus_tag LOCUS_00960 113907 112516 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459007.1 protein_id gnl|my_center|LOCUS_00960 116223 114142 gene locus_tag LOCUS_00970 gene recG 116223 114142 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459023.1 protein_id gnl|my_center|LOCUS_00970 117038 116355 gene locus_tag LOCUS_00980 gene trmH 117038 116355 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478720.1 protein_id gnl|my_center|LOCUS_00980 119212 117092 gene locus_tag LOCUS_00990 gene spoT 119212 117092 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 protein_id gnl|my_center|LOCUS_00990 119524 119252 gene locus_tag LOCUS_01000 gene rpoZ 119524 119252 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379346.1 protein_id gnl|my_center|LOCUS_01000 119671 119757 gene locus_tag LOCUS_t00080 119671 119757 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 120363 119740 gene locus_tag LOCUS_01010 gene gmk 120363 119740 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458969.1 protein_id gnl|my_center|LOCUS_01010 121922 120699 gene locus_tag LOCUS_01020 121922 120699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_01020 122216 121932 gene locus_tag LOCUS_01030 122216 121932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01030 122565 122206 gene locus_tag LOCUS_01040 122565 122206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 122977 122570 gene locus_tag LOCUS_01050 122977 122570 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_01050 123530 123003 gene locus_tag LOCUS_01060 123530 123003 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458945.1 protein_id gnl|my_center|LOCUS_01060 124901 123540 gene locus_tag LOCUS_01070 124901 123540 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459000.1 protein_id gnl|my_center|LOCUS_01070 125669 124905 gene locus_tag LOCUS_01080 125669 124905 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_01080 128329 125732 gene locus_tag LOCUS_01090 128329 125732 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458992.1 protein_id gnl|my_center|LOCUS_01090 129151 129324 gene locus_tag LOCUS_01100 129151 129324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01100 129422 130177 gene locus_tag LOCUS_01110 129422 130177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 130179 131222 gene locus_tag LOCUS_01120 130179 131222 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459031.1 protein_id gnl|my_center|LOCUS_01120 131261 133090 gene locus_tag LOCUS_01130 131261 133090 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458972.1 protein_id gnl|my_center|LOCUS_01130 133100 133957 gene locus_tag LOCUS_01140 133100 133957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105620.1 protein_id gnl|my_center|LOCUS_01140 133994 134833 gene locus_tag LOCUS_01150 133994 134833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005529144.1 protein_id gnl|my_center|LOCUS_01150 135069 135422 gene locus_tag LOCUS_01160 135069 135422 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458957.1 protein_id gnl|my_center|LOCUS_01160 135592 135963 gene locus_tag LOCUS_01170 135592 135963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260975.1 protein_id gnl|my_center|LOCUS_01170 136162 137115 gene locus_tag LOCUS_01180 136162 137115 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260976.1 protein_id gnl|my_center|LOCUS_01180 138048 137182 gene locus_tag LOCUS_01190 138048 137182 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 protein_id gnl|my_center|LOCUS_01190 138223 138939 gene locus_tag LOCUS_01200 gene rph 138223 138939 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478751.1 protein_id gnl|my_center|LOCUS_01200 139044 139685 gene locus_tag LOCUS_01210 gene pyrE 139044 139685 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458955.1 protein_id gnl|my_center|LOCUS_01210 140765 139827 gene locus_tag LOCUS_01220 140765 139827 CDS product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458959.1 protein_id gnl|my_center|LOCUS_01220 141627 140776 gene locus_tag LOCUS_01230 141627 140776 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_01230 142220 141630 gene locus_tag LOCUS_01240 gene slmA 142220 141630 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478760.1 protein_id gnl|my_center|LOCUS_01240 143579 142377 gene locus_tag LOCUS_01250 gene coaBC 143579 142377 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478613.1 protein_id gnl|my_center|LOCUS_01250 143787 145460 gene locus_tag LOCUS_01260 143787 145460 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489697.1 protein_id gnl|my_center|LOCUS_01260 145574 146248 gene locus_tag LOCUS_01270 gene radC 145574 146248 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 protein_id gnl|my_center|LOCUS_01270 146552 146788 gene locus_tag LOCUS_01280 gene rpmB 146552 146788 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 protein_id gnl|my_center|LOCUS_01280 146802 146972 gene locus_tag LOCUS_01290 gene rpmG 146802 146972 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_01290 147149 147625 gene locus_tag LOCUS_01300 147149 147625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462494.1 protein_id gnl|my_center|LOCUS_01300 147744 148553 gene locus_tag LOCUS_01310 gene mutM 147744 148553 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462495.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence002 <1 1230 gene locus_tag LOCUS_01320 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260991.1:alkaline phosphatase family protein 1827 1333 gene locus_tag LOCUS_01330 gene coaD 1827 1333 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078888.1 protein_id gnl|my_center|LOCUS_01330 1956 2945 gene locus_tag LOCUS_01340 1956 2945 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_01340 3708 2914 gene locus_tag LOCUS_01350 3708 2914 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042983.1 protein_id gnl|my_center|LOCUS_01350 4753 3695 gene locus_tag LOCUS_01360 4753 3695 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260995.1 protein_id gnl|my_center|LOCUS_01360 4853 5248 gene locus_tag LOCUS_01370 4853 5248 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 protein_id gnl|my_center|LOCUS_01370 5245 5964 gene locus_tag LOCUS_01380 5245 5964 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459670.1 protein_id gnl|my_center|LOCUS_01380 5994 7826 gene locus_tag LOCUS_01390 5994 7826 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993346.1 protein_id gnl|my_center|LOCUS_01390 8629 7865 gene locus_tag LOCUS_01400 8629 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9885 9208 gene locus_tag LOCUS_01410 gene rffC 9885 9208 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174848112.1 protein_id gnl|my_center|LOCUS_01410 10115 11251 gene locus_tag LOCUS_01420 gene rffA 10115 11251 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612080.1 protein_id gnl|my_center|LOCUS_01420 11254 12372 gene locus_tag LOCUS_01430 11254 12372 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466249.1 protein_id gnl|my_center|LOCUS_01430 12390 13403 gene locus_tag LOCUS_01440 gene pseB 12390 13403 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_01440 13412 14575 gene locus_tag LOCUS_01450 gene pseC 13412 14575 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_01450 14575 15267 gene locus_tag LOCUS_01460 gene pseF 14575 15267 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_01460 15271 16224 gene locus_tag LOCUS_01470 gene pseG 15271 16224 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01470 16384 18573 gene locus_tag LOCUS_01480 16384 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 18584 19288 gene locus_tag LOCUS_01490 18584 19288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 19297 19608 gene locus_tag LOCUS_01500 19297 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01500 19536 20339 gene locus_tag LOCUS_01510 19536 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 21372 20374 gene locus_tag LOCUS_01520 21372 20374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073584690.1 protein_id gnl|my_center|LOCUS_01520 22097 21417 gene locus_tag LOCUS_01530 22097 21417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 23377 22100 gene locus_tag LOCUS_01540 gene waaA 23377 22100 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466242.1 protein_id gnl|my_center|LOCUS_01540 24429 23371 gene locus_tag LOCUS_01550 gene waaF 24429 23371 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466240.1 protein_id gnl|my_center|LOCUS_01550 25412 24426 gene locus_tag LOCUS_01560 gene lpxM 25412 24426 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466232.1 protein_id gnl|my_center|LOCUS_01560 26455 25514 gene locus_tag LOCUS_01570 gene rfaD 26455 25514 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466230.1 protein_id gnl|my_center|LOCUS_01570 27629 26640 gene locus_tag LOCUS_01580 gene wecA 27629 26640 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417117.1 protein_id gnl|my_center|LOCUS_01580 28094 28342 gene locus_tag LOCUS_01590 28094 28342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 28355 29320 gene locus_tag LOCUS_01600 28355 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 30554 31492 gene locus_tag LOCUS_01610 30554 31492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 31696 32613 gene locus_tag LOCUS_01620 gene wbbL 31696 32613 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase WbbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262539.1 protein_id gnl|my_center|LOCUS_01620 32607 33572 gene locus_tag LOCUS_01630 32607 33572 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889297.1 protein_id gnl|my_center|LOCUS_01630 33651 35210 gene locus_tag LOCUS_01640 33651 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 35607 36689 gene locus_tag LOCUS_01650 gene rfbB 35607 36689 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706709.1 protein_id gnl|my_center|LOCUS_01650 36689 37579 gene locus_tag LOCUS_01660 gene rfbD 36689 37579 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706708.1 protein_id gnl|my_center|LOCUS_01660 37582 38466 gene locus_tag LOCUS_01670 gene rfbA 37582 38466 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_01670 38469 39005 gene locus_tag LOCUS_01680 gene rfbC 38469 39005 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_01680 39292 40077 gene locus_tag LOCUS_01690 39292 40077 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_01690 40102 41763 gene locus_tag LOCUS_01700 40102 41763 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 protein_id gnl|my_center|LOCUS_01700 41775 42956 gene locus_tag LOCUS_01710 41775 42956 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_01710 42968 43378 gene locus_tag LOCUS_01720 gene gspG 42968 43378 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 protein_id gnl|my_center|LOCUS_01720 43381 43797 gene locus_tag LOCUS_01730 43381 43797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 43800 44186 gene locus_tag LOCUS_01740 43800 44186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 44188 44916 gene locus_tag LOCUS_01750 44188 44916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 44913 45863 gene locus_tag LOCUS_01760 44913 45863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 45868 46974 gene locus_tag LOCUS_01770 45868 46974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 46962 47597 gene locus_tag LOCUS_01780 46962 47597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 47597 48130 gene locus_tag LOCUS_01790 47597 48130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 48127 50244 gene locus_tag LOCUS_01800 gene gspD 48127 50244 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533584.1 protein_id gnl|my_center|LOCUS_01800 51135 53066 gene locus_tag LOCUS_01810 51135 53066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 53260 54582 gene locus_tag LOCUS_01820 53260 54582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_01820 54572 55345 gene locus_tag LOCUS_01830 54572 55345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 55361 58642 gene locus_tag LOCUS_01840 55361 58642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 60062 58749 gene locus_tag LOCUS_01850 60062 58749 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481419.1 protein_id gnl|my_center|LOCUS_01850 60375 61286 gene locus_tag LOCUS_01860 gene cysD 60375 61286 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 protein_id gnl|my_center|LOCUS_01860 61383 63029 gene locus_tag LOCUS_01870 61383 63029 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_01870 63048 63671 gene locus_tag LOCUS_01880 gene cysC 63048 63671 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707306.1 protein_id gnl|my_center|LOCUS_01880 63683 65101 gene locus_tag LOCUS_01890 gene cysN 63683 65101 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021169.1 protein_id gnl|my_center|LOCUS_01890 65117 66379 gene locus_tag LOCUS_01900 65117 66379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 66392 67156 gene locus_tag LOCUS_01910 66392 67156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 67164 68033 gene locus_tag LOCUS_01920 67164 68033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 68030 68986 gene locus_tag LOCUS_01930 68030 68986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 68995 69936 gene locus_tag LOCUS_01940 68995 69936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 69896 71023 gene locus_tag LOCUS_01950 69896 71023 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 protein_id gnl|my_center|LOCUS_01950 71194 71619 gene locus_tag LOCUS_01960 71194 71619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 71612 72232 gene locus_tag LOCUS_01970 71612 72232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 72261 73436 gene locus_tag LOCUS_01980 72261 73436 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_01980 73489 75399 gene locus_tag LOCUS_01990 73489 75399 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261053.1 protein_id gnl|my_center|LOCUS_01990 76285 75515 gene locus_tag LOCUS_02000 gene tpiA 76285 75515 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466271.1 protein_id gnl|my_center|LOCUS_02000 76546 76893 gene locus_tag LOCUS_02010 76546 76893 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458871.1 protein_id gnl|my_center|LOCUS_02010 76869 77378 gene locus_tag LOCUS_02020 76869 77378 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458874.1 protein_id gnl|my_center|LOCUS_02020 77683 77898 gene locus_tag LOCUS_02030 77683 77898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 78236 77892 gene locus_tag LOCUS_02040 78236 77892 CDS product DUF3135 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458876.1 protein_id gnl|my_center|LOCUS_02040 78988 78374 gene locus_tag LOCUS_02050 78988 78374 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484031.1 protein_id gnl|my_center|LOCUS_02050 80298 79291 gene locus_tag LOCUS_02060 gene glpX 80298 79291 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458880.1 protein_id gnl|my_center|LOCUS_02060 80633 80875 gene locus_tag LOCUS_02070 gene zapB 80633 80875 CDS product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481417.1 protein_id gnl|my_center|LOCUS_02070 81463 80939 gene locus_tag LOCUS_02080 gene rraA 81463 80939 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457192.1 protein_id gnl|my_center|LOCUS_02080 82456 81539 gene locus_tag LOCUS_02090 82456 81539 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457195.1 protein_id gnl|my_center|LOCUS_02090 84100 82769 gene locus_tag LOCUS_02100 gene hslU 84100 82769 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457198.1 protein_id gnl|my_center|LOCUS_02100 84681 84130 gene locus_tag LOCUS_02110 gene hslV 84681 84130 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455873.1 protein_id gnl|my_center|LOCUS_02110 85240 84884 gene locus_tag LOCUS_02120 85240 84884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 86575 85568 gene locus_tag LOCUS_02130 gene cytR 86575 85568 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481416.1 protein_id gnl|my_center|LOCUS_02130 88882 86780 gene locus_tag LOCUS_02140 gene priA 88882 86780 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481427.1 protein_id gnl|my_center|LOCUS_02140 89279 89497 gene locus_tag LOCUS_02150 gene rpmE 89279 89497 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 protein_id gnl|my_center|LOCUS_02150 89955 90266 gene locus_tag LOCUS_02160 gene rpsJ 89955 90266 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410492.1 protein_id gnl|my_center|LOCUS_02160 90281 90910 gene locus_tag LOCUS_02170 gene rplC 90281 90910 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 protein_id gnl|my_center|LOCUS_02170 90928 91530 gene locus_tag LOCUS_02180 gene rplD 90928 91530 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 protein_id gnl|my_center|LOCUS_02180 91527 91829 gene locus_tag LOCUS_02190 gene rplW 91527 91829 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398471.1 protein_id gnl|my_center|LOCUS_02190 91845 92669 gene locus_tag LOCUS_02200 gene rplB 91845 92669 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489461.1 protein_id gnl|my_center|LOCUS_02200 92691 92969 gene locus_tag LOCUS_02210 gene rpsS 92691 92969 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_02210 92980 93312 gene locus_tag LOCUS_02220 gene rplV 92980 93312 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_02220 93331 94029 gene locus_tag LOCUS_02230 gene rpsC 93331 94029 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383161.1 protein_id gnl|my_center|LOCUS_02230 94041 94451 gene locus_tag LOCUS_02240 gene rplP 94041 94451 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379577.1 protein_id gnl|my_center|LOCUS_02240 94451 94642 gene locus_tag LOCUS_02250 gene rpmC 94451 94642 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 protein_id gnl|my_center|LOCUS_02250 94642 94896 gene locus_tag LOCUS_02260 gene rpsQ 94642 94896 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461671.1 protein_id gnl|my_center|LOCUS_02260 95061 95432 gene locus_tag LOCUS_02270 gene rplN 95061 95432 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489425.1 protein_id gnl|my_center|LOCUS_02270 95446 95763 gene locus_tag LOCUS_02280 gene rplX 95446 95763 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729178.1 protein_id gnl|my_center|LOCUS_02280 95787 96326 gene locus_tag LOCUS_02290 gene rplE 95787 96326 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455660.1 protein_id gnl|my_center|LOCUS_02290 96344 96649 gene locus_tag LOCUS_02300 gene rpsN 96344 96649 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455658.1 protein_id gnl|my_center|LOCUS_02300 96679 97071 gene locus_tag LOCUS_02310 gene rpsH 96679 97071 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455656.1 protein_id gnl|my_center|LOCUS_02310 97084 97617 gene locus_tag LOCUS_02320 gene rplF 97084 97617 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455654.1 protein_id gnl|my_center|LOCUS_02320 97627 97980 gene locus_tag LOCUS_02330 gene rplR 97627 97980 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435088.1 protein_id gnl|my_center|LOCUS_02330 97995 98498 gene locus_tag LOCUS_02340 gene rpsE 97995 98498 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435090.1 protein_id gnl|my_center|LOCUS_02340 98506 98682 gene locus_tag LOCUS_02350 gene rpmD 98506 98682 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_02350 98688 99122 gene locus_tag LOCUS_02360 gene rplO 98688 99122 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_02360 99143 100477 gene locus_tag LOCUS_02370 gene secY 99143 100477 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 protein_id gnl|my_center|LOCUS_02370 100779 101135 gene locus_tag LOCUS_02380 gene rpsM 100779 101135 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450559.1 protein_id gnl|my_center|LOCUS_02380 101154 101543 gene locus_tag LOCUS_02390 gene rpsK 101154 101543 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118870.1 protein_id gnl|my_center|LOCUS_02390 101571 102191 gene locus_tag LOCUS_02400 gene rpsD 101571 102191 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383146.1 protein_id gnl|my_center|LOCUS_02400 102216 103208 gene locus_tag LOCUS_02410 gene rpoA 102216 103208 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383143.1 protein_id gnl|my_center|LOCUS_02410 103235 103615 gene locus_tag LOCUS_02420 gene rplQ 103235 103615 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383141.1 protein_id gnl|my_center|LOCUS_02420 104381 103887 gene locus_tag LOCUS_02430 104381 103887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 105116 104496 gene locus_tag LOCUS_02440 105116 104496 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 protein_id gnl|my_center|LOCUS_02440 105348 105944 gene locus_tag LOCUS_02450 105348 105944 CDS product LysM-like peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454652.1 protein_id gnl|my_center|LOCUS_02450 106881 106021 gene locus_tag LOCUS_02460 106881 106021 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196597804.1 protein_id gnl|my_center|LOCUS_02460 107334 106882 gene locus_tag LOCUS_02470 107334 106882 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454683.1 protein_id gnl|my_center|LOCUS_02470 107481 108860 gene locus_tag LOCUS_02480 gene dbpA 107481 108860 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454697.1 protein_id gnl|my_center|LOCUS_02480 109500 108928 gene locus_tag LOCUS_02490 109500 108928 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_02490 111559 109598 gene locus_tag LOCUS_02500 gene cpdB 111559 109598 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454661.1 protein_id gnl|my_center|LOCUS_02500 111834 112709 gene locus_tag LOCUS_02510 gene cobA 111834 112709 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 protein_id gnl|my_center|LOCUS_02510 112768 113676 gene locus_tag LOCUS_02520 gene cysD 112768 113676 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454659.1 protein_id gnl|my_center|LOCUS_02520 113695 115125 gene locus_tag LOCUS_02530 gene cysN 113695 115125 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454657.1 protein_id gnl|my_center|LOCUS_02530 115334 117058 gene locus_tag LOCUS_02540 115334 117058 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454668.1 protein_id gnl|my_center|LOCUS_02540 117083 117700 gene locus_tag LOCUS_02550 gene cysC 117083 117700 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454655.1 protein_id gnl|my_center|LOCUS_02550 118696 117791 gene locus_tag LOCUS_02560 118696 117791 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417387.1 protein_id gnl|my_center|LOCUS_02560 119525 119031 gene locus_tag LOCUS_02570 119525 119031 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 protein_id gnl|my_center|LOCUS_02570 119833 119531 gene locus_tag LOCUS_02580 119833 119531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 120789 119860 gene locus_tag LOCUS_02590 120789 119860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02590 121514 120786 gene locus_tag LOCUS_02600 121514 120786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_02600 122277 121567 gene locus_tag LOCUS_02610 122277 121567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 123388 122837 gene locus_tag LOCUS_02620 123388 122837 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454650.1 protein_id gnl|my_center|LOCUS_02620 123603 123803 gene locus_tag LOCUS_02630 123603 123803 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454667.1 protein_id gnl|my_center|LOCUS_02630 124490 123852 gene locus_tag LOCUS_02640 gene msrA 124490 123852 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479646.1 protein_id gnl|my_center|LOCUS_02640 124657 126369 gene locus_tag LOCUS_02650 124657 126369 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454701.1 protein_id gnl|my_center|LOCUS_02650 126366 130226 gene locus_tag LOCUS_02660 126366 130226 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479640.1 protein_id gnl|my_center|LOCUS_02660 130252 130599 gene locus_tag LOCUS_02670 130252 130599 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454676.1 protein_id gnl|my_center|LOCUS_02670 130664 131002 gene locus_tag LOCUS_02680 130664 131002 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261795.1 protein_id gnl|my_center|LOCUS_02680 131611 131078 gene locus_tag LOCUS_02690 gene ppa 131611 131078 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454643.1 protein_id gnl|my_center|LOCUS_02690 132753 131737 gene locus_tag LOCUS_02700 gene fbp 132753 131737 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454699.1 protein_id gnl|my_center|LOCUS_02700 133068 134426 gene locus_tag LOCUS_02710 gene mpl 133068 134426 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479669.1 protein_id gnl|my_center|LOCUS_02710 134426 135064 gene locus_tag LOCUS_02720 134426 135064 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454680.1 protein_id gnl|my_center|LOCUS_02720 135316 136308 gene locus_tag LOCUS_02730 gene thiB 135316 136308 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479648.1 protein_id gnl|my_center|LOCUS_02730 136397 137908 gene locus_tag LOCUS_02740 gene thiP 136397 137908 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479637.1 protein_id gnl|my_center|LOCUS_02740 137908 138612 gene locus_tag LOCUS_02750 gene thiQ 137908 138612 CDS product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454663.1 protein_id gnl|my_center|LOCUS_02750 139125 138688 gene locus_tag LOCUS_02760 139125 138688 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454686.1 protein_id gnl|my_center|LOCUS_02760 139397 139170 gene locus_tag LOCUS_02770 139397 139170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02770 141748 139520 gene locus_tag LOCUS_02780 141748 139520 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454675.1 protein_id gnl|my_center|LOCUS_02780 143007 142039 gene locus_tag LOCUS_02790 143007 142039 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 protein_id gnl|my_center|LOCUS_02790 143863 143393 gene locus_tag LOCUS_02800 gene argR 143863 143393 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005430583.1 protein_id gnl|my_center|LOCUS_02800 144224 145159 gene locus_tag LOCUS_02810 gene mdh 144224 145159 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 protein_id gnl|my_center|LOCUS_02810 145284 145475 gene locus_tag LOCUS_02820 145284 145475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479653.1 protein_id gnl|my_center|LOCUS_02820 146527 145556 gene locus_tag LOCUS_02830 gene ispB 146527 145556 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479642.1 protein_id gnl|my_center|LOCUS_02830 146785 147096 gene locus_tag LOCUS_02840 gene rplU 146785 147096 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_02840 147117 147374 gene locus_tag LOCUS_02850 gene rpmA 147117 147374 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 protein_id gnl|my_center|LOCUS_02850 147586 148761 gene locus_tag LOCUS_02860 gene cgtA 147586 148761 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489537.1 protein_id gnl|my_center|LOCUS_02860 148931 149359 gene locus_tag LOCUS_02870 148931 149359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02870 149356 149700 gene locus_tag LOCUS_02880 149356 149700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02880 149682 150173 gene locus_tag LOCUS_02890 149682 150173 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 protein_id gnl|my_center|LOCUS_02890 150183 150662 gene locus_tag LOCUS_02900 gene folA 150183 150662 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459612.1 protein_id gnl|my_center|LOCUS_02900 151536 150730 gene locus_tag LOCUS_02910 gene apaH 151536 150730 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480531.1 protein_id gnl|my_center|LOCUS_02910 151929 151549 gene locus_tag LOCUS_02920 gene apaG 151929 151549 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 protein_id gnl|my_center|LOCUS_02920 152813 152001 gene locus_tag LOCUS_02930 gene rsmA 152813 152001 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 protein_id gnl|my_center|LOCUS_02930 153808 152810 gene locus_tag LOCUS_02940 gene pdxA 153808 152810 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459624.1 protein_id gnl|my_center|LOCUS_02940 155081 153798 gene locus_tag LOCUS_02950 gene surA 155081 153798 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459625.1 protein_id gnl|my_center|LOCUS_02950 157482 155137 gene locus_tag LOCUS_02960 gene lptD 157482 155137 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480552.1 protein_id gnl|my_center|LOCUS_02960 157751 158611 gene locus_tag LOCUS_02970 gene djlA 157751 158611 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459635.1 protein_id gnl|my_center|LOCUS_02970 159530 158748 gene locus_tag LOCUS_02980 159530 158748 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480502.1 protein_id gnl|my_center|LOCUS_02980 160266 159664 gene locus_tag LOCUS_02990 gene leuD 160266 159664 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480538.1 protein_id gnl|my_center|LOCUS_02990 161678 160278 gene locus_tag LOCUS_03000 gene leuC 161678 160278 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480559.1 protein_id gnl|my_center|LOCUS_03000 162955 161864 gene locus_tag LOCUS_03010 gene leuB 162955 161864 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459506.1 protein_id gnl|my_center|LOCUS_03010 164597 163050 gene locus_tag LOCUS_03020 gene leuA 164597 163050 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459507.1 protein_id gnl|my_center|LOCUS_03020 165308 165976 gene locus_tag LOCUS_03030 165308 165976 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459508.1 protein_id gnl|my_center|LOCUS_03030 166124 166672 gene locus_tag LOCUS_03040 166124 166672 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480556.1 protein_id gnl|my_center|LOCUS_03040 166676 167725 gene locus_tag LOCUS_03050 166676 167725 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_03050 168571 169530 gene locus_tag LOCUS_03060 gene calR 168571 169530 CDS product LysR family transcriptional regulator CalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459522.1 protein_id gnl|my_center|LOCUS_03060 169830 171638 gene locus_tag LOCUS_03070 169830 171638 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 protein_id gnl|my_center|LOCUS_03070 172087 173811 gene locus_tag LOCUS_03080 172087 173811 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480580.1 protein_id gnl|my_center|LOCUS_03080 173813 174307 gene locus_tag LOCUS_03090 gene ilvN 173813 174307 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459526.1 protein_id gnl|my_center|LOCUS_03090 174420 176300 gene locus_tag LOCUS_03100 174420 176300 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480536.1 protein_id gnl|my_center|LOCUS_03100 177011 176352 gene locus_tag LOCUS_03110 177011 176352 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480529.1 protein_id gnl|my_center|LOCUS_03110 178582 177170 gene locus_tag LOCUS_03120 gene pykF 178582 177170 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453794.1 protein_id gnl|my_center|LOCUS_03120 179015 179776 gene locus_tag LOCUS_03130 179015 179776 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453786.1 protein_id gnl|my_center|LOCUS_03130 179891 181723 gene locus_tag LOCUS_03140 gene glmS 179891 181723 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453795.1 protein_id gnl|my_center|LOCUS_03140 182019 182396 gene locus_tag LOCUS_03150 182019 182396 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480571.1 protein_id gnl|my_center|LOCUS_03150 182425 183180 gene locus_tag LOCUS_03160 182425 183180 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480575.1 protein_id gnl|my_center|LOCUS_03160 183173 184543 gene locus_tag LOCUS_03170 183173 184543 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480540.1 protein_id gnl|my_center|LOCUS_03170 184927 184646 gene locus_tag LOCUS_03180 184927 184646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 185091 185810 gene locus_tag LOCUS_03190 185091 185810 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_03190 186044 186319 gene locus_tag LOCUS_03200 186044 186319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497023.1 protein_id gnl|my_center|LOCUS_03200 186454 186379 gene locus_tag LOCUS_t00090 186454 186379 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 188323 186599 gene locus_tag LOCUS_03210 gene rpoD 188323 186599 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 protein_id gnl|my_center|LOCUS_03210 190320 188560 gene locus_tag LOCUS_03220 gene dnaG 190320 188560 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453774.1 protein_id gnl|my_center|LOCUS_03220 190912 190469 gene locus_tag LOCUS_03230 190912 190469 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_03230 191156 190941 gene locus_tag LOCUS_03240 gene rpsU 191156 190941 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145625.1 protein_id gnl|my_center|LOCUS_03240 191341 192402 gene locus_tag LOCUS_03250 gene tsaD 191341 192402 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105657.1 protein_id gnl|my_center|LOCUS_03250 192581 192916 gene locus_tag LOCUS_03260 192581 192916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 192931 193398 gene locus_tag LOCUS_03270 192931 193398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03270 194046 193435 gene locus_tag LOCUS_03280 gene plsY 194046 193435 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479185.1 protein_id gnl|my_center|LOCUS_03280 194249 194608 gene locus_tag LOCUS_03290 gene folB 194249 194608 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 protein_id gnl|my_center|LOCUS_03290 194605 195087 gene locus_tag LOCUS_03300 gene folK 194605 195087 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465890.1 protein_id gnl|my_center|LOCUS_03300 195104 195907 gene locus_tag LOCUS_03310 195104 195907 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479178.1 protein_id gnl|my_center|LOCUS_03310 197198 195978 gene locus_tag LOCUS_03320 197198 195978 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479176.1 protein_id gnl|my_center|LOCUS_03320 197358 198980 gene locus_tag LOCUS_03330 197358 198980 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479167.1 protein_id gnl|my_center|LOCUS_03330 198980 199702 gene locus_tag LOCUS_03340 198980 199702 CDS product general secretion pathway protein GspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479189.1 protein_id gnl|my_center|LOCUS_03340 200380 199769 gene locus_tag LOCUS_03350 200380 199769 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 protein_id gnl|my_center|LOCUS_03350 201819 200560 gene locus_tag LOCUS_03360 201819 200560 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479165.1 protein_id gnl|my_center|LOCUS_03360 202636 201950 gene locus_tag LOCUS_03370 202636 201950 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479163.1 protein_id gnl|my_center|LOCUS_03370 202836 204368 gene locus_tag LOCUS_03380 202836 204368 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479180.1 protein_id gnl|my_center|LOCUS_03380 205166 204393 gene locus_tag LOCUS_03390 205166 204393 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455438.1 protein_id gnl|my_center|LOCUS_03390 205312 206505 gene locus_tag LOCUS_03400 205312 206505 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455439.1 protein_id gnl|my_center|LOCUS_03400 206617 209460 gene locus_tag LOCUS_03410 gene glnE 206617 209460 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455447.1 protein_id gnl|my_center|LOCUS_03410 209538 210968 gene locus_tag LOCUS_03420 gene hldE 209538 210968 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455449.1 protein_id gnl|my_center|LOCUS_03420 212583 211261 gene locus_tag LOCUS_03430 gene vpoC 212583 211261 CDS product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 protein_id gnl|my_center|LOCUS_03430 212813 213463 gene locus_tag LOCUS_03440 gene nudF 212813 213463 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457144.1 protein_id gnl|my_center|LOCUS_03440 213463 213906 gene locus_tag LOCUS_03450 213463 213906 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482022.1 protein_id gnl|my_center|LOCUS_03450 213966 214772 gene locus_tag LOCUS_03460 gene cpdA 213966 214772 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482023.1 protein_id gnl|my_center|LOCUS_03460 214900 215412 gene locus_tag LOCUS_03470 gene yqiA 214900 215412 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457154.1 protein_id gnl|my_center|LOCUS_03470 215663 217543 gene locus_tag LOCUS_03480 gene parE 215663 217543 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457157.1 protein_id gnl|my_center|LOCUS_03480 217547 219835 gene locus_tag LOCUS_03490 gene parC 217547 219835 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482017.1 protein_id gnl|my_center|LOCUS_03490 220937 219873 gene locus_tag LOCUS_03500 gene degS 220937 219873 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490480.1 protein_id gnl|my_center|LOCUS_03500 222424 221057 gene locus_tag LOCUS_03510 222424 221057 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 protein_id gnl|my_center|LOCUS_03510 223102 222659 gene locus_tag LOCUS_03520 gene zapG 223102 222659 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457173.1 protein_id gnl|my_center|LOCUS_03520 223299 224402 gene locus_tag LOCUS_03530 gene zapE 223299 224402 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105660.1 protein_id gnl|my_center|LOCUS_03530 224656 225084 gene locus_tag LOCUS_03540 gene rplM 224656 225084 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 protein_id gnl|my_center|LOCUS_03540 225100 225492 gene locus_tag LOCUS_03550 gene rpsI 225100 225492 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458217.1 protein_id gnl|my_center|LOCUS_03550 226076 226666 gene locus_tag LOCUS_03560 gene petA 226076 226666 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479718.1 protein_id gnl|my_center|LOCUS_03560 226666 227931 gene locus_tag LOCUS_03570 226666 227931 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479717.1 protein_id gnl|my_center|LOCUS_03570 227928 228665 gene locus_tag LOCUS_03580 227928 228665 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 protein_id gnl|my_center|LOCUS_03580 228762 229397 gene locus_tag LOCUS_03590 gene sspA 228762 229397 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458199.1 protein_id gnl|my_center|LOCUS_03590 229417 229902 gene locus_tag LOCUS_03600 gene sspB 229417 229902 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 protein_id gnl|my_center|LOCUS_03600 230530 229949 gene locus_tag LOCUS_03610 230530 229949 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105663.1 protein_id gnl|my_center|LOCUS_03610 231142 230552 gene locus_tag LOCUS_03620 231142 230552 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458175.1 protein_id gnl|my_center|LOCUS_03620 231514 231146 gene locus_tag LOCUS_03630 231514 231146 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479720.1 protein_id gnl|my_center|LOCUS_03630 233312 231501 gene locus_tag LOCUS_03640 233312 231501 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458195.1 protein_id gnl|my_center|LOCUS_03640 233381 234244 gene locus_tag LOCUS_03650 gene rsmI 233381 234244 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 protein_id gnl|my_center|LOCUS_03650 235074 236096 gene locus_tag LOCUS_03660 gene rsmH 235074 236096 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458168.1 protein_id gnl|my_center|LOCUS_03660 236102 236419 gene locus_tag LOCUS_03670 gene ftsL 236102 236419 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458197.1 protein_id gnl|my_center|LOCUS_03670 236416 238200 gene locus_tag LOCUS_03680 236416 238200 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458172.1 protein_id gnl|my_center|LOCUS_03680 238255 239736 gene locus_tag LOCUS_03690 gene murE 238255 239736 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458180.1 protein_id gnl|my_center|LOCUS_03690 239733 241097 gene locus_tag LOCUS_03700 gene murF 239733 241097 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458188.1 protein_id gnl|my_center|LOCUS_03700 241097 242179 gene locus_tag LOCUS_03710 gene mraY 241097 242179 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458164.1 protein_id gnl|my_center|LOCUS_03710 242229 243542 gene locus_tag LOCUS_03720 gene murD 242229 243542 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458170.1 protein_id gnl|my_center|LOCUS_03720 243561 244757 gene locus_tag LOCUS_03730 gene ftsW 243561 244757 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458190.1 protein_id gnl|my_center|LOCUS_03730 244744 245811 gene locus_tag LOCUS_03740 gene murG 244744 245811 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458193.1 protein_id gnl|my_center|LOCUS_03740 245834 247294 gene locus_tag LOCUS_03750 gene murC 245834 247294 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458174.1 protein_id gnl|my_center|LOCUS_03750 247485 248270 gene locus_tag LOCUS_03760 247485 248270 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489880.1 protein_id gnl|my_center|LOCUS_03760 248263 249525 gene locus_tag LOCUS_03770 gene ftsA 248263 249525 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458184.1 protein_id gnl|my_center|LOCUS_03770 249556 250794 gene locus_tag LOCUS_03780 gene ftsZ 249556 250794 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497096.1 protein_id gnl|my_center|LOCUS_03780 250895 251812 gene locus_tag LOCUS_03790 gene lpxC 250895 251812 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461213.1 protein_id gnl|my_center|LOCUS_03790 252340 251879 gene locus_tag LOCUS_03800 252340 251879 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480837.1 protein_id gnl|my_center|LOCUS_03800 252747 255476 gene locus_tag LOCUS_03810 gene secA 252747 255476 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461206.1 protein_id gnl|my_center|LOCUS_03810 255815 256213 gene locus_tag LOCUS_03820 gene mutT 255815 256213 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461225.1 protein_id gnl|my_center|LOCUS_03820 256327 257136 gene locus_tag LOCUS_03830 gene dapB 256327 257136 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461189.1 protein_id gnl|my_center|LOCUS_03830 257618 258757 gene locus_tag LOCUS_03840 gene carA 257618 258757 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 protein_id gnl|my_center|LOCUS_03840 258774 262007 gene locus_tag LOCUS_03850 gene carB 258774 262007 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461228.1 protein_id gnl|my_center|LOCUS_03850 262151 262366 gene locus_tag LOCUS_03860 262151 262366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 263407 262493 gene locus_tag LOCUS_03870 263407 262493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 263659 264438 gene locus_tag LOCUS_03880 263659 264438 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461211.1 protein_id gnl|my_center|LOCUS_03880 265234 264368 gene locus_tag LOCUS_03890 265234 264368 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105668.1 protein_id gnl|my_center|LOCUS_03890 265981 265361 gene locus_tag LOCUS_03900 265981 265361 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461192.1 protein_id gnl|my_center|LOCUS_03900 266883 266059 gene locus_tag LOCUS_03910 gene btuF 266883 266059 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461204.1 protein_id gnl|my_center|LOCUS_03910 267836 266883 gene locus_tag LOCUS_03920 267836 266883 CDS product cobalamin biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461205.1 protein_id gnl|my_center|LOCUS_03920 268546 267851 gene locus_tag LOCUS_03930 gene mtnN 268546 267851 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 protein_id gnl|my_center|LOCUS_03930 268971 268612 gene locus_tag LOCUS_03940 268971 268612 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480841.1 protein_id gnl|my_center|LOCUS_03940 270544 269132 gene locus_tag LOCUS_03950 270544 269132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 protein_id gnl|my_center|LOCUS_03950 275028 270565 gene locus_tag LOCUS_03960 gene gltB 275028 270565 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461215.1 protein_id gnl|my_center|LOCUS_03960 276950 275481 gene locus_tag LOCUS_03970 276950 275481 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480842.1 protein_id gnl|my_center|LOCUS_03970 278143 276950 gene locus_tag LOCUS_03980 278143 276950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 281502 278095 gene locus_tag LOCUS_03990 281502 278095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 282058 283002 gene locus_tag LOCUS_04000 282058 283002 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480839.1 protein_id gnl|my_center|LOCUS_04000 283053 284798 gene locus_tag LOCUS_04010 283053 284798 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455892.1 protein_id gnl|my_center|LOCUS_04010 284994 287354 gene locus_tag LOCUS_04020 gene arcB 284994 287354 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488721.1 protein_id gnl|my_center|LOCUS_04020 287356 287805 gene locus_tag LOCUS_04030 287356 287805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488692.1 protein_id gnl|my_center|LOCUS_04030 288591 287875 gene locus_tag LOCUS_04040 gene arcA 288591 287875 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105671.1 protein_id gnl|my_center|LOCUS_04040 288950 289357 gene locus_tag LOCUS_04050 288950 289357 CDS product DUF3293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105673.1 protein_id gnl|my_center|LOCUS_04050 289416 289898 gene locus_tag LOCUS_04060 289416 289898 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460676.1 protein_id gnl|my_center|LOCUS_04060 290368 289895 gene locus_tag LOCUS_04070 290368 289895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460677.1 protein_id gnl|my_center|LOCUS_04070 290980 293439 gene locus_tag LOCUS_04080 gene thrA 290980 293439 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479590.1 protein_id gnl|my_center|LOCUS_04080 293445 294416 gene locus_tag LOCUS_04090 gene thrB 293445 294416 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 protein_id gnl|my_center|LOCUS_04090 294413 295693 gene locus_tag LOCUS_04100 gene thrC 294413 295693 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479592.1 protein_id gnl|my_center|LOCUS_04100 295834 296493 gene locus_tag LOCUS_04110 295834 296493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 296977 296600 gene locus_tag LOCUS_04120 gene grcA 296977 296600 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459053.1 protein_id gnl|my_center|LOCUS_04120 297305 298192 gene locus_tag LOCUS_04130 gene nfo 297305 298192 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479588.1 protein_id gnl|my_center|LOCUS_04130 298603 299283 gene locus_tag LOCUS_04140 gene ung 298603 299283 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465920.1 protein_id gnl|my_center|LOCUS_04140 299418 299969 gene locus_tag LOCUS_04150 299418 299969 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459058.1 protein_id gnl|my_center|LOCUS_04150 300384 300199 gene locus_tag LOCUS_04160 300384 300199 CDS product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459060.1 protein_id gnl|my_center|LOCUS_04160 301103 302539 gene locus_tag LOCUS_04170 301103 302539 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459389.1 protein_id gnl|my_center|LOCUS_04170 302652 303428 gene locus_tag LOCUS_04180 gene yaaA 302652 303428 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 protein_id gnl|my_center|LOCUS_04180 303630 304265 gene locus_tag LOCUS_04190 303630 304265 CDS product alternative oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 protein_id gnl|my_center|LOCUS_04190 305551 304328 gene locus_tag LOCUS_04200 gene srmB 305551 304328 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479730.1 protein_id gnl|my_center|LOCUS_04200 306399 305659 gene locus_tag LOCUS_04210 306399 305659 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488675.1 protein_id gnl|my_center|LOCUS_04210 306667 308022 gene locus_tag LOCUS_04220 gene brnQ 306667 308022 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479733.1 protein_id gnl|my_center|LOCUS_04220 308623 308105 gene locus_tag LOCUS_04230 gene fldB 308623 308105 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479739.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence003 282 1199 gene locus_tag LOCUS_04240 gene xerD 282 1199 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479728.1 protein_id gnl|my_center|LOCUS_04240 1249 2037 gene locus_tag LOCUS_04250 gene dsbC 1249 2037 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487646.1 protein_id gnl|my_center|LOCUS_04250 2060 3823 gene locus_tag LOCUS_04260 gene recJ 2060 3823 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479737.1 protein_id gnl|my_center|LOCUS_04260 4349 5095 gene locus_tag LOCUS_04270 4349 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04270 5130 6662 gene locus_tag LOCUS_04280 gene lysS 5130 6662 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459407.1 protein_id gnl|my_center|LOCUS_04280 6907 8241 gene locus_tag LOCUS_04290 gene vpsR 6907 8241 CDS product cyclic-di-GMP-binding transcriptional regulator VpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459408.1 protein_id gnl|my_center|LOCUS_04290 8747 8998 gene locus_tag LOCUS_04300 8747 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459410.1 protein_id gnl|my_center|LOCUS_04300 10151 9117 gene locus_tag LOCUS_04310 10151 9117 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488759.1 protein_id gnl|my_center|LOCUS_04310 10306 10617 gene locus_tag LOCUS_04320 10306 10617 CDS product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481791.1 protein_id gnl|my_center|LOCUS_04320 11564 10884 gene locus_tag LOCUS_04330 gene mutH 11564 10884 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481789.1 protein_id gnl|my_center|LOCUS_04330 12014 12172 gene locus_tag LOCUS_04340 12014 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 12183 12701 gene locus_tag LOCUS_04350 gene rppH 12183 12701 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481384.1 protein_id gnl|my_center|LOCUS_04350 12711 13847 gene locus_tag LOCUS_04360 12711 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 13817 14956 gene locus_tag LOCUS_04370 13817 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 14963 15754 gene locus_tag LOCUS_04380 14963 15754 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481395.1 protein_id gnl|my_center|LOCUS_04380 15843 16664 gene locus_tag LOCUS_04390 gene lgt 15843 16664 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481391.1 protein_id gnl|my_center|LOCUS_04390 16674 17525 gene locus_tag LOCUS_04400 16674 17525 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481388.1 protein_id gnl|my_center|LOCUS_04400 19343 18195 gene locus_tag LOCUS_04410 19343 18195 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481386.1 protein_id gnl|my_center|LOCUS_04410 19725 20615 gene locus_tag LOCUS_04420 gene nhaR 19725 20615 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457134.1 protein_id gnl|my_center|LOCUS_04420 20749 21054 gene locus_tag LOCUS_04430 20749 21054 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 protein_id gnl|my_center|LOCUS_04430 21446 21186 gene locus_tag LOCUS_04440 gene rpsT 21446 21186 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381938.1 protein_id gnl|my_center|LOCUS_04440 21741 23303 gene locus_tag LOCUS_04450 gene murJ 21741 23303 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477919.1 protein_id gnl|my_center|LOCUS_04450 23373 24308 gene locus_tag LOCUS_04460 gene ribF 23373 24308 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_04460 24373 27201 gene locus_tag LOCUS_04470 gene ileS 24373 27201 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 protein_id gnl|my_center|LOCUS_04470 27275 27781 gene locus_tag LOCUS_04480 gene lspA 27275 27781 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460289.1 protein_id gnl|my_center|LOCUS_04480 28009 28440 gene locus_tag LOCUS_04490 gene fkpB 28009 28440 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 protein_id gnl|my_center|LOCUS_04490 28465 29430 gene locus_tag LOCUS_04500 gene ispH 28465 29430 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460282.1 protein_id gnl|my_center|LOCUS_04500 30241 29513 gene locus_tag LOCUS_04510 gene btsR 30241 29513 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460295.1 protein_id gnl|my_center|LOCUS_04510 31943 30273 gene locus_tag LOCUS_04520 31943 30273 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477917.1 protein_id gnl|my_center|LOCUS_04520 33566 32082 gene locus_tag LOCUS_04530 33566 32082 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 protein_id gnl|my_center|LOCUS_04530 33883 34224 gene locus_tag LOCUS_04540 33883 34224 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460271.1 protein_id gnl|my_center|LOCUS_04540 34416 34664 gene locus_tag LOCUS_04550 34416 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 35663 34737 gene locus_tag LOCUS_04560 gene murQ 35663 34737 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477926.1 protein_id gnl|my_center|LOCUS_04560 36855 35728 gene locus_tag LOCUS_04570 36855 35728 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477894.1 protein_id gnl|my_center|LOCUS_04570 36941 37924 gene locus_tag LOCUS_04580 gene nagZ 36941 37924 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477936.1 protein_id gnl|my_center|LOCUS_04580 38130 39236 gene locus_tag LOCUS_04590 38130 39236 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477886.1 protein_id gnl|my_center|LOCUS_04590 39261 39473 gene locus_tag LOCUS_04600 39261 39473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04600 39497 40390 gene locus_tag LOCUS_04610 gene tyrA 39497 40390 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477896.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04610 41460 40459 gene locus_tag LOCUS_04620 41460 40459 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477915.1 protein_id gnl|my_center|LOCUS_04620 41855 41487 gene locus_tag LOCUS_04630 41855 41487 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570784.1 protein_id gnl|my_center|LOCUS_04630 43725 42058 gene locus_tag LOCUS_04640 gene ettA 43725 42058 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460278.1 protein_id gnl|my_center|LOCUS_04640 44176 46047 gene locus_tag LOCUS_04650 gene sltY 44176 46047 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105682.1 protein_id gnl|my_center|LOCUS_04650 46061 46363 gene locus_tag LOCUS_04660 gene trpR 46061 46363 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497218.1 protein_id gnl|my_center|LOCUS_04660 46978 46445 gene locus_tag LOCUS_04670 gene yjjX 46978 46445 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451172.1 protein_id gnl|my_center|LOCUS_04670 48181 47003 gene locus_tag LOCUS_04680 gene pheA 48181 47003 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_04680 48752 48426 gene locus_tag LOCUS_04690 gene raiA 48752 48426 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468590.1 protein_id gnl|my_center|LOCUS_04690 50589 49120 gene locus_tag LOCUS_04700 50589 49120 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451626.1 protein_id gnl|my_center|LOCUS_04700 51439 50711 gene locus_tag LOCUS_04710 51439 50711 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460312.1 protein_id gnl|my_center|LOCUS_04710 51576 52553 gene locus_tag LOCUS_04720 gene rluD 51576 52553 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460300.1 protein_id gnl|my_center|LOCUS_04720 52555 53283 gene locus_tag LOCUS_04730 gene pgeF 52555 53283 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477884.1 protein_id gnl|my_center|LOCUS_04730 53430 56003 gene locus_tag LOCUS_04740 gene clpB 53430 56003 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460310.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence004 557 889 gene locus_tag LOCUS_04750 557 889 CDS product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483015.1 protein_id gnl|my_center|LOCUS_04750 902 1741 gene locus_tag LOCUS_04760 gene mepA 902 1741 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483061.1 protein_id gnl|my_center|LOCUS_04760 2050 2358 gene locus_tag LOCUS_04770 2050 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496359.1 protein_id gnl|my_center|LOCUS_04770 2654 2400 gene locus_tag LOCUS_04780 2654 2400 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460170.1 protein_id gnl|my_center|LOCUS_04780 4057 2657 gene locus_tag LOCUS_04790 gene yegQ 4057 2657 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483089.1 protein_id gnl|my_center|LOCUS_04790 5138 4224 gene locus_tag LOCUS_04800 gene rdgC 5138 4224 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483046.1 protein_id gnl|my_center|LOCUS_04800 5363 6052 gene locus_tag LOCUS_04810 gene phoB 5363 6052 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460184.1 protein_id gnl|my_center|LOCUS_04810 6093 7391 gene locus_tag LOCUS_04820 gene phoR 6093 7391 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 protein_id gnl|my_center|LOCUS_04820 7391 8356 gene locus_tag LOCUS_04830 7391 8356 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460208.1 protein_id gnl|my_center|LOCUS_04830 9893 8388 gene locus_tag LOCUS_04840 gene ppx 9893 8388 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460163.1 protein_id gnl|my_center|LOCUS_04840 11967 9877 gene locus_tag LOCUS_04850 gene ppk1 11967 9877 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 protein_id gnl|my_center|LOCUS_04850 12180 12566 gene locus_tag LOCUS_04860 12180 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 12665 14383 gene locus_tag LOCUS_04870 12665 14383 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460206.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 14411 16084 gene locus_tag LOCUS_04880 gene pstA 14411 16084 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460157.1 protein_id gnl|my_center|LOCUS_04880 16087 16905 gene locus_tag LOCUS_04890 gene pstB 16087 16905 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 protein_id gnl|my_center|LOCUS_04890 16938 17645 gene locus_tag LOCUS_04900 gene phoU 16938 17645 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440349.1 protein_id gnl|my_center|LOCUS_04900 18021 17632 gene locus_tag LOCUS_04910 18021 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 18723 18202 gene locus_tag LOCUS_04920 18723 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 19794 18862 gene locus_tag LOCUS_04930 19794 18862 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 protein_id gnl|my_center|LOCUS_04930 20580 19804 gene locus_tag LOCUS_04940 gene ppk2 20580 19804 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_04940 21390 20647 gene locus_tag LOCUS_04950 21390 20647 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 protein_id gnl|my_center|LOCUS_04950 22272 21664 gene locus_tag LOCUS_04960 22272 21664 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381738.1 protein_id gnl|my_center|LOCUS_04960 22509 23378 gene locus_tag LOCUS_04970 22509 23378 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460156.1 protein_id gnl|my_center|LOCUS_04970 23979 25613 gene locus_tag LOCUS_04980 gene aceB 23979 25613 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483026.1 protein_id gnl|my_center|LOCUS_04980 25762 27075 gene locus_tag LOCUS_04990 gene aceA 25762 27075 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460165.1 protein_id gnl|my_center|LOCUS_04990 27664 27215 gene locus_tag LOCUS_05000 27664 27215 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460159.1 protein_id gnl|my_center|LOCUS_05000 28120 27899 gene locus_tag LOCUS_05010 28120 27899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 28376 29305 gene locus_tag LOCUS_05020 28376 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05020 29786 30838 gene locus_tag LOCUS_05030 gene queA 29786 30838 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482995.1 protein_id gnl|my_center|LOCUS_05030 31044 32180 gene locus_tag LOCUS_05040 gene tgt 31044 32180 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460199.1 protein_id gnl|my_center|LOCUS_05040 32358 32687 gene locus_tag LOCUS_05050 gene yajC 32358 32687 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 protein_id gnl|my_center|LOCUS_05050 32709 34565 gene locus_tag LOCUS_05060 gene secD 32709 34565 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_05060 34580 35527 gene locus_tag LOCUS_05070 gene secF 34580 35527 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_05070 35762 36169 gene locus_tag LOCUS_05080 35762 36169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 37423 36410 gene locus_tag LOCUS_05090 37423 36410 CDS product IS110-like element ISVpa1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477109.1 protein_id gnl|my_center|LOCUS_05090 37774 37698 gene locus_tag LOCUS_t00100 37774 37698 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 37886 37810 gene locus_tag LOCUS_t00110 37886 37810 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 38070 37959 gene locus_tag LOCUS_r00020 38070 37959 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence005 1111 308 gene locus_tag LOCUS_05100 gene suhB 1111 308 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 protein_id gnl|my_center|LOCUS_05100 1343 2062 gene locus_tag LOCUS_05110 gene trmJ 1343 2062 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460175.1 protein_id gnl|my_center|LOCUS_05110 2218 2694 gene locus_tag LOCUS_05120 gene iscR 2218 2694 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 protein_id gnl|my_center|LOCUS_05120 2723 3937 gene locus_tag LOCUS_05130 2723 3937 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_05130 3975 4358 gene locus_tag LOCUS_05140 gene iscU 3975 4358 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483070.1 protein_id gnl|my_center|LOCUS_05140 4432 4755 gene locus_tag LOCUS_05150 gene iscA 4432 4755 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 protein_id gnl|my_center|LOCUS_05150 4811 5326 gene locus_tag LOCUS_05160 gene hscB 4811 5326 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460241.1 protein_id gnl|my_center|LOCUS_05160 5348 7201 gene locus_tag LOCUS_05170 gene hscA 5348 7201 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 protein_id gnl|my_center|LOCUS_05170 7215 7553 gene locus_tag LOCUS_05180 gene fdx 7215 7553 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 protein_id gnl|my_center|LOCUS_05180 7599 7793 gene locus_tag LOCUS_05190 gene iscX 7599 7793 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 protein_id gnl|my_center|LOCUS_05190 7965 9263 gene locus_tag LOCUS_05200 gene pepB 7965 9263 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460223.1 protein_id gnl|my_center|LOCUS_05200 9364 9789 gene locus_tag LOCUS_05210 gene ndk 9364 9789 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence006 390 1517 gene locus_tag LOCUS_05220 390 1517 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460214.1 protein_id gnl|my_center|LOCUS_05220 1910 2857 gene locus_tag LOCUS_05230 gene rodZ 1910 2857 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 protein_id gnl|my_center|LOCUS_05230 2863 3981 gene locus_tag LOCUS_05240 gene ispG 2863 3981 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460234.1 protein_id gnl|my_center|LOCUS_05240 4036 5304 gene locus_tag LOCUS_05250 gene hisS 4036 5304 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460225.1 protein_id gnl|my_center|LOCUS_05250 5430 6044 gene locus_tag LOCUS_05260 5430 6044 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460236.1 protein_id gnl|my_center|LOCUS_05260 6057 7217 gene locus_tag LOCUS_05270 gene bamB 6057 7217 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460257.1 protein_id gnl|my_center|LOCUS_05270 7399 8895 gene locus_tag LOCUS_05280 gene der 7399 8895 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483018.1 protein_id gnl|my_center|LOCUS_05280 8989 9777 gene locus_tag LOCUS_05290 8989 9777 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105691.1 protein_id gnl|my_center|LOCUS_05290 10152 11156 gene locus_tag LOCUS_05300 10152 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 11228 11452 gene locus_tag LOCUS_05310 11228 11452 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460239.1 protein_id gnl|my_center|LOCUS_05310 12780 11449 gene locus_tag LOCUS_05320 gene xseA 12780 11449 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 protein_id gnl|my_center|LOCUS_05320 13013 14476 gene locus_tag LOCUS_05330 gene guaB 13013 14476 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460229.1 protein_id gnl|my_center|LOCUS_05330 14603 16156 gene locus_tag LOCUS_05340 gene guaA 14603 16156 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460250.1 protein_id gnl|my_center|LOCUS_05340 16276 17067 gene locus_tag LOCUS_05350 16276 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05350 17113 17841 gene locus_tag LOCUS_05360 17113 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05360 18045 19739 gene locus_tag LOCUS_05370 18045 19739 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483021.1 protein_id gnl|my_center|LOCUS_05370 19922 20515 gene locus_tag LOCUS_05380 19922 20515 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104914.1 protein_id gnl|my_center|LOCUS_05380 22191 20644 gene locus_tag LOCUS_05390 22191 20644 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464242.1 protein_id gnl|my_center|LOCUS_05390 23755 22499 gene locus_tag LOCUS_05400 23755 22499 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483093.1 protein_id gnl|my_center|LOCUS_05400 23862 24758 gene locus_tag LOCUS_05410 23862 24758 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483027.1 protein_id gnl|my_center|LOCUS_05410 24974 26923 gene locus_tag LOCUS_05420 24974 26923 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074095.1 protein_id gnl|my_center|LOCUS_05420 27172 27684 gene locus_tag LOCUS_05430 27172 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105694.1 protein_id gnl|my_center|LOCUS_05430 27686 28828 gene locus_tag LOCUS_05440 27686 28828 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_05440 28998 30266 gene locus_tag LOCUS_05450 28998 30266 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482970.1 protein_id gnl|my_center|LOCUS_05450 30474 31802 gene locus_tag LOCUS_05460 30474 31802 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105695.1 protein_id gnl|my_center|LOCUS_05460 31796 32632 gene locus_tag LOCUS_05470 31796 32632 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483055.1 protein_id gnl|my_center|LOCUS_05470 34048 32681 gene locus_tag LOCUS_05480 34048 32681 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464256.1 protein_id gnl|my_center|LOCUS_05480 34827 34228 gene locus_tag LOCUS_05490 34827 34228 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778787.1 protein_id gnl|my_center|LOCUS_05490 36118 34949 gene locus_tag LOCUS_05500 36118 34949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 36637 36344 gene locus_tag LOCUS_05510 36637 36344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 36900 36622 gene locus_tag LOCUS_05520 36900 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 37983 37090 gene locus_tag LOCUS_05530 37983 37090 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482988.1 protein_id gnl|my_center|LOCUS_05530 40000 38279 gene locus_tag LOCUS_05540 gene dcm 40000 38279 CDS product DNA-cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157265.1 protein_id gnl|my_center|LOCUS_05540 40097 40258 gene locus_tag LOCUS_05550 40097 40258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence007 584 1177 gene locus_tag LOCUS_05560 584 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1887 1520 gene locus_tag LOCUS_tm00010 1887 1520 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2441 1956 gene locus_tag LOCUS_05570 gene smpB 2441 1956 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455975.1 protein_id gnl|my_center|LOCUS_05570 2560 3003 gene locus_tag LOCUS_05580 2560 3003 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 protein_id gnl|my_center|LOCUS_05580 2993 3349 gene locus_tag LOCUS_05590 2993 3349 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 protein_id gnl|my_center|LOCUS_05590 3769 3410 gene locus_tag LOCUS_05600 gene bamE 3769 3410 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455981.1 protein_id gnl|my_center|LOCUS_05600 4498 4016 gene locus_tag LOCUS_05610 4498 4016 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071115951.1 protein_id gnl|my_center|LOCUS_05610 6184 4520 gene locus_tag LOCUS_05620 gene recN 6184 4520 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456006.1 protein_id gnl|my_center|LOCUS_05620 7534 6353 gene locus_tag LOCUS_05630 7534 6353 CDS product DUF3103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483024.1 protein_id gnl|my_center|LOCUS_05630 8666 7782 gene locus_tag LOCUS_05640 gene nadK 8666 7782 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455932.1 protein_id gnl|my_center|LOCUS_05640 8812 9408 gene locus_tag LOCUS_05650 gene grpE 8812 9408 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455958.1 protein_id gnl|my_center|LOCUS_05650 9830 11104 gene locus_tag LOCUS_05660 9830 11104 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482999.1 protein_id gnl|my_center|LOCUS_05660 11406 13322 gene locus_tag LOCUS_05670 gene dnaK 11406 13322 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455943.1 protein_id gnl|my_center|LOCUS_05670 13509 14672 gene locus_tag LOCUS_05680 gene dnaJ 13509 14672 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 protein_id gnl|my_center|LOCUS_05680 15259 14750 gene locus_tag LOCUS_05690 15259 14750 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483031.1 protein_id gnl|my_center|LOCUS_05690 15287 15799 gene locus_tag LOCUS_05700 15287 15799 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454868.1 protein_id gnl|my_center|LOCUS_05700 15811 16452 gene locus_tag LOCUS_05710 15811 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455995.1 protein_id gnl|my_center|LOCUS_05710 16449 16877 gene locus_tag LOCUS_05720 16449 16877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 16834 17742 gene locus_tag LOCUS_05730 16834 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 17732 18139 gene locus_tag LOCUS_05740 17732 18139 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455961.1 protein_id gnl|my_center|LOCUS_05740 18434 19993 gene locus_tag LOCUS_05750 18434 19993 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483074.1 protein_id gnl|my_center|LOCUS_05750 20637 21170 gene locus_tag LOCUS_05760 gene tadA 20637 21170 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455934.1 protein_id gnl|my_center|LOCUS_05760 23275 21671 gene locus_tag LOCUS_05770 gene mltF 23275 21671 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455996.1 protein_id gnl|my_center|LOCUS_05770 23590 27486 gene locus_tag LOCUS_05780 gene purL 23590 27486 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261382.1 protein_id gnl|my_center|LOCUS_05780 27849 28151 gene locus_tag LOCUS_05790 27849 28151 CDS product DUF3622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455950.1 protein_id gnl|my_center|LOCUS_05790 29321 28251 gene locus_tag LOCUS_05800 29321 28251 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_05800 29652 30191 gene locus_tag LOCUS_05810 29652 30191 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 protein_id gnl|my_center|LOCUS_05810 31739 30267 gene locus_tag LOCUS_05820 31739 30267 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 protein_id gnl|my_center|LOCUS_05820 32776 34065 gene locus_tag LOCUS_05830 32776 34065 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_05830 34650 35114 gene locus_tag LOCUS_05840 gene tet(34) 34650 35114 CDS product oxytetracycline resistance phosphoribosyltransferase domain-containing protein Tet(34) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381590.1 protein_id gnl|my_center|LOCUS_05840 35205 36452 gene locus_tag LOCUS_05850 gene frsA 35205 36452 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455935.1 protein_id gnl|my_center|LOCUS_05850 36571 36960 gene locus_tag LOCUS_05860 gene crl 36571 36960 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455997.1 protein_id gnl|my_center|LOCUS_05860 37083 38222 gene locus_tag LOCUS_05870 gene proB 37083 38222 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483011.1 protein_id gnl|my_center|LOCUS_05870 38240 39490 gene locus_tag LOCUS_05880 38240 39490 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483082.1 protein_id gnl|my_center|LOCUS_05880 39618 40058 gene locus_tag LOCUS_05890 gene nrdR 39618 40058 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 protein_id gnl|my_center|LOCUS_05890 40074 41198 gene locus_tag LOCUS_05900 gene ribD 40074 41198 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483035.1 protein_id gnl|my_center|LOCUS_05900 41210 41863 gene locus_tag LOCUS_05910 41210 41863 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483039.1 protein_id gnl|my_center|LOCUS_05910 42022 43131 gene locus_tag LOCUS_05920 gene ribBA 42022 43131 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483000.1 protein_id gnl|my_center|LOCUS_05920 43301 43771 gene locus_tag LOCUS_05930 gene ribE 43301 43771 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 protein_id gnl|my_center|LOCUS_05930 43771 44238 gene locus_tag LOCUS_05940 gene nusB 43771 44238 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456038.1 protein_id gnl|my_center|LOCUS_05940 44317 45282 gene locus_tag LOCUS_05950 gene thiL 44317 45282 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456036.1 protein_id gnl|my_center|LOCUS_05950 45340 45843 gene locus_tag LOCUS_05960 gene pgpA 45340 45843 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482983.1 protein_id gnl|my_center|LOCUS_05960 47800 45935 gene locus_tag LOCUS_05970 gene dxs 47800 45935 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483016.1 protein_id gnl|my_center|LOCUS_05970 48705 47821 gene locus_tag LOCUS_05980 gene ispA 48705 47821 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 protein_id gnl|my_center|LOCUS_05980 48969 48727 gene locus_tag LOCUS_05990 gene xseB 48969 48727 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 protein_id gnl|my_center|LOCUS_05990 49230 49991 gene locus_tag LOCUS_06000 gene pomA 49230 49991 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_06000 50005 50955 gene locus_tag LOCUS_06010 50005 50955 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460634.1 protein_id gnl|my_center|LOCUS_06010 51167 52615 gene locus_tag LOCUS_06020 gene thiI 51167 52615 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 protein_id gnl|my_center|LOCUS_06020 53137 54057 gene locus_tag LOCUS_06030 53137 54057 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105705.1 protein_id gnl|my_center|LOCUS_06030 54038 54661 gene locus_tag LOCUS_06040 54038 54661 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_06040 54651 55049 gene locus_tag LOCUS_06050 54651 55049 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489963.1 protein_id gnl|my_center|LOCUS_06050 55046 56137 gene locus_tag LOCUS_06060 gene rlmM 55046 56137 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451600.1 protein_id gnl|my_center|LOCUS_06060 56978 56226 gene locus_tag LOCUS_06070 56978 56226 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_06070 57953 57171 gene locus_tag LOCUS_06080 gene xni 57953 57171 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459149.1 protein_id gnl|my_center|LOCUS_06080 59388 58012 gene locus_tag LOCUS_06090 gene ppnN 59388 58012 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459150.1 protein_id gnl|my_center|LOCUS_06090 61037 59601 gene locus_tag LOCUS_06100 61037 59601 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105707.1 protein_id gnl|my_center|LOCUS_06100 63547 61265 gene locus_tag LOCUS_06110 63547 61265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459154.1 protein_id gnl|my_center|LOCUS_06110 64553 63708 gene locus_tag LOCUS_06120 gene queF 64553 63708 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459155.1 protein_id gnl|my_center|LOCUS_06120 64661 65206 gene locus_tag LOCUS_06130 gene syd 64661 65206 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 protein_id gnl|my_center|LOCUS_06130 65209 65985 gene locus_tag LOCUS_06140 65209 65985 CDS product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459158.1 protein_id gnl|my_center|LOCUS_06140 66302 68497 gene locus_tag LOCUS_06150 66302 68497 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682151.1 protein_id gnl|my_center|LOCUS_06150 68589 69797 gene locus_tag LOCUS_06160 68589 69797 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682145.1 protein_id gnl|my_center|LOCUS_06160 70675 69866 gene locus_tag LOCUS_06170 70675 69866 CDS product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459159.1 protein_id gnl|my_center|LOCUS_06170 71391 70708 gene locus_tag LOCUS_06180 71391 70708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459160.1 protein_id gnl|my_center|LOCUS_06180 72409 71375 gene locus_tag LOCUS_06190 gene metN 72409 71375 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459161.1 protein_id gnl|my_center|LOCUS_06190 72753 73304 gene locus_tag LOCUS_06200 gene gmhB 72753 73304 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459163.1 protein_id gnl|my_center|LOCUS_06200 73379 74326 gene locus_tag LOCUS_06210 gene treR 73379 74326 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479596.1 protein_id gnl|my_center|LOCUS_06210 74502 75926 gene locus_tag LOCUS_06220 gene treB 74502 75926 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479599.1 protein_id gnl|my_center|LOCUS_06220 76019 77023 gene locus_tag LOCUS_06230 76019 77023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 77020 77706 gene locus_tag LOCUS_06240 77020 77706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 78362 77790 gene locus_tag LOCUS_06250 78362 77790 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496223.1 protein_id gnl|my_center|LOCUS_06250 78740 79990 gene locus_tag LOCUS_06260 78740 79990 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479594.1 protein_id gnl|my_center|LOCUS_06260 81742 80777 gene locus_tag LOCUS_06270 gene lipA 81742 80777 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488793.1 protein_id gnl|my_center|LOCUS_06270 82401 81739 gene locus_tag LOCUS_06280 gene lipB 82401 81739 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 protein_id gnl|my_center|LOCUS_06280 82856 82578 gene locus_tag LOCUS_06290 gene ybeD 82856 82578 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488798.1 protein_id gnl|my_center|LOCUS_06290 84196 83018 gene locus_tag LOCUS_06300 84196 83018 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488796.1 protein_id gnl|my_center|LOCUS_06300 85084 84287 gene locus_tag LOCUS_06310 85084 84287 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483406.1 protein_id gnl|my_center|LOCUS_06310 86208 85087 gene locus_tag LOCUS_06320 gene rodA 86208 85087 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 protein_id gnl|my_center|LOCUS_06320 88127 86208 gene locus_tag LOCUS_06330 gene mrdA 88127 86208 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493014.1 protein_id gnl|my_center|LOCUS_06330 88627 88157 gene locus_tag LOCUS_06340 gene rlmH 88627 88157 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456129.1 protein_id gnl|my_center|LOCUS_06340 88949 88632 gene locus_tag LOCUS_06350 gene rsfS 88949 88632 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456130.1 protein_id gnl|my_center|LOCUS_06350 90059 89040 gene locus_tag LOCUS_06360 gene holA 90059 89040 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489928.1 protein_id gnl|my_center|LOCUS_06360 90605 90063 gene locus_tag LOCUS_06370 gene lptE 90605 90063 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454508.1 protein_id gnl|my_center|LOCUS_06370 93350 90777 gene locus_tag LOCUS_06380 gene leuS 93350 90777 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 protein_id gnl|my_center|LOCUS_06380 93505 93975 gene locus_tag LOCUS_06390 93505 93975 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 protein_id gnl|my_center|LOCUS_06390 95508 94027 gene locus_tag LOCUS_06400 gene lnt 95508 94027 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 protein_id gnl|my_center|LOCUS_06400 96483 95629 gene locus_tag LOCUS_06410 gene corC 96483 95629 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 protein_id gnl|my_center|LOCUS_06410 97054 96590 gene locus_tag LOCUS_06420 gene ybeY 97054 96590 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483484.1 protein_id gnl|my_center|LOCUS_06420 98154 97057 gene locus_tag LOCUS_06430 98154 97057 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483495.1 protein_id gnl|my_center|LOCUS_06430 99652 98228 gene locus_tag LOCUS_06440 gene miaB 99652 98228 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483497.1 protein_id gnl|my_center|LOCUS_06440 99911 101086 gene locus_tag LOCUS_06450 99911 101086 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 protein_id gnl|my_center|LOCUS_06450 101331 101247 gene locus_tag LOCUS_t00120 101331 101247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101460 101386 gene locus_tag LOCUS_t00130 101460 101386 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 101590 101506 gene locus_tag LOCUS_t00140 101590 101506 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101696 101612 gene locus_tag LOCUS_t00150 101696 101612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101791 101715 gene locus_tag LOCUS_t00160 101791 101715 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 101899 101815 gene locus_tag LOCUS_t00170 101899 101815 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 102027 101953 gene locus_tag LOCUS_t00180 102027 101953 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 137 63 gene locus_tag LOCUS_t00190 137 63 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 253 169 gene locus_tag LOCUS_t00200 253 169 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 361 287 gene locus_tag LOCUS_t00210 361 287 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 486 402 gene locus_tag LOCUS_t00220 486 402 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 616 540 gene locus_tag LOCUS_t00230 616 540 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 725 641 gene locus_tag LOCUS_t00240 725 641 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 853 779 gene locus_tag LOCUS_t00250 853 779 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 968 884 gene locus_tag LOCUS_t00260 968 884 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1076 1002 gene locus_tag LOCUS_t00270 1076 1002 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1192 1108 gene locus_tag LOCUS_t00280 1192 1108 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1302 1218 gene locus_tag LOCUS_t00290 1302 1218 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1451 1375 gene locus_tag LOCUS_t00300 1451 1375 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1605 1531 gene locus_tag LOCUS_t00310 1605 1531 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1721 1637 gene locus_tag LOCUS_t00320 1721 1637 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1837 1761 gene locus_tag LOCUS_t00330 1837 1761 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3214 2123 gene locus_tag LOCUS_06460 gene ychF 3214 2123 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496175.1 protein_id gnl|my_center|LOCUS_06460 3815 3225 gene locus_tag LOCUS_06470 gene pth 3815 3225 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 protein_id gnl|my_center|LOCUS_06470 4911 3967 gene locus_tag LOCUS_06480 4911 3967 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496171.1 protein_id gnl|my_center|LOCUS_06480 5827 4940 gene locus_tag LOCUS_06490 gene ispE 5827 4940 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 protein_id gnl|my_center|LOCUS_06490 6447 5809 gene locus_tag LOCUS_06500 gene lolB 6447 5809 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490532.1 protein_id gnl|my_center|LOCUS_06500 6582 7838 gene locus_tag LOCUS_06510 gene hemA 6582 7838 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490531.1 protein_id gnl|my_center|LOCUS_06510 7868 8956 gene locus_tag LOCUS_06520 gene prfA 7868 8956 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456867.1 protein_id gnl|my_center|LOCUS_06520 8960 9817 gene locus_tag LOCUS_06530 gene prmC 8960 9817 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 protein_id gnl|my_center|LOCUS_06530 9858 10241 gene locus_tag LOCUS_06540 9858 10241 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468486.1 protein_id gnl|my_center|LOCUS_06540 10247 11056 gene locus_tag LOCUS_06550 10247 11056 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481357.1 protein_id gnl|my_center|LOCUS_06550 11111 11962 gene locus_tag LOCUS_06560 gene kdsA 11111 11962 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457350.1 protein_id gnl|my_center|LOCUS_06560 12287 13948 gene locus_tag LOCUS_06570 gene ushA 12287 13948 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481350.1 protein_id gnl|my_center|LOCUS_06570 14040 14423 gene locus_tag LOCUS_06580 14040 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06580 15729 14575 gene locus_tag LOCUS_06590 gene rluF 15729 14575 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481361.1 protein_id gnl|my_center|LOCUS_06590 16414 15833 gene locus_tag LOCUS_06600 gene smrA 16414 15833 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 protein_id gnl|my_center|LOCUS_06600 16949 17025 gene locus_tag LOCUS_t00340 16949 17025 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17865 17443 gene locus_tag LOCUS_06610 17865 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 18825 17947 gene locus_tag LOCUS_06620 18825 17947 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482258.1 protein_id gnl|my_center|LOCUS_06620 19283 21934 gene locus_tag LOCUS_06630 19283 21934 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489828.1 protein_id gnl|my_center|LOCUS_06630 22375 23031 gene locus_tag LOCUS_06640 22375 23031 CDS product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453980.1 protein_id gnl|my_center|LOCUS_06640 23456 23226 gene locus_tag LOCUS_06650 23456 23226 CDS product PAS factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479230.1 protein_id gnl|my_center|LOCUS_06650 24049 23600 gene locus_tag LOCUS_06660 24049 23600 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454003.1 protein_id gnl|my_center|LOCUS_06660 25927 24074 gene locus_tag LOCUS_06670 25927 24074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 26772 25849 gene locus_tag LOCUS_06680 26772 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 27248 27631 gene locus_tag LOCUS_06690 27248 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 27601 28641 gene locus_tag LOCUS_06700 27601 28641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06700 28803 30230 gene locus_tag LOCUS_06710 gene gltX 28803 30230 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482241.1 protein_id gnl|my_center|LOCUS_06710 30835 31794 gene locus_tag LOCUS_06720 30835 31794 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453991.1 protein_id gnl|my_center|LOCUS_06720 32412 31906 gene locus_tag LOCUS_06730 32412 31906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482262.1 protein_id gnl|my_center|LOCUS_06730 32804 32728 gene locus_tag LOCUS_t00350 32804 32728 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33958 32873 gene locus_tag LOCUS_06740 33958 32873 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482259.1 protein_id gnl|my_center|LOCUS_06740 34386 34159 gene locus_tag LOCUS_06750 34386 34159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 34280 34816 gene locus_tag LOCUS_06760 34280 34816 CDS product FlgO family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382013.1 protein_id gnl|my_center|LOCUS_06760 34826 35257 gene locus_tag LOCUS_06770 gene flgP 34826 35257 CDS product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453982.1 protein_id gnl|my_center|LOCUS_06770 35805 35380 gene locus_tag LOCUS_06780 gene flgN 35805 35380 CDS product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482247.1 protein_id gnl|my_center|LOCUS_06780 36148 35834 gene locus_tag LOCUS_06790 gene flgM 36148 35834 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482225.1 protein_id gnl|my_center|LOCUS_06790 36574 36275 gene locus_tag LOCUS_06800 36574 36275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 37099 38025 gene locus_tag LOCUS_06810 37099 38025 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462297.1 protein_id gnl|my_center|LOCUS_06810 38037 38864 gene locus_tag LOCUS_06820 38037 38864 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462295.1 protein_id gnl|my_center|LOCUS_06820 39055 38849 gene locus_tag LOCUS_06830 39055 38849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 39184 39579 gene locus_tag LOCUS_06840 gene flgB 39184 39579 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462294.1 protein_id gnl|my_center|LOCUS_06840 39585 39998 gene locus_tag LOCUS_06850 gene flgC 39585 39998 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462293.1 protein_id gnl|my_center|LOCUS_06850 40016 40723 gene locus_tag LOCUS_06860 gene flgD 40016 40723 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462292.1 protein_id gnl|my_center|LOCUS_06860 40755 42068 gene locus_tag LOCUS_06870 gene flgE 40755 42068 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462291.1 protein_id gnl|my_center|LOCUS_06870 42368 43117 gene locus_tag LOCUS_06880 42368 43117 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462290.1 protein_id gnl|my_center|LOCUS_06880 43136 43924 gene locus_tag LOCUS_06890 gene flgG 43136 43924 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382032.1 protein_id gnl|my_center|LOCUS_06890 43952 44731 gene locus_tag LOCUS_06900 gene flgH 43952 44731 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462288.1 protein_id gnl|my_center|LOCUS_06900 44777 45868 gene locus_tag LOCUS_06910 44777 45868 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454020.1 protein_id gnl|my_center|LOCUS_06910 45887 46813 gene locus_tag LOCUS_06920 gene flgJ 45887 46813 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_06920 46981 48897 gene locus_tag LOCUS_06930 gene flgK 46981 48897 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482264.1 protein_id gnl|my_center|LOCUS_06930 48911 50101 gene locus_tag LOCUS_06940 gene flgL 48911 50101 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482245.1 protein_id gnl|my_center|LOCUS_06940 50506 51660 gene locus_tag LOCUS_06950 50506 51660 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462278.1 protein_id gnl|my_center|LOCUS_06950 52152 53285 gene locus_tag LOCUS_06960 52152 53285 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481079.1 protein_id gnl|my_center|LOCUS_06960 53399 54523 gene locus_tag LOCUS_06970 53399 54523 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482232.1 protein_id gnl|my_center|LOCUS_06970 55131 54622 gene locus_tag LOCUS_06980 gene crr 55131 54622 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 protein_id gnl|my_center|LOCUS_06980 56961 55237 gene locus_tag LOCUS_06990 gene ptsI 56961 55237 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489822.1 protein_id gnl|my_center|LOCUS_06990 57358 57101 gene locus_tag LOCUS_07000 57358 57101 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436894.1 protein_id gnl|my_center|LOCUS_07000 58625 57657 gene locus_tag LOCUS_07010 gene cysK 58625 57657 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489833.1 protein_id gnl|my_center|LOCUS_07010 59550 58792 gene locus_tag LOCUS_07020 gene cysZ 59550 58792 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489850.1 protein_id gnl|my_center|LOCUS_07020 59821 60777 gene locus_tag LOCUS_07030 gene zipA 59821 60777 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478499.1 protein_id gnl|my_center|LOCUS_07030 60866 62878 gene locus_tag LOCUS_07040 gene ligA 60866 62878 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_07040 63392 64780 gene locus_tag LOCUS_07050 63392 64780 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704981.1 protein_id gnl|my_center|LOCUS_07050 64856 65224 gene locus_tag LOCUS_07060 64856 65224 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460271.1 protein_id gnl|my_center|LOCUS_07060 65498 65322 gene locus_tag LOCUS_07070 65498 65322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 66287 65826 gene locus_tag LOCUS_07080 66287 65826 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454539.1 protein_id gnl|my_center|LOCUS_07080 67211 66297 gene locus_tag LOCUS_07090 67211 66297 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454552.1 protein_id gnl|my_center|LOCUS_07090 68993 67374 gene locus_tag LOCUS_07100 gene bcsG 68993 67374 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263705.1 protein_id gnl|my_center|LOCUS_07100 69169 68993 gene locus_tag LOCUS_07110 69169 68993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 70227 69166 gene locus_tag LOCUS_07120 70227 69166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 70454 70654 gene locus_tag LOCUS_07130 70454 70654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 71208 71429 gene locus_tag LOCUS_07140 71208 71429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 71426 71665 gene locus_tag LOCUS_07150 71426 71665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 71632 72195 gene locus_tag LOCUS_07160 71632 72195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 72208 74841 gene locus_tag LOCUS_07170 gene bcsA 72208 74841 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263701.1 protein_id gnl|my_center|LOCUS_07170 74831 76900 gene locus_tag LOCUS_07180 gene bcsB 74831 76900 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263700.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07180 76813 77121 gene locus_tag LOCUS_07190 76813 77121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 77118 78227 gene locus_tag LOCUS_07200 gene bcsZ 77118 78227 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263699.1 protein_id gnl|my_center|LOCUS_07200 78215 81982 gene locus_tag LOCUS_07210 78215 81982 CDS product cellulose synthase subunit BcsC-related outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263698.1 protein_id gnl|my_center|LOCUS_07210 82943 82089 gene locus_tag LOCUS_07220 82943 82089 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454528.1 protein_id gnl|my_center|LOCUS_07220 84227 83400 gene locus_tag LOCUS_07230 84227 83400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478523.1 protein_id gnl|my_center|LOCUS_07230 85206 84265 gene locus_tag LOCUS_07240 85206 84265 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478501.1 protein_id gnl|my_center|LOCUS_07240 85423 86157 gene locus_tag LOCUS_07250 85423 86157 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_07250 86154 86945 gene locus_tag LOCUS_07260 86154 86945 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_07260 86935 87285 gene locus_tag LOCUS_07270 86935 87285 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_07270 87282 87686 gene locus_tag LOCUS_07280 87282 87686 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_07280 87811 88020 gene locus_tag LOCUS_07290 87811 88020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105727.1 protein_id gnl|my_center|LOCUS_07290 88106 88651 gene locus_tag LOCUS_07300 gene yfcE 88106 88651 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 protein_id gnl|my_center|LOCUS_07300 88983 88705 gene locus_tag LOCUS_07310 88983 88705 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454560.1 protein_id gnl|my_center|LOCUS_07310 89798 89007 gene locus_tag LOCUS_07320 89798 89007 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478504.1 protein_id gnl|my_center|LOCUS_07320 90324 89809 gene locus_tag LOCUS_07330 gene toxS 90324 89809 CDS product transmembrane regulator ToxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454545.1 protein_id gnl|my_center|LOCUS_07330 91214 90336 gene locus_tag LOCUS_07340 gene toxR 91214 90336 CDS product transcriptional regulator ToxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478489.1 protein_id gnl|my_center|LOCUS_07340 91484 93388 gene locus_tag LOCUS_07350 gene htpG 91484 93388 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478520.1 protein_id gnl|my_center|LOCUS_07350 93708 94352 gene locus_tag LOCUS_07360 gene adk 93708 94352 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 protein_id gnl|my_center|LOCUS_07360 94493 95458 gene locus_tag LOCUS_07370 gene hemH 94493 95458 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478510.1 protein_id gnl|my_center|LOCUS_07370 96939 95551 gene locus_tag LOCUS_07380 96939 95551 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 protein_id gnl|my_center|LOCUS_07380 97271 97765 gene locus_tag LOCUS_07390 gene rfaH 97271 97765 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454588.1 protein_id gnl|my_center|LOCUS_07390 99773 98109 gene locus_tag LOCUS_07400 gene asnB 99773 98109 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 protein_id gnl|my_center|LOCUS_07400 101523 100003 gene locus_tag LOCUS_07410 101523 100003 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478508.1 protein_id gnl|my_center|LOCUS_07410 102890 101676 gene locus_tag LOCUS_07420 102890 101676 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454586.1 protein_id gnl|my_center|LOCUS_07420 104029 102893 gene locus_tag LOCUS_07430 gene nagA 104029 102893 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478503.1 protein_id gnl|my_center|LOCUS_07430 104520 105836 gene locus_tag LOCUS_07440 gene nagE 104520 105836 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454584.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 106330 108000 gene locus_tag LOCUS_07450 gene glnS 106330 108000 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 protein_id gnl|my_center|LOCUS_07450 108644 108063 gene locus_tag LOCUS_07460 108644 108063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 109169 108720 gene locus_tag LOCUS_07470 gene fcrX 109169 108720 CDS product ferric iron uptake transcriptional regulator FcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489847.1 protein_id gnl|my_center|LOCUS_07470 109590 109874 gene locus_tag LOCUS_07480 109590 109874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 110462 109929 gene locus_tag LOCUS_07490 gene fldA 110462 109929 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489824.1 protein_id gnl|my_center|LOCUS_07490 110733 110512 gene locus_tag LOCUS_07500 110733 110512 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461613.1 protein_id gnl|my_center|LOCUS_07500 111613 110846 gene locus_tag LOCUS_07510 111613 110846 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489819.1 protein_id gnl|my_center|LOCUS_07510 111706 112248 gene locus_tag LOCUS_07520 gene seqA 111706 112248 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 protein_id gnl|my_center|LOCUS_07520 112342 113988 gene locus_tag LOCUS_07530 gene pgm 112342 113988 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455478.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence009 831 79 gene locus_tag LOCUS_07540 831 79 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455460.1 protein_id gnl|my_center|LOCUS_07540 964 1722 gene locus_tag LOCUS_07550 964 1722 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455494.1 protein_id gnl|my_center|LOCUS_07550 3239 1950 gene locus_tag LOCUS_07560 3239 1950 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455487.1 protein_id gnl|my_center|LOCUS_07560 3635 4027 gene locus_tag LOCUS_07570 gene sdhC 3635 4027 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478785.1 protein_id gnl|my_center|LOCUS_07570 4021 4365 gene locus_tag LOCUS_07580 gene sdhD 4021 4365 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455480.1 protein_id gnl|my_center|LOCUS_07580 4366 6132 gene locus_tag LOCUS_07590 gene sdhA 4366 6132 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418302.1 protein_id gnl|my_center|LOCUS_07590 6151 6861 gene locus_tag LOCUS_07600 6151 6861 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455467.1 protein_id gnl|my_center|LOCUS_07600 6954 9779 gene locus_tag LOCUS_07610 gene sucA 6954 9779 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455464.1 protein_id gnl|my_center|LOCUS_07610 9808 11016 gene locus_tag LOCUS_07620 gene odhB 9808 11016 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455502.1 protein_id gnl|my_center|LOCUS_07620 11219 12385 gene locus_tag LOCUS_07630 gene sucC 11219 12385 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455468.1 protein_id gnl|my_center|LOCUS_07630 12385 13257 gene locus_tag LOCUS_07640 gene sucD 12385 13257 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 protein_id gnl|my_center|LOCUS_07640 14155 13370 gene locus_tag LOCUS_07650 gene znuB 14155 13370 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 protein_id gnl|my_center|LOCUS_07650 14936 14148 gene locus_tag LOCUS_07660 gene znuC 14936 14148 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455461.1 protein_id gnl|my_center|LOCUS_07660 15015 15896 gene locus_tag LOCUS_07670 gene znuA 15015 15896 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 protein_id gnl|my_center|LOCUS_07670 16105 19497 gene locus_tag LOCUS_07680 16105 19497 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478796.1 protein_id gnl|my_center|LOCUS_07680 20297 20524 gene locus_tag LOCUS_07690 20297 20524 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 protein_id gnl|my_center|LOCUS_07690 20524 22800 gene locus_tag LOCUS_07700 gene feoB 20524 22800 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455466.1 protein_id gnl|my_center|LOCUS_07700 22797 23027 gene locus_tag LOCUS_07710 22797 23027 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455490.1 protein_id gnl|my_center|LOCUS_07710 23621 23100 gene locus_tag LOCUS_07720 23621 23100 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_07720 24200 23772 gene locus_tag LOCUS_07730 24200 23772 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455485.1 protein_id gnl|my_center|LOCUS_07730 26171 24438 gene locus_tag LOCUS_07740 gene argS 26171 24438 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 protein_id gnl|my_center|LOCUS_07740 26392 26988 gene locus_tag LOCUS_07750 26392 26988 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478779.1 protein_id gnl|my_center|LOCUS_07750 28134 27301 gene locus_tag LOCUS_07760 gene purU 28134 27301 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478783.1 protein_id gnl|my_center|LOCUS_07760 28319 28501 gene locus_tag LOCUS_07770 28319 28501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 28659 30584 gene locus_tag LOCUS_07780 28659 30584 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105733.1 protein_id gnl|my_center|LOCUS_07780 30627 31328 gene locus_tag LOCUS_07790 gene tsaB 30627 31328 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 protein_id gnl|my_center|LOCUS_07790 31382 31687 gene locus_tag LOCUS_07800 31382 31687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478797.1 protein_id gnl|my_center|LOCUS_07800 31716 32273 gene locus_tag LOCUS_07810 31716 32273 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478780.1 protein_id gnl|my_center|LOCUS_07810 32448 33134 gene locus_tag LOCUS_07820 32448 33134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478778.1 protein_id gnl|my_center|LOCUS_07820 33241 34932 gene locus_tag LOCUS_07830 gene fadD 33241 34932 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455511.1 protein_id gnl|my_center|LOCUS_07830 35020 36138 gene locus_tag LOCUS_07840 gene rnd 35020 36138 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496047.1 protein_id gnl|my_center|LOCUS_07840 36703 36554 gene locus_tag LOCUS_07850 36703 36554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07850 37518 36706 gene locus_tag LOCUS_07860 gene minD 37518 36706 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458081.1 protein_id gnl|my_center|LOCUS_07860 38200 37538 gene locus_tag LOCUS_07870 gene minC 38200 37538 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105734.1 protein_id gnl|my_center|LOCUS_07870 38398 38682 gene locus_tag LOCUS_07880 38398 38682 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460544.1 protein_id gnl|my_center|LOCUS_07880 38727 39698 gene locus_tag LOCUS_07890 38727 39698 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 protein_id gnl|my_center|LOCUS_07890 39779 40723 gene locus_tag LOCUS_07900 39779 40723 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479005.1 protein_id gnl|my_center|LOCUS_07900 40959 42158 gene locus_tag LOCUS_07910 40959 42158 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479028.1 protein_id gnl|my_center|LOCUS_07910 43239 42379 gene locus_tag LOCUS_07920 gene folD 43239 42379 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460545.1 protein_id gnl|my_center|LOCUS_07920 43444 43520 gene locus_tag LOCUS_t00360 43444 43520 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 43681 45372 gene locus_tag LOCUS_07930 43681 45372 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460549.1 protein_id gnl|my_center|LOCUS_07930 45379 45795 gene locus_tag LOCUS_07940 45379 45795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 45989 46885 gene locus_tag LOCUS_07950 45989 46885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 47339 47043 gene locus_tag LOCUS_07960 47339 47043 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_07960 47912 47349 gene locus_tag LOCUS_07970 47912 47349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086378.1 protein_id gnl|my_center|LOCUS_07970 49762 47912 gene locus_tag LOCUS_07980 49762 47912 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_07980 50590 51981 gene locus_tag LOCUS_07990 gene tssA 50590 51981 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480330.1 protein_id gnl|my_center|LOCUS_07990 52008 52538 gene locus_tag LOCUS_08000 52008 52538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 52608 53117 gene locus_tag LOCUS_08010 gene tssB 52608 53117 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 protein_id gnl|my_center|LOCUS_08010 53117 54595 gene locus_tag LOCUS_08020 gene tssC 53117 54595 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315895.1 protein_id gnl|my_center|LOCUS_08020 54643 55998 gene locus_tag LOCUS_08030 gene tssC 54643 55998 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480259.1 protein_id gnl|my_center|LOCUS_08030 55995 56411 gene locus_tag LOCUS_08040 55995 56411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 56404 58185 gene locus_tag LOCUS_08050 gene tssF 56404 58185 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973760.1 protein_id gnl|my_center|LOCUS_08050 58167 59150 gene locus_tag LOCUS_08060 58167 59150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 59159 61765 gene locus_tag LOCUS_08070 gene tssH 59159 61765 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_08070 61908 63062 gene locus_tag LOCUS_08080 61908 63062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 63072 65267 gene locus_tag LOCUS_08090 63072 65267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 65264 66397 gene locus_tag LOCUS_08100 65264 66397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 66400 67095 gene locus_tag LOCUS_08110 66400 67095 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940524.1 protein_id gnl|my_center|LOCUS_08110 67129 68076 gene locus_tag LOCUS_08120 67129 68076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 68076 68543 gene locus_tag LOCUS_08130 68076 68543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 68546 69862 gene locus_tag LOCUS_08140 gene tssK 68546 69862 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973757.1 protein_id gnl|my_center|LOCUS_08140 69870 71012 gene locus_tag LOCUS_08150 69870 71012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 71014 74466 gene locus_tag LOCUS_08160 gene tssM 71014 74466 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464016.1 protein_id gnl|my_center|LOCUS_08160 74469 75104 gene locus_tag LOCUS_08170 74469 75104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 75120 76967 gene locus_tag LOCUS_08180 75120 76967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 77978 77094 gene locus_tag LOCUS_08190 77978 77094 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454316.1 protein_id gnl|my_center|LOCUS_08190 79838 78474 gene locus_tag LOCUS_08200 79838 78474 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479025.1 protein_id gnl|my_center|LOCUS_08200 79964 81199 gene locus_tag LOCUS_08210 79964 81199 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479020.1 protein_id gnl|my_center|LOCUS_08210 82410 81292 gene locus_tag LOCUS_08220 82410 81292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08220 82904 82419 gene locus_tag LOCUS_08230 82904 82419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08230 83314 83976 gene locus_tag LOCUS_08240 83314 83976 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460581.1 protein_id gnl|my_center|LOCUS_08240 83973 85340 gene locus_tag LOCUS_08250 83973 85340 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479004.1 protein_id gnl|my_center|LOCUS_08250 85576 88551 gene locus_tag LOCUS_08260 85576 88551 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479027.1 protein_id gnl|my_center|LOCUS_08260 88984 89799 gene locus_tag LOCUS_08270 88984 89799 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479022.1 protein_id gnl|my_center|LOCUS_08270 90009 91478 gene locus_tag LOCUS_08280 90009 91478 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479031.1 protein_id gnl|my_center|LOCUS_08280 91694 92692 gene locus_tag LOCUS_08290 91694 92692 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479018.1 protein_id gnl|my_center|LOCUS_08290 92768 93442 gene locus_tag LOCUS_08300 92768 93442 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_08300 93446 94807 gene locus_tag LOCUS_08310 93446 94807 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 protein_id gnl|my_center|LOCUS_08310 95032 94835 gene locus_tag LOCUS_08320 95032 94835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 96435 95251 gene locus_tag LOCUS_08330 96435 95251 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490599.1 protein_id gnl|my_center|LOCUS_08330 98245 96440 gene locus_tag LOCUS_08340 98245 96440 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482580.1 protein_id gnl|my_center|LOCUS_08340 98771 100075 gene locus_tag LOCUS_08350 gene tig 98771 100075 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 protein_id gnl|my_center|LOCUS_08350 100181 100807 gene locus_tag LOCUS_08360 gene clpP 100181 100807 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482529.1 protein_id gnl|my_center|LOCUS_08360 100879 102159 gene locus_tag LOCUS_08370 gene clpX 100879 102159 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460618.1 protein_id gnl|my_center|LOCUS_08370 102290 104641 gene locus_tag LOCUS_08380 gene lon 102290 104641 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 protein_id gnl|my_center|LOCUS_08380 104834 105106 gene locus_tag LOCUS_08390 104834 105106 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 protein_id gnl|my_center|LOCUS_08390 105318 107177 gene locus_tag LOCUS_08400 gene ppiD 105318 107177 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 protein_id gnl|my_center|LOCUS_08400 107315 107608 gene locus_tag LOCUS_08410 107315 107608 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021449594.1 protein_id gnl|my_center|LOCUS_08410 108244 107693 gene locus_tag LOCUS_08420 gene rrtA 108244 107693 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482515.1 protein_id gnl|my_center|LOCUS_08420 108248 108865 gene locus_tag LOCUS_08430 108248 108865 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482520.1 protein_id gnl|my_center|LOCUS_08430 110200 108878 gene locus_tag LOCUS_08440 110200 108878 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482541.1 protein_id gnl|my_center|LOCUS_08440 110800 110216 gene locus_tag LOCUS_08450 gene yfbR 110800 110216 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_08450 112129 110915 gene locus_tag LOCUS_08460 112129 110915 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_08460 112346 113653 gene locus_tag LOCUS_08470 112346 113653 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482525.1 protein_id gnl|my_center|LOCUS_08470 113650 115356 gene locus_tag LOCUS_08480 gene menD 113650 115356 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482534.1 protein_id gnl|my_center|LOCUS_08480 116152 117030 gene locus_tag LOCUS_08490 gene menB 116152 117030 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482536.1 protein_id gnl|my_center|LOCUS_08490 117161 118150 gene locus_tag LOCUS_08500 gene menC 117161 118150 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482548.1 protein_id gnl|my_center|LOCUS_08500 118135 118866 gene locus_tag LOCUS_08510 118135 118866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 118956 119570 gene locus_tag LOCUS_08520 118956 119570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08520 121075 119621 gene locus_tag LOCUS_08530 gene nagE 121075 119621 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263302.1 protein_id gnl|my_center|LOCUS_08530 121325 122116 gene locus_tag LOCUS_08540 121325 122116 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477420.1 protein_id gnl|my_center|LOCUS_08540 122474 122674 gene locus_tag LOCUS_08550 122474 122674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 123535 122660 gene locus_tag LOCUS_08560 123535 122660 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486366.1 protein_id gnl|my_center|LOCUS_08560 124970 123726 gene locus_tag LOCUS_08570 124970 123726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08570 125599 124871 gene locus_tag LOCUS_08580 125599 124871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 126203 125613 gene locus_tag LOCUS_08590 126203 125613 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 protein_id gnl|my_center|LOCUS_08590 126463 127335 gene locus_tag LOCUS_08600 126463 127335 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 protein_id gnl|my_center|LOCUS_08600 127845 127761 gene locus_tag LOCUS_t00370 127845 127761 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 128030 127946 gene locus_tag LOCUS_t00380 128030 127946 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 85 1 gene locus_tag LOCUS_t00390 85 1 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 255 171 gene locus_tag LOCUS_t00400 255 171 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 538 1644 gene locus_tag LOCUS_08610 gene vmeE 538 1644 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105748.1 protein_id gnl|my_center|LOCUS_08610 1644 4757 gene locus_tag LOCUS_08620 gene vmeF 1644 4757 CDS product multidrug efflux RND transporter permease subunit VmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481813.1 protein_id gnl|my_center|LOCUS_08620 4985 5167 gene locus_tag LOCUS_08630 4985 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5800 5225 gene locus_tag LOCUS_08640 5800 5225 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461140.1 protein_id gnl|my_center|LOCUS_08640 5934 6251 gene locus_tag LOCUS_08650 5934 6251 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481865.1 protein_id gnl|my_center|LOCUS_08650 7420 6326 gene locus_tag LOCUS_08660 7420 6326 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481869.1 protein_id gnl|my_center|LOCUS_08660 7566 8036 gene locus_tag LOCUS_08670 7566 8036 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481879.1 protein_id gnl|my_center|LOCUS_08670 8425 11370 gene locus_tag LOCUS_08680 8425 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451572.1 protein_id gnl|my_center|LOCUS_08680 12370 11510 gene locus_tag LOCUS_08690 gene tesB 12370 11510 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481871.1 protein_id gnl|my_center|LOCUS_08690 12539 12973 gene locus_tag LOCUS_08700 12539 12973 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461146.1 protein_id gnl|my_center|LOCUS_08700 13292 13005 gene locus_tag LOCUS_08710 13292 13005 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481834.1 protein_id gnl|my_center|LOCUS_08710 13579 14322 gene locus_tag LOCUS_08720 13579 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461144.1 protein_id gnl|my_center|LOCUS_08720 14489 16495 gene locus_tag LOCUS_08730 14489 16495 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481822.1 protein_id gnl|my_center|LOCUS_08730 16851 17585 gene locus_tag LOCUS_08740 16851 17585 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_08740 18151 17828 gene locus_tag LOCUS_08750 18151 17828 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461160.1 protein_id gnl|my_center|LOCUS_08750 18384 20003 gene locus_tag LOCUS_08760 18384 20003 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_08760 20346 20765 gene locus_tag LOCUS_08770 20346 20765 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_08770 20881 22332 gene locus_tag LOCUS_08780 20881 22332 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262039.1 protein_id gnl|my_center|LOCUS_08780 22433 24739 gene locus_tag LOCUS_08790 22433 24739 CDS product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481815.1 protein_id gnl|my_center|LOCUS_08790 25046 25804 gene locus_tag LOCUS_08800 gene udp 25046 25804 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481824.1 protein_id gnl|my_center|LOCUS_08800 27120 25960 gene locus_tag LOCUS_08810 27120 25960 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 protein_id gnl|my_center|LOCUS_08810 29278 27287 gene locus_tag LOCUS_08820 29278 27287 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481899.1 protein_id gnl|my_center|LOCUS_08820 29511 29861 gene locus_tag LOCUS_08830 gene hinT 29511 29861 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 protein_id gnl|my_center|LOCUS_08830 29928 31322 gene locus_tag LOCUS_08840 29928 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481819.1 protein_id gnl|my_center|LOCUS_08840 31322 31714 gene locus_tag LOCUS_08850 31322 31714 CDS product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456243.1 protein_id gnl|my_center|LOCUS_08850 31802 32392 gene locus_tag LOCUS_08860 gene lpoB 31802 32392 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456187.1 protein_id gnl|my_center|LOCUS_08860 32698 33336 gene locus_tag LOCUS_08870 32698 33336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08870 33415 33954 gene locus_tag LOCUS_08880 gene ycfP 33415 33954 CDS product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456278.1 protein_id gnl|my_center|LOCUS_08880 34475 35764 gene locus_tag LOCUS_08890 34475 35764 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456272.1 protein_id gnl|my_center|LOCUS_08890 36416 35850 gene locus_tag LOCUS_08900 36416 35850 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481806.1 protein_id gnl|my_center|LOCUS_08900 37204 36473 gene locus_tag LOCUS_08910 37204 36473 CDS product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454880.1 protein_id gnl|my_center|LOCUS_08910 40711 37418 gene locus_tag LOCUS_08920 gene mfd 40711 37418 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481852.1 protein_id gnl|my_center|LOCUS_08920 41286 40717 gene locus_tag LOCUS_08930 41286 40717 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481874.1 protein_id gnl|my_center|LOCUS_08930 41637 42761 gene locus_tag LOCUS_08940 gene lolC 41637 42761 CDS product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029787805.1 protein_id gnl|my_center|LOCUS_08940 42754 43461 gene locus_tag LOCUS_08950 gene lolD 42754 43461 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_08950 43464 44708 gene locus_tag LOCUS_08960 gene lolE 43464 44708 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481897.1 protein_id gnl|my_center|LOCUS_08960 45390 44908 gene locus_tag LOCUS_08970 45390 44908 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481854.1 protein_id gnl|my_center|LOCUS_08970 45573 47024 gene locus_tag LOCUS_08980 45573 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08980 47005 47682 gene locus_tag LOCUS_08990 47005 47682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 47714 49462 gene locus_tag LOCUS_09000 gene msbA 47714 49462 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456206.1 protein_id gnl|my_center|LOCUS_09000 49468 50475 gene locus_tag LOCUS_09010 gene lpxK 49468 50475 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456276.1 protein_id gnl|my_center|LOCUS_09010 50456 50635 gene locus_tag LOCUS_09020 50456 50635 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 protein_id gnl|my_center|LOCUS_09020 50635 51393 gene locus_tag LOCUS_09030 gene kdsB 50635 51393 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456221.1 protein_id gnl|my_center|LOCUS_09030 51997 51476 gene locus_tag LOCUS_09040 51997 51476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09040 53034 51910 gene locus_tag LOCUS_09050 53034 51910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09050 54340 53231 gene locus_tag LOCUS_09060 54340 53231 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481863.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 56296 54362 gene locus_tag LOCUS_09070 56296 54362 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456210.1 protein_id gnl|my_center|LOCUS_09070 57285 56785 gene locus_tag LOCUS_09080 57285 56785 CDS product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456271.1 protein_id gnl|my_center|LOCUS_09080 59042 58302 gene locus_tag LOCUS_09090 gene pflA 59042 58302 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456250.1 protein_id gnl|my_center|LOCUS_09090 60164 59187 gene locus_tag LOCUS_09100 60164 59187 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481800.1 protein_id gnl|my_center|LOCUS_09100 62592 60316 gene locus_tag LOCUS_09110 gene pflB 62592 60316 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840420.1 protein_id gnl|my_center|LOCUS_09110 64446 62899 gene locus_tag LOCUS_09120 64446 62899 CDS product DUF3360 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456280.1 protein_id gnl|my_center|LOCUS_09120 65032 65802 gene locus_tag LOCUS_09130 65032 65802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 protein_id gnl|my_center|LOCUS_09130 65883 66653 gene locus_tag LOCUS_09140 65883 66653 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481817.1 protein_id gnl|my_center|LOCUS_09140 66735 67475 gene locus_tag LOCUS_09150 66735 67475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 protein_id gnl|my_center|LOCUS_09150 67479 68156 gene locus_tag LOCUS_09160 67479 68156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456275.1 protein_id gnl|my_center|LOCUS_09160 69050 68244 gene locus_tag LOCUS_09170 gene xthA 69050 68244 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 protein_id gnl|my_center|LOCUS_09170 69330 69166 gene locus_tag LOCUS_09180 gene rsmS 69330 69166 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 protein_id gnl|my_center|LOCUS_09180 69875 69330 gene locus_tag LOCUS_09190 69875 69330 CDS product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456195.1 protein_id gnl|my_center|LOCUS_09190 70657 69872 gene locus_tag LOCUS_09200 70657 69872 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492537.1 protein_id gnl|my_center|LOCUS_09200 72747 70672 gene locus_tag LOCUS_09210 gene dinG 72747 70672 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489085.1 protein_id gnl|my_center|LOCUS_09210 73261 74292 gene locus_tag LOCUS_09220 gene ompT 73261 74292 CDS product porin OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751972.1 protein_id gnl|my_center|LOCUS_09220 74369 75046 gene locus_tag LOCUS_09230 74369 75046 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773947.1 protein_id gnl|my_center|LOCUS_09230 75843 75313 gene locus_tag LOCUS_09240 75843 75313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09240 76215 78440 gene locus_tag LOCUS_09250 76215 78440 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_09250 78806 78588 gene locus_tag LOCUS_09260 gene cspD 78806 78588 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456215.1 protein_id gnl|my_center|LOCUS_09260 79505 79825 gene locus_tag LOCUS_09270 gene clpS 79505 79825 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456259.1 protein_id gnl|my_center|LOCUS_09270 79874 82144 gene locus_tag LOCUS_09280 gene clpA 79874 82144 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 protein_id gnl|my_center|LOCUS_09280 82274 83311 gene locus_tag LOCUS_09290 82274 83311 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456185.1 protein_id gnl|my_center|LOCUS_09290 83589 83371 gene locus_tag LOCUS_09300 gene infA 83589 83371 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 protein_id gnl|my_center|LOCUS_09300 84371 83670 gene locus_tag LOCUS_09310 84371 83670 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457240.1 protein_id gnl|my_center|LOCUS_09310 85078 84368 gene locus_tag LOCUS_09320 gene aat 85078 84368 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457250.1 protein_id gnl|my_center|LOCUS_09320 85120 85596 gene locus_tag LOCUS_09330 85120 85596 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478951.1 protein_id gnl|my_center|LOCUS_09330 85758 87038 gene locus_tag LOCUS_09340 gene aroA 85758 87038 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457254.1 protein_id gnl|my_center|LOCUS_09340 87351 87103 gene locus_tag LOCUS_09350 87351 87103 CDS product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478953.1 protein_id gnl|my_center|LOCUS_09350 87831 89438 gene locus_tag LOCUS_09360 87831 89438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 89459 90457 gene locus_tag LOCUS_09370 89459 90457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 90944 92161 gene locus_tag LOCUS_09380 gene glgC 90944 92161 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457246.1 protein_id gnl|my_center|LOCUS_09380 92151 93608 gene locus_tag LOCUS_09390 gene glgA 92151 93608 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483115.1 protein_id gnl|my_center|LOCUS_09390 93730 94533 gene locus_tag LOCUS_09400 93730 94533 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 protein_id gnl|my_center|LOCUS_09400 94892 94575 gene locus_tag LOCUS_09410 94892 94575 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483105.1 protein_id gnl|my_center|LOCUS_09410 95584 94889 gene locus_tag LOCUS_09420 95584 94889 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_09420 96291 95701 gene locus_tag LOCUS_09430 96291 95701 CDS product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457243.1 protein_id gnl|my_center|LOCUS_09430 97777 96773 gene locus_tag LOCUS_09440 gene purR 97777 96773 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 protein_id gnl|my_center|LOCUS_09440 98872 98225 gene locus_tag LOCUS_09450 gene torD 98872 98225 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 protein_id gnl|my_center|LOCUS_09450 99106 99819 gene locus_tag LOCUS_09460 gene torR 99106 99819 CDS product two-component system response regulator TorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457237.1 protein_id gnl|my_center|LOCUS_09460 100424 99906 gene locus_tag LOCUS_09470 100424 99906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 100546 100701 gene locus_tag LOCUS_09480 100546 100701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 100806 101282 gene locus_tag LOCUS_09490 100806 101282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 101183 101599 gene locus_tag LOCUS_09500 101183 101599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09500 101602 102939 gene locus_tag LOCUS_09510 gene mukF 101602 102939 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483103.1 protein_id gnl|my_center|LOCUS_09510 102920 103645 gene locus_tag LOCUS_09520 gene mukE 102920 103645 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483111.1 protein_id gnl|my_center|LOCUS_09520 103642 108111 gene locus_tag LOCUS_09530 gene mukB 103642 108111 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105766.1 protein_id gnl|my_center|LOCUS_09530 109122 108175 gene locus_tag LOCUS_09540 109122 108175 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206144.1 protein_id gnl|my_center|LOCUS_09540 109374 110864 gene locus_tag LOCUS_09550 109374 110864 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206143.1 protein_id gnl|my_center|LOCUS_09550 110946 112511 gene locus_tag LOCUS_09560 110946 112511 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481647.1 protein_id gnl|my_center|LOCUS_09560 112498 114138 gene locus_tag LOCUS_09570 112498 114138 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_09570 114488 114219 gene locus_tag LOCUS_09580 114488 114219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 115532 114564 gene locus_tag LOCUS_09590 115532 114564 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 protein_id gnl|my_center|LOCUS_09590 117041 115536 gene locus_tag LOCUS_09600 117041 115536 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_09600 117799 117053 gene locus_tag LOCUS_09610 117799 117053 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457212.1 protein_id gnl|my_center|LOCUS_09610 118992 118021 gene locus_tag LOCUS_09620 gene cmoB 118992 118021 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483112.1 protein_id gnl|my_center|LOCUS_09620 119914 119177 gene locus_tag LOCUS_09630 gene cmoA 119914 119177 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457217.1 protein_id gnl|my_center|LOCUS_09630 120885 120019 gene locus_tag LOCUS_09640 120885 120019 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454571.1 protein_id gnl|my_center|LOCUS_09640 121158 122936 gene locus_tag LOCUS_09650 gene aspS 121158 122936 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483110.1 protein_id gnl|my_center|LOCUS_09650 123333 123854 gene locus_tag LOCUS_09660 gene ruvC 123333 123854 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 protein_id gnl|my_center|LOCUS_09660 123781 123969 gene locus_tag LOCUS_09670 123781 123969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 123972 125423 gene locus_tag LOCUS_09680 123972 125423 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078607651.1 protein_id gnl|my_center|LOCUS_09680 125502 126116 gene locus_tag LOCUS_09690 gene ruvA 125502 126116 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 protein_id gnl|my_center|LOCUS_09690 126138 127142 gene locus_tag LOCUS_09700 gene ruvB 126138 127142 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457270.1 protein_id gnl|my_center|LOCUS_09700 127604 129190 gene locus_tag LOCUS_09710 gene cydA 127604 129190 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457265.1 protein_id gnl|my_center|LOCUS_09710 129208 130344 gene locus_tag LOCUS_09720 gene cydB 129208 130344 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483614.1 protein_id gnl|my_center|LOCUS_09720 130457 130759 gene locus_tag LOCUS_09730 gene ybgE 130457 130759 CDS product cyd operon protein YbgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495828.1 protein_id gnl|my_center|LOCUS_09730 130932 131351 gene locus_tag LOCUS_09740 gene ybgC 130932 131351 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483618.1 protein_id gnl|my_center|LOCUS_09740 131341 132039 gene locus_tag LOCUS_09750 gene tolQ 131341 132039 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_09750 132043 132486 gene locus_tag LOCUS_09760 132043 132486 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459813.1 protein_id gnl|my_center|LOCUS_09760 132500 133567 gene locus_tag LOCUS_09770 gene tolA 132500 133567 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483633.1 protein_id gnl|my_center|LOCUS_09770 133580 134932 gene locus_tag LOCUS_09780 gene tolB 133580 134932 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459807.1 protein_id gnl|my_center|LOCUS_09780 134948 135481 gene locus_tag LOCUS_09790 gene pal 134948 135481 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 protein_id gnl|my_center|LOCUS_09790 135497 136261 gene locus_tag LOCUS_09800 gene ybgF 135497 136261 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483625.1 protein_id gnl|my_center|LOCUS_09800 136426 137487 gene locus_tag LOCUS_09810 gene nadA 136426 137487 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483627.1 protein_id gnl|my_center|LOCUS_09810 137620 138663 gene locus_tag LOCUS_09820 137620 138663 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 protein_id gnl|my_center|LOCUS_09820 138663 139079 gene locus_tag LOCUS_09830 138663 139079 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_09830 139088 139657 gene locus_tag LOCUS_09840 139088 139657 CDS product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483629.1 protein_id gnl|my_center|LOCUS_09840 139663 140826 gene locus_tag LOCUS_09850 139663 140826 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483628.1 protein_id gnl|my_center|LOCUS_09850 141384 140923 gene locus_tag LOCUS_09860 141384 140923 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483350.1 protein_id gnl|my_center|LOCUS_09860 142556 141411 gene locus_tag LOCUS_09870 142556 141411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 143716 142553 gene locus_tag LOCUS_09880 143716 142553 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_09880 144618 143722 gene locus_tag LOCUS_09890 144618 143722 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383153.1 protein_id gnl|my_center|LOCUS_09890 145017 144787 gene locus_tag LOCUS_09900 145017 144787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 146040 145429 gene locus_tag LOCUS_09910 146040 145429 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459839.1 protein_id gnl|my_center|LOCUS_09910 146094 148514 gene locus_tag LOCUS_09920 146094 148514 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483605.1 protein_id gnl|my_center|LOCUS_09920 148893 149342 gene locus_tag LOCUS_09930 148893 149342 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459815.1 protein_id gnl|my_center|LOCUS_09930 149487 149574 gene locus_tag LOCUS_t00410 149487 149574 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 149805 149993 gene locus_tag LOCUS_09940 149805 149993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 151758 150100 gene locus_tag LOCUS_09950 151758 150100 CDS product TIGR04141 family sporadically distributed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149523363.1 protein_id gnl|my_center|LOCUS_09950 151968 153473 gene locus_tag LOCUS_09960 151968 153473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 153463 153876 gene locus_tag LOCUS_09970 153463 153876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 153968 156091 gene locus_tag LOCUS_09980 153968 156091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 156091 157680 gene locus_tag LOCUS_09990 156091 157680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 157680 159044 gene locus_tag LOCUS_10000 157680 159044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 159058 163377 gene locus_tag LOCUS_10010 159058 163377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 163377 164204 gene locus_tag LOCUS_10020 163377 164204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 164201 165334 gene locus_tag LOCUS_10030 164201 165334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 165337 167022 gene locus_tag LOCUS_10040 165337 167022 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878530.1 protein_id gnl|my_center|LOCUS_10040 167015 167593 gene locus_tag LOCUS_10050 167015 167593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 167590 169119 gene locus_tag LOCUS_10060 167590 169119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 169260 173453 gene locus_tag LOCUS_10070 169260 173453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 174408 175991 gene locus_tag LOCUS_10080 174408 175991 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080316864.1 protein_id gnl|my_center|LOCUS_10080 176123 176842 gene locus_tag LOCUS_10090 176123 176842 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102115.1 protein_id gnl|my_center|LOCUS_10090 176853 178268 gene locus_tag LOCUS_10100 176853 178268 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023919.1 protein_id gnl|my_center|LOCUS_10100 178277 179035 gene locus_tag LOCUS_10110 178277 179035 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302816.1 protein_id gnl|my_center|LOCUS_10110 179175 180077 gene locus_tag LOCUS_10120 179175 180077 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_10120 180135 180275 gene locus_tag LOCUS_10130 180135 180275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 180327 180662 gene locus_tag LOCUS_10140 180327 180662 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 protein_id gnl|my_center|LOCUS_10140 180848 181330 gene locus_tag LOCUS_10150 180848 181330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 181499 183136 gene locus_tag LOCUS_10160 181499 183136 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483603.1 protein_id gnl|my_center|LOCUS_10160 183474 184610 gene locus_tag LOCUS_10170 gene vmeA 183474 184610 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477962.1 protein_id gnl|my_center|LOCUS_10170 184613 187147 gene locus_tag LOCUS_10180 gene vmeB 184613 187147 CDS product multidrug efflux RND transporter permease subunit VmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477950.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10180 187141 187773 gene locus_tag LOCUS_10190 187141 187773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10190 >Feature sequence011 345 626 gene locus_tag LOCUS_10200 345 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 778 1287 gene locus_tag LOCUS_10210 778 1287 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965861.1 protein_id gnl|my_center|LOCUS_10210 1433 1861 gene locus_tag LOCUS_10220 1433 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2016 2648 gene locus_tag LOCUS_10230 2016 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2804 3304 gene locus_tag LOCUS_10240 2804 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3464 3739 gene locus_tag LOCUS_10250 3464 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3938 4285 gene locus_tag LOCUS_10260 3938 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4439 4939 gene locus_tag LOCUS_10270 4439 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5665 6237 gene locus_tag LOCUS_10280 5665 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6314 7105 gene locus_tag LOCUS_10290 6314 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 7247 8194 gene locus_tag LOCUS_10300 7247 8194 CDS product bacteriophage abortive infection AbiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055270450.1 protein_id gnl|my_center|LOCUS_10300 8339 9160 gene locus_tag LOCUS_10310 8339 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence012 2003 282 gene locus_tag LOCUS_10320 gene cydC 2003 282 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483528.1 protein_id gnl|my_center|LOCUS_10320 3579 1996 gene locus_tag LOCUS_10330 gene cydD 3579 1996 CDS product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488660.1 protein_id gnl|my_center|LOCUS_10330 4845 3886 gene locus_tag LOCUS_10340 gene trxB 4845 3886 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_10340 5216 5872 gene locus_tag LOCUS_10350 5216 5872 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456172.1 protein_id gnl|my_center|LOCUS_10350 5856 7091 gene locus_tag LOCUS_10360 5856 7091 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483538.1 protein_id gnl|my_center|LOCUS_10360 7992 7168 gene locus_tag LOCUS_10370 7992 7168 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_10370 8253 9398 gene locus_tag LOCUS_10380 8253 9398 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483518.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 9313 9591 gene locus_tag LOCUS_10390 9313 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 11123 9753 gene locus_tag LOCUS_10400 11123 9753 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462594.1 protein_id gnl|my_center|LOCUS_10400 12006 11305 gene locus_tag LOCUS_10410 12006 11305 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462605.1 protein_id gnl|my_center|LOCUS_10410 13920 12232 gene locus_tag LOCUS_10420 13920 12232 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462599.1 protein_id gnl|my_center|LOCUS_10420 14138 16492 gene locus_tag LOCUS_10430 14138 16492 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_10430 16628 17386 gene locus_tag LOCUS_10440 16628 17386 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462596.1 protein_id gnl|my_center|LOCUS_10440 17621 17998 gene locus_tag LOCUS_10450 17621 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462601.1 protein_id gnl|my_center|LOCUS_10450 18306 19982 gene locus_tag LOCUS_10460 18306 19982 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462598.1 protein_id gnl|my_center|LOCUS_10460 21177 20074 gene locus_tag LOCUS_10470 21177 20074 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 protein_id gnl|my_center|LOCUS_10470 21774 21382 gene locus_tag LOCUS_10480 21774 21382 CDS product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462595.1 protein_id gnl|my_center|LOCUS_10480 22411 22226 gene locus_tag LOCUS_10490 22411 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462602.1 protein_id gnl|my_center|LOCUS_10490 23570 22590 gene locus_tag LOCUS_10500 23570 22590 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483520.1 protein_id gnl|my_center|LOCUS_10500 24315 23647 gene locus_tag LOCUS_10510 24315 23647 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483532.1 protein_id gnl|my_center|LOCUS_10510 25129 24440 gene locus_tag LOCUS_10520 25129 24440 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462644.1 protein_id gnl|my_center|LOCUS_10520 25986 25306 gene locus_tag LOCUS_10530 25986 25306 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462648.1 protein_id gnl|my_center|LOCUS_10530 26251 29064 gene locus_tag LOCUS_10540 26251 29064 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462645.1 protein_id gnl|my_center|LOCUS_10540 29091 29288 gene locus_tag LOCUS_10550 29091 29288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10550 29381 29842 gene locus_tag LOCUS_10560 29381 29842 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_10560 30122 30685 gene locus_tag LOCUS_10570 30122 30685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 30682 31368 gene locus_tag LOCUS_10580 gene fre 30682 31368 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586597.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence013 3602 792 gene locus_tag LOCUS_10590 3602 792 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 protein_id gnl|my_center|LOCUS_10590 5623 3659 gene locus_tag LOCUS_10600 5623 3659 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480740.1 protein_id gnl|my_center|LOCUS_10600 6255 5623 gene locus_tag LOCUS_10610 6255 5623 CDS product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454971.1 protein_id gnl|my_center|LOCUS_10610 6541 8082 gene locus_tag LOCUS_10620 6541 8082 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454921.1 protein_id gnl|my_center|LOCUS_10620 8165 8695 gene locus_tag LOCUS_10630 8165 8695 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454828.1 protein_id gnl|my_center|LOCUS_10630 9073 8753 gene locus_tag LOCUS_10640 9073 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11562 9070 gene locus_tag LOCUS_10650 11562 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 12372 11827 gene locus_tag LOCUS_10660 12372 11827 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 protein_id gnl|my_center|LOCUS_10660 14351 12411 gene locus_tag LOCUS_10670 14351 12411 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454986.1 protein_id gnl|my_center|LOCUS_10670 14711 14361 gene locus_tag LOCUS_10680 14711 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454806.1 protein_id gnl|my_center|LOCUS_10680 15072 16280 gene locus_tag LOCUS_10690 15072 16280 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 protein_id gnl|my_center|LOCUS_10690 16803 19250 gene locus_tag LOCUS_10700 16803 19250 CDS product DmsA/YnfE/YnfF family dimethyl sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483420.1 protein_id gnl|my_center|LOCUS_10700 19250 19879 gene locus_tag LOCUS_10710 gene dmsB 19250 19879 CDS product dimethylsulfoxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483443.1 protein_id gnl|my_center|LOCUS_10710 19879 20730 gene locus_tag LOCUS_10720 19879 20730 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483416.1 protein_id gnl|my_center|LOCUS_10720 20861 21472 gene locus_tag LOCUS_10730 20861 21472 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483451.1 protein_id gnl|my_center|LOCUS_10730 21459 21956 gene locus_tag LOCUS_10740 21459 21956 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483465.1 protein_id gnl|my_center|LOCUS_10740 22596 22012 gene locus_tag LOCUS_10750 22596 22012 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483453.1 protein_id gnl|my_center|LOCUS_10750 22793 26809 gene locus_tag LOCUS_10760 gene hrpA 22793 26809 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 protein_id gnl|my_center|LOCUS_10760 27020 27502 gene locus_tag LOCUS_10770 27020 27502 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483427.1 protein_id gnl|my_center|LOCUS_10770 27707 28222 gene locus_tag LOCUS_10780 27707 28222 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454858.1 protein_id gnl|my_center|LOCUS_10780 28389 29096 gene locus_tag LOCUS_10790 gene deoD 28389 29096 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072663.1 protein_id gnl|my_center|LOCUS_10790 29184 30350 gene locus_tag LOCUS_10800 gene tsgA 29184 30350 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072662.1 protein_id gnl|my_center|LOCUS_10800 31093 30419 gene locus_tag LOCUS_10810 31093 30419 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072661.1 protein_id gnl|my_center|LOCUS_10810 31531 31103 gene locus_tag LOCUS_10820 31531 31103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480781.1 protein_id gnl|my_center|LOCUS_10820 35393 31683 gene locus_tag LOCUS_10830 35393 31683 CDS product M66 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035991.1 protein_id gnl|my_center|LOCUS_10830 37054 35948 gene locus_tag LOCUS_10840 37054 35948 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454889.1 protein_id gnl|my_center|LOCUS_10840 37846 39294 gene locus_tag LOCUS_10850 37846 39294 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10850 39291 39584 gene locus_tag LOCUS_10860 39291 39584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10860 41454 40555 gene locus_tag LOCUS_10870 41454 40555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 42221 41532 gene locus_tag LOCUS_10880 42221 41532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 43909 42290 gene locus_tag LOCUS_10890 43909 42290 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803911.1 protein_id gnl|my_center|LOCUS_10890 44562 44080 gene locus_tag LOCUS_10900 44562 44080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 45227 44541 gene locus_tag LOCUS_10910 45227 44541 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816996.1 protein_id gnl|my_center|LOCUS_10910 45633 46451 gene locus_tag LOCUS_10920 45633 46451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 46716 47486 gene locus_tag LOCUS_10930 46716 47486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 47483 50530 gene locus_tag LOCUS_10940 47483 50530 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_10940 52055 50583 gene locus_tag LOCUS_10950 52055 50583 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477744.1 protein_id gnl|my_center|LOCUS_10950 52969 52304 gene locus_tag LOCUS_10960 gene vpsT 52969 52304 CDS product LuxR family transcriptional regulator VpsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651013.1 protein_id gnl|my_center|LOCUS_10960 53956 53078 gene locus_tag LOCUS_10970 53956 53078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 56426 53946 gene locus_tag LOCUS_10980 56426 53946 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210857.1 protein_id gnl|my_center|LOCUS_10980 57084 56410 gene locus_tag LOCUS_10990 57084 56410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 57800 57096 gene locus_tag LOCUS_11000 57800 57096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 58381 57887 gene locus_tag LOCUS_11010 58381 57887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 58961 58467 gene locus_tag LOCUS_11020 58961 58467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 59271 59906 gene locus_tag LOCUS_11030 59271 59906 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105916.1 protein_id gnl|my_center|LOCUS_11030 59906 60472 gene locus_tag LOCUS_11040 59906 60472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477711.1 protein_id gnl|my_center|LOCUS_11040 61900 60524 gene locus_tag LOCUS_11050 61900 60524 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477800.1 protein_id gnl|my_center|LOCUS_11050 62649 62807 gene locus_tag LOCUS_11060 62649 62807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477734.1 protein_id gnl|my_center|LOCUS_11060 62839 63573 gene locus_tag LOCUS_11070 62839 63573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477843.1 protein_id gnl|my_center|LOCUS_11070 64198 63737 gene locus_tag LOCUS_11080 64198 63737 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422766.1 protein_id gnl|my_center|LOCUS_11080 64587 65660 gene locus_tag LOCUS_11090 gene hppD 64587 65660 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454802.1 protein_id gnl|my_center|LOCUS_11090 65653 66783 gene locus_tag LOCUS_11100 65653 66783 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480624.1 protein_id gnl|my_center|LOCUS_11100 66793 67830 gene locus_tag LOCUS_11110 66793 67830 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454824.1 protein_id gnl|my_center|LOCUS_11110 67851 68519 gene locus_tag LOCUS_11120 gene maiA 67851 68519 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454866.1 protein_id gnl|my_center|LOCUS_11120 68704 69366 gene locus_tag LOCUS_11130 68704 69366 CDS product DUF2726 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455004.1 protein_id gnl|my_center|LOCUS_11130 69513 69851 gene locus_tag LOCUS_11140 69513 69851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454847.1 protein_id gnl|my_center|LOCUS_11140 70031 70107 gene locus_tag LOCUS_t00420 70031 70107 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 70154 70230 gene locus_tag LOCUS_t00430 70154 70230 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 70849 72348 gene locus_tag LOCUS_11150 70849 72348 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114786309.1 protein_id gnl|my_center|LOCUS_11150 73338 72421 gene locus_tag LOCUS_11160 73338 72421 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713800.1 protein_id gnl|my_center|LOCUS_11160 73567 74658 gene locus_tag LOCUS_11170 73567 74658 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_11170 75982 74702 gene locus_tag LOCUS_11180 75982 74702 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263251.1 protein_id gnl|my_center|LOCUS_11180 76275 76835 gene locus_tag LOCUS_11190 76275 76835 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263250.1 protein_id gnl|my_center|LOCUS_11190 77905 77000 gene locus_tag LOCUS_11200 77905 77000 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477794.1 protein_id gnl|my_center|LOCUS_11200 78026 78508 gene locus_tag LOCUS_11210 78026 78508 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464470.1 protein_id gnl|my_center|LOCUS_11210 78770 79204 gene locus_tag LOCUS_11220 78770 79204 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477866.1 protein_id gnl|my_center|LOCUS_11220 79683 79243 gene locus_tag LOCUS_11230 79683 79243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 80302 79676 gene locus_tag LOCUS_11240 80302 79676 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903504.1 protein_id gnl|my_center|LOCUS_11240 80409 80957 gene locus_tag LOCUS_11250 gene cyaB 80409 80957 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105925.1 protein_id gnl|my_center|LOCUS_11250 81095 81424 gene locus_tag LOCUS_11260 81095 81424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 81664 82278 gene locus_tag LOCUS_11270 81664 82278 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_11270 82463 83401 gene locus_tag LOCUS_11280 82463 83401 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921808.1 protein_id gnl|my_center|LOCUS_11280 84174 83464 gene locus_tag LOCUS_11290 84174 83464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11290 84518 84177 gene locus_tag LOCUS_11300 84518 84177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11300 85005 84520 gene locus_tag LOCUS_11310 85005 84520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021454613.1 protein_id gnl|my_center|LOCUS_11310 88121 85017 gene locus_tag LOCUS_11320 88121 85017 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477868.1 protein_id gnl|my_center|LOCUS_11320 88409 88795 gene locus_tag LOCUS_11330 88409 88795 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483459.1 protein_id gnl|my_center|LOCUS_11330 89449 88817 gene locus_tag LOCUS_11340 89449 88817 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483433.1 protein_id gnl|my_center|LOCUS_11340 90650 89460 gene locus_tag LOCUS_11350 90650 89460 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483424.1 protein_id gnl|my_center|LOCUS_11350 91315 90647 gene locus_tag LOCUS_11360 91315 90647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 93366 91939 gene locus_tag LOCUS_11370 93366 91939 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483455.1 protein_id gnl|my_center|LOCUS_11370 94481 93363 gene locus_tag LOCUS_11380 94481 93363 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483463.1 protein_id gnl|my_center|LOCUS_11380 95525 94560 gene locus_tag LOCUS_11390 95525 94560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 97386 96211 gene locus_tag LOCUS_11400 97386 96211 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483422.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11400 98545 97379 gene locus_tag LOCUS_11410 98545 97379 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483470.1 protein_id gnl|my_center|LOCUS_11410 99742 98558 gene locus_tag LOCUS_11420 99742 98558 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483478.1 protein_id gnl|my_center|LOCUS_11420 100972 99938 gene locus_tag LOCUS_11430 100972 99938 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483417.1 protein_id gnl|my_center|LOCUS_11430 102470 100965 gene locus_tag LOCUS_11440 102470 100965 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483461.1 protein_id gnl|my_center|LOCUS_11440 102993 102616 gene locus_tag LOCUS_11450 102993 102616 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454845.1 protein_id gnl|my_center|LOCUS_11450 103687 103007 gene locus_tag LOCUS_11460 103687 103007 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454821.1 protein_id gnl|my_center|LOCUS_11460 105792 103687 gene locus_tag LOCUS_11470 105792 103687 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483457.1 protein_id gnl|my_center|LOCUS_11470 106622 105789 gene locus_tag LOCUS_11480 106622 105789 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491469.1 protein_id gnl|my_center|LOCUS_11480 106973 106656 gene locus_tag LOCUS_11490 106973 106656 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454817.1 protein_id gnl|my_center|LOCUS_11490 107307 108191 gene locus_tag LOCUS_11500 107307 108191 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 protein_id gnl|my_center|LOCUS_11500 109207 108194 gene locus_tag LOCUS_11510 109207 108194 CDS product DUF3080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454864.1 protein_id gnl|my_center|LOCUS_11510 110685 109315 gene locus_tag LOCUS_11520 110685 109315 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483441.1 protein_id gnl|my_center|LOCUS_11520 110967 111578 gene locus_tag LOCUS_11530 110967 111578 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_11530 111863 111669 gene locus_tag LOCUS_11540 111863 111669 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243592.1 protein_id gnl|my_center|LOCUS_11540 112997 112131 gene locus_tag LOCUS_11550 112997 112131 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 protein_id gnl|my_center|LOCUS_11550 113162 114193 gene locus_tag LOCUS_11560 113162 114193 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488594.1 protein_id gnl|my_center|LOCUS_11560 114193 115167 gene locus_tag LOCUS_11570 114193 115167 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453915.1 protein_id gnl|my_center|LOCUS_11570 115294 115638 gene locus_tag LOCUS_11580 115294 115638 CDS product DUF3802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453925.1 protein_id gnl|my_center|LOCUS_11580 116154 115675 gene locus_tag LOCUS_11590 116154 115675 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453841.1 protein_id gnl|my_center|LOCUS_11590 116295 118322 gene locus_tag LOCUS_11600 116295 118322 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490107.1 protein_id gnl|my_center|LOCUS_11600 118622 121792 gene locus_tag LOCUS_11610 118622 121792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 122375 123094 gene locus_tag LOCUS_11620 122375 123094 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464619.1 protein_id gnl|my_center|LOCUS_11620 123107 124003 gene locus_tag LOCUS_11630 gene prpB 123107 124003 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464610.1 protein_id gnl|my_center|LOCUS_11630 124135 125277 gene locus_tag LOCUS_11640 gene prpC 124135 125277 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477858.1 protein_id gnl|my_center|LOCUS_11640 125410 126048 gene locus_tag LOCUS_11650 125410 126048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 126101 127303 gene locus_tag LOCUS_11660 126101 127303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 127320 128021 gene locus_tag LOCUS_11670 127320 128021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11670 128045 129232 gene locus_tag LOCUS_11680 gene prpF 128045 129232 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477855.1 protein_id gnl|my_center|LOCUS_11680 129267 130415 gene locus_tag LOCUS_11690 129267 130415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 130514 131173 gene locus_tag LOCUS_11700 130514 131173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 131333 131806 gene locus_tag LOCUS_11710 131333 131806 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477859.1 protein_id gnl|my_center|LOCUS_11710 132251 133576 gene locus_tag LOCUS_11720 132251 133576 CDS product bifunctional NUDIX hydrolase/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493156.1 protein_id gnl|my_center|LOCUS_11720 134452 133643 gene locus_tag LOCUS_11730 134452 133643 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477847.1 protein_id gnl|my_center|LOCUS_11730 134588 135268 gene locus_tag LOCUS_11740 gene queE 134588 135268 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451308.1 protein_id gnl|my_center|LOCUS_11740 135283 135981 gene locus_tag LOCUS_11750 gene queC 135283 135981 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477815.1 protein_id gnl|my_center|LOCUS_11750 137770 135938 gene locus_tag LOCUS_11760 137770 135938 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477747.1 protein_id gnl|my_center|LOCUS_11760 138437 138084 gene locus_tag LOCUS_11770 138437 138084 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477755.1 protein_id gnl|my_center|LOCUS_11770 139161 138547 gene locus_tag LOCUS_11780 139161 138547 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477817.1 protein_id gnl|my_center|LOCUS_11780 140474 139164 gene locus_tag LOCUS_11790 140474 139164 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence014 1040 315 gene locus_tag LOCUS_11800 1040 315 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_11800 2842 1298 gene locus_tag LOCUS_11810 gene hutH 2842 1298 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105800.1 protein_id gnl|my_center|LOCUS_11810 3951 2845 gene locus_tag LOCUS_11820 3951 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11820 4544 3975 gene locus_tag LOCUS_11830 4544 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 5654 4641 gene locus_tag LOCUS_11840 gene hutG 5654 4641 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483530.1 protein_id gnl|my_center|LOCUS_11840 6906 5656 gene locus_tag LOCUS_11850 gene hutI 6906 5656 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483557.1 protein_id gnl|my_center|LOCUS_11850 7734 7027 gene locus_tag LOCUS_11860 gene hutC 7734 7027 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483583.1 protein_id gnl|my_center|LOCUS_11860 7928 8671 gene locus_tag LOCUS_11870 7928 8671 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462606.1 protein_id gnl|my_center|LOCUS_11870 9663 8677 gene locus_tag LOCUS_11880 9663 8677 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462610.1 protein_id gnl|my_center|LOCUS_11880 9954 11882 gene locus_tag LOCUS_11890 gene thrS 9954 11882 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490070.1 protein_id gnl|my_center|LOCUS_11890 11937 12437 gene locus_tag LOCUS_11900 gene infC 11937 12437 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894072.1 protein_id gnl|my_center|LOCUS_11900 12561 12755 gene locus_tag LOCUS_11910 gene rpmI 12561 12755 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462620.1 protein_id gnl|my_center|LOCUS_11910 12796 13149 gene locus_tag LOCUS_11920 gene rplT 12796 13149 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_11920 13372 13917 gene locus_tag LOCUS_11930 13372 13917 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464345.1 protein_id gnl|my_center|LOCUS_11930 13977 14261 gene locus_tag LOCUS_11940 13977 14261 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483310.1 protein_id gnl|my_center|LOCUS_11940 14278 14658 gene locus_tag LOCUS_11950 14278 14658 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462158.1 protein_id gnl|my_center|LOCUS_11950 14669 15058 gene locus_tag LOCUS_11960 14669 15058 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261873.1 protein_id gnl|my_center|LOCUS_11960 15060 15374 gene locus_tag LOCUS_11970 15060 15374 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462608.1 protein_id gnl|my_center|LOCUS_11970 15518 15973 gene locus_tag LOCUS_11980 15518 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 16313 17122 gene locus_tag LOCUS_11990 16313 17122 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462617.1 protein_id gnl|my_center|LOCUS_11990 17460 18578 gene locus_tag LOCUS_12000 17460 18578 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480635.1 protein_id gnl|my_center|LOCUS_12000 18813 19796 gene locus_tag LOCUS_12010 gene pheS 18813 19796 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480737.1 protein_id gnl|my_center|LOCUS_12010 19815 22202 gene locus_tag LOCUS_12020 gene pheT 19815 22202 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 protein_id gnl|my_center|LOCUS_12020 23074 22298 gene locus_tag LOCUS_12030 gene cpdA 23074 22298 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_12030 23996 23118 gene locus_tag LOCUS_12040 23996 23118 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_12040 24524 24820 gene locus_tag LOCUS_12050 gene ihfA 24524 24820 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 protein_id gnl|my_center|LOCUS_12050 25741 24968 gene locus_tag LOCUS_12060 25741 24968 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480657.1 protein_id gnl|my_center|LOCUS_12060 26077 26727 gene locus_tag LOCUS_12070 26077 26727 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480776.1 protein_id gnl|my_center|LOCUS_12070 27982 26807 gene locus_tag LOCUS_12080 gene purT 27982 26807 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480612.1 protein_id gnl|my_center|LOCUS_12080 29016 28129 gene locus_tag LOCUS_12090 gene cdd 29016 28129 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454956.1 protein_id gnl|my_center|LOCUS_12090 29960 29283 gene locus_tag LOCUS_12100 29960 29283 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480762.1 protein_id gnl|my_center|LOCUS_12100 30336 29962 gene locus_tag LOCUS_12110 30336 29962 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455074.1 protein_id gnl|my_center|LOCUS_12110 31816 30395 gene locus_tag LOCUS_12120 gene sbcB 31816 30395 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454911.1 protein_id gnl|my_center|LOCUS_12120 32645 31947 gene locus_tag LOCUS_12130 32645 31947 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480749.1 protein_id gnl|my_center|LOCUS_12130 33294 33905 gene locus_tag LOCUS_12140 33294 33905 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_12140 33925 34968 gene locus_tag LOCUS_12150 gene cobT 33925 34968 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480702.1 protein_id gnl|my_center|LOCUS_12150 34968 35774 gene locus_tag LOCUS_12160 34968 35774 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778770.1 protein_id gnl|my_center|LOCUS_12160 35771 36304 gene locus_tag LOCUS_12170 gene cobU 35771 36304 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480659.1 protein_id gnl|my_center|LOCUS_12170 36316 36930 gene locus_tag LOCUS_12180 gene cobC 36316 36930 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480583.1 protein_id gnl|my_center|LOCUS_12180 37013 38812 gene locus_tag LOCUS_12190 37013 38812 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480694.1 protein_id gnl|my_center|LOCUS_12190 39051 40079 gene locus_tag LOCUS_12200 39051 40079 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480742.1 protein_id gnl|my_center|LOCUS_12200 40164 40952 gene locus_tag LOCUS_12210 gene btuC 40164 40952 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454796.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 40930 41178 gene locus_tag LOCUS_12220 40930 41178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 41165 41932 gene locus_tag LOCUS_12230 gene btuD 41165 41932 CDS product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454996.1 protein_id gnl|my_center|LOCUS_12230 42310 41987 gene locus_tag LOCUS_12240 42310 41987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 42632 43117 gene locus_tag LOCUS_12250 42632 43117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 43851 43216 gene locus_tag LOCUS_12260 43851 43216 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454856.1 protein_id gnl|my_center|LOCUS_12260 44481 43900 gene locus_tag LOCUS_12270 44481 43900 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480777.1 protein_id gnl|my_center|LOCUS_12270 45775 44564 gene locus_tag LOCUS_12280 45775 44564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455072.1 protein_id gnl|my_center|LOCUS_12280 45888 46757 gene locus_tag LOCUS_12290 45888 46757 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454832.1 protein_id gnl|my_center|LOCUS_12290 47362 46910 gene locus_tag LOCUS_12300 47362 46910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 47916 47401 gene locus_tag LOCUS_12310 47916 47401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 49012 47906 gene locus_tag LOCUS_12320 49012 47906 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477158.1 protein_id gnl|my_center|LOCUS_12320 49472 49242 gene locus_tag LOCUS_12330 49472 49242 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454961.1 protein_id gnl|my_center|LOCUS_12330 49824 51266 gene locus_tag LOCUS_12340 49824 51266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480626.1 protein_id gnl|my_center|LOCUS_12340 51292 52410 gene locus_tag LOCUS_12350 51292 52410 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454928.1 protein_id gnl|my_center|LOCUS_12350 52420 53136 gene locus_tag LOCUS_12360 52420 53136 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454982.1 protein_id gnl|my_center|LOCUS_12360 53141 54175 gene locus_tag LOCUS_12370 53141 54175 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 protein_id gnl|my_center|LOCUS_12370 54352 54993 gene locus_tag LOCUS_12380 54352 54993 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455037.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12380 55120 55635 gene locus_tag LOCUS_12390 55120 55635 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480687.1 protein_id gnl|my_center|LOCUS_12390 55622 56749 gene locus_tag LOCUS_12400 gene rlmF 55622 56749 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454860.1 protein_id gnl|my_center|LOCUS_12400 57210 56803 gene locus_tag LOCUS_12410 57210 56803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 58774 57194 gene locus_tag LOCUS_12420 58774 57194 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_12420 59953 59339 gene locus_tag LOCUS_12430 gene pilW 59953 59339 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477819.1 protein_id gnl|my_center|LOCUS_12430 61416 60475 gene locus_tag LOCUS_12440 gene metA 61416 60475 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464332.1 protein_id gnl|my_center|LOCUS_12440 61760 62422 gene locus_tag LOCUS_12450 61760 62422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478188.1 protein_id gnl|my_center|LOCUS_12450 62835 63188 gene locus_tag LOCUS_12460 62835 63188 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261337.1 protein_id gnl|my_center|LOCUS_12460 63600 63241 gene locus_tag LOCUS_12470 63600 63241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 64216 64398 gene locus_tag LOCUS_12480 64216 64398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 64912 64445 gene locus_tag LOCUS_12490 64912 64445 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021447722.1 protein_id gnl|my_center|LOCUS_12490 65348 65019 gene locus_tag LOCUS_12500 65348 65019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 68314 66953 gene locus_tag LOCUS_12510 68314 66953 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483216.1 protein_id gnl|my_center|LOCUS_12510 69664 68411 gene locus_tag LOCUS_12520 69664 68411 CDS product serine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458812.1 protein_id gnl|my_center|LOCUS_12520 70610 70011 gene locus_tag LOCUS_12530 70610 70011 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458814.1 protein_id gnl|my_center|LOCUS_12530 70734 71273 gene locus_tag LOCUS_12540 70734 71273 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_12540 71280 72983 gene locus_tag LOCUS_12550 71280 72983 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483312.1 protein_id gnl|my_center|LOCUS_12550 73301 73068 gene locus_tag LOCUS_12560 73301 73068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 74458 73280 gene locus_tag LOCUS_12570 gene pabB 74458 73280 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483132.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 74741 76258 gene locus_tag LOCUS_12580 74741 76258 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376905.1 protein_id gnl|my_center|LOCUS_12580 76434 76619 gene locus_tag LOCUS_12590 76434 76619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458825.1 protein_id gnl|my_center|LOCUS_12590 76776 78152 gene locus_tag LOCUS_12600 76776 78152 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483259.1 protein_id gnl|my_center|LOCUS_12600 78149 79189 gene locus_tag LOCUS_12610 78149 79189 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483263.1 protein_id gnl|my_center|LOCUS_12610 79290 80834 gene locus_tag LOCUS_12620 gene tyrR 79290 80834 CDS product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483314.1 protein_id gnl|my_center|LOCUS_12620 80900 81481 gene locus_tag LOCUS_12630 gene rimJ 80900 81481 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458831.1 protein_id gnl|my_center|LOCUS_12630 81485 82072 gene locus_tag LOCUS_12640 81485 82072 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_12640 82086 82559 gene locus_tag LOCUS_12650 82086 82559 CDS product DUF2947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 protein_id gnl|my_center|LOCUS_12650 83580 82618 gene locus_tag LOCUS_12660 83580 82618 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105976.1 protein_id gnl|my_center|LOCUS_12660 83822 84226 gene locus_tag LOCUS_12670 83822 84226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 84377 85279 gene locus_tag LOCUS_12680 84377 85279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 86022 86366 gene locus_tag LOCUS_12690 86022 86366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 86490 86963 gene locus_tag LOCUS_12700 86490 86963 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483220.1 protein_id gnl|my_center|LOCUS_12700 87109 87720 gene locus_tag LOCUS_12710 87109 87720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 88490 88798 gene locus_tag LOCUS_12720 88490 88798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 88795 89646 gene locus_tag LOCUS_12730 88795 89646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 89697 90455 gene locus_tag LOCUS_12740 89697 90455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 90623 90931 gene locus_tag LOCUS_12750 90623 90931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 91165 91767 gene locus_tag LOCUS_12760 91165 91767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12760 91917 91780 gene locus_tag LOCUS_12770 91917 91780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 91949 92527 gene locus_tag LOCUS_12780 91949 92527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 92772 93137 gene locus_tag LOCUS_12790 92772 93137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 93331 93903 gene locus_tag LOCUS_12800 93331 93903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 94385 94017 gene locus_tag LOCUS_12810 94385 94017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464338.1 protein_id gnl|my_center|LOCUS_12810 95204 94653 gene locus_tag LOCUS_12820 95204 94653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 95453 96670 gene locus_tag LOCUS_12830 95453 96670 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851191.1 protein_id gnl|my_center|LOCUS_12830 98604 96667 gene locus_tag LOCUS_12840 98604 96667 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105914.1 protein_id gnl|my_center|LOCUS_12840 98997 100370 gene locus_tag LOCUS_12850 gene cysS 98997 100370 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_12850 101851 100442 gene locus_tag LOCUS_12860 101851 100442 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_12860 103084 102077 gene locus_tag LOCUS_12870 gene proX 103084 102077 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 protein_id gnl|my_center|LOCUS_12870 104195 103077 gene locus_tag LOCUS_12880 gene proW 104195 103077 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464578.1 protein_id gnl|my_center|LOCUS_12880 105388 104201 gene locus_tag LOCUS_12890 gene proV 105388 104201 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464644.1 protein_id gnl|my_center|LOCUS_12890 105827 107707 gene locus_tag LOCUS_12900 105827 107707 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464433.1 protein_id gnl|my_center|LOCUS_12900 107704 108453 gene locus_tag LOCUS_12910 107704 108453 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477841.1 protein_id gnl|my_center|LOCUS_12910 108679 110343 gene locus_tag LOCUS_12920 108679 110343 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_12920 110675 111220 gene locus_tag LOCUS_12930 gene ectA 110675 111220 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477699.1 protein_id gnl|my_center|LOCUS_12930 111256 112521 gene locus_tag LOCUS_12940 gene ectB 111256 112521 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464458.1 protein_id gnl|my_center|LOCUS_12940 112535 112921 gene locus_tag LOCUS_12950 112535 112921 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 protein_id gnl|my_center|LOCUS_12950 113009 114433 gene locus_tag LOCUS_12960 113009 114433 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 protein_id gnl|my_center|LOCUS_12960 114826 114491 gene locus_tag LOCUS_12970 114826 114491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 116071 115085 gene locus_tag LOCUS_12980 116071 115085 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464337.1 protein_id gnl|my_center|LOCUS_12980 117283 116399 gene locus_tag LOCUS_12990 117283 116399 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_12990 117472 118368 gene locus_tag LOCUS_13000 117472 118368 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531059.1 protein_id gnl|my_center|LOCUS_13000 118760 119605 gene locus_tag LOCUS_13010 118760 119605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 119599 120270 gene locus_tag LOCUS_13020 119599 120270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13020 120477 120635 gene locus_tag LOCUS_13030 120477 120635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 120683 120931 gene locus_tag LOCUS_13040 120683 120931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 121402 121722 gene locus_tag LOCUS_13050 121402 121722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 121755 122099 gene locus_tag LOCUS_13060 121755 122099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 123472 122321 gene locus_tag LOCUS_13070 123472 122321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477777.1 protein_id gnl|my_center|LOCUS_13070 124656 123469 gene locus_tag LOCUS_13080 124656 123469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464455.1 protein_id gnl|my_center|LOCUS_13080 125655 124675 gene locus_tag LOCUS_13090 125655 124675 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464702.1 protein_id gnl|my_center|LOCUS_13090 125838 125659 gene locus_tag LOCUS_13100 125838 125659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13100 127073 125799 gene locus_tag LOCUS_13110 127073 125799 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464326.1 protein_id gnl|my_center|LOCUS_13110 127451 127224 gene locus_tag LOCUS_13120 127451 127224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250488.1 protein_id gnl|my_center|LOCUS_13120 128058 127897 gene locus_tag LOCUS_13130 128058 127897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262028.1 protein_id gnl|my_center|LOCUS_13130 128289 129908 gene locus_tag LOCUS_13140 128289 129908 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464527.1 protein_id gnl|my_center|LOCUS_13140 129905 130591 gene locus_tag LOCUS_13150 129905 130591 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464372.1 protein_id gnl|my_center|LOCUS_13150 131318 130752 gene locus_tag LOCUS_13160 131318 130752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13160 132888 131245 gene locus_tag LOCUS_13170 132888 131245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 133946 133011 gene locus_tag LOCUS_13180 133946 133011 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705822.1 protein_id gnl|my_center|LOCUS_13180 134492 135994 gene locus_tag LOCUS_13190 gene zwf 134492 135994 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477796.1 protein_id gnl|my_center|LOCUS_13190 135991 136707 gene locus_tag LOCUS_13200 gene pgl 135991 136707 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464630.1 protein_id gnl|my_center|LOCUS_13200 136748 138196 gene locus_tag LOCUS_13210 gene gnd 136748 138196 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 protein_id gnl|my_center|LOCUS_13210 138709 138951 gene locus_tag LOCUS_13220 138709 138951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 138959 139492 gene locus_tag LOCUS_13230 138959 139492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 139713 139507 gene locus_tag LOCUS_13240 139713 139507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464314.1 protein_id gnl|my_center|LOCUS_13240 139985 141505 gene locus_tag LOCUS_13250 139985 141505 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_13250 142505 141603 gene locus_tag LOCUS_13260 142505 141603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 142780 142986 gene locus_tag LOCUS_13270 142780 142986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 144810 143047 gene locus_tag LOCUS_13280 144810 143047 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464568.1 protein_id gnl|my_center|LOCUS_13280 145058 146578 gene locus_tag LOCUS_13290 145058 146578 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009697454.1 protein_id gnl|my_center|LOCUS_13290 147814 146642 gene locus_tag LOCUS_13300 147814 146642 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_13300 148115 149086 gene locus_tag LOCUS_13310 148115 149086 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13310 150891 149155 gene locus_tag LOCUS_13320 150891 149155 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057937.1 protein_id gnl|my_center|LOCUS_13320 151818 151048 gene locus_tag LOCUS_13330 151818 151048 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477770.1 protein_id gnl|my_center|LOCUS_13330 153500 151974 gene locus_tag LOCUS_13340 153500 151974 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464542.1 protein_id gnl|my_center|LOCUS_13340 154015 153521 gene locus_tag LOCUS_13350 154015 153521 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464370.1 protein_id gnl|my_center|LOCUS_13350 155219 154245 gene locus_tag LOCUS_13360 155219 154245 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 protein_id gnl|my_center|LOCUS_13360 155505 155903 gene locus_tag LOCUS_13370 155505 155903 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477765.1 protein_id gnl|my_center|LOCUS_13370 156156 156572 gene locus_tag LOCUS_13380 156156 156572 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479428.1 protein_id gnl|my_center|LOCUS_13380 156562 157005 gene locus_tag LOCUS_13390 156562 157005 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266566.1 protein_id gnl|my_center|LOCUS_13390 157308 157691 gene locus_tag LOCUS_13400 157308 157691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453855.1 protein_id gnl|my_center|LOCUS_13400 157728 157946 gene locus_tag LOCUS_13410 157728 157946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 157963 158421 gene locus_tag LOCUS_13420 157963 158421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 158618 158394 gene locus_tag LOCUS_13430 158618 158394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 159433 158615 gene locus_tag LOCUS_13440 159433 158615 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_13440 159613 160362 gene locus_tag LOCUS_13450 159613 160362 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453853.1 protein_id gnl|my_center|LOCUS_13450 160535 161443 gene locus_tag LOCUS_13460 gene nagK 160535 161443 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453903.1 protein_id gnl|my_center|LOCUS_13460 161636 162133 gene locus_tag LOCUS_13470 161636 162133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 162477 162211 gene locus_tag LOCUS_13480 162477 162211 CDS product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377584.1 protein_id gnl|my_center|LOCUS_13480 164330 162552 gene locus_tag LOCUS_13490 164330 162552 CDS product bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479452.1 protein_id gnl|my_center|LOCUS_13490 164914 164327 gene locus_tag LOCUS_13500 gene mobA 164914 164327 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453897.1 protein_id gnl|my_center|LOCUS_13500 165611 164892 gene locus_tag LOCUS_13510 165611 164892 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396189.1 protein_id gnl|my_center|LOCUS_13510 166353 165655 gene locus_tag LOCUS_13520 166353 165655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479424.1 protein_id gnl|my_center|LOCUS_13520 167178 166360 gene locus_tag LOCUS_13530 167178 166360 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479446.1 protein_id gnl|my_center|LOCUS_13530 167522 168973 gene locus_tag LOCUS_13540 167522 168973 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453875.1 protein_id gnl|my_center|LOCUS_13540 168963 171005 gene locus_tag LOCUS_13550 168963 171005 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479449.1 protein_id gnl|my_center|LOCUS_13550 172003 171098 gene locus_tag LOCUS_13560 172003 171098 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 protein_id gnl|my_center|LOCUS_13560 174351 172006 gene locus_tag LOCUS_13570 174351 172006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262113.1 protein_id gnl|my_center|LOCUS_13570 174422 174571 gene locus_tag LOCUS_13580 174422 174571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 174752 176344 gene locus_tag LOCUS_13590 174752 176344 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 protein_id gnl|my_center|LOCUS_13590 176537 177337 gene locus_tag LOCUS_13600 176537 177337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 177835 178197 gene locus_tag LOCUS_13610 177835 178197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13610 178170 178949 gene locus_tag LOCUS_13620 178170 178949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13620 180599 178992 gene locus_tag LOCUS_13630 180599 178992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 181811 180987 gene locus_tag LOCUS_13640 181811 180987 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453887.1 protein_id gnl|my_center|LOCUS_13640 182141 182593 gene locus_tag LOCUS_13650 182141 182593 CDS product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396177.1 protein_id gnl|my_center|LOCUS_13650 182583 183206 gene locus_tag LOCUS_13660 182583 183206 CDS product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479426.1 protein_id gnl|my_center|LOCUS_13660 183517 185178 gene locus_tag LOCUS_13670 183517 185178 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396174.1 protein_id gnl|my_center|LOCUS_13670 185188 185820 gene locus_tag LOCUS_13680 185188 185820 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453916.1 protein_id gnl|my_center|LOCUS_13680 185894 186094 gene locus_tag LOCUS_13690 185894 186094 CDS product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396171.1 protein_id gnl|my_center|LOCUS_13690 186105 188960 gene locus_tag LOCUS_13700 186105 188960 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 protein_id gnl|my_center|LOCUS_13700 188972 189580 gene locus_tag LOCUS_13710 gene fdh3B 188972 189580 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453840.1 protein_id gnl|my_center|LOCUS_13710 189594 190646 gene locus_tag LOCUS_13720 189594 190646 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453863.1 protein_id gnl|my_center|LOCUS_13720 190630 191046 gene locus_tag LOCUS_13730 190630 191046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479430.1 protein_id gnl|my_center|LOCUS_13730 191390 195784 gene locus_tag LOCUS_13740 191390 195784 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479434.1 protein_id gnl|my_center|LOCUS_13740 195774 196673 gene locus_tag LOCUS_13750 195774 196673 CDS product immunity 49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453885.1 protein_id gnl|my_center|LOCUS_13750 196785 197678 gene locus_tag LOCUS_13760 196785 197678 CDS product immunity 49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453885.1 protein_id gnl|my_center|LOCUS_13760 198047 197868 gene locus_tag LOCUS_13770 198047 197868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 198168 198899 gene locus_tag LOCUS_13780 gene cobB 198168 198899 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105862.1 protein_id gnl|my_center|LOCUS_13780 200117 199080 gene locus_tag LOCUS_13790 200117 199080 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484168.1 protein_id gnl|my_center|LOCUS_13790 201393 200362 gene locus_tag LOCUS_13800 201393 200362 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017448550.1 protein_id gnl|my_center|LOCUS_13800 202270 201500 gene locus_tag LOCUS_13810 gene potC 202270 201500 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389180.1 protein_id gnl|my_center|LOCUS_13810 203130 202270 gene locus_tag LOCUS_13820 gene potB 203130 202270 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457403.1 protein_id gnl|my_center|LOCUS_13820 204226 203111 gene locus_tag LOCUS_13830 gene potA 204226 203111 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495030.1 protein_id gnl|my_center|LOCUS_13830 204628 205425 gene locus_tag LOCUS_13840 204628 205425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457395.1 protein_id gnl|my_center|LOCUS_13840 205451 206254 gene locus_tag LOCUS_13850 205451 206254 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477606.1 protein_id gnl|my_center|LOCUS_13850 206272 206934 gene locus_tag LOCUS_13860 206272 206934 CDS product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495024.1 protein_id gnl|my_center|LOCUS_13860 207133 208026 gene locus_tag LOCUS_13870 gene ttcA 207133 208026 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477636.1 protein_id gnl|my_center|LOCUS_13870 208695 208153 gene locus_tag LOCUS_13880 208695 208153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13880 209099 208728 gene locus_tag LOCUS_13890 209099 208728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13890 210027 209281 gene locus_tag LOCUS_13900 210027 209281 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 protein_id gnl|my_center|LOCUS_13900 210795 210118 gene locus_tag LOCUS_13910 210795 210118 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477632.1 protein_id gnl|my_center|LOCUS_13910 210969 210805 gene locus_tag LOCUS_13920 gene ccoS 210969 210805 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457379.1 protein_id gnl|my_center|LOCUS_13920 213347 210984 gene locus_tag LOCUS_13930 213347 210984 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 protein_id gnl|my_center|LOCUS_13930 213828 213352 gene locus_tag LOCUS_13940 213828 213352 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457371.1 protein_id gnl|my_center|LOCUS_13940 214892 213918 gene locus_tag LOCUS_13950 gene ccoP 214892 213918 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 protein_id gnl|my_center|LOCUS_13950 215065 214892 gene locus_tag LOCUS_13960 215065 214892 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396487.1 protein_id gnl|my_center|LOCUS_13960 215697 215077 gene locus_tag LOCUS_13970 gene ccoO 215697 215077 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457377.1 protein_id gnl|my_center|LOCUS_13970 217137 215710 gene locus_tag LOCUS_13980 gene ccoN 217137 215710 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 protein_id gnl|my_center|LOCUS_13980 217394 217750 gene locus_tag LOCUS_13990 217394 217750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457383.1 protein_id gnl|my_center|LOCUS_13990 217864 219051 gene locus_tag LOCUS_14000 217864 219051 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457387.1 protein_id gnl|my_center|LOCUS_14000 219041 220756 gene locus_tag LOCUS_14010 219041 220756 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457375.1 protein_id gnl|my_center|LOCUS_14010 221211 221633 gene locus_tag LOCUS_14020 221211 221633 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477617.1 protein_id gnl|my_center|LOCUS_14020 222552 221662 gene locus_tag LOCUS_14030 222552 221662 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_14030 223341 222634 gene locus_tag LOCUS_14040 223341 222634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 223587 223429 gene locus_tag LOCUS_14050 223587 223429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 223787 223575 gene locus_tag LOCUS_14060 223787 223575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 224295 223888 gene locus_tag LOCUS_14070 224295 223888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479340.1 protein_id gnl|my_center|LOCUS_14070 224491 224288 gene locus_tag LOCUS_14080 224491 224288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 225035 224484 gene locus_tag LOCUS_14090 225035 224484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 225658 225032 gene locus_tag LOCUS_14100 225658 225032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 226458 225661 gene locus_tag LOCUS_14110 226458 225661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 226873 226448 gene locus_tag LOCUS_14120 226873 226448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 227076 226870 gene locus_tag LOCUS_14130 227076 226870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 227216 227076 gene locus_tag LOCUS_14140 227216 227076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 227585 227226 gene locus_tag LOCUS_14150 227585 227226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 228416 227595 gene locus_tag LOCUS_14160 228416 227595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 229317 228658 gene locus_tag LOCUS_14170 229317 228658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105875.1 protein_id gnl|my_center|LOCUS_14170 229738 229304 gene locus_tag LOCUS_14180 229738 229304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 230103 229738 gene locus_tag LOCUS_14190 230103 229738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 230297 230139 gene locus_tag LOCUS_14200 230297 230139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 231921 230308 gene locus_tag LOCUS_14210 231921 230308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 232157 231894 gene locus_tag LOCUS_14220 232157 231894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 232401 232207 gene locus_tag LOCUS_14230 232401 232207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 232726 232529 gene locus_tag LOCUS_14240 232726 232529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 233058 232726 gene locus_tag LOCUS_14250 233058 232726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 233255 233055 gene locus_tag LOCUS_14260 233255 233055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 233400 233663 gene locus_tag LOCUS_14270 233400 233663 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005390085.1 protein_id gnl|my_center|LOCUS_14270 234013 233660 gene locus_tag LOCUS_14280 234013 233660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 234004 234216 gene locus_tag LOCUS_14290 234004 234216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14290 236047 234830 gene locus_tag LOCUS_14300 236047 234830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 236935 236624 gene locus_tag LOCUS_14310 236935 236624 CDS product DUF3634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105880.1 protein_id gnl|my_center|LOCUS_14310 237395 236946 gene locus_tag LOCUS_14320 gene matP 237395 236946 CDS product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457449.1 protein_id gnl|my_center|LOCUS_14320 237609 239249 gene locus_tag LOCUS_14330 237609 239249 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457453.1 protein_id gnl|my_center|LOCUS_14330 239320 239838 gene locus_tag LOCUS_14340 gene fabA 239320 239838 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005390081.1 protein_id gnl|my_center|LOCUS_14340 240160 239987 gene locus_tag LOCUS_14350 gene rmf 240160 239987 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494976.1 protein_id gnl|my_center|LOCUS_14350 242024 240321 gene locus_tag LOCUS_14360 242024 240321 CDS product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481371.1 protein_id gnl|my_center|LOCUS_14360 244008 242089 gene locus_tag LOCUS_14370 244008 242089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 protein_id gnl|my_center|LOCUS_14370 244237 243986 gene locus_tag LOCUS_14380 244237 243986 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105882.1 protein_id gnl|my_center|LOCUS_14380 246379 244256 gene locus_tag LOCUS_14390 gene rlmKL 246379 244256 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481936.1 protein_id gnl|my_center|LOCUS_14390 247434 246892 gene locus_tag LOCUS_14400 247434 246892 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458262.1 protein_id gnl|my_center|LOCUS_14400 248610 247588 gene locus_tag LOCUS_14410 gene pyrD 248610 247588 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458264.1 protein_id gnl|my_center|LOCUS_14410 253757 248916 gene locus_tag LOCUS_14420 253757 248916 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458266.1 protein_id gnl|my_center|LOCUS_14420 256854 254242 gene locus_tag LOCUS_14430 gene pepN 256854 254242 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481930.1 protein_id gnl|my_center|LOCUS_14430 257782 257081 gene locus_tag LOCUS_14440 257782 257081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450937.1 protein_id gnl|my_center|LOCUS_14440 259950 257956 gene locus_tag LOCUS_14450 gene prc 259950 257956 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458272.1 protein_id gnl|my_center|LOCUS_14450 260594 259968 gene locus_tag LOCUS_14460 gene proQ 260594 259968 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458274.1 protein_id gnl|my_center|LOCUS_14460 261165 260692 gene locus_tag LOCUS_14470 261165 260692 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480795.1 protein_id gnl|my_center|LOCUS_14470 261607 263049 gene locus_tag LOCUS_14480 261607 263049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480797.1 protein_id gnl|my_center|LOCUS_14480 263996 263814 gene locus_tag LOCUS_14490 263996 263814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 264082 264312 gene locus_tag LOCUS_14500 264082 264312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 264309 266963 gene locus_tag LOCUS_14510 gene mam7 264309 266963 CDS product MCE family putative adhesion factor MAM7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457104.1 protein_id gnl|my_center|LOCUS_14510 267101 268537 gene locus_tag LOCUS_14520 gene rsmF 267101 268537 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457106.1 protein_id gnl|my_center|LOCUS_14520 269717 268833 gene locus_tag LOCUS_14530 269717 268833 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_14530 269884 271236 gene locus_tag LOCUS_14540 269884 271236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457111.1 protein_id gnl|my_center|LOCUS_14540 271752 271261 gene locus_tag LOCUS_14550 271752 271261 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457113.1 protein_id gnl|my_center|LOCUS_14550 272212 273264 gene locus_tag LOCUS_14560 272212 273264 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457114.1 protein_id gnl|my_center|LOCUS_14560 273297 273779 gene locus_tag LOCUS_14570 273297 273779 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 protein_id gnl|my_center|LOCUS_14570 274815 273895 gene locus_tag LOCUS_14580 274815 273895 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457118.1 protein_id gnl|my_center|LOCUS_14580 275278 276306 gene locus_tag LOCUS_14590 275278 276306 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457119.1 protein_id gnl|my_center|LOCUS_14590 276379 277584 gene locus_tag LOCUS_14600 276379 277584 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 protein_id gnl|my_center|LOCUS_14600 277586 278683 gene locus_tag LOCUS_14610 277586 278683 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 protein_id gnl|my_center|LOCUS_14610 278707 279456 gene locus_tag LOCUS_14620 278707 279456 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482000.1 protein_id gnl|my_center|LOCUS_14620 279835 280497 gene locus_tag LOCUS_14630 279835 280497 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 protein_id gnl|my_center|LOCUS_14630 280862 281191 gene locus_tag LOCUS_14640 280862 281191 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377396.1 protein_id gnl|my_center|LOCUS_14640 281496 281224 gene locus_tag LOCUS_14650 gene yccX 281496 281224 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486991.1 protein_id gnl|my_center|LOCUS_14650 281587 282990 gene locus_tag LOCUS_14660 281587 282990 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490568.1 protein_id gnl|my_center|LOCUS_14660 283185 284378 gene locus_tag LOCUS_14670 283185 284378 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477750.1 protein_id gnl|my_center|LOCUS_14670 288852 284428 gene locus_tag LOCUS_14680 288852 284428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 289240 290553 gene locus_tag LOCUS_14690 289240 290553 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105888.1 protein_id gnl|my_center|LOCUS_14690 290555 291172 gene locus_tag LOCUS_14700 290555 291172 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477806.1 protein_id gnl|my_center|LOCUS_14700 <296812 291241 gene locus_tag LOCUS_14710 <296812 291241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:retention module-containing protein >Feature sequence015 768 574 gene locus_tag LOCUS_14720 768 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455030.1 protein_id gnl|my_center|LOCUS_14720 848 1534 gene locus_tag LOCUS_14730 848 1534 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 protein_id gnl|my_center|LOCUS_14730 2602 1625 gene locus_tag LOCUS_14740 2602 1625 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444554.1 protein_id gnl|my_center|LOCUS_14740 2901 2614 gene locus_tag LOCUS_14750 2901 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3005 3883 gene locus_tag LOCUS_14760 3005 3883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703477.1 protein_id gnl|my_center|LOCUS_14760 4311 5654 gene locus_tag LOCUS_14770 4311 5654 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_14770 7397 6024 gene locus_tag LOCUS_14780 7397 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 7563 7832 gene locus_tag LOCUS_14790 7563 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8217 8615 gene locus_tag LOCUS_14800 8217 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 8605 8844 gene locus_tag LOCUS_14810 8605 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 11365 9491 gene locus_tag LOCUS_14820 11365 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15455 11358 gene locus_tag LOCUS_14830 15455 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 15991 16482 gene locus_tag LOCUS_14840 15991 16482 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454955.1 protein_id gnl|my_center|LOCUS_14840 16805 18544 gene locus_tag LOCUS_14850 16805 18544 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454912.1 protein_id gnl|my_center|LOCUS_14850 18547 20319 gene locus_tag LOCUS_14860 18547 20319 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480774.1 protein_id gnl|my_center|LOCUS_14860 20583 21131 gene locus_tag LOCUS_14870 20583 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454867.1 protein_id gnl|my_center|LOCUS_14870 23398 21176 gene locus_tag LOCUS_14880 23398 21176 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173315.1 protein_id gnl|my_center|LOCUS_14880 25591 23615 gene locus_tag LOCUS_14890 gene fhuB 25591 23615 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707923.1 protein_id gnl|my_center|LOCUS_14890 26367 25591 gene locus_tag LOCUS_14900 26367 25591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707922.1 protein_id gnl|my_center|LOCUS_14900 27252 26488 gene locus_tag LOCUS_14910 27252 26488 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307174.1 protein_id gnl|my_center|LOCUS_14910 27843 27628 gene locus_tag LOCUS_14920 27843 27628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455055.1 protein_id gnl|my_center|LOCUS_14920 28998 27943 gene locus_tag LOCUS_14930 28998 27943 CDS product c-di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454827.1 protein_id gnl|my_center|LOCUS_14930 30516 29326 gene locus_tag LOCUS_14940 30516 29326 CDS product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455065.1 protein_id gnl|my_center|LOCUS_14940 31898 30705 gene locus_tag LOCUS_14950 31898 30705 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_14950 32138 32578 gene locus_tag LOCUS_14960 32138 32578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 32644 34035 gene locus_tag LOCUS_14970 32644 34035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 34675 34046 gene locus_tag LOCUS_14980 34675 34046 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_14980 34890 36158 gene locus_tag LOCUS_14990 34890 36158 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480753.1 protein_id gnl|my_center|LOCUS_14990 36806 36204 gene locus_tag LOCUS_15000 36806 36204 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 protein_id gnl|my_center|LOCUS_15000 37742 36975 gene locus_tag LOCUS_15010 37742 36975 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480600.1 protein_id gnl|my_center|LOCUS_15010 38081 39037 gene locus_tag LOCUS_15020 38081 39037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490126.1 protein_id gnl|my_center|LOCUS_15020 39914 39057 gene locus_tag LOCUS_15030 39914 39057 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480734.1 protein_id gnl|my_center|LOCUS_15030 41504 39960 gene locus_tag LOCUS_15040 41504 39960 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480758.1 protein_id gnl|my_center|LOCUS_15040 42338 41712 gene locus_tag LOCUS_15050 42338 41712 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480654.1 protein_id gnl|my_center|LOCUS_15050 43877 42675 gene locus_tag LOCUS_15060 43877 42675 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480625.1 protein_id gnl|my_center|LOCUS_15060 44338 46047 gene locus_tag LOCUS_15070 gene scrG 44338 46047 CDS product regulatory protein ScrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105816.1 protein_id gnl|my_center|LOCUS_15070 46159 47478 gene locus_tag LOCUS_15080 46159 47478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 47993 47520 gene locus_tag LOCUS_15090 47993 47520 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454901.1 protein_id gnl|my_center|LOCUS_15090 49318 48065 gene locus_tag LOCUS_15100 49318 48065 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480639.1 protein_id gnl|my_center|LOCUS_15100 50740 49322 gene locus_tag LOCUS_15110 50740 49322 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480671.1 protein_id gnl|my_center|LOCUS_15110 52016 51051 gene locus_tag LOCUS_15120 52016 51051 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477785.1 protein_id gnl|my_center|LOCUS_15120 52653 53282 gene locus_tag LOCUS_15130 52653 53282 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572325.1 protein_id gnl|my_center|LOCUS_15130 53798 55225 gene locus_tag LOCUS_15140 53798 55225 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477788.1 protein_id gnl|my_center|LOCUS_15140 55651 55289 gene locus_tag LOCUS_15150 gene queD 55651 55289 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845978.1 protein_id gnl|my_center|LOCUS_15150 55951 57576 gene locus_tag LOCUS_15160 55951 57576 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483222.1 protein_id gnl|my_center|LOCUS_15160 57764 59164 gene locus_tag LOCUS_15170 gene asnS 57764 59164 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458036.1 protein_id gnl|my_center|LOCUS_15170 59686 59273 gene locus_tag LOCUS_15180 59686 59273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 59938 59717 gene locus_tag LOCUS_15190 59938 59717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458038.1 protein_id gnl|my_center|LOCUS_15190 61428 60037 gene locus_tag LOCUS_15200 61428 60037 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458040.1 protein_id gnl|my_center|LOCUS_15200 61606 61836 gene locus_tag LOCUS_15210 61606 61836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483298.1 protein_id gnl|my_center|LOCUS_15210 62059 62358 gene locus_tag LOCUS_15220 62059 62358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458048.1 protein_id gnl|my_center|LOCUS_15220 62585 64051 gene locus_tag LOCUS_15230 62585 64051 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053055794.1 protein_id gnl|my_center|LOCUS_15230 64233 65423 gene locus_tag LOCUS_15240 64233 65423 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 protein_id gnl|my_center|LOCUS_15240 66142 65501 gene locus_tag LOCUS_15250 66142 65501 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483235.1 protein_id gnl|my_center|LOCUS_15250 66360 68249 gene locus_tag LOCUS_15260 66360 68249 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_15260 68258 68812 gene locus_tag LOCUS_15270 68258 68812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15270 70933 69050 gene locus_tag LOCUS_15280 70933 69050 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458057.1 protein_id gnl|my_center|LOCUS_15280 72724 71153 gene locus_tag LOCUS_15290 72724 71153 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 protein_id gnl|my_center|LOCUS_15290 73141 73596 gene locus_tag LOCUS_15300 gene cosR 73141 73596 CDS product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_15300 74193 73648 gene locus_tag LOCUS_15310 74193 73648 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_15310 75633 74278 gene locus_tag LOCUS_15320 75633 74278 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458065.1 protein_id gnl|my_center|LOCUS_15320 77025 75739 gene locus_tag LOCUS_15330 77025 75739 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_15330 77577 77038 gene locus_tag LOCUS_15340 77577 77038 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_15340 78810 77716 gene locus_tag LOCUS_15350 78810 77716 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_15350 79613 79224 gene locus_tag LOCUS_15360 79613 79224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490722.1 protein_id gnl|my_center|LOCUS_15360 79883 80551 gene locus_tag LOCUS_15370 79883 80551 CDS product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457834.1 protein_id gnl|my_center|LOCUS_15370 81220 80564 gene locus_tag LOCUS_15380 81220 80564 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457830.1 protein_id gnl|my_center|LOCUS_15380 81899 81351 gene locus_tag LOCUS_15390 81899 81351 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457820.1 protein_id gnl|my_center|LOCUS_15390 83640 82072 gene locus_tag LOCUS_15400 83640 82072 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105986.1 protein_id gnl|my_center|LOCUS_15400 84850 83768 gene locus_tag LOCUS_15410 84850 83768 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105987.1 protein_id gnl|my_center|LOCUS_15410 85868 84831 gene locus_tag LOCUS_15420 85868 84831 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457822.1 protein_id gnl|my_center|LOCUS_15420 87261 85879 gene locus_tag LOCUS_15430 87261 85879 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457832.1 protein_id gnl|my_center|LOCUS_15430 88616 87354 gene locus_tag LOCUS_15440 88616 87354 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457828.1 protein_id gnl|my_center|LOCUS_15440 89440 88793 gene locus_tag LOCUS_15450 gene ribA 89440 88793 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490705.1 protein_id gnl|my_center|LOCUS_15450 90473 90042 gene locus_tag LOCUS_15460 90473 90042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 90966 90436 gene locus_tag LOCUS_15470 90966 90436 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457824.1 protein_id gnl|my_center|LOCUS_15470 91159 90947 gene locus_tag LOCUS_15480 91159 90947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 92852 92073 gene locus_tag LOCUS_15490 92852 92073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15490 93131 92862 gene locus_tag LOCUS_15500 93131 92862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15500 93832 93125 gene locus_tag LOCUS_15510 93832 93125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15510 94515 93829 gene locus_tag LOCUS_15520 gene nrfC 94515 93829 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466518.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence016 638 288 gene locus_tag LOCUS_15530 638 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1117 818 gene locus_tag LOCUS_15540 1117 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1774 1265 gene locus_tag LOCUS_15550 1774 1265 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483274.1 protein_id gnl|my_center|LOCUS_15550 2562 1909 gene locus_tag LOCUS_15560 2562 1909 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_15560 3171 3392 gene locus_tag LOCUS_15570 3171 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3636 3394 gene locus_tag LOCUS_15580 3636 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15580 4159 3836 gene locus_tag LOCUS_15590 4159 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5035 4295 gene locus_tag LOCUS_15600 5035 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6149 5199 gene locus_tag LOCUS_15610 6149 5199 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 protein_id gnl|my_center|LOCUS_15610 6826 6155 gene locus_tag LOCUS_15620 6826 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7275 6988 gene locus_tag LOCUS_15630 7275 6988 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869995.1 protein_id gnl|my_center|LOCUS_15630 7553 7272 gene locus_tag LOCUS_15640 7553 7272 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_15640 8392 7751 gene locus_tag LOCUS_15650 8392 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 8899 8687 gene locus_tag LOCUS_15660 8899 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9430 9146 gene locus_tag LOCUS_15670 9430 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10113 9604 gene locus_tag LOCUS_15680 10113 9604 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483274.1 protein_id gnl|my_center|LOCUS_15680 10562 10248 gene locus_tag LOCUS_15690 10562 10248 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_15690 10881 10549 gene locus_tag LOCUS_15700 10881 10549 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_15700 12501 11062 gene locus_tag LOCUS_15710 12501 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 13169 12654 gene locus_tag LOCUS_15720 13169 12654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261925.1 protein_id gnl|my_center|LOCUS_15720 13946 13314 gene locus_tag LOCUS_15730 13946 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 14568 14086 gene locus_tag LOCUS_15740 14568 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 15201 14716 gene locus_tag LOCUS_15750 15201 14716 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267607.1 protein_id gnl|my_center|LOCUS_15750 16110 15316 gene locus_tag LOCUS_15760 16110 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 16546 16280 gene locus_tag LOCUS_15770 16546 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937852.1 protein_id gnl|my_center|LOCUS_15770 17100 16777 gene locus_tag LOCUS_15780 17100 16777 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963786.1 protein_id gnl|my_center|LOCUS_15780 18008 17217 gene locus_tag LOCUS_15790 18008 17217 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921712.1 protein_id gnl|my_center|LOCUS_15790 18476 18117 gene locus_tag LOCUS_15800 18476 18117 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_15800 18837 18517 gene locus_tag LOCUS_15810 18837 18517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 19517 18981 gene locus_tag LOCUS_15820 19517 18981 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451042.1 protein_id gnl|my_center|LOCUS_15820 20138 19668 gene locus_tag LOCUS_15830 20138 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 20780 20319 gene locus_tag LOCUS_15840 20780 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 22056 21553 gene locus_tag LOCUS_15850 gene def 22056 21553 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395192.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence017 900 298 gene locus_tag LOCUS_15860 900 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15860 1628 891 gene locus_tag LOCUS_15870 1628 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 2933 1644 gene locus_tag LOCUS_15880 gene dsdX 2933 1644 CDS product D-serine transporter DsdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032644228.1 protein_id gnl|my_center|LOCUS_15880 3316 4134 gene locus_tag LOCUS_15890 gene dsdC 3316 4134 CDS product DNA-binding transcriptional regulator DsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288116.1 protein_id gnl|my_center|LOCUS_15890 6188 4254 gene locus_tag LOCUS_15900 6188 4254 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263777.1 protein_id gnl|my_center|LOCUS_15900 7357 6188 gene locus_tag LOCUS_15910 7357 6188 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469785.1 protein_id gnl|my_center|LOCUS_15910 8625 7522 gene locus_tag LOCUS_15920 gene serC 8625 7522 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456169.1 protein_id gnl|my_center|LOCUS_15920 10010 8748 gene locus_tag LOCUS_15930 10010 8748 CDS product DUF945 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483545.1 protein_id gnl|my_center|LOCUS_15930 10197 12140 gene locus_tag LOCUS_15940 10197 12140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489098.1 protein_id gnl|my_center|LOCUS_15940 12133 12630 gene locus_tag LOCUS_15950 12133 12630 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483573.1 protein_id gnl|my_center|LOCUS_15950 12832 13386 gene locus_tag LOCUS_15960 12832 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459590.1 protein_id gnl|my_center|LOCUS_15960 14121 13540 gene locus_tag LOCUS_15970 14121 13540 CDS product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459593.1 protein_id gnl|my_center|LOCUS_15970 14491 15411 gene locus_tag LOCUS_15980 14491 15411 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483559.1 protein_id gnl|my_center|LOCUS_15980 15476 16381 gene locus_tag LOCUS_15990 15476 16381 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105795.1 protein_id gnl|my_center|LOCUS_15990 16537 17049 gene locus_tag LOCUS_16000 16537 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483562.1 protein_id gnl|my_center|LOCUS_16000 17169 18815 gene locus_tag LOCUS_16010 gene panP 17169 18815 CDS product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483514.1 protein_id gnl|my_center|LOCUS_16010 19126 19980 gene locus_tag LOCUS_16020 19126 19980 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483567.1 protein_id gnl|my_center|LOCUS_16020 21276 20038 gene locus_tag LOCUS_16030 21276 20038 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483569.1 protein_id gnl|my_center|LOCUS_16030 21638 21904 gene locus_tag LOCUS_16040 21638 21904 CDS product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459605.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence018 16 759 gene locus_tag LOCUS_16050 16 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 939 2621 gene locus_tag LOCUS_16060 939 2621 CDS product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483552.1 protein_id gnl|my_center|LOCUS_16060 3933 2731 gene locus_tag LOCUS_16070 3933 2731 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462412.1 protein_id gnl|my_center|LOCUS_16070 6399 4114 gene locus_tag LOCUS_16080 6399 4114 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462399.1 protein_id gnl|my_center|LOCUS_16080 7095 6469 gene locus_tag LOCUS_16090 7095 6469 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462382.1 protein_id gnl|my_center|LOCUS_16090 8860 7688 gene locus_tag LOCUS_16100 gene nhaA 8860 7688 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462393.1 protein_id gnl|my_center|LOCUS_16100 10314 9190 gene locus_tag LOCUS_16110 10314 9190 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462391.1 protein_id gnl|my_center|LOCUS_16110 10847 10314 gene locus_tag LOCUS_16120 10847 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16120 12768 10936 gene locus_tag LOCUS_16130 12768 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16130 13420 12749 gene locus_tag LOCUS_16140 13420 12749 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462397.1 protein_id gnl|my_center|LOCUS_16140 14929 13553 gene locus_tag LOCUS_16150 14929 13553 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483564.1 protein_id gnl|my_center|LOCUS_16150 15024 16469 gene locus_tag LOCUS_16160 15024 16469 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483524.1 protein_id gnl|my_center|LOCUS_16160 16677 18578 gene locus_tag LOCUS_16170 16677 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 19343 18681 gene locus_tag LOCUS_16180 19343 18681 CDS product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462414.1 protein_id gnl|my_center|LOCUS_16180 20545 19343 gene locus_tag LOCUS_16190 20545 19343 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462380.1 protein_id gnl|my_center|LOCUS_16190 21714 21013 gene locus_tag LOCUS_16200 gene rsuA 21714 21013 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462415.1 protein_id gnl|my_center|LOCUS_16200 21789 23540 gene locus_tag LOCUS_16210 21789 23540 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 protein_id gnl|my_center|LOCUS_16210 23618 24046 gene locus_tag LOCUS_16220 23618 24046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462404.1 protein_id gnl|my_center|LOCUS_16220 24078 24737 gene locus_tag LOCUS_16230 24078 24737 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478918.1 protein_id gnl|my_center|LOCUS_16230 24820 26076 gene locus_tag LOCUS_16240 24820 26076 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478930.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence019 <1 818 gene locus_tag LOCUS_16250 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071337.1:IS4-like element ISSod7 family transposase 2208 913 gene locus_tag LOCUS_16260 2208 913 CDS product LssY C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261992.1 protein_id gnl|my_center|LOCUS_16260 2958 2224 gene locus_tag LOCUS_16270 2958 2224 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261993.1 protein_id gnl|my_center|LOCUS_16270 3365 3643 gene locus_tag LOCUS_16280 gene rplY 3365 3643 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378066.1 protein_id gnl|my_center|LOCUS_16280 4392 3862 gene locus_tag LOCUS_16290 4392 3862 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462440.1 protein_id gnl|my_center|LOCUS_16290 5096 4392 gene locus_tag LOCUS_16300 5096 4392 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478928.1 protein_id gnl|my_center|LOCUS_16300 5446 7161 gene locus_tag LOCUS_16310 gene ushA 5446 7161 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478924.1 protein_id gnl|my_center|LOCUS_16310 7601 7822 gene locus_tag LOCUS_16320 7601 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462330.1 protein_id gnl|my_center|LOCUS_16320 8195 7947 gene locus_tag LOCUS_16330 8195 7947 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105788.1 protein_id gnl|my_center|LOCUS_16330 8416 8862 gene locus_tag LOCUS_16340 8416 8862 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462359.1 protein_id gnl|my_center|LOCUS_16340 10431 8941 gene locus_tag LOCUS_16350 10431 8941 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_16350 11455 10787 gene locus_tag LOCUS_16360 11455 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 12469 11873 gene locus_tag LOCUS_16370 12469 11873 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462333.1 protein_id gnl|my_center|LOCUS_16370 14264 12459 gene locus_tag LOCUS_16380 14264 12459 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105787.1 protein_id gnl|my_center|LOCUS_16380 14584 15567 gene locus_tag LOCUS_16390 14584 15567 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462348.1 protein_id gnl|my_center|LOCUS_16390 15588 17384 gene locus_tag LOCUS_16400 15588 17384 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462308.1 protein_id gnl|my_center|LOCUS_16400 17381 18151 gene locus_tag LOCUS_16410 17381 18151 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478886.1 protein_id gnl|my_center|LOCUS_16410 18221 18898 gene locus_tag LOCUS_16420 18221 18898 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462335.1 protein_id gnl|my_center|LOCUS_16420 19235 20392 gene locus_tag LOCUS_16430 19235 20392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462369.1 protein_id gnl|my_center|LOCUS_16430 20402 22111 gene locus_tag LOCUS_16440 20402 22111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 protein_id gnl|my_center|LOCUS_16440 22077 22724 gene locus_tag LOCUS_16450 22077 22724 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462377.1 protein_id gnl|my_center|LOCUS_16450 22717 23325 gene locus_tag LOCUS_16460 22717 23325 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 protein_id gnl|my_center|LOCUS_16460 23548 23396 gene locus_tag LOCUS_16470 23548 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 24167 25348 gene locus_tag LOCUS_16480 gene norR 24167 25348 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486909.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 25759 27420 gene locus_tag LOCUS_16490 gene hcp 25759 27420 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462358.1 protein_id gnl|my_center|LOCUS_16490 27497 28540 gene locus_tag LOCUS_16500 27497 28540 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462345.1 protein_id gnl|my_center|LOCUS_16500 29565 28633 gene locus_tag LOCUS_16510 29565 28633 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 protein_id gnl|my_center|LOCUS_16510 30289 29597 gene locus_tag LOCUS_16520 30289 29597 CDS product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462361.1 protein_id gnl|my_center|LOCUS_16520 31952 30339 gene locus_tag LOCUS_16530 31952 30339 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462336.1 protein_id gnl|my_center|LOCUS_16530 33634 32204 gene locus_tag LOCUS_16540 33634 32204 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 protein_id gnl|my_center|LOCUS_16540 34005 35462 gene locus_tag LOCUS_16550 gene cls 34005 35462 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 protein_id gnl|my_center|LOCUS_16550 35653 36858 gene locus_tag LOCUS_16560 35653 36858 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478937.1 protein_id gnl|my_center|LOCUS_16560 37467 36904 gene locus_tag LOCUS_16570 37467 36904 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478903.1 protein_id gnl|my_center|LOCUS_16570 40641 37537 gene locus_tag LOCUS_16580 gene vmeI 40641 37537 CDS product efflux RND transporter permease subunit VmeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_16580 41723 40638 gene locus_tag LOCUS_16590 gene vmeH 41723 40638 CDS product efflux RND transporter periplasmic adaptor subunit VmeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478901.1 protein_id gnl|my_center|LOCUS_16590 42567 41725 gene locus_tag LOCUS_16600 gene vmeG 42567 41725 CDS product efflux RND transporter periplasmic adaptor subunit VmeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462329.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16600 43300 42911 gene locus_tag LOCUS_16610 gene pspC 43300 42911 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 protein_id gnl|my_center|LOCUS_16610 43526 43293 gene locus_tag LOCUS_16620 gene pspB 43526 43293 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462365.1 protein_id gnl|my_center|LOCUS_16620 44212 43541 gene locus_tag LOCUS_16630 gene pspA 44212 43541 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462360.1 protein_id gnl|my_center|LOCUS_16630 44447 45457 gene locus_tag LOCUS_16640 gene pspF 44447 45457 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462315.1 protein_id gnl|my_center|LOCUS_16640 45722 47341 gene locus_tag LOCUS_16650 gene sapA 45722 47341 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462340.1 protein_id gnl|my_center|LOCUS_16650 47341 48303 gene locus_tag LOCUS_16660 47341 48303 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478933.1 protein_id gnl|my_center|LOCUS_16660 48290 49177 gene locus_tag LOCUS_16670 48290 49177 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462338.1 protein_id gnl|my_center|LOCUS_16670 49177 50172 gene locus_tag LOCUS_16680 49177 50172 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462378.1 protein_id gnl|my_center|LOCUS_16680 50169 50951 gene locus_tag LOCUS_16690 50169 50951 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462331.1 protein_id gnl|my_center|LOCUS_16690 51463 51074 gene locus_tag LOCUS_16700 51463 51074 CDS product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478908.1 protein_id gnl|my_center|LOCUS_16700 52443 51538 gene locus_tag LOCUS_16710 52443 51538 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462364.1 protein_id gnl|my_center|LOCUS_16710 52650 53864 gene locus_tag LOCUS_16720 52650 53864 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478915.1 protein_id gnl|my_center|LOCUS_16720 55672 53933 gene locus_tag LOCUS_16730 55672 53933 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478875.1 protein_id gnl|my_center|LOCUS_16730 58334 55872 gene locus_tag LOCUS_16740 gene torA 58334 55872 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462326.1 protein_id gnl|my_center|LOCUS_16740 59544 58360 gene locus_tag LOCUS_16750 gene torC 59544 58360 CDS product pentaheme c-type cytochrome TorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462368.1 protein_id gnl|my_center|LOCUS_16750 59774 59595 gene locus_tag LOCUS_16760 gene torE 59774 59595 CDS product trimethylamine N-oxide reductase system protein TorE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450728.1 protein_id gnl|my_center|LOCUS_16760 60238 61038 gene locus_tag LOCUS_16770 60238 61038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478879.1 protein_id gnl|my_center|LOCUS_16770 61290 61427 gene locus_tag LOCUS_16780 61290 61427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478877.1 protein_id gnl|my_center|LOCUS_16780 62350 61490 gene locus_tag LOCUS_16790 gene focA 62350 61490 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462425.1 protein_id gnl|my_center|LOCUS_16790 62650 62886 gene locus_tag LOCUS_16800 62650 62886 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462432.1 protein_id gnl|my_center|LOCUS_16800 63386 62964 gene locus_tag LOCUS_16810 63386 62964 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462438.1 protein_id gnl|my_center|LOCUS_16810 63476 64351 gene locus_tag LOCUS_16820 63476 64351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462429.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence020 1008 2354 gene locus_tag LOCUS_16830 gene nrfA 1008 2354 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483164.1 protein_id gnl|my_center|LOCUS_16830 3023 2469 gene locus_tag LOCUS_16840 3023 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457839.1 protein_id gnl|my_center|LOCUS_16840 3499 3065 gene locus_tag LOCUS_16850 3499 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6449 3810 gene locus_tag LOCUS_16860 gene gyrA 6449 3810 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457842.1 protein_id gnl|my_center|LOCUS_16860 6759 7466 gene locus_tag LOCUS_16870 6759 7466 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483291.1 protein_id gnl|my_center|LOCUS_16870 7969 10251 gene locus_tag LOCUS_16880 gene nrdA 7969 10251 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457837.1 protein_id gnl|my_center|LOCUS_16880 10332 11465 gene locus_tag LOCUS_16890 gene nrdB 10332 11465 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457864.1 protein_id gnl|my_center|LOCUS_16890 11465 11743 gene locus_tag LOCUS_16900 gene yfaE 11465 11743 CDS product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483309.1 protein_id gnl|my_center|LOCUS_16900 12008 11832 gene locus_tag LOCUS_16910 12008 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16910 13066 11954 gene locus_tag LOCUS_16920 13066 11954 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457838.1 protein_id gnl|my_center|LOCUS_16920 13251 14168 gene locus_tag LOCUS_16930 13251 14168 CDS product DUF3943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450944.1 protein_id gnl|my_center|LOCUS_16930 14409 14921 gene locus_tag LOCUS_16940 14409 14921 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483182.1 protein_id gnl|my_center|LOCUS_16940 16149 14995 gene locus_tag LOCUS_16950 gene nspC 16149 14995 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483192.1 protein_id gnl|my_center|LOCUS_16950 17618 16365 gene locus_tag LOCUS_16960 17618 16365 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483247.1 protein_id gnl|my_center|LOCUS_16960 20528 17637 gene locus_tag LOCUS_16970 20528 17637 CDS product pyridoxal phosphate-dependent class III aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490729.1 protein_id gnl|my_center|LOCUS_16970 21291 21216 gene locus_tag LOCUS_t00440 21291 21216 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21389 21303 gene locus_tag LOCUS_t00450 21389 21303 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21543 21468 gene locus_tag LOCUS_t00460 21543 21468 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21654 21581 gene locus_tag LOCUS_t00470 21654 21581 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22613 22056 gene locus_tag LOCUS_16980 gene pgsA 22613 22056 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494716.1 protein_id gnl|my_center|LOCUS_16980 24426 22660 gene locus_tag LOCUS_16990 gene uvrC 24426 22660 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105992.1 protein_id gnl|my_center|LOCUS_16990 25138 24494 gene locus_tag LOCUS_17000 gene uvrY 25138 24494 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 protein_id gnl|my_center|LOCUS_17000 25653 26135 gene locus_tag LOCUS_17010 25653 26135 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_17010 26204 28057 gene locus_tag LOCUS_17020 26204 28057 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_17020 28133 30496 gene locus_tag LOCUS_17030 28133 30496 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 protein_id gnl|my_center|LOCUS_17030 31219 30524 gene locus_tag LOCUS_17040 31219 30524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488521.1 protein_id gnl|my_center|LOCUS_17040 31511 32077 gene locus_tag LOCUS_17050 gene yeiP 31511 32077 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465079.1 protein_id gnl|my_center|LOCUS_17050 32080 32400 gene locus_tag LOCUS_17060 32080 32400 CDS product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465080.1 protein_id gnl|my_center|LOCUS_17060 33485 32547 gene locus_tag LOCUS_17070 gene rluB 33485 32547 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465081.1 protein_id gnl|my_center|LOCUS_17070 33837 34562 gene locus_tag LOCUS_17080 33837 34562 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481620.1 protein_id gnl|my_center|LOCUS_17080 35250 34630 gene locus_tag LOCUS_17090 35250 34630 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 protein_id gnl|my_center|LOCUS_17090 36168 35290 gene locus_tag LOCUS_17100 36168 35290 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465084.1 protein_id gnl|my_center|LOCUS_17100 36565 38130 gene locus_tag LOCUS_17110 36565 38130 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948595.1 protein_id gnl|my_center|LOCUS_17110 38147 38728 gene locus_tag LOCUS_17120 38147 38728 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 protein_id gnl|my_center|LOCUS_17120 38793 39803 gene locus_tag LOCUS_17130 gene trpD 38793 39803 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465092.1 protein_id gnl|my_center|LOCUS_17130 39817 41256 gene locus_tag LOCUS_17140 gene trpCF 39817 41256 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488526.1 protein_id gnl|my_center|LOCUS_17140 41321 42511 gene locus_tag LOCUS_17150 gene trpB 41321 42511 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481609.1 protein_id gnl|my_center|LOCUS_17150 42511 43317 gene locus_tag LOCUS_17160 gene trpA 42511 43317 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481690.1 protein_id gnl|my_center|LOCUS_17160 43655 44914 gene locus_tag LOCUS_17170 43655 44914 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481619.1 protein_id gnl|my_center|LOCUS_17170 46390 48945 gene locus_tag LOCUS_17180 46390 48945 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489189.1 protein_id gnl|my_center|LOCUS_17180 49036 49278 gene locus_tag LOCUS_17190 49036 49278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481662.1 protein_id gnl|my_center|LOCUS_17190 49399 49962 gene locus_tag LOCUS_17200 49399 49962 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481614.1 protein_id gnl|my_center|LOCUS_17200 50073 50468 gene locus_tag LOCUS_17210 gene yciA 50073 50468 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459205.1 protein_id gnl|my_center|LOCUS_17210 50581 50877 gene locus_tag LOCUS_17220 50581 50877 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 protein_id gnl|my_center|LOCUS_17220 50881 51282 gene locus_tag LOCUS_17230 50881 51282 CDS product GspS/AspS pilotin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459209.1 protein_id gnl|my_center|LOCUS_17230 53660 51378 gene locus_tag LOCUS_17240 gene metE 53660 51378 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481651.1 protein_id gnl|my_center|LOCUS_17240 53925 54836 gene locus_tag LOCUS_17250 gene metR 53925 54836 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481610.1 protein_id gnl|my_center|LOCUS_17250 55059 54859 gene locus_tag LOCUS_17260 55059 54859 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457961.1 protein_id gnl|my_center|LOCUS_17260 55954 55244 gene locus_tag LOCUS_17270 55954 55244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457936.1 protein_id gnl|my_center|LOCUS_17270 58230 56026 gene locus_tag LOCUS_17280 58230 56026 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457928.1 protein_id gnl|my_center|LOCUS_17280 58767 61130 gene locus_tag LOCUS_17290 58767 61130 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481673.1 protein_id gnl|my_center|LOCUS_17290 62537 61215 gene locus_tag LOCUS_17300 62537 61215 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 protein_id gnl|my_center|LOCUS_17300 64020 62614 gene locus_tag LOCUS_17310 64020 62614 CDS product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707739.1 protein_id gnl|my_center|LOCUS_17310 64444 64061 gene locus_tag LOCUS_17320 64444 64061 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_17320 65137 64469 gene locus_tag LOCUS_17330 65137 64469 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140991.1 protein_id gnl|my_center|LOCUS_17330 66121 65735 gene locus_tag LOCUS_17340 66121 65735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 67532 66114 gene locus_tag LOCUS_17350 67532 66114 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 protein_id gnl|my_center|LOCUS_17350 68575 67535 gene locus_tag LOCUS_17360 68575 67535 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705135.1 protein_id gnl|my_center|LOCUS_17360 68729 69406 gene locus_tag LOCUS_17370 68729 69406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457963.1 protein_id gnl|my_center|LOCUS_17370 69403 70680 gene locus_tag LOCUS_17380 69403 70680 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457946.1 protein_id gnl|my_center|LOCUS_17380 71973 70819 gene locus_tag LOCUS_17390 71973 70819 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457913.1 protein_id gnl|my_center|LOCUS_17390 72196 71981 gene locus_tag LOCUS_17400 72196 71981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 72313 73209 gene locus_tag LOCUS_17410 72313 73209 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 protein_id gnl|my_center|LOCUS_17410 73771 73229 gene locus_tag LOCUS_17420 73771 73229 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_17420 74755 73895 gene locus_tag LOCUS_17430 74755 73895 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376746.1 protein_id gnl|my_center|LOCUS_17430 74870 75934 gene locus_tag LOCUS_17440 74870 75934 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457950.1 protein_id gnl|my_center|LOCUS_17440 75944 76960 gene locus_tag LOCUS_17450 75944 76960 CDS product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457934.1 protein_id gnl|my_center|LOCUS_17450 77485 78459 gene locus_tag LOCUS_17460 77485 78459 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210043.1 protein_id gnl|my_center|LOCUS_17460 78522 80015 gene locus_tag LOCUS_17470 78522 80015 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210044.1 protein_id gnl|my_center|LOCUS_17470 80008 81006 gene locus_tag LOCUS_17480 80008 81006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210045.1 protein_id gnl|my_center|LOCUS_17480 81010 81804 gene locus_tag LOCUS_17490 81010 81804 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210046.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17490 81982 83616 gene locus_tag LOCUS_17500 81982 83616 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210047.1 protein_id gnl|my_center|LOCUS_17500 84041 83694 gene locus_tag LOCUS_17510 84041 83694 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875287.1 protein_id gnl|my_center|LOCUS_17510 84511 84095 gene locus_tag LOCUS_17520 84511 84095 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451209.1 protein_id gnl|my_center|LOCUS_17520 85161 84808 gene locus_tag LOCUS_17530 85161 84808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 86931 85897 gene locus_tag LOCUS_17540 86931 85897 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_17540 87930 86956 gene locus_tag LOCUS_17550 87930 86956 CDS product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_17550 88963 88553 gene locus_tag LOCUS_17560 88963 88553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 89555 88977 gene locus_tag LOCUS_17570 89555 88977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 89931 90731 gene locus_tag LOCUS_17580 89931 90731 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455215.1 protein_id gnl|my_center|LOCUS_17580 90739 91674 gene locus_tag LOCUS_17590 90739 91674 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455215.1 protein_id gnl|my_center|LOCUS_17590 91804 92757 gene locus_tag LOCUS_17600 91804 92757 CDS product DUF2860 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461468.1 protein_id gnl|my_center|LOCUS_17600 93039 93653 gene locus_tag LOCUS_17610 93039 93653 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478451.1 protein_id gnl|my_center|LOCUS_17610 95027 93846 gene locus_tag LOCUS_17620 gene malE 95027 93846 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463104.1 protein_id gnl|my_center|LOCUS_17620 96290 95043 gene locus_tag LOCUS_17630 96290 95043 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_17630 97327 96320 gene locus_tag LOCUS_17640 97327 96320 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311136.1 protein_id gnl|my_center|LOCUS_17640 98334 97612 gene locus_tag LOCUS_17650 98334 97612 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_17650 99610 98327 gene locus_tag LOCUS_17660 99610 98327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481616.1 protein_id gnl|my_center|LOCUS_17660 100827 99613 gene locus_tag LOCUS_17670 100827 99613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 protein_id gnl|my_center|LOCUS_17670 102095 100824 gene locus_tag LOCUS_17680 102095 100824 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481611.1 protein_id gnl|my_center|LOCUS_17680 103224 102088 gene locus_tag LOCUS_17690 103224 102088 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376722.1 protein_id gnl|my_center|LOCUS_17690 104521 103673 gene locus_tag LOCUS_17700 104521 103673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_17700 105209 104796 gene locus_tag LOCUS_17710 105209 104796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 105739 105206 gene locus_tag LOCUS_17720 105739 105206 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481644.1 protein_id gnl|my_center|LOCUS_17720 106170 105736 gene locus_tag LOCUS_17730 106170 105736 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481688.1 protein_id gnl|my_center|LOCUS_17730 106994 106188 gene locus_tag LOCUS_17740 106994 106188 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481649.1 protein_id gnl|my_center|LOCUS_17740 107569 107057 gene locus_tag LOCUS_17750 107569 107057 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481652.1 protein_id gnl|my_center|LOCUS_17750 109677 107566 gene locus_tag LOCUS_17760 109677 107566 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481629.1 protein_id gnl|my_center|LOCUS_17760 110278 111183 gene locus_tag LOCUS_17770 110278 111183 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481663.1 protein_id gnl|my_center|LOCUS_17770 114411 111250 gene locus_tag LOCUS_17780 114411 111250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 114700 114563 gene locus_tag LOCUS_17790 114700 114563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 114841 116172 gene locus_tag LOCUS_17800 114841 116172 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 protein_id gnl|my_center|LOCUS_17800 116165 117811 gene locus_tag LOCUS_17810 gene pqiB 116165 117811 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457973.1 protein_id gnl|my_center|LOCUS_17810 117811 118380 gene locus_tag LOCUS_17820 117811 118380 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457982.1 protein_id gnl|my_center|LOCUS_17820 120071 118443 gene locus_tag LOCUS_17830 120071 118443 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262512.1 protein_id gnl|my_center|LOCUS_17830 120487 120816 gene locus_tag LOCUS_17840 120487 120816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 122505 120865 gene locus_tag LOCUS_17850 122505 120865 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081091997.1 protein_id gnl|my_center|LOCUS_17850 123915 122893 gene locus_tag LOCUS_17860 gene trpS 123915 122893 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477948.1 protein_id gnl|my_center|LOCUS_17860 124679 124275 gene locus_tag LOCUS_17870 124679 124275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 124909 127089 gene locus_tag LOCUS_17880 gene katG 124909 127089 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_17880 127521 128477 gene locus_tag LOCUS_17890 127521 128477 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451195.1 protein_id gnl|my_center|LOCUS_17890 129336 128635 gene locus_tag LOCUS_17900 129336 128635 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_17900 130751 129360 gene locus_tag LOCUS_17910 130751 129360 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966488.1 protein_id gnl|my_center|LOCUS_17910 132132 130885 gene locus_tag LOCUS_17920 132132 130885 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_17920 132421 133167 gene locus_tag LOCUS_17930 132421 133167 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 protein_id gnl|my_center|LOCUS_17930 133648 133196 gene locus_tag LOCUS_17940 133648 133196 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477958.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence021 346 669 gene locus_tag LOCUS_17950 346 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17950 666 1304 gene locus_tag LOCUS_17960 666 1304 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478872.1 protein_id gnl|my_center|LOCUS_17960 1861 1373 gene locus_tag LOCUS_17970 1861 1373 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450744.1 protein_id gnl|my_center|LOCUS_17970 3581 2199 gene locus_tag LOCUS_17980 gene cysS 3581 2199 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 protein_id gnl|my_center|LOCUS_17980 3786 4280 gene locus_tag LOCUS_17990 3786 4280 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478939.1 protein_id gnl|my_center|LOCUS_17990 4341 5069 gene locus_tag LOCUS_18000 gene lpxH 4341 5069 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489008.1 protein_id gnl|my_center|LOCUS_18000 5179 6393 gene locus_tag LOCUS_18010 5179 6393 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459985.1 protein_id gnl|my_center|LOCUS_18010 6477 6980 gene locus_tag LOCUS_18020 6477 6980 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459984.1 protein_id gnl|my_center|LOCUS_18020 7897 7262 gene locus_tag LOCUS_18030 gene hisIE 7897 7262 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 protein_id gnl|my_center|LOCUS_18030 8667 7894 gene locus_tag LOCUS_18040 gene hisF 8667 7894 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459998.1 protein_id gnl|my_center|LOCUS_18040 9386 8649 gene locus_tag LOCUS_18050 gene hisA 9386 8649 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460044.1 protein_id gnl|my_center|LOCUS_18050 10013 9399 gene locus_tag LOCUS_18060 gene hisH 10013 9399 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 protein_id gnl|my_center|LOCUS_18060 11113 10040 gene locus_tag LOCUS_18070 gene hisB 11113 10040 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 protein_id gnl|my_center|LOCUS_18070 12223 11183 gene locus_tag LOCUS_18080 gene hisC 12223 11183 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480420.1 protein_id gnl|my_center|LOCUS_18080 13546 12236 gene locus_tag LOCUS_18090 gene hisD 13546 12236 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480396.1 protein_id gnl|my_center|LOCUS_18090 14448 13552 gene locus_tag LOCUS_18100 gene hisG 14448 13552 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480403.1 protein_id gnl|my_center|LOCUS_18100 14903 15946 gene locus_tag LOCUS_18110 14903 15946 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480409.1 protein_id gnl|my_center|LOCUS_18110 17839 16238 gene locus_tag LOCUS_18120 gene tet(35) 17839 16238 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_18120 18733 19146 gene locus_tag LOCUS_18130 18733 19146 CDS product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 protein_id gnl|my_center|LOCUS_18130 20596 19292 gene locus_tag LOCUS_18140 20596 19292 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459989.1 protein_id gnl|my_center|LOCUS_18140 20982 20713 gene locus_tag LOCUS_18150 20982 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459999.1 protein_id gnl|my_center|LOCUS_18150 21171 22295 gene locus_tag LOCUS_18160 gene mnmA 21171 22295 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459992.1 protein_id gnl|my_center|LOCUS_18160 22306 22923 gene locus_tag LOCUS_18170 gene hflD 22306 22923 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459996.1 protein_id gnl|my_center|LOCUS_18170 23077 24447 gene locus_tag LOCUS_18180 gene purB 23077 24447 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 protein_id gnl|my_center|LOCUS_18180 25247 24711 gene locus_tag LOCUS_18190 25247 24711 CDS product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460054.1 protein_id gnl|my_center|LOCUS_18190 25792 25247 gene locus_tag LOCUS_18200 25792 25247 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459994.1 protein_id gnl|my_center|LOCUS_18200 26675 26319 gene locus_tag LOCUS_18210 26675 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18210 27577 26675 gene locus_tag LOCUS_18220 27577 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 28392 27571 gene locus_tag LOCUS_18230 28392 27571 CDS product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480418.1 protein_id gnl|my_center|LOCUS_18230 29704 28394 gene locus_tag LOCUS_18240 29704 28394 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 protein_id gnl|my_center|LOCUS_18240 30442 29717 gene locus_tag LOCUS_18250 30442 29717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480419.1 protein_id gnl|my_center|LOCUS_18250 30858 30439 gene locus_tag LOCUS_18260 30858 30439 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 protein_id gnl|my_center|LOCUS_18260 31941 31072 gene locus_tag LOCUS_18270 gene htpX 31941 31072 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459987.1 protein_id gnl|my_center|LOCUS_18270 32312 32479 gene locus_tag LOCUS_18280 32312 32479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459995.1 protein_id gnl|my_center|LOCUS_18280 33258 32575 gene locus_tag LOCUS_18290 gene bioD 33258 32575 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460040.1 protein_id gnl|my_center|LOCUS_18290 34076 33255 gene locus_tag LOCUS_18300 gene bioC 34076 33255 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460024.1 protein_id gnl|my_center|LOCUS_18300 35227 34076 gene locus_tag LOCUS_18310 gene bioF 35227 34076 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460056.1 protein_id gnl|my_center|LOCUS_18310 36266 35214 gene locus_tag LOCUS_18320 gene bioB 36266 35214 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460014.1 protein_id gnl|my_center|LOCUS_18320 36397 37674 gene locus_tag LOCUS_18330 gene bioA 36397 37674 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487357.1 protein_id gnl|my_center|LOCUS_18330 38078 37812 gene locus_tag LOCUS_18340 38078 37812 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479278.1 protein_id gnl|my_center|LOCUS_18340 38656 38216 gene locus_tag LOCUS_18350 38656 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 39381 38650 gene locus_tag LOCUS_18360 39381 38650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479276.1 protein_id gnl|my_center|LOCUS_18360 40895 39588 gene locus_tag LOCUS_18370 gene serS 40895 39588 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487368.1 protein_id gnl|my_center|LOCUS_18370 42342 40987 gene locus_tag LOCUS_18380 42342 40987 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482170.1 protein_id gnl|my_center|LOCUS_18380 42969 42343 gene locus_tag LOCUS_18390 gene lolA 42969 42343 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 protein_id gnl|my_center|LOCUS_18390 46262 43044 gene locus_tag LOCUS_18400 46262 43044 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489025.1 protein_id gnl|my_center|LOCUS_18400 46907 46413 gene locus_tag LOCUS_18410 gene lrp 46907 46413 CDS product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 protein_id gnl|my_center|LOCUS_18410 47064 48188 gene locus_tag LOCUS_18420 gene ald 47064 48188 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477975.1 protein_id gnl|my_center|LOCUS_18420 49478 48282 gene locus_tag LOCUS_18430 49478 48282 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477972.1 protein_id gnl|my_center|LOCUS_18430 50506 49532 gene locus_tag LOCUS_18440 gene cysB 50506 49532 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 protein_id gnl|my_center|LOCUS_18440 50944 51708 gene locus_tag LOCUS_18450 50944 51708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459911.1 protein_id gnl|my_center|LOCUS_18450 51819 52616 gene locus_tag LOCUS_18460 51819 52616 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 protein_id gnl|my_center|LOCUS_18460 54499 52661 gene locus_tag LOCUS_18470 54499 52661 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457989.1 protein_id gnl|my_center|LOCUS_18470 55614 54913 gene locus_tag LOCUS_18480 gene pyrF 55614 54913 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 protein_id gnl|my_center|LOCUS_18480 56874 55699 gene locus_tag LOCUS_18490 gene lapB 56874 55699 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 protein_id gnl|my_center|LOCUS_18490 57186 56893 gene locus_tag LOCUS_18500 57186 56893 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457987.1 protein_id gnl|my_center|LOCUS_18500 57651 57367 gene locus_tag LOCUS_18510 gene ihfB 57651 57367 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 protein_id gnl|my_center|LOCUS_18510 59535 57865 gene locus_tag LOCUS_18520 gene rpsA 59535 57865 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494602.1 protein_id gnl|my_center|LOCUS_18520 60326 59646 gene locus_tag LOCUS_18530 gene cmk 60326 59646 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 protein_id gnl|my_center|LOCUS_18530 61599 60538 gene locus_tag LOCUS_18540 gene sohB 61599 60538 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 protein_id gnl|my_center|LOCUS_18540 61878 62624 gene locus_tag LOCUS_18550 61878 62624 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453938.1 protein_id gnl|my_center|LOCUS_18550 62756 63448 gene locus_tag LOCUS_18560 gene imuA 62756 63448 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453940.1 protein_id gnl|my_center|LOCUS_18560 63453 64856 gene locus_tag LOCUS_18570 63453 64856 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453942.1 protein_id gnl|my_center|LOCUS_18570 64884 67958 gene locus_tag LOCUS_18580 64884 67958 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453944.1 protein_id gnl|my_center|LOCUS_18580 69234 68281 gene locus_tag LOCUS_18590 69234 68281 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453945.1 protein_id gnl|my_center|LOCUS_18590 70623 69406 gene locus_tag LOCUS_18600 70623 69406 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453947.1 protein_id gnl|my_center|LOCUS_18600 70922 72364 gene locus_tag LOCUS_18610 gene pyk 70922 72364 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453949.1 protein_id gnl|my_center|LOCUS_18610 73553 72414 gene locus_tag LOCUS_18620 73553 72414 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106012.1 protein_id gnl|my_center|LOCUS_18620 73792 74382 gene locus_tag LOCUS_18630 73792 74382 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453954.1 protein_id gnl|my_center|LOCUS_18630 74847 76307 gene locus_tag LOCUS_18640 74847 76307 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453956.1 protein_id gnl|my_center|LOCUS_18640 76846 76475 gene locus_tag LOCUS_18650 76846 76475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 protein_id gnl|my_center|LOCUS_18650 76952 77152 gene locus_tag LOCUS_18660 76952 77152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 78585 77155 gene locus_tag LOCUS_18670 gene ptsG 78585 77155 CDS product PTS glucose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453963.1 protein_id gnl|my_center|LOCUS_18670 79797 79030 gene locus_tag LOCUS_18680 79797 79030 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 protein_id gnl|my_center|LOCUS_18680 80750 79788 gene locus_tag LOCUS_18690 80750 79788 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453965.1 protein_id gnl|my_center|LOCUS_18690 81407 80775 gene locus_tag LOCUS_18700 gene tmk 81407 80775 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490472.1 protein_id gnl|my_center|LOCUS_18700 81868 81404 gene locus_tag LOCUS_18710 81868 81404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 82419 81886 gene locus_tag LOCUS_18720 82419 81886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18720 83231 82416 gene locus_tag LOCUS_18730 gene pabC 83231 82416 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453968.1 protein_id gnl|my_center|LOCUS_18730 84587 83340 gene locus_tag LOCUS_18740 gene fabF 84587 83340 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482767.1 protein_id gnl|my_center|LOCUS_18740 84914 84681 gene locus_tag LOCUS_18750 gene acpP 84914 84681 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406112.1 protein_id gnl|my_center|LOCUS_18750 85897 85160 gene locus_tag LOCUS_18760 gene fabG 85897 85160 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_18760 86852 85929 gene locus_tag LOCUS_18770 gene fabD 86852 85929 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_18770 87879 86929 gene locus_tag LOCUS_18780 87879 86929 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 protein_id gnl|my_center|LOCUS_18780 88910 87885 gene locus_tag LOCUS_18790 gene plsX 88910 87885 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490633.1 protein_id gnl|my_center|LOCUS_18790 89091 88921 gene locus_tag LOCUS_18800 gene rpmF 89091 88921 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396978.1 protein_id gnl|my_center|LOCUS_18800 89675 89151 gene locus_tag LOCUS_18810 gene yceD 89675 89151 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 protein_id gnl|my_center|LOCUS_18810 89825 90406 gene locus_tag LOCUS_18820 89825 90406 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461585.1 protein_id gnl|my_center|LOCUS_18820 91547 90603 gene locus_tag LOCUS_18830 gene rluC 91547 90603 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461586.1 protein_id gnl|my_center|LOCUS_18830 92186 95206 gene locus_tag LOCUS_18840 gene rne 92186 95206 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461594.1 protein_id gnl|my_center|LOCUS_18840 95532 97091 gene locus_tag LOCUS_18850 95532 97091 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_18850 97633 97184 gene locus_tag LOCUS_18860 97633 97184 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 protein_id gnl|my_center|LOCUS_18860 97751 98356 gene locus_tag LOCUS_18870 gene cobO 97751 98356 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461596.1 protein_id gnl|my_center|LOCUS_18870 100519 98432 gene locus_tag LOCUS_18880 100519 98432 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 protein_id gnl|my_center|LOCUS_18880 101352 100711 gene locus_tag LOCUS_18890 gene udk 101352 100711 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461598.1 protein_id gnl|my_center|LOCUS_18890 102610 101534 gene locus_tag LOCUS_18900 gene apbC 102610 101534 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461600.1 protein_id gnl|my_center|LOCUS_18900 102827 104887 gene locus_tag LOCUS_18910 gene metG 102827 104887 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482411.1 protein_id gnl|my_center|LOCUS_18910 105203 104955 gene locus_tag LOCUS_18920 105203 104955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 105724 105371 gene locus_tag LOCUS_18930 105724 105371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 106808 105735 gene locus_tag LOCUS_18940 106808 105735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 107153 107758 gene locus_tag LOCUS_18950 107153 107758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18950 107755 107958 gene locus_tag LOCUS_18960 107755 107958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18960 108895 108056 gene locus_tag LOCUS_18970 gene fadR 108895 108056 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461531.1 protein_id gnl|my_center|LOCUS_18970 109538 111124 gene locus_tag LOCUS_18980 gene nhaB 109538 111124 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482404.1 protein_id gnl|my_center|LOCUS_18980 111364 111744 gene locus_tag LOCUS_18990 111364 111744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 112438 111830 gene locus_tag LOCUS_19000 112438 111830 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482415.1 protein_id gnl|my_center|LOCUS_19000 112595 113560 gene locus_tag LOCUS_19010 gene dusC 112595 113560 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461533.1 protein_id gnl|my_center|LOCUS_19010 115089 113629 gene locus_tag LOCUS_19020 115089 113629 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493122.1 protein_id gnl|my_center|LOCUS_19020 116561 115200 gene locus_tag LOCUS_19030 116561 115200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 117028 116495 gene locus_tag LOCUS_19040 117028 116495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 117483 117169 gene locus_tag LOCUS_19050 117483 117169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19050 117658 117491 gene locus_tag LOCUS_19060 117658 117491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 117966 117694 gene locus_tag LOCUS_19070 117966 117694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19070 118898 117963 gene locus_tag LOCUS_19080 118898 117963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461508.1 protein_id gnl|my_center|LOCUS_19080 119649 118954 gene locus_tag LOCUS_19090 119649 118954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19090 119921 119634 gene locus_tag LOCUS_19100 119921 119634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19100 120681 120229 gene locus_tag LOCUS_19110 gene yfbV 120681 120229 CDS product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461479.1 protein_id gnl|my_center|LOCUS_19110 121028 122224 gene locus_tag LOCUS_19120 121028 122224 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418325.1 protein_id gnl|my_center|LOCUS_19120 122363 124528 gene locus_tag LOCUS_19130 gene pta 122363 124528 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461502.1 protein_id gnl|my_center|LOCUS_19130 125873 124599 gene locus_tag LOCUS_19140 125873 124599 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_19140 126952 126044 gene locus_tag LOCUS_19150 126952 126044 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482408.1 protein_id gnl|my_center|LOCUS_19150 128155 127163 gene locus_tag LOCUS_19160 gene oppF 128155 127163 CDS product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 protein_id gnl|my_center|LOCUS_19160 129123 128152 gene locus_tag LOCUS_19170 129123 128152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482402.1 protein_id gnl|my_center|LOCUS_19170 130062 129154 gene locus_tag LOCUS_19180 gene oppC 130062 129154 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482423.1 protein_id gnl|my_center|LOCUS_19180 130992 130072 gene locus_tag LOCUS_19190 gene oppB 130992 130072 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461536.1 protein_id gnl|my_center|LOCUS_19190 132730 131099 gene locus_tag LOCUS_19200 132730 131099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461499.1 protein_id gnl|my_center|LOCUS_19200 132711 132866 gene locus_tag LOCUS_19210 132711 132866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 133757 133302 gene locus_tag LOCUS_19220 gene moaE 133757 133302 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490611.1 protein_id gnl|my_center|LOCUS_19220 134016 133759 gene locus_tag LOCUS_19230 gene moaD 134016 133759 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461535.1 protein_id gnl|my_center|LOCUS_19230 134492 134016 gene locus_tag LOCUS_19240 gene moaC 134492 134016 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461493.1 protein_id gnl|my_center|LOCUS_19240 135031 134519 gene locus_tag LOCUS_19250 gene moaB 135031 134519 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 protein_id gnl|my_center|LOCUS_19250 136121 135132 gene locus_tag LOCUS_19260 gene moaA 136121 135132 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 protein_id gnl|my_center|LOCUS_19260 136424 137314 gene locus_tag LOCUS_19270 136424 137314 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482407.1 protein_id gnl|my_center|LOCUS_19270 137705 137361 gene locus_tag LOCUS_19280 137705 137361 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482417.1 protein_id gnl|my_center|LOCUS_19280 139102 137702 gene locus_tag LOCUS_19290 139102 137702 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106018.1 protein_id gnl|my_center|LOCUS_19290 141489 139459 gene locus_tag LOCUS_19300 gene uvrB 141489 139459 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482400.1 protein_id gnl|my_center|LOCUS_19300 142048 142123 gene locus_tag LOCUS_t00480 142048 142123 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 142469 143047 gene locus_tag LOCUS_19310 gene rsxA 142469 143047 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 protein_id gnl|my_center|LOCUS_19310 143051 143644 gene locus_tag LOCUS_19320 gene rsxB 143051 143644 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_19320 143653 146493 gene locus_tag LOCUS_19330 gene rsxC 143653 146493 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480818.1 protein_id gnl|my_center|LOCUS_19330 146493 147539 gene locus_tag LOCUS_19340 gene rsxD 146493 147539 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480820.1 protein_id gnl|my_center|LOCUS_19340 147547 148185 gene locus_tag LOCUS_19350 gene rsxG 147547 148185 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 protein_id gnl|my_center|LOCUS_19350 148178 148870 gene locus_tag LOCUS_19360 148178 148870 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_19360 148950 149591 gene locus_tag LOCUS_19370 gene nth 148950 149591 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 protein_id gnl|my_center|LOCUS_19370 149623 150039 gene locus_tag LOCUS_19380 gene gloA 149623 150039 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 protein_id gnl|my_center|LOCUS_19380 150177 150611 gene locus_tag LOCUS_19390 150177 150611 CDS product DUF2753 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490627.1 protein_id gnl|my_center|LOCUS_19390 151600 150719 gene locus_tag LOCUS_19400 151600 150719 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494483.1 protein_id gnl|my_center|LOCUS_19400 151906 152550 gene locus_tag LOCUS_19410 gene rnt 151906 152550 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490636.1 protein_id gnl|my_center|LOCUS_19410 152579 153904 gene locus_tag LOCUS_19420 152579 153904 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490613.1 protein_id gnl|my_center|LOCUS_19420 154127 155470 gene locus_tag LOCUS_19430 154127 155470 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261578.1 protein_id gnl|my_center|LOCUS_19430 155510 156586 gene locus_tag LOCUS_19440 155510 156586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 156622 159933 gene locus_tag LOCUS_19450 156622 159933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 160518 160039 gene locus_tag LOCUS_19460 160518 160039 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19460 161078 160743 gene locus_tag LOCUS_19470 161078 160743 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494473.1 protein_id gnl|my_center|LOCUS_19470 161657 162241 gene locus_tag LOCUS_19480 gene sodB 161657 162241 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 protein_id gnl|my_center|LOCUS_19480 162397 162900 gene locus_tag LOCUS_19490 162397 162900 CDS product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461768.1 protein_id gnl|my_center|LOCUS_19490 163035 163769 gene locus_tag LOCUS_19500 163035 163769 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461731.1 protein_id gnl|my_center|LOCUS_19500 166637 163950 gene locus_tag LOCUS_19510 gene adhE 166637 163950 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461748.1 protein_id gnl|my_center|LOCUS_19510 167290 167928 gene locus_tag LOCUS_19520 167290 167928 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461786.1 protein_id gnl|my_center|LOCUS_19520 167991 168839 gene locus_tag LOCUS_19530 167991 168839 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 protein_id gnl|my_center|LOCUS_19530 169578 169066 gene locus_tag LOCUS_19540 gene mshA 169578 169066 CDS product type IV pilin MshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106342.1 protein_id gnl|my_center|LOCUS_19540 170816 169701 gene locus_tag LOCUS_19550 gene asd 170816 169701 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479551.1 protein_id gnl|my_center|LOCUS_19550 171254 172687 gene locus_tag LOCUS_19560 gene nhaC 171254 172687 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479559.1 protein_id gnl|my_center|LOCUS_19560 173808 172768 gene locus_tag LOCUS_19570 173808 172768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461741.1 protein_id gnl|my_center|LOCUS_19570 174432 174046 gene locus_tag LOCUS_19580 174432 174046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 175357 174521 gene locus_tag LOCUS_19590 175357 174521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 176469 175471 gene locus_tag LOCUS_19600 gene yejK 176469 175471 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461746.1 protein_id gnl|my_center|LOCUS_19600 176555 176782 gene locus_tag LOCUS_19610 176555 176782 CDS product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461743.1 protein_id gnl|my_center|LOCUS_19610 176805 178613 gene locus_tag LOCUS_19620 176805 178613 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461736.1 protein_id gnl|my_center|LOCUS_19620 178756 178846 gene locus_tag LOCUS_t00490 178756 178846 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 182254 179453 gene locus_tag LOCUS_19630 182254 179453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 183018 182254 gene locus_tag LOCUS_19640 183018 182254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 184717 183029 gene locus_tag LOCUS_19650 gene hscC 184717 183029 CDS product molecular chaperone HscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367875.1 protein_id gnl|my_center|LOCUS_19650 185825 184896 gene locus_tag LOCUS_19660 185825 184896 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461762.1 protein_id gnl|my_center|LOCUS_19660 186107 186796 gene locus_tag LOCUS_19670 186107 186796 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_19670 188961 186997 gene locus_tag LOCUS_19680 188961 186997 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_19680 189609 189061 gene locus_tag LOCUS_19690 189609 189061 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 protein_id gnl|my_center|LOCUS_19690 191796 189784 gene locus_tag LOCUS_19700 191796 189784 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451165.1 protein_id gnl|my_center|LOCUS_19700 192023 193873 gene locus_tag LOCUS_19710 gene sppA 192023 193873 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461788.1 protein_id gnl|my_center|LOCUS_19710 193988 195004 gene locus_tag LOCUS_19720 gene ansA 193988 195004 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479567.1 protein_id gnl|my_center|LOCUS_19720 195344 195060 gene locus_tag LOCUS_19730 195344 195060 CDS product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 protein_id gnl|my_center|LOCUS_19730 195443 196270 gene locus_tag LOCUS_19740 195443 196270 CDS product DUF2989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461738.1 protein_id gnl|my_center|LOCUS_19740 196832 196413 gene locus_tag LOCUS_19750 gene msrB 196832 196413 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 protein_id gnl|my_center|LOCUS_19750 197161 198156 gene locus_tag LOCUS_19760 gene gap 197161 198156 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479552.1 protein_id gnl|my_center|LOCUS_19760 198314 199198 gene locus_tag LOCUS_19770 198314 199198 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_19770 199284 199631 gene locus_tag LOCUS_19780 199284 199631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 200610 199642 gene locus_tag LOCUS_19790 200610 199642 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 protein_id gnl|my_center|LOCUS_19790 200938 202974 gene locus_tag LOCUS_19800 200938 202974 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460086.1 protein_id gnl|my_center|LOCUS_19800 203088 203927 gene locus_tag LOCUS_19810 gene rlmA 203088 203927 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 protein_id gnl|my_center|LOCUS_19810 204015 204962 gene locus_tag LOCUS_19820 204015 204962 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479569.1 protein_id gnl|my_center|LOCUS_19820 205158 205517 gene locus_tag LOCUS_19830 205158 205517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460108.1 protein_id gnl|my_center|LOCUS_19830 205659 207557 gene locus_tag LOCUS_19840 205659 207557 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 protein_id gnl|my_center|LOCUS_19840 207732 209309 gene locus_tag LOCUS_19850 207732 209309 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479531.1 protein_id gnl|my_center|LOCUS_19850 209444 209740 gene locus_tag LOCUS_19860 209444 209740 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460130.1 protein_id gnl|my_center|LOCUS_19860 209823 210218 gene locus_tag LOCUS_19870 209823 210218 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479499.1 protein_id gnl|my_center|LOCUS_19870 210259 210543 gene locus_tag LOCUS_19880 210259 210543 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479521.1 protein_id gnl|my_center|LOCUS_19880 210977 210627 gene locus_tag LOCUS_19890 210977 210627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19890 212248 210962 gene locus_tag LOCUS_19900 212248 210962 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479510.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 212552 212803 gene locus_tag LOCUS_19910 212552 212803 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397239.1 protein_id gnl|my_center|LOCUS_19910 213310 212870 gene locus_tag LOCUS_19920 213310 212870 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 protein_id gnl|my_center|LOCUS_19920 213543 213791 gene locus_tag LOCUS_19930 213543 213791 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460076.1 protein_id gnl|my_center|LOCUS_19930 214450 213788 gene locus_tag LOCUS_19940 214450 213788 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005397228.1 protein_id gnl|my_center|LOCUS_19940 215757 214480 gene locus_tag LOCUS_19950 215757 214480 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479508.1 protein_id gnl|my_center|LOCUS_19950 216153 215773 gene locus_tag LOCUS_19960 216153 215773 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 protein_id gnl|my_center|LOCUS_19960 216403 217728 gene locus_tag LOCUS_19970 216403 217728 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451163.1 protein_id gnl|my_center|LOCUS_19970 217942 218640 gene locus_tag LOCUS_19980 gene aqpZ 217942 218640 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460095.1 protein_id gnl|my_center|LOCUS_19980 219293 218694 gene locus_tag LOCUS_19990 gene recR 219293 218694 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460088.1 protein_id gnl|my_center|LOCUS_19990 219653 219324 gene locus_tag LOCUS_20000 219653 219324 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460082.1 protein_id gnl|my_center|LOCUS_20000 221931 219736 gene locus_tag LOCUS_20010 gene dnaX 221931 219736 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460096.1 protein_id gnl|my_center|LOCUS_20010 222485 221940 gene locus_tag LOCUS_20020 gene apt 222485 221940 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460112.1 protein_id gnl|my_center|LOCUS_20020 223052 222648 gene locus_tag LOCUS_20030 223052 222648 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460100.1 protein_id gnl|my_center|LOCUS_20030 224521 223415 gene locus_tag LOCUS_20040 224521 223415 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493238.1 protein_id gnl|my_center|LOCUS_20040 224806 225681 gene locus_tag LOCUS_20050 224806 225681 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 protein_id gnl|my_center|LOCUS_20050 227552 226038 gene locus_tag LOCUS_20060 gene purF 227552 226038 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460097.1 protein_id gnl|my_center|LOCUS_20060 228080 227589 gene locus_tag LOCUS_20070 228080 227589 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479544.1 protein_id gnl|my_center|LOCUS_20070 228735 228142 gene locus_tag LOCUS_20080 228735 228142 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479575.1 protein_id gnl|my_center|LOCUS_20080 230012 228750 gene locus_tag LOCUS_20090 gene folC 230012 228750 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460139.1 protein_id gnl|my_center|LOCUS_20090 230985 230059 gene locus_tag LOCUS_20100 gene accD 230985 230059 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 protein_id gnl|my_center|LOCUS_20100 231976 231182 gene locus_tag LOCUS_20110 gene truA 231976 231182 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 protein_id gnl|my_center|LOCUS_20110 232967 232068 gene locus_tag LOCUS_20120 232967 232068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence022 3300 3461 gene locus_tag LOCUS_20130 3300 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 4428 3415 gene locus_tag LOCUS_20140 4428 3415 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460137.1 protein_id gnl|my_center|LOCUS_20140 5576 4425 gene locus_tag LOCUS_20150 5576 4425 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494418.1 protein_id gnl|my_center|LOCUS_20150 7087 5876 gene locus_tag LOCUS_20160 gene fabB 7087 5876 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460738.1 protein_id gnl|my_center|LOCUS_20160 7216 9234 gene locus_tag LOCUS_20170 gene mnmC 7216 9234 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479475.1 protein_id gnl|my_center|LOCUS_20170 9986 9462 gene locus_tag LOCUS_20180 9986 9462 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 protein_id gnl|my_center|LOCUS_20180 10408 10145 gene locus_tag LOCUS_20190 10408 10145 CDS product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479532.1 protein_id gnl|my_center|LOCUS_20190 10954 10424 gene locus_tag LOCUS_20200 10954 10424 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457675.1 protein_id gnl|my_center|LOCUS_20200 11282 11905 gene locus_tag LOCUS_20210 11282 11905 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479564.1 protein_id gnl|my_center|LOCUS_20210 12701 11967 gene locus_tag LOCUS_20220 12701 11967 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173423.1 protein_id gnl|my_center|LOCUS_20220 12792 13730 gene locus_tag LOCUS_20230 12792 13730 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_20230 14836 13751 gene locus_tag LOCUS_20240 gene aroC 14836 13751 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479467.1 protein_id gnl|my_center|LOCUS_20240 15990 15058 gene locus_tag LOCUS_20250 gene prmB 15990 15058 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 protein_id gnl|my_center|LOCUS_20250 16052 16582 gene locus_tag LOCUS_20260 gene smrB 16052 16582 CDS product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457721.1 protein_id gnl|my_center|LOCUS_20260 17129 16665 gene locus_tag LOCUS_20270 gene sixA 17129 16665 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479576.1 protein_id gnl|my_center|LOCUS_20270 17505 20282 gene locus_tag LOCUS_20280 17505 20282 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 protein_id gnl|my_center|LOCUS_20280 20378 20650 gene locus_tag LOCUS_20290 20378 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 22842 20728 gene locus_tag LOCUS_20300 gene fadJ 22842 20728 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 protein_id gnl|my_center|LOCUS_20300 24151 22949 gene locus_tag LOCUS_20310 gene fadI 24151 22949 CDS product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457699.1 protein_id gnl|my_center|LOCUS_20310 24770 25333 gene locus_tag LOCUS_20320 24770 25333 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479482.1 protein_id gnl|my_center|LOCUS_20320 25326 26057 gene locus_tag LOCUS_20330 25326 26057 CDS product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 protein_id gnl|my_center|LOCUS_20330 26356 27618 gene locus_tag LOCUS_20340 26356 27618 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457664.1 protein_id gnl|my_center|LOCUS_20340 27928 29241 gene locus_tag LOCUS_20350 27928 29241 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479485.1 protein_id gnl|my_center|LOCUS_20350 30126 29335 gene locus_tag LOCUS_20360 30126 29335 CDS product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106038.1 protein_id gnl|my_center|LOCUS_20360 31536 30319 gene locus_tag LOCUS_20370 gene ccmI 31536 30319 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479509.1 protein_id gnl|my_center|LOCUS_20370 32021 31536 gene locus_tag LOCUS_20380 32021 31536 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457737.1 protein_id gnl|my_center|LOCUS_20380 32572 32018 gene locus_tag LOCUS_20390 32572 32018 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457723.1 protein_id gnl|my_center|LOCUS_20390 34319 32574 gene locus_tag LOCUS_20400 34319 32574 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457778.1 protein_id gnl|my_center|LOCUS_20400 35040 34555 gene locus_tag LOCUS_20410 gene ccmE 35040 34555 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457727.1 protein_id gnl|my_center|LOCUS_20410 35243 35037 gene locus_tag LOCUS_20420 gene ccmD 35243 35037 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457743.1 protein_id gnl|my_center|LOCUS_20420 35752 35255 gene locus_tag LOCUS_20430 35752 35255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20430 35997 35752 gene locus_tag LOCUS_20440 35997 35752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20440 36783 36106 gene locus_tag LOCUS_20450 gene ccmB 36783 36106 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 protein_id gnl|my_center|LOCUS_20450 37393 36776 gene locus_tag LOCUS_20460 gene ccmA 37393 36776 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 protein_id gnl|my_center|LOCUS_20460 38081 37590 gene locus_tag LOCUS_20470 38081 37590 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479536.1 protein_id gnl|my_center|LOCUS_20470 38575 38081 gene locus_tag LOCUS_20480 38575 38081 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 protein_id gnl|my_center|LOCUS_20480 39637 38612 gene locus_tag LOCUS_20490 39637 38612 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106039.1 protein_id gnl|my_center|LOCUS_20490 40406 39630 gene locus_tag LOCUS_20500 40406 39630 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479466.1 protein_id gnl|my_center|LOCUS_20500 41530 40415 gene locus_tag LOCUS_20510 41530 40415 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479477.1 protein_id gnl|my_center|LOCUS_20510 43781 41559 gene locus_tag LOCUS_20520 43781 41559 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262350.1 protein_id gnl|my_center|LOCUS_20520 44534 43791 gene locus_tag LOCUS_20530 44534 43791 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457755.1 protein_id gnl|my_center|LOCUS_20530 45030 44650 gene locus_tag LOCUS_20540 gene cheY 45030 44650 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211091957.1 protein_id gnl|my_center|LOCUS_20540 45797 45063 gene locus_tag LOCUS_20550 45797 45063 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457739.1 protein_id gnl|my_center|LOCUS_20550 46677 45790 gene locus_tag LOCUS_20560 46677 45790 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457698.1 protein_id gnl|my_center|LOCUS_20560 48197 46692 gene locus_tag LOCUS_20570 gene flhF 48197 46692 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457694.1 protein_id gnl|my_center|LOCUS_20570 50245 48224 gene locus_tag LOCUS_20580 gene flhA 50245 48224 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481069.1 protein_id gnl|my_center|LOCUS_20580 51572 50520 gene locus_tag LOCUS_20590 gene flhB 51572 50520 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457645.1 protein_id gnl|my_center|LOCUS_20590 52444 51662 gene locus_tag LOCUS_20600 gene fliR 52444 51662 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481059.1 protein_id gnl|my_center|LOCUS_20600 52726 52457 gene locus_tag LOCUS_20610 gene fliQ 52726 52457 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457784.1 protein_id gnl|my_center|LOCUS_20610 53574 52753 gene locus_tag LOCUS_20620 gene fliP 53574 52753 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481091.1 protein_id gnl|my_center|LOCUS_20620 54022 53609 gene locus_tag LOCUS_20630 gene fliO 54022 53609 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457659.1 protein_id gnl|my_center|LOCUS_20630 54434 54024 gene locus_tag LOCUS_20640 gene fliN 54434 54024 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457660.1 protein_id gnl|my_center|LOCUS_20640 55558 54518 gene locus_tag LOCUS_20650 gene fliM 55558 54518 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457756.1 protein_id gnl|my_center|LOCUS_20650 56066 55566 gene locus_tag LOCUS_20660 gene fliL 56066 55566 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457696.1 protein_id gnl|my_center|LOCUS_20660 58218 56107 gene locus_tag LOCUS_20670 58218 56107 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481082.1 protein_id gnl|my_center|LOCUS_20670 59049 58606 gene locus_tag LOCUS_20680 gene fliJ 59049 58606 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457733.1 protein_id gnl|my_center|LOCUS_20680 60375 59056 gene locus_tag LOCUS_20690 gene fliI 60375 59056 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457757.1 protein_id gnl|my_center|LOCUS_20690 61179 60379 gene locus_tag LOCUS_20700 gene fliH 61179 60379 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481084.1 protein_id gnl|my_center|LOCUS_20700 62301 61249 gene locus_tag LOCUS_20710 gene fliG 62301 61249 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457745.1 protein_id gnl|my_center|LOCUS_20710 64036 62294 gene locus_tag LOCUS_20720 gene fliF 64036 62294 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457713.1 protein_id gnl|my_center|LOCUS_20720 64363 64052 gene locus_tag LOCUS_20730 gene fliE 64363 64052 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457685.1 protein_id gnl|my_center|LOCUS_20730 65897 64506 gene locus_tag LOCUS_20740 65897 64506 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457658.1 protein_id gnl|my_center|LOCUS_20740 66966 65935 gene locus_tag LOCUS_20750 66966 65935 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457625.1 protein_id gnl|my_center|LOCUS_20750 68587 67121 gene locus_tag LOCUS_20760 68587 67121 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481102.1 protein_id gnl|my_center|LOCUS_20760 69280 68870 gene locus_tag LOCUS_20770 gene fliS 69280 68870 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005433081.1 protein_id gnl|my_center|LOCUS_20770 69598 69293 gene locus_tag LOCUS_20780 69598 69293 CDS product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457717.1 protein_id gnl|my_center|LOCUS_20780 71620 69602 gene locus_tag LOCUS_20790 gene fliD 71620 69602 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481075.1 protein_id gnl|my_center|LOCUS_20790 72069 71641 gene locus_tag LOCUS_20800 gene flaG 72069 71641 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481049.1 protein_id gnl|my_center|LOCUS_20800 73281 72151 gene locus_tag LOCUS_20810 73281 72151 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457770.1 protein_id gnl|my_center|LOCUS_20810 74713 73580 gene locus_tag LOCUS_20820 74713 73580 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481079.1 protein_id gnl|my_center|LOCUS_20820 76116 74977 gene locus_tag LOCUS_20830 76116 74977 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481067.1 protein_id gnl|my_center|LOCUS_20830 77180 76278 gene locus_tag LOCUS_20840 77180 76278 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457759.1 protein_id gnl|my_center|LOCUS_20840 77708 77223 gene locus_tag LOCUS_20850 77708 77223 CDS product DUF2919 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481060.1 protein_id gnl|my_center|LOCUS_20850 77854 78207 gene locus_tag LOCUS_20860 77854 78207 CDS product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 protein_id gnl|my_center|LOCUS_20860 78209 78547 gene locus_tag LOCUS_20870 78209 78547 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457665.1 protein_id gnl|my_center|LOCUS_20870 78872 78585 gene locus_tag LOCUS_20880 78872 78585 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494336.1 protein_id gnl|my_center|LOCUS_20880 79119 79469 gene locus_tag LOCUS_20890 79119 79469 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 protein_id gnl|my_center|LOCUS_20890 79488 80624 gene locus_tag LOCUS_20900 gene dapE 79488 80624 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457682.1 protein_id gnl|my_center|LOCUS_20900 80664 81362 gene locus_tag LOCUS_20910 80664 81362 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457656.1 protein_id gnl|my_center|LOCUS_20910 81359 81562 gene locus_tag LOCUS_20920 81359 81562 CDS product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457657.1 protein_id gnl|my_center|LOCUS_20920 82639 81623 gene locus_tag LOCUS_20930 gene bamC 82639 81623 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481086.1 protein_id gnl|my_center|LOCUS_20930 83566 82688 gene locus_tag LOCUS_20940 gene dapA 83566 82688 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481116.1 protein_id gnl|my_center|LOCUS_20940 83973 84515 gene locus_tag LOCUS_20950 83973 84515 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465166.1 protein_id gnl|my_center|LOCUS_20950 84535 85005 gene locus_tag LOCUS_20960 gene bcp 84535 85005 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 protein_id gnl|my_center|LOCUS_20960 86140 85070 gene locus_tag LOCUS_20970 86140 85070 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_20970 86387 86142 gene locus_tag LOCUS_20980 86387 86142 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481078.1 protein_id gnl|my_center|LOCUS_20980 86648 88102 gene locus_tag LOCUS_20990 86648 88102 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457720.1 protein_id gnl|my_center|LOCUS_20990 88119 88469 gene locus_tag LOCUS_21000 gene arsC 88119 88469 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457719.1 protein_id gnl|my_center|LOCUS_21000 88470 89042 gene locus_tag LOCUS_21010 gene wrbA 88470 89042 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457725.1 protein_id gnl|my_center|LOCUS_21010 89063 89503 gene locus_tag LOCUS_21020 89063 89503 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457718.1 protein_id gnl|my_center|LOCUS_21020 90903 89617 gene locus_tag LOCUS_21030 90903 89617 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481094.1 protein_id gnl|my_center|LOCUS_21030 91129 92382 gene locus_tag LOCUS_21040 91129 92382 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 protein_id gnl|my_center|LOCUS_21040 93168 92536 gene locus_tag LOCUS_21050 gene upp 93168 92536 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 protein_id gnl|my_center|LOCUS_21050 93355 93149 gene locus_tag LOCUS_21060 93355 93149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 93342 94382 gene locus_tag LOCUS_21070 gene purM 93342 94382 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 protein_id gnl|my_center|LOCUS_21070 94525 95163 gene locus_tag LOCUS_21080 gene purN 94525 95163 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457769.1 protein_id gnl|my_center|LOCUS_21080 96331 95486 gene locus_tag LOCUS_21090 96331 95486 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 protein_id gnl|my_center|LOCUS_21090 96968 96393 gene locus_tag LOCUS_21100 gene lpcA 96968 96393 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457680.1 protein_id gnl|my_center|LOCUS_21100 97327 99771 gene locus_tag LOCUS_21110 gene fadE 97327 99771 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481111.1 protein_id gnl|my_center|LOCUS_21110 100140 99877 gene locus_tag LOCUS_21120 100140 99877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 101783 100707 gene locus_tag LOCUS_21130 101783 100707 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457771.1 protein_id gnl|my_center|LOCUS_21130 102584 101865 gene locus_tag LOCUS_21140 gene dnaQ 102584 101865 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457782.1 protein_id gnl|my_center|LOCUS_21140 102643 103107 gene locus_tag LOCUS_21150 gene rnhA 102643 103107 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484436.1 protein_id gnl|my_center|LOCUS_21150 103805 103104 gene locus_tag LOCUS_21160 103805 103104 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481108.1 protein_id gnl|my_center|LOCUS_21160 103899 104657 gene locus_tag LOCUS_21170 gene gloB 103899 104657 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 protein_id gnl|my_center|LOCUS_21170 104895 106466 gene locus_tag LOCUS_21180 104895 106466 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_21180 106463 107149 gene locus_tag LOCUS_21190 106463 107149 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481061.1 protein_id gnl|my_center|LOCUS_21190 108039 107158 gene locus_tag LOCUS_21200 108039 107158 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456741.1 protein_id gnl|my_center|LOCUS_21200 108433 108089 gene locus_tag LOCUS_21210 gene glnB 108433 108089 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_21210 108958 108656 gene locus_tag LOCUS_21220 108958 108656 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488964.1 protein_id gnl|my_center|LOCUS_21220 110430 109099 gene locus_tag LOCUS_21230 gene tilS 110430 109099 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456735.1 protein_id gnl|my_center|LOCUS_21230 111494 110535 gene locus_tag LOCUS_21240 gene accA 111494 110535 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480969.1 protein_id gnl|my_center|LOCUS_21240 115022 111543 gene locus_tag LOCUS_21250 gene dnaE 115022 111543 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480973.1 protein_id gnl|my_center|LOCUS_21250 115753 115115 gene locus_tag LOCUS_21260 gene rnhB 115753 115115 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_21260 116902 115763 gene locus_tag LOCUS_21270 gene lpxB 116902 115763 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480975.1 protein_id gnl|my_center|LOCUS_21270 117842 117054 gene locus_tag LOCUS_21280 gene lpxA 117842 117054 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456706.1 protein_id gnl|my_center|LOCUS_21280 118296 117844 gene locus_tag LOCUS_21290 gene fabZ 118296 117844 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456699.1 protein_id gnl|my_center|LOCUS_21290 119478 118447 gene locus_tag LOCUS_21300 gene lpxD 119478 118447 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480972.1 protein_id gnl|my_center|LOCUS_21300 119994 119485 gene locus_tag LOCUS_21310 119994 119485 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456715.1 protein_id gnl|my_center|LOCUS_21310 122425 120011 gene locus_tag LOCUS_21320 gene bamA 122425 120011 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456717.1 protein_id gnl|my_center|LOCUS_21320 123829 122471 gene locus_tag LOCUS_21330 gene rseP 123829 122471 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 protein_id gnl|my_center|LOCUS_21330 125034 123829 gene locus_tag LOCUS_21340 gene ispC 125034 123829 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456710.1 protein_id gnl|my_center|LOCUS_21340 125928 125086 gene locus_tag LOCUS_21350 125928 125086 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 protein_id gnl|my_center|LOCUS_21350 126696 125941 gene locus_tag LOCUS_21360 126696 125941 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480970.1 protein_id gnl|my_center|LOCUS_21360 127350 126793 gene locus_tag LOCUS_21370 gene frr 127350 126793 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 protein_id gnl|my_center|LOCUS_21370 128179 127448 gene locus_tag LOCUS_21380 gene pyrH 128179 127448 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484104.1 protein_id gnl|my_center|LOCUS_21380 129178 128333 gene locus_tag LOCUS_21390 gene tsf 129178 128333 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456729.1 protein_id gnl|my_center|LOCUS_21390 130038 129310 gene locus_tag LOCUS_21400 gene rpsB 130038 129310 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 protein_id gnl|my_center|LOCUS_21400 130436 131314 gene locus_tag LOCUS_21410 gene map 130436 131314 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456732.1 protein_id gnl|my_center|LOCUS_21410 131415 134039 gene locus_tag LOCUS_21420 gene glnD 131415 134039 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479040.1 protein_id gnl|my_center|LOCUS_21420 134192 134575 gene locus_tag LOCUS_21430 134192 134575 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456756.1 protein_id gnl|my_center|LOCUS_21430 135438 134671 gene locus_tag LOCUS_21440 gene truC 135438 134671 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 protein_id gnl|my_center|LOCUS_21440 135845 135444 gene locus_tag LOCUS_21450 135845 135444 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456758.1 protein_id gnl|my_center|LOCUS_21450 135835 136872 gene locus_tag LOCUS_21460 135835 136872 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_21460 136886 137185 gene locus_tag LOCUS_21470 136886 137185 CDS product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106044.1 protein_id gnl|my_center|LOCUS_21470 137552 137145 gene locus_tag LOCUS_21480 137552 137145 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021452994.1 protein_id gnl|my_center|LOCUS_21480 138537 138830 gene locus_tag LOCUS_21490 138537 138830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456591.1 protein_id gnl|my_center|LOCUS_21490 138827 139270 gene locus_tag LOCUS_21500 138827 139270 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456606.1 protein_id gnl|my_center|LOCUS_21500 139366 140091 gene locus_tag LOCUS_21510 139366 140091 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700244.1 protein_id gnl|my_center|LOCUS_21510 141734 140148 gene locus_tag LOCUS_21520 141734 140148 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484923.1 protein_id gnl|my_center|LOCUS_21520 142352 142092 gene locus_tag LOCUS_21530 142352 142092 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479047.1 protein_id gnl|my_center|LOCUS_21530 142475 143170 gene locus_tag LOCUS_21540 gene tsaA 142475 143170 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479043.1 protein_id gnl|my_center|LOCUS_21540 143282 144997 gene locus_tag LOCUS_21550 143282 144997 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479053.1 protein_id gnl|my_center|LOCUS_21550 145172 145840 gene locus_tag LOCUS_21560 145172 145840 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456672.1 protein_id gnl|my_center|LOCUS_21560 145954 146160 gene locus_tag LOCUS_21570 145954 146160 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391765.1 protein_id gnl|my_center|LOCUS_21570 146160 146351 gene locus_tag LOCUS_21580 146160 146351 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456636.1 protein_id gnl|my_center|LOCUS_21580 147809 146445 gene locus_tag LOCUS_21590 147809 146445 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456537.1 protein_id gnl|my_center|LOCUS_21590 148814 148053 gene locus_tag LOCUS_21600 148814 148053 CDS product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479062.1 protein_id gnl|my_center|LOCUS_21600 149338 148904 gene locus_tag LOCUS_21610 149338 148904 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456579.1 protein_id gnl|my_center|LOCUS_21610 149505 151340 gene locus_tag LOCUS_21620 149505 151340 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456651.1 protein_id gnl|my_center|LOCUS_21620 152338 151337 gene locus_tag LOCUS_21630 gene dinB 152338 151337 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456663.1 protein_id gnl|my_center|LOCUS_21630 153568 152519 gene locus_tag LOCUS_21640 gene dinB 153568 152519 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261445.1 protein_id gnl|my_center|LOCUS_21640 153839 154003 gene locus_tag LOCUS_21650 153839 154003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 154797 154162 gene locus_tag LOCUS_21660 154797 154162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 155936 154854 gene locus_tag LOCUS_21670 155936 154854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789323.1 protein_id gnl|my_center|LOCUS_21670 156999 155929 gene locus_tag LOCUS_21680 156999 155929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 157725 157369 gene locus_tag LOCUS_21690 157725 157369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 158273 160894 gene locus_tag LOCUS_21700 158273 160894 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_21700 163304 161199 gene locus_tag LOCUS_21710 163304 161199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 164041 164208 gene locus_tag LOCUS_21720 164041 164208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 164186 165052 gene locus_tag LOCUS_21730 164186 165052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21730 166211 166044 gene locus_tag LOCUS_21740 166211 166044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 166491 166916 gene locus_tag LOCUS_21750 166491 166916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 167516 167142 gene locus_tag LOCUS_21760 167516 167142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 167749 168084 gene locus_tag LOCUS_21770 167749 168084 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489540.1 protein_id gnl|my_center|LOCUS_21770 168077 169483 gene locus_tag LOCUS_21780 168077 169483 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480506.1 protein_id gnl|my_center|LOCUS_21780 172117 169706 gene locus_tag LOCUS_21790 172117 169706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 175851 172117 gene locus_tag LOCUS_21800 175851 172117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 176813 175938 gene locus_tag LOCUS_21810 176813 175938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 177795 177244 gene locus_tag LOCUS_21820 177795 177244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 180571 177788 gene locus_tag LOCUS_21830 180571 177788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 182830 180581 gene locus_tag LOCUS_21840 182830 180581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 184067 182823 gene locus_tag LOCUS_21850 184067 182823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 184388 185587 gene locus_tag LOCUS_21860 184388 185587 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705738.1 protein_id gnl|my_center|LOCUS_21860 185897 185664 gene locus_tag LOCUS_21870 gene nqrM 185897 185664 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456576.1 protein_id gnl|my_center|LOCUS_21870 186924 185920 gene locus_tag LOCUS_21880 186924 185920 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456539.1 protein_id gnl|my_center|LOCUS_21880 188303 187080 gene locus_tag LOCUS_21890 gene nqrF 188303 187080 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456545.1 protein_id gnl|my_center|LOCUS_21890 188933 188337 gene locus_tag LOCUS_21900 gene nqrE 188933 188337 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436652.1 protein_id gnl|my_center|LOCUS_21900 189573 188941 gene locus_tag LOCUS_21910 189573 188941 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456515.1 protein_id gnl|my_center|LOCUS_21910 190358 189573 gene locus_tag LOCUS_21920 190358 189573 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456526.1 protein_id gnl|my_center|LOCUS_21920 191589 190348 gene locus_tag LOCUS_21930 191589 190348 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456580.1 protein_id gnl|my_center|LOCUS_21930 192939 191593 gene locus_tag LOCUS_21940 192939 191593 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 protein_id gnl|my_center|LOCUS_21940 193702 193394 gene locus_tag LOCUS_21950 gene bolA 193702 193394 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_21950 194439 195077 gene locus_tag LOCUS_21960 194439 195077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 195106 195675 gene locus_tag LOCUS_21970 195106 195675 CDS product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456550.1 protein_id gnl|my_center|LOCUS_21970 195675 196220 gene locus_tag LOCUS_21980 195675 196220 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456634.1 protein_id gnl|my_center|LOCUS_21980 196292 197644 gene locus_tag LOCUS_21990 196292 197644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 protein_id gnl|my_center|LOCUS_21990 198371 197712 gene locus_tag LOCUS_22000 198371 197712 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482349.1 protein_id gnl|my_center|LOCUS_22000 198952 198368 gene locus_tag LOCUS_22010 198952 198368 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482287.1 protein_id gnl|my_center|LOCUS_22010 200359 198998 gene locus_tag LOCUS_22020 200359 198998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 200952 200356 gene locus_tag LOCUS_22030 200952 200356 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482286.1 protein_id gnl|my_center|LOCUS_22030 201276 202076 gene locus_tag LOCUS_22040 201276 202076 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482307.1 protein_id gnl|my_center|LOCUS_22040 202181 203074 gene locus_tag LOCUS_22050 gene panE 202181 203074 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482324.1 protein_id gnl|my_center|LOCUS_22050 203071 203670 gene locus_tag LOCUS_22060 203071 203670 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482283.1 protein_id gnl|my_center|LOCUS_22060 203670 204881 gene locus_tag LOCUS_22070 gene csdA 203670 204881 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482293.1 protein_id gnl|my_center|LOCUS_22070 205411 204983 gene locus_tag LOCUS_22080 gene csdE 205411 204983 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_22080 206242 205433 gene locus_tag LOCUS_22090 gene tcdA 206242 205433 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_22090 207448 206345 gene locus_tag LOCUS_22100 gene mltA 207448 206345 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456533.1 protein_id gnl|my_center|LOCUS_22100 208157 207711 gene locus_tag LOCUS_22110 208157 207711 CDS product DUF2850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488983.1 protein_id gnl|my_center|LOCUS_22110 208322 209659 gene locus_tag LOCUS_22120 gene argA 208322 209659 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482311.1 protein_id gnl|my_center|LOCUS_22120 209921 210109 gene locus_tag LOCUS_22130 209921 210109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106047.1 protein_id gnl|my_center|LOCUS_22130 212306 210147 gene locus_tag LOCUS_22140 gene recD 212306 210147 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482289.1 protein_id gnl|my_center|LOCUS_22140 215944 212306 gene locus_tag LOCUS_22150 gene recB 215944 212306 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 protein_id gnl|my_center|LOCUS_22150 219993 216496 gene locus_tag LOCUS_22160 gene recC 219993 216496 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 protein_id gnl|my_center|LOCUS_22160 220368 222149 gene locus_tag LOCUS_22170 220368 222149 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482315.1 protein_id gnl|my_center|LOCUS_22170 223187 222213 gene locus_tag LOCUS_22180 223187 222213 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482291.1 protein_id gnl|my_center|LOCUS_22180 223299 223637 gene locus_tag LOCUS_22190 223299 223637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 223709 224215 gene locus_tag LOCUS_22200 223709 224215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22200 224363 224662 gene locus_tag LOCUS_22210 224363 224662 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482297.1 protein_id gnl|my_center|LOCUS_22210 225109 225846 gene locus_tag LOCUS_22220 225109 225846 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423808.1 protein_id gnl|my_center|LOCUS_22220 225870 226853 gene locus_tag LOCUS_22230 225870 226853 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263919.1 protein_id gnl|my_center|LOCUS_22230 227784 227353 gene locus_tag LOCUS_22240 227784 227353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 228732 227803 gene locus_tag LOCUS_22250 228732 227803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 229786 228950 gene locus_tag LOCUS_22260 229786 228950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 229934 230194 gene locus_tag LOCUS_22270 229934 230194 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_22270 230194 230496 gene locus_tag LOCUS_22280 230194 230496 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_22280 230916 231947 gene locus_tag LOCUS_22290 gene dapD 230916 231947 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456577.1 protein_id gnl|my_center|LOCUS_22290 233398 232343 gene locus_tag LOCUS_22300 gene glpQ 233398 232343 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482305.1 protein_id gnl|my_center|LOCUS_22300 234820 233453 gene locus_tag LOCUS_22310 gene glpT 234820 233453 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456512.1 protein_id gnl|my_center|LOCUS_22310 235691 236545 gene locus_tag LOCUS_22320 235691 236545 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456607.1 protein_id gnl|my_center|LOCUS_22320 236604 238121 gene locus_tag LOCUS_22330 gene glpK 236604 238121 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456578.1 protein_id gnl|my_center|LOCUS_22330 238311 239102 gene locus_tag LOCUS_22340 238311 239102 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456614.1 protein_id gnl|my_center|LOCUS_22340 239281 240840 gene locus_tag LOCUS_22350 gene glpD 239281 240840 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456665.1 protein_id gnl|my_center|LOCUS_22350 241052 243151 gene locus_tag LOCUS_22360 241052 243151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 243082 246708 gene locus_tag LOCUS_22370 gene sslE 243082 246708 CDS product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034469.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 246875 247999 gene locus_tag LOCUS_22380 gene mltC 246875 247999 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419348.1 protein_id gnl|my_center|LOCUS_22380 248717 248115 gene locus_tag LOCUS_22390 248717 248115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 249300 248686 gene locus_tag LOCUS_22400 249300 248686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22400 249419 250051 gene locus_tag LOCUS_22410 249419 250051 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456648.1 protein_id gnl|my_center|LOCUS_22410 250701 250090 gene locus_tag LOCUS_22420 250701 250090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 251175 250843 gene locus_tag LOCUS_22430 251175 250843 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456696.1 protein_id gnl|my_center|LOCUS_22430 251353 252351 gene locus_tag LOCUS_22440 251353 252351 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456547.1 protein_id gnl|my_center|LOCUS_22440 253591 252533 gene locus_tag LOCUS_22450 gene galM 253591 252533 CDS product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625973.1 protein_id gnl|my_center|LOCUS_22450 254804 253644 gene locus_tag LOCUS_22460 gene galK 254804 253644 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_22460 256058 255006 gene locus_tag LOCUS_22470 256058 255006 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482347.1 protein_id gnl|my_center|LOCUS_22470 257228 256209 gene locus_tag LOCUS_22480 gene galE 257228 256209 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 protein_id gnl|my_center|LOCUS_22480 257811 259583 gene locus_tag LOCUS_22490 gene mrdA 257811 259583 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493014.1 protein_id gnl|my_center|LOCUS_22490 259827 260813 gene locus_tag LOCUS_22500 gene ebgR 259827 260813 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482344.1 protein_id gnl|my_center|LOCUS_22500 261157 264255 gene locus_tag LOCUS_22510 gene ebgA 261157 264255 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482309.1 protein_id gnl|my_center|LOCUS_22510 264259 264708 gene locus_tag LOCUS_22520 264259 264708 CDS product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482306.1 protein_id gnl|my_center|LOCUS_22520 264798 266231 gene locus_tag LOCUS_22530 264798 266231 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704219.1 protein_id gnl|my_center|LOCUS_22530 267258 266332 gene locus_tag LOCUS_22540 267258 266332 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106053.1 protein_id gnl|my_center|LOCUS_22540 267371 268510 gene locus_tag LOCUS_22550 gene chrA 267371 268510 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482338.1 protein_id gnl|my_center|LOCUS_22550 268732 268580 gene locus_tag LOCUS_22560 268732 268580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 270732 269719 gene locus_tag LOCUS_22570 270732 269719 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450998.1 protein_id gnl|my_center|LOCUS_22570 271692 270748 gene locus_tag LOCUS_22580 271692 270748 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456630.1 protein_id gnl|my_center|LOCUS_22580 272663 271695 gene locus_tag LOCUS_22590 272663 271695 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456615.1 protein_id gnl|my_center|LOCUS_22590 274115 272673 gene locus_tag LOCUS_22600 274115 272673 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456652.1 protein_id gnl|my_center|LOCUS_22600 275339 274131 gene locus_tag LOCUS_22610 275339 274131 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456628.1 protein_id gnl|my_center|LOCUS_22610 275870 275352 gene locus_tag LOCUS_22620 275870 275352 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456608.1 protein_id gnl|my_center|LOCUS_22620 276343 275867 gene locus_tag LOCUS_22630 276343 275867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 276573 276343 gene locus_tag LOCUS_22640 276573 276343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22640 277643 276609 gene locus_tag LOCUS_22650 277643 276609 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451008.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22650 277900 277673 gene locus_tag LOCUS_22660 277900 277673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482341.1 protein_id gnl|my_center|LOCUS_22660 278682 277915 gene locus_tag LOCUS_22670 278682 277915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 279395 278739 gene locus_tag LOCUS_22680 279395 278739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22680 280095 279403 gene locus_tag LOCUS_22690 gene cpaB 280095 279403 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_22690 281488 280049 gene locus_tag LOCUS_22700 281488 280049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456587.1 protein_id gnl|my_center|LOCUS_22700 282031 281549 gene locus_tag LOCUS_22710 282031 281549 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482299.1 protein_id gnl|my_center|LOCUS_22710 282218 282045 gene locus_tag LOCUS_22720 282218 282045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456688.1 protein_id gnl|my_center|LOCUS_22720 282559 283284 gene locus_tag LOCUS_22730 282559 283284 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456623.1 protein_id gnl|my_center|LOCUS_22730 283412 285103 gene locus_tag LOCUS_22740 283412 285103 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456535.1 protein_id gnl|my_center|LOCUS_22740 285382 285173 gene locus_tag LOCUS_22750 285382 285173 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456575.1 protein_id gnl|my_center|LOCUS_22750 285480 286409 gene locus_tag LOCUS_22760 285480 286409 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456619.1 protein_id gnl|my_center|LOCUS_22760 288602 286515 gene locus_tag LOCUS_22770 gene fusA 288602 286515 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_22770 290199 288820 gene locus_tag LOCUS_22780 gene radA 290199 288820 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 protein_id gnl|my_center|LOCUS_22780 290351 290782 gene locus_tag LOCUS_22790 290351 290782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22790 290761 292701 gene locus_tag LOCUS_22800 290761 292701 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481588.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22800 293737 292757 gene locus_tag LOCUS_22810 gene serB 293737 292757 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481549.1 protein_id gnl|my_center|LOCUS_22810 293829 294434 gene locus_tag LOCUS_22820 293829 294434 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481596.1 protein_id gnl|my_center|LOCUS_22820 295230 294511 gene locus_tag LOCUS_22830 gene deoD 295230 294511 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456104.1 protein_id gnl|my_center|LOCUS_22830 296595 295375 gene locus_tag LOCUS_22840 296595 295375 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456086.1 protein_id gnl|my_center|LOCUS_22840 297988 296660 gene locus_tag LOCUS_22850 gene deoA 297988 296660 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456100.1 protein_id gnl|my_center|LOCUS_22850 298863 298087 gene locus_tag LOCUS_22860 gene deoC 298863 298087 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456105.1 protein_id gnl|my_center|LOCUS_22860 300728 299445 gene locus_tag LOCUS_22870 300728 299445 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 protein_id gnl|my_center|LOCUS_22870 301250 300933 gene locus_tag LOCUS_22880 301250 300933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 301708 301199 gene locus_tag LOCUS_22890 301708 301199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22890 301862 301695 gene locus_tag LOCUS_22900 301862 301695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 303572 301983 gene locus_tag LOCUS_22910 gene prfC 303572 301983 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456063.1 protein_id gnl|my_center|LOCUS_22910 303962 303693 gene locus_tag LOCUS_22920 303962 303693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 304768 303941 gene locus_tag LOCUS_22930 304768 303941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22930 305395 304940 gene locus_tag LOCUS_22940 gene rimI 305395 304940 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481582.1 protein_id gnl|my_center|LOCUS_22940 305806 305408 gene locus_tag LOCUS_22950 305806 305408 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456107.1 protein_id gnl|my_center|LOCUS_22950 305870 306322 gene locus_tag LOCUS_22960 305870 306322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456073.1 protein_id gnl|my_center|LOCUS_22960 306898 306395 gene locus_tag LOCUS_22970 306898 306395 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456061.1 protein_id gnl|my_center|LOCUS_22970 307295 306882 gene locus_tag LOCUS_22980 307295 306882 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456068.1 protein_id gnl|my_center|LOCUS_22980 307767 309710 gene locus_tag LOCUS_22990 307767 309710 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456059.1 protein_id gnl|my_center|LOCUS_22990 309861 310874 gene locus_tag LOCUS_23000 309861 310874 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456088.1 protein_id gnl|my_center|LOCUS_23000 310865 311773 gene locus_tag LOCUS_23010 310865 311773 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481567.1 protein_id gnl|my_center|LOCUS_23010 313190 311844 gene locus_tag LOCUS_23020 gene vmrA 313190 311844 CDS product sodium-coupled multidrug efflux MATE transporter VmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481584.1 protein_id gnl|my_center|LOCUS_23020 313661 313248 gene locus_tag LOCUS_23030 313661 313248 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481594.1 protein_id gnl|my_center|LOCUS_23030 314677 313760 gene locus_tag LOCUS_23040 gene nlpI 314677 313760 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481586.1 protein_id gnl|my_center|LOCUS_23040 316990 314858 gene locus_tag LOCUS_23050 gene pnp 316990 314858 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 protein_id gnl|my_center|LOCUS_23050 317582 317313 gene locus_tag LOCUS_23060 gene rpsO 317582 317313 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456110.1 protein_id gnl|my_center|LOCUS_23060 318677 317733 gene locus_tag LOCUS_23070 gene truB 318677 317733 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481564.1 protein_id gnl|my_center|LOCUS_23070 319084 318677 gene locus_tag LOCUS_23080 gene rbfA 319084 318677 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 protein_id gnl|my_center|LOCUS_23080 321879 319195 gene locus_tag LOCUS_23090 gene infB 321879 319195 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 protein_id gnl|my_center|LOCUS_23090 323388 321901 gene locus_tag LOCUS_23100 gene nusA 323388 321901 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456069.1 protein_id gnl|my_center|LOCUS_23100 323880 323425 gene locus_tag LOCUS_23110 gene rimP 323880 323425 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 protein_id gnl|my_center|LOCUS_23110 324185 324109 gene locus_tag LOCUS_t00500 324185 324109 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 324325 324242 gene locus_tag LOCUS_t00510 324325 324242 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 324684 324343 gene locus_tag LOCUS_23120 gene secG 324684 324343 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481580.1 protein_id gnl|my_center|LOCUS_23120 326248 324908 gene locus_tag LOCUS_23130 gene glmM 326248 324908 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481562.1 protein_id gnl|my_center|LOCUS_23130 327113 326268 gene locus_tag LOCUS_23140 gene folP 327113 326268 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481601.1 protein_id gnl|my_center|LOCUS_23140 329156 327168 gene locus_tag LOCUS_23150 gene ftsH 329156 327168 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021447645.1 protein_id gnl|my_center|LOCUS_23150 329885 329256 gene locus_tag LOCUS_23160 gene rlmE 329885 329256 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480463.1 protein_id gnl|my_center|LOCUS_23160 330024 330320 gene locus_tag LOCUS_23170 gene yhbY 330024 330320 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 protein_id gnl|my_center|LOCUS_23170 330860 330387 gene locus_tag LOCUS_23180 gene greA 330860 330387 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485311.1 protein_id gnl|my_center|LOCUS_23180 331397 332416 gene locus_tag LOCUS_23190 331397 332416 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490380.1 protein_id gnl|my_center|LOCUS_23190 332575 333954 gene locus_tag LOCUS_23200 gene dacB 332575 333954 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479070.1 protein_id gnl|my_center|LOCUS_23200 334778 333933 gene locus_tag LOCUS_23210 334778 333933 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479095.1 protein_id gnl|my_center|LOCUS_23210 336390 335203 gene locus_tag LOCUS_23220 gene tyrS 336390 335203 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479092.1 protein_id gnl|my_center|LOCUS_23220 336520 337812 gene locus_tag LOCUS_23230 336520 337812 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490383.1 protein_id gnl|my_center|LOCUS_23230 340985 337851 gene locus_tag LOCUS_23240 gene vmeK 340985 337851 CDS product multidrug efflux RND transporter permease subunit VmeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_23240 342110 340995 gene locus_tag LOCUS_23250 gene vmeJ 342110 340995 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_23250 342567 342226 gene locus_tag LOCUS_23260 gene erpA 342567 342226 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461279.1 protein_id gnl|my_center|LOCUS_23260 342814 344109 gene locus_tag LOCUS_23270 gene hemL 342814 344109 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479079.1 protein_id gnl|my_center|LOCUS_23270 344469 345554 gene locus_tag LOCUS_23280 344469 345554 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 protein_id gnl|my_center|LOCUS_23280 345631 346653 gene locus_tag LOCUS_23290 gene rsmC 345631 346653 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479074.1 protein_id gnl|my_center|LOCUS_23290 346882 349854 gene locus_tag LOCUS_23300 346882 349854 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461251.1 protein_id gnl|my_center|LOCUS_23300 349847 350269 gene locus_tag LOCUS_23310 349847 350269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23310 >Feature sequence023 1069 2751 gene locus_tag LOCUS_23320 1069 2751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461274.1 protein_id gnl|my_center|LOCUS_23320 2923 3909 gene locus_tag LOCUS_23330 2923 3909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461259.1 protein_id gnl|my_center|LOCUS_23330 3912 4937 gene locus_tag LOCUS_23340 3912 4937 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461261.1 protein_id gnl|my_center|LOCUS_23340 4940 5923 gene locus_tag LOCUS_23350 4940 5923 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 protein_id gnl|my_center|LOCUS_23350 5972 6967 gene locus_tag LOCUS_23360 5972 6967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461254.1 protein_id gnl|my_center|LOCUS_23360 7038 8777 gene locus_tag LOCUS_23370 7038 8777 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479087.1 protein_id gnl|my_center|LOCUS_23370 8780 9670 gene locus_tag LOCUS_23380 8780 9670 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479072.1 protein_id gnl|my_center|LOCUS_23380 9679 11598 gene locus_tag LOCUS_23390 9679 11598 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461264.1 protein_id gnl|my_center|LOCUS_23390 11685 14093 gene locus_tag LOCUS_23400 11685 14093 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461246.1 protein_id gnl|my_center|LOCUS_23400 14219 15631 gene locus_tag LOCUS_23410 14219 15631 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479097.1 protein_id gnl|my_center|LOCUS_23410 16759 15728 gene locus_tag LOCUS_23420 16759 15728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 protein_id gnl|my_center|LOCUS_23420 18384 16759 gene locus_tag LOCUS_23430 18384 16759 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461269.1 protein_id gnl|my_center|LOCUS_23430 19497 18484 gene locus_tag LOCUS_23440 19497 18484 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479089.1 protein_id gnl|my_center|LOCUS_23440 20880 19651 gene locus_tag LOCUS_23450 20880 19651 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_23450 21244 20906 gene locus_tag LOCUS_23460 21244 20906 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386570.1 protein_id gnl|my_center|LOCUS_23460 21801 21433 gene locus_tag LOCUS_23470 21801 21433 CDS product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490395.1 protein_id gnl|my_center|LOCUS_23470 21854 22024 gene locus_tag LOCUS_23480 21854 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 24866 22278 gene locus_tag LOCUS_23490 gene acnB 24866 22278 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032551753.1 protein_id gnl|my_center|LOCUS_23490 27389 25137 gene locus_tag LOCUS_23500 27389 25137 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480207.1 protein_id gnl|my_center|LOCUS_23500 29930 27540 gene locus_tag LOCUS_23510 gene mrcB 29930 27540 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480205.1 protein_id gnl|my_center|LOCUS_23510 32424 29923 gene locus_tag LOCUS_23520 gene hrpB 32424 29923 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480202.1 protein_id gnl|my_center|LOCUS_23520 32458 32721 gene locus_tag LOCUS_23530 32458 32721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23530 32745 33173 gene locus_tag LOCUS_23540 32745 33173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23540 33310 33756 gene locus_tag LOCUS_23550 gene dksA 33310 33756 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490361.1 protein_id gnl|my_center|LOCUS_23550 33845 34708 gene locus_tag LOCUS_23560 gene gluQRS 33845 34708 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490360.1 protein_id gnl|my_center|LOCUS_23560 34853 36178 gene locus_tag LOCUS_23570 gene pcnB 34853 36178 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015297242.1 protein_id gnl|my_center|LOCUS_23570 36175 36660 gene locus_tag LOCUS_23580 gene folK 36175 36660 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_23580 36685 37479 gene locus_tag LOCUS_23590 gene panB 36685 37479 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454450.1 protein_id gnl|my_center|LOCUS_23590 37491 38393 gene locus_tag LOCUS_23600 gene panC 37491 38393 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454448.1 protein_id gnl|my_center|LOCUS_23600 39384 38455 gene locus_tag LOCUS_23610 gene lpxL 39384 38455 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490362.1 protein_id gnl|my_center|LOCUS_23610 39939 39526 gene locus_tag LOCUS_23620 39939 39526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23620 40298 39924 gene locus_tag LOCUS_23630 40298 39924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23630 41215 40298 gene locus_tag LOCUS_23640 41215 40298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462584.1 protein_id gnl|my_center|LOCUS_23640 43126 41456 gene locus_tag LOCUS_23650 43126 41456 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479694.1 protein_id gnl|my_center|LOCUS_23650 43411 44079 gene locus_tag LOCUS_23660 gene can 43411 44079 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462578.1 protein_id gnl|my_center|LOCUS_23660 44698 44168 gene locus_tag LOCUS_23670 gene hpt 44698 44168 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479701.1 protein_id gnl|my_center|LOCUS_23670 45018 45632 gene locus_tag LOCUS_23680 gene opaR 45018 45632 CDS product transcriptional regulator OpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479697.1 protein_id gnl|my_center|LOCUS_23680 47384 45954 gene locus_tag LOCUS_23690 gene lpdA 47384 45954 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479684.1 protein_id gnl|my_center|LOCUS_23690 49535 47628 gene locus_tag LOCUS_23700 gene aceF 49535 47628 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262618.1 protein_id gnl|my_center|LOCUS_23700 52229 49566 gene locus_tag LOCUS_23710 gene aceE 52229 49566 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262619.1 protein_id gnl|my_center|LOCUS_23710 53052 52285 gene locus_tag LOCUS_23720 gene pdhR 53052 52285 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009602124.1 protein_id gnl|my_center|LOCUS_23720 54008 53457 gene locus_tag LOCUS_23730 gene ampD 54008 53457 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479703.1 protein_id gnl|my_center|LOCUS_23730 54101 54988 gene locus_tag LOCUS_23740 gene nadC 54101 54988 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479699.1 protein_id gnl|my_center|LOCUS_23740 55216 55674 gene locus_tag LOCUS_23750 55216 55674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 55674 57359 gene locus_tag LOCUS_23760 gene pilB 55674 57359 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479695.1 protein_id gnl|my_center|LOCUS_23760 57375 58598 gene locus_tag LOCUS_23770 57375 58598 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479682.1 protein_id gnl|my_center|LOCUS_23770 58669 59274 gene locus_tag LOCUS_23780 58669 59274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23780 59223 59537 gene locus_tag LOCUS_23790 59223 59537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23790 59538 60152 gene locus_tag LOCUS_23800 gene coaE 59538 60152 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480887.1 protein_id gnl|my_center|LOCUS_23800 60181 60921 gene locus_tag LOCUS_23810 gene zapD 60181 60921 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480890.1 protein_id gnl|my_center|LOCUS_23810 60985 61179 gene locus_tag LOCUS_23820 gene yacG 60985 61179 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462546.1 protein_id gnl|my_center|LOCUS_23820 62110 61757 gene locus_tag LOCUS_23830 gene rplS 62110 61757 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462554.1 protein_id gnl|my_center|LOCUS_23830 62895 62152 gene locus_tag LOCUS_23840 gene trmD 62895 62152 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462562.1 protein_id gnl|my_center|LOCUS_23840 63471 62923 gene locus_tag LOCUS_23850 gene rimM 63471 62923 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462552.1 protein_id gnl|my_center|LOCUS_23850 63749 63501 gene locus_tag LOCUS_23860 gene rpsP 63749 63501 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 protein_id gnl|my_center|LOCUS_23860 65342 63960 gene locus_tag LOCUS_23870 gene ffh 65342 63960 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 protein_id gnl|my_center|LOCUS_23870 65576 65442 gene locus_tag LOCUS_23880 65576 65442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 65557 66351 gene locus_tag LOCUS_23890 65557 66351 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462565.1 protein_id gnl|my_center|LOCUS_23890 66507 67781 gene locus_tag LOCUS_23900 66507 67781 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence024 818 300 gene locus_tag LOCUS_23910 gene luxS 818 300 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 protein_id gnl|my_center|LOCUS_23910 1501 896 gene locus_tag LOCUS_23920 1501 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480904.1 protein_id gnl|my_center|LOCUS_23920 3089 1521 gene locus_tag LOCUS_23930 gene gshA 3089 1521 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462538.1 protein_id gnl|my_center|LOCUS_23930 5670 3253 gene locus_tag LOCUS_23940 5670 3253 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106066.1 protein_id gnl|my_center|LOCUS_23940 6098 5676 gene locus_tag LOCUS_23950 6098 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23950 6569 6108 gene locus_tag LOCUS_23960 6569 6108 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462564.1 protein_id gnl|my_center|LOCUS_23960 6811 6563 gene locus_tag LOCUS_23970 6811 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23970 7512 6826 gene locus_tag LOCUS_23980 7512 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23980 8791 7661 gene locus_tag LOCUS_23990 8791 7661 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_23990 10594 8801 gene locus_tag LOCUS_24000 gene oadA 10594 8801 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_24000 10884 10627 gene locus_tag LOCUS_24010 10884 10627 CDS product oxaloacetate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106067.1 protein_id gnl|my_center|LOCUS_24010 11555 11479 gene locus_tag LOCUS_t00520 11555 11479 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11690 11614 gene locus_tag LOCUS_t00530 11690 11614 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11825 11749 gene locus_tag LOCUS_t00540 11825 11749 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 99 23 gene locus_tag LOCUS_t00550 99 23 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 234 158 gene locus_tag LOCUS_t00560 234 158 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 368 292 gene locus_tag LOCUS_t00570 368 292 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 501 425 gene locus_tag LOCUS_t00580 501 425 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 678 587 gene locus_tag LOCUS_t00590 678 587 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 784 708 gene locus_tag LOCUS_t00600 784 708 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 906 815 gene locus_tag LOCUS_t00610 906 815 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1347 1150 gene locus_tag LOCUS_24020 gene csrA 1347 1150 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 protein_id gnl|my_center|LOCUS_24020 2627 1440 gene locus_tag LOCUS_24030 2627 1440 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478552.1 protein_id gnl|my_center|LOCUS_24030 5413 2831 gene locus_tag LOCUS_24040 gene alaS 5413 2831 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455546.1 protein_id gnl|my_center|LOCUS_24040 6023 5553 gene locus_tag LOCUS_24050 gene recX 6023 5553 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 protein_id gnl|my_center|LOCUS_24050 7272 6229 gene locus_tag LOCUS_24060 gene recA 7272 6229 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478550.1 protein_id gnl|my_center|LOCUS_24060 7937 7473 gene locus_tag LOCUS_24070 gene pncC 7937 7473 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_24070 8068 10602 gene locus_tag LOCUS_24080 gene mutS 8068 10602 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478546.1 protein_id gnl|my_center|LOCUS_24080 11677 10691 gene locus_tag LOCUS_24090 gene rpoS 11677 10691 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393877.1 protein_id gnl|my_center|LOCUS_24090 12669 11758 gene locus_tag LOCUS_24100 12669 11758 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_24100 13310 12684 gene locus_tag LOCUS_24110 13310 12684 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455562.1 protein_id gnl|my_center|LOCUS_24110 14086 13310 gene locus_tag LOCUS_24120 gene surE 14086 13310 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 protein_id gnl|my_center|LOCUS_24120 15129 14086 gene locus_tag LOCUS_24130 gene truD 15129 14086 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478539.1 protein_id gnl|my_center|LOCUS_24130 15651 15175 gene locus_tag LOCUS_24140 gene ispF 15651 15175 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380896.1 protein_id gnl|my_center|LOCUS_24140 16376 15666 gene locus_tag LOCUS_24150 gene ispD 16376 15666 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_24150 16659 16378 gene locus_tag LOCUS_24160 gene ftsB 16659 16378 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455577.1 protein_id gnl|my_center|LOCUS_24160 18327 17026 gene locus_tag LOCUS_24170 gene eno 18327 17026 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455579.1 protein_id gnl|my_center|LOCUS_24170 20046 18406 gene locus_tag LOCUS_24180 20046 18406 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455581.1 protein_id gnl|my_center|LOCUS_24180 20995 20198 gene locus_tag LOCUS_24190 gene mazG 20995 20198 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477361.1 protein_id gnl|my_center|LOCUS_24190 23438 21219 gene locus_tag LOCUS_24200 gene relA 23438 21219 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490307.1 protein_id gnl|my_center|LOCUS_24200 24882 23563 gene locus_tag LOCUS_24210 gene rlmD 24882 23563 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482575.1 protein_id gnl|my_center|LOCUS_24210 25075 27873 gene locus_tag LOCUS_24220 gene barA 25075 27873 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482572.1 protein_id gnl|my_center|LOCUS_24220 28353 27973 gene locus_tag LOCUS_24230 gene acpS 28353 27973 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_24230 29097 28366 gene locus_tag LOCUS_24240 gene pdxJ 29097 28366 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482574.1 protein_id gnl|my_center|LOCUS_24240 29825 29094 gene locus_tag LOCUS_24250 gene recO 29825 29094 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482573.1 protein_id gnl|my_center|LOCUS_24250 30916 29954 gene locus_tag LOCUS_24260 gene era 30916 29954 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460684.1 protein_id gnl|my_center|LOCUS_24260 31586 30909 gene locus_tag LOCUS_24270 gene rnc 31586 30909 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_24270 32507 31608 gene locus_tag LOCUS_24280 gene lepB 32507 31608 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460682.1 protein_id gnl|my_center|LOCUS_24280 34405 32612 gene locus_tag LOCUS_24290 gene lepA 34405 32612 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460681.1 protein_id gnl|my_center|LOCUS_24290 35003 34533 gene locus_tag LOCUS_24300 35003 34533 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490334.1 protein_id gnl|my_center|LOCUS_24300 35965 35000 gene locus_tag LOCUS_24310 gene rseB 35965 35000 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490311.1 protein_id gnl|my_center|LOCUS_24310 36600 35962 gene locus_tag LOCUS_24320 36600 35962 CDS product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481241.1 protein_id gnl|my_center|LOCUS_24320 37191 36613 gene locus_tag LOCUS_24330 gene rpoE 37191 36613 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_24330 37750 39357 gene locus_tag LOCUS_24340 gene nadB 37750 39357 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490333.1 protein_id gnl|my_center|LOCUS_24340 40008 39748 gene locus_tag LOCUS_24350 40008 39748 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458651.1 protein_id gnl|my_center|LOCUS_24350 40245 41213 gene locus_tag LOCUS_24360 gene ygfZ 40245 41213 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481243.1 protein_id gnl|my_center|LOCUS_24360 41206 41679 gene locus_tag LOCUS_24370 41206 41679 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481229.1 protein_id gnl|my_center|LOCUS_24370 42325 42531 gene locus_tag LOCUS_24380 42325 42531 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380970.1 protein_id gnl|my_center|LOCUS_24380 43819 42611 gene locus_tag LOCUS_24390 43819 42611 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 protein_id gnl|my_center|LOCUS_24390 45026 43848 gene locus_tag LOCUS_24400 gene ubiH 45026 43848 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481244.1 protein_id gnl|my_center|LOCUS_24400 45646 45068 gene locus_tag LOCUS_24410 45646 45068 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457285.1 protein_id gnl|my_center|LOCUS_24410 45896 46204 gene locus_tag LOCUS_24420 45896 46204 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484120.1 protein_id gnl|my_center|LOCUS_24420 46403 46996 gene locus_tag LOCUS_24430 46403 46996 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482482.1 protein_id gnl|my_center|LOCUS_24430 47055 47711 gene locus_tag LOCUS_24440 gene rpiA 47055 47711 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482455.1 protein_id gnl|my_center|LOCUS_24440 47970 49199 gene locus_tag LOCUS_24450 gene serA 47970 49199 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482463.1 protein_id gnl|my_center|LOCUS_24450 49967 49275 gene locus_tag LOCUS_24460 49967 49275 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482489.1 protein_id gnl|my_center|LOCUS_24460 50970 50074 gene locus_tag LOCUS_24470 50970 50074 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482449.1 protein_id gnl|my_center|LOCUS_24470 51111 51740 gene locus_tag LOCUS_24480 51111 51740 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482474.1 protein_id gnl|my_center|LOCUS_24480 51765 52247 gene locus_tag LOCUS_24490 51765 52247 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482492.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence026 1204 338 gene locus_tag LOCUS_24500 gene mscS 1204 338 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_24500 2737 1661 gene locus_tag LOCUS_24510 gene fbaA 2737 1661 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417587.1 protein_id gnl|my_center|LOCUS_24510 4053 2893 gene locus_tag LOCUS_24520 4053 2893 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482432.1 protein_id gnl|my_center|LOCUS_24520 5244 4207 gene locus_tag LOCUS_24530 gene epd 5244 4207 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461726.1 protein_id gnl|my_center|LOCUS_24530 5444 5680 gene locus_tag LOCUS_24540 5444 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 7740 5731 gene locus_tag LOCUS_24550 gene tkt 7740 5731 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482487.1 protein_id gnl|my_center|LOCUS_24550 8109 9263 gene locus_tag LOCUS_24560 gene metK 8109 9263 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461723.1 protein_id gnl|my_center|LOCUS_24560 9545 10342 gene locus_tag LOCUS_24570 9545 10342 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_24570 10410 10907 gene locus_tag LOCUS_24580 10410 10907 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461721.1 protein_id gnl|my_center|LOCUS_24580 11058 10885 gene locus_tag LOCUS_24590 11058 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 11057 11752 gene locus_tag LOCUS_24600 gene endA 11057 11752 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461720.1 protein_id gnl|my_center|LOCUS_24600 11899 12630 gene locus_tag LOCUS_24610 gene rsmE 11899 12630 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 protein_id gnl|my_center|LOCUS_24610 12644 13594 gene locus_tag LOCUS_24620 gene gshB 12644 13594 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 protein_id gnl|my_center|LOCUS_24620 13717 14286 gene locus_tag LOCUS_24630 13717 14286 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_24630 14334 14759 gene locus_tag LOCUS_24640 gene ruvX 14334 14759 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461715.1 protein_id gnl|my_center|LOCUS_24640 15928 14822 gene locus_tag LOCUS_24650 15928 14822 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461714.1 protein_id gnl|my_center|LOCUS_24650 16998 15958 gene locus_tag LOCUS_24660 16998 15958 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461712.1 protein_id gnl|my_center|LOCUS_24660 17027 17737 gene locus_tag LOCUS_24670 17027 17737 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461710.1 protein_id gnl|my_center|LOCUS_24670 17869 18687 gene locus_tag LOCUS_24680 gene proC 17869 18687 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482485.1 protein_id gnl|my_center|LOCUS_24680 18741 19298 gene locus_tag LOCUS_24690 18741 19298 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087263.1 protein_id gnl|my_center|LOCUS_24690 19298 19588 gene locus_tag LOCUS_24700 gene yggU 19298 19588 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482461.1 protein_id gnl|my_center|LOCUS_24700 19648 20079 gene locus_tag LOCUS_24710 19648 20079 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461703.1 protein_id gnl|my_center|LOCUS_24710 20238 20840 gene locus_tag LOCUS_24720 20238 20840 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 protein_id gnl|my_center|LOCUS_24720 20859 22031 gene locus_tag LOCUS_24730 gene hemW 20859 22031 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482442.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence027 1072 152 gene locus_tag LOCUS_24740 gene glsB 1072 152 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482494.1 protein_id gnl|my_center|LOCUS_24740 2203 1175 gene locus_tag LOCUS_24750 2203 1175 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482466.1 protein_id gnl|my_center|LOCUS_24750 2934 2215 gene locus_tag LOCUS_24760 gene trmB 2934 2215 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482471.1 protein_id gnl|my_center|LOCUS_24760 3138 4214 gene locus_tag LOCUS_24770 gene mutY 3138 4214 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482480.1 protein_id gnl|my_center|LOCUS_24770 4234 4506 gene locus_tag LOCUS_24780 4234 4506 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482430.1 protein_id gnl|my_center|LOCUS_24780 4593 5723 gene locus_tag LOCUS_24790 gene mltC 4593 5723 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 protein_id gnl|my_center|LOCUS_24790 5833 5908 gene locus_tag LOCUS_t00620 5833 5908 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5974 6049 gene locus_tag LOCUS_t00630 5974 6049 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6057 6132 gene locus_tag LOCUS_t00640 6057 6132 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6175 6250 gene locus_tag LOCUS_t00650 6175 6250 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6321 6396 gene locus_tag LOCUS_t00660 6321 6396 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6404 6479 gene locus_tag LOCUS_t00670 6404 6479 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6522 6597 gene locus_tag LOCUS_t00680 6522 6597 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6892 8517 gene locus_tag LOCUS_24800 6892 8517 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106074.1 protein_id gnl|my_center|LOCUS_24800 8752 8827 gene locus_tag LOCUS_t00690 8752 8827 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8879 8954 gene locus_tag LOCUS_t00700 8879 8954 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8976 9051 gene locus_tag LOCUS_t00710 8976 9051 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9092 9167 gene locus_tag LOCUS_t00720 9092 9167 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9183 9258 gene locus_tag LOCUS_t00730 9183 9258 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10850 9414 gene locus_tag LOCUS_24810 10850 9414 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482428.1 protein_id gnl|my_center|LOCUS_24810 11561 11484 gene locus_tag LOCUS_t00740 11561 11484 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11708 11597 gene locus_tag LOCUS_r00030 11708 11597 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence028 1649 522 gene locus_tag LOCUS_24820 1649 522 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461085.1 protein_id gnl|my_center|LOCUS_24820 2880 1882 gene locus_tag LOCUS_24830 2880 1882 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461087.1 protein_id gnl|my_center|LOCUS_24830 3739 2984 gene locus_tag LOCUS_24840 gene chbG 3739 2984 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461089.1 protein_id gnl|my_center|LOCUS_24840 5079 3757 gene locus_tag LOCUS_24850 5079 3757 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461090.1 protein_id gnl|my_center|LOCUS_24850 5401 5090 gene locus_tag LOCUS_24860 5401 5090 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461092.1 protein_id gnl|my_center|LOCUS_24860 6783 5449 gene locus_tag LOCUS_24870 6783 5449 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478832.1 protein_id gnl|my_center|LOCUS_24870 7177 6872 gene locus_tag LOCUS_24880 7177 6872 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478850.1 protein_id gnl|my_center|LOCUS_24880 8376 7582 gene locus_tag LOCUS_24890 8376 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 8846 8762 gene locus_tag LOCUS_t00750 8846 8762 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9669 9004 gene locus_tag LOCUS_24900 9669 9004 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478827.1 protein_id gnl|my_center|LOCUS_24900 9906 10385 gene locus_tag LOCUS_24910 9906 10385 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461101.1 protein_id gnl|my_center|LOCUS_24910 11529 10459 gene locus_tag LOCUS_24920 gene lptG 11529 10459 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 protein_id gnl|my_center|LOCUS_24920 12633 11533 gene locus_tag LOCUS_24930 gene lptF 12633 11533 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461105.1 protein_id gnl|my_center|LOCUS_24930 12834 14342 gene locus_tag LOCUS_24940 gene pepA 12834 14342 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461107.1 protein_id gnl|my_center|LOCUS_24940 14458 14907 gene locus_tag LOCUS_24950 14458 14907 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106076.1 protein_id gnl|my_center|LOCUS_24950 15002 15613 gene locus_tag LOCUS_24960 15002 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 15592 17859 gene locus_tag LOCUS_24970 15592 17859 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478852.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24970 18086 18484 gene locus_tag LOCUS_24980 18086 18484 CDS product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455908.1 protein_id gnl|my_center|LOCUS_24980 18600 19505 gene locus_tag LOCUS_24990 18600 19505 CDS product bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455096.1 protein_id gnl|my_center|LOCUS_24990 20322 19522 gene locus_tag LOCUS_25000 20322 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455097.1 protein_id gnl|my_center|LOCUS_25000 20889 20473 gene locus_tag LOCUS_25010 gene rraB 20889 20473 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455099.1 protein_id gnl|my_center|LOCUS_25010 21474 22694 gene locus_tag LOCUS_25020 gene arcA 21474 22694 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455102.1 protein_id gnl|my_center|LOCUS_25020 22852 23856 gene locus_tag LOCUS_25030 22852 23856 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 protein_id gnl|my_center|LOCUS_25030 24142 25071 gene locus_tag LOCUS_25040 gene pyrB 24142 25071 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 protein_id gnl|my_center|LOCUS_25040 25088 25549 gene locus_tag LOCUS_25050 gene pyrI 25088 25549 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455107.1 protein_id gnl|my_center|LOCUS_25050 25715 26104 gene locus_tag LOCUS_25060 25715 26104 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455108.1 protein_id gnl|my_center|LOCUS_25060 26915 26190 gene locus_tag LOCUS_25070 26915 26190 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455109.1 protein_id gnl|my_center|LOCUS_25070 28328 27063 gene locus_tag LOCUS_25080 gene murA 28328 27063 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455110.1 protein_id gnl|my_center|LOCUS_25080 28591 28337 gene locus_tag LOCUS_25090 gene ibaG 28591 28337 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455111.1 protein_id gnl|my_center|LOCUS_25090 28903 28595 gene locus_tag LOCUS_25100 28903 28595 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455113.1 protein_id gnl|my_center|LOCUS_25100 29541 28903 gene locus_tag LOCUS_25110 29541 28903 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478835.1 protein_id gnl|my_center|LOCUS_25110 30033 29545 gene locus_tag LOCUS_25120 gene mlaD 30033 29545 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455116.1 protein_id gnl|my_center|LOCUS_25120 30827 30036 gene locus_tag LOCUS_25130 gene mlaE 30827 30036 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 protein_id gnl|my_center|LOCUS_25130 31620 30817 gene locus_tag LOCUS_25140 gene mlaF 31620 30817 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 protein_id gnl|my_center|LOCUS_25140 32029 32994 gene locus_tag LOCUS_25150 32029 32994 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 protein_id gnl|my_center|LOCUS_25150 33030 34001 gene locus_tag LOCUS_25160 gene kdsD 33030 34001 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 protein_id gnl|my_center|LOCUS_25160 34209 34652 gene locus_tag LOCUS_25170 gene lptC 34209 34652 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467805.1 protein_id gnl|my_center|LOCUS_25170 34633 35124 gene locus_tag LOCUS_25180 gene lptA 34633 35124 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467803.1 protein_id gnl|my_center|LOCUS_25180 35126 35851 gene locus_tag LOCUS_25190 gene lptB 35126 35851 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_25190 35902 37377 gene locus_tag LOCUS_25200 35902 37377 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 protein_id gnl|my_center|LOCUS_25200 37402 37689 gene locus_tag LOCUS_25210 gene hpf 37402 37689 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467451.1 protein_id gnl|my_center|LOCUS_25210 37692 38138 gene locus_tag LOCUS_25220 gene ptsN 37692 38138 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 protein_id gnl|my_center|LOCUS_25220 38153 39016 gene locus_tag LOCUS_25230 gene rapZ 38153 39016 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468663.1 protein_id gnl|my_center|LOCUS_25230 39019 39294 gene locus_tag LOCUS_25240 39019 39294 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468661.1 protein_id gnl|my_center|LOCUS_25240 39726 41081 gene locus_tag LOCUS_25250 gene mgtE 39726 41081 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478833.1 protein_id gnl|my_center|LOCUS_25250 42508 41165 gene locus_tag LOCUS_25260 gene pmbA 42508 41165 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478840.1 protein_id gnl|my_center|LOCUS_25260 42619 43143 gene locus_tag LOCUS_25270 gene yjgA 42619 43143 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457057.1 protein_id gnl|my_center|LOCUS_25270 44171 43209 gene locus_tag LOCUS_25280 44171 43209 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_25280 44956 44204 gene locus_tag LOCUS_25290 gene rluA 44956 44204 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478830.1 protein_id gnl|my_center|LOCUS_25290 45195 46460 gene locus_tag LOCUS_25300 45195 46460 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_25300 49462 46553 gene locus_tag LOCUS_25310 gene rapA 49462 46553 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461840.1 protein_id gnl|my_center|LOCUS_25310 50011 51387 gene locus_tag LOCUS_25320 50011 51387 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461836.1 protein_id gnl|my_center|LOCUS_25320 52947 51502 gene locus_tag LOCUS_25330 gene tldD 52947 51502 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461834.1 protein_id gnl|my_center|LOCUS_25330 53780 52959 gene locus_tag LOCUS_25340 53780 52959 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461832.1 protein_id gnl|my_center|LOCUS_25340 57704 53820 gene locus_tag LOCUS_25350 57704 53820 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478842.1 protein_id gnl|my_center|LOCUS_25350 59185 57716 gene locus_tag LOCUS_25360 gene rng 59185 57716 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 protein_id gnl|my_center|LOCUS_25360 59774 59205 gene locus_tag LOCUS_25370 59774 59205 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461824.1 protein_id gnl|my_center|LOCUS_25370 60267 59779 gene locus_tag LOCUS_25380 gene mreD 60267 59779 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461823.1 protein_id gnl|my_center|LOCUS_25380 61072 60257 gene locus_tag LOCUS_25390 gene mreC 61072 60257 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 protein_id gnl|my_center|LOCUS_25390 62371 61328 gene locus_tag LOCUS_25400 62371 61328 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381144.1 protein_id gnl|my_center|LOCUS_25400 67098 62521 gene locus_tag LOCUS_25410 67098 62521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 67537 67103 gene locus_tag LOCUS_25420 67537 67103 CDS product MSHA biogenesis protein MshP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480999.1 protein_id gnl|my_center|LOCUS_25420 68315 67527 gene locus_tag LOCUS_25430 68315 67527 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481003.1 protein_id gnl|my_center|LOCUS_25430 68893 68315 gene locus_tag LOCUS_25440 68893 68315 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 protein_id gnl|my_center|LOCUS_25440 69309 68890 gene locus_tag LOCUS_25450 69309 68890 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481001.1 protein_id gnl|my_center|LOCUS_25450 69696 69472 gene locus_tag LOCUS_25460 69696 69472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481019.1 protein_id gnl|my_center|LOCUS_25460 70245 69766 gene locus_tag LOCUS_25470 70245 69766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 70944 70483 gene locus_tag LOCUS_25480 70944 70483 CDS product MSHA biogenesis protein MshF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456302.1 protein_id gnl|my_center|LOCUS_25480 72168 70948 gene locus_tag LOCUS_25490 72168 70948 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_25490 73901 72177 gene locus_tag LOCUS_25500 73901 72177 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456306.1 protein_id gnl|my_center|LOCUS_25500 74983 73898 gene locus_tag LOCUS_25510 74983 73898 CDS product MSHA biogenesis protein MshN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480990.1 protein_id gnl|my_center|LOCUS_25510 75825 74980 gene locus_tag LOCUS_25520 75825 74980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456312.1 protein_id gnl|my_center|LOCUS_25520 77529 75862 gene locus_tag LOCUS_25530 gene mshL 77529 75862 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 protein_id gnl|my_center|LOCUS_25530 77882 77550 gene locus_tag LOCUS_25540 77882 77550 CDS product MSHA biogenesis protein MshK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481006.1 protein_id gnl|my_center|LOCUS_25540 78525 77875 gene locus_tag LOCUS_25550 gene gspM 78525 77875 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456325.1 protein_id gnl|my_center|LOCUS_25550 79904 78522 gene locus_tag LOCUS_25560 79904 78522 CDS product MSHA biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481017.1 protein_id gnl|my_center|LOCUS_25560 81988 79973 gene locus_tag LOCUS_25570 gene csrD 81988 79973 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106082.1 protein_id gnl|my_center|LOCUS_25570 82750 82205 gene locus_tag LOCUS_25580 82750 82205 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466625.1 protein_id gnl|my_center|LOCUS_25580 83028 83672 gene locus_tag LOCUS_25590 83028 83672 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480993.1 protein_id gnl|my_center|LOCUS_25590 83837 84643 gene locus_tag LOCUS_25600 gene galU 83837 84643 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466627.1 protein_id gnl|my_center|LOCUS_25600 84781 87603 gene locus_tag LOCUS_25610 gene uvrA 84781 87603 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 protein_id gnl|my_center|LOCUS_25610 88080 89453 gene locus_tag LOCUS_25620 88080 89453 CDS product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481013.1 protein_id gnl|my_center|LOCUS_25620 90632 89511 gene locus_tag LOCUS_25630 90632 89511 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_25630 91158 92510 gene locus_tag LOCUS_25640 gene lysC 91158 92510 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480997.1 protein_id gnl|my_center|LOCUS_25640 96258 92578 gene locus_tag LOCUS_25650 gene metH 96258 92578 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 protein_id gnl|my_center|LOCUS_25650 96450 97772 gene locus_tag LOCUS_25660 96450 97772 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106084.1 protein_id gnl|my_center|LOCUS_25660 98414 98338 gene locus_tag LOCUS_t00760 98414 98338 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 98560 98451 gene locus_tag LOCUS_r00040 98560 98451 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 98656 98581 gene locus_tag LOCUS_t00770 98656 98581 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 98868 98757 gene locus_tag LOCUS_r00050 98868 98757 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence029 1697 918 gene locus_tag LOCUS_25670 1697 918 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 protein_id gnl|my_center|LOCUS_25670 3426 1690 gene locus_tag LOCUS_25680 gene cysI 3426 1690 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455813.1 protein_id gnl|my_center|LOCUS_25680 5282 3426 gene locus_tag LOCUS_25690 5282 3426 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477367.1 protein_id gnl|my_center|LOCUS_25690 5629 5399 gene locus_tag LOCUS_25700 5629 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455817.1 protein_id gnl|my_center|LOCUS_25700 6450 5872 gene locus_tag LOCUS_25710 6450 5872 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455819.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25710 6765 6550 gene locus_tag LOCUS_25720 gene pspG 6765 6550 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455821.1 protein_id gnl|my_center|LOCUS_25720 7876 6929 gene locus_tag LOCUS_25730 gene dusA 7876 6929 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477377.1 protein_id gnl|my_center|LOCUS_25730 8189 8647 gene locus_tag LOCUS_25740 gene zur 8189 8647 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381268.1 protein_id gnl|my_center|LOCUS_25740 8665 9126 gene locus_tag LOCUS_25750 8665 9126 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381269.1 protein_id gnl|my_center|LOCUS_25750 10879 9227 gene locus_tag LOCUS_25760 gene pgi 10879 9227 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_25760 11186 11605 gene locus_tag LOCUS_25770 11186 11605 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_25770 12853 11657 gene locus_tag LOCUS_25780 12853 11657 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477374.1 protein_id gnl|my_center|LOCUS_25780 13942 12857 gene locus_tag LOCUS_25790 gene alr 13942 12857 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 protein_id gnl|my_center|LOCUS_25790 15346 14015 gene locus_tag LOCUS_25800 15346 14015 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455859.1 protein_id gnl|my_center|LOCUS_25800 15556 16320 gene locus_tag LOCUS_25810 15556 16320 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455861.1 protein_id gnl|my_center|LOCUS_25810 16858 16406 gene locus_tag LOCUS_25820 gene rplI 16858 16406 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 protein_id gnl|my_center|LOCUS_25820 17118 16891 gene locus_tag LOCUS_25830 gene rpsR 17118 16891 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090472.1 protein_id gnl|my_center|LOCUS_25830 17437 17135 gene locus_tag LOCUS_25840 gene priB 17437 17135 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467185.1 protein_id gnl|my_center|LOCUS_25840 17835 17446 gene locus_tag LOCUS_25850 gene rpsF 17835 17446 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381299.1 protein_id gnl|my_center|LOCUS_25850 18763 18092 gene locus_tag LOCUS_25860 gene rpe 18763 18092 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480446.1 protein_id gnl|my_center|LOCUS_25860 19702 18863 gene locus_tag LOCUS_25870 19702 18863 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 protein_id gnl|my_center|LOCUS_25870 21292 19772 gene locus_tag LOCUS_25880 21292 19772 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480444.1 protein_id gnl|my_center|LOCUS_25880 22444 21344 gene locus_tag LOCUS_25890 gene aroB 22444 21344 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 protein_id gnl|my_center|LOCUS_25890 22994 22476 gene locus_tag LOCUS_25900 gene aroK 22994 22476 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_25900 23456 23184 gene locus_tag LOCUS_25910 23456 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25910 24850 23489 gene locus_tag LOCUS_25920 24850 23489 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699327.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25920 25472 24957 gene locus_tag LOCUS_25930 25472 24957 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480477.1 protein_id gnl|my_center|LOCUS_25930 26055 25462 gene locus_tag LOCUS_25940 gene pilO 26055 25462 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480482.1 protein_id gnl|my_center|LOCUS_25940 26489 26052 gene locus_tag LOCUS_25950 26489 26052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 27636 26620 gene locus_tag LOCUS_25960 gene pilM 27636 26620 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480475.1 protein_id gnl|my_center|LOCUS_25960 27830 30343 gene locus_tag LOCUS_25970 27830 30343 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480476.1 protein_id gnl|my_center|LOCUS_25970 31330 30422 gene locus_tag LOCUS_25980 gene oxyR 31330 30422 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465160.1 protein_id gnl|my_center|LOCUS_25980 31505 32233 gene locus_tag LOCUS_25990 31505 32233 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_25990 34996 33122 gene locus_tag LOCUS_26000 gene argH 34996 33122 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 protein_id gnl|my_center|LOCUS_26000 36461 35247 gene locus_tag LOCUS_26010 36461 35247 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 protein_id gnl|my_center|LOCUS_26010 37343 36552 gene locus_tag LOCUS_26020 gene argB 37343 36552 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480488.1 protein_id gnl|my_center|LOCUS_26020 38369 37365 gene locus_tag LOCUS_26030 gene argC 38369 37365 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465147.1 protein_id gnl|my_center|LOCUS_26030 38514 39650 gene locus_tag LOCUS_26040 gene argE 38514 39650 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465145.1 protein_id gnl|my_center|LOCUS_26040 39923 42562 gene locus_tag LOCUS_26050 gene ppc 39923 42562 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465143.1 protein_id gnl|my_center|LOCUS_26050 42998 43537 gene locus_tag LOCUS_26060 42998 43537 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 protein_id gnl|my_center|LOCUS_26060 44510 43608 gene locus_tag LOCUS_26070 gene metF 44510 43608 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465139.1 protein_id gnl|my_center|LOCUS_26070 47190 44782 gene locus_tag LOCUS_26080 47190 44782 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465137.1 protein_id gnl|my_center|LOCUS_26080 47914 47207 gene locus_tag LOCUS_26090 47914 47207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26090 48369 47935 gene locus_tag LOCUS_26100 48369 47935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26100 48599 48919 gene locus_tag LOCUS_26110 gene metJ 48599 48919 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005432736.1 protein_id gnl|my_center|LOCUS_26110 50310 49033 gene locus_tag LOCUS_26120 50310 49033 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_26120 50995 50519 gene locus_tag LOCUS_26130 gene bfr 50995 50519 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395745.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence030 3376 1277 gene locus_tag LOCUS_26140 gene fusA 3376 1277 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 protein_id gnl|my_center|LOCUS_26140 3988 3518 gene locus_tag LOCUS_26150 gene rpsG 3988 3518 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488949.1 protein_id gnl|my_center|LOCUS_26150 4463 4089 gene locus_tag LOCUS_26160 gene rpsL 4463 4089 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_26160 4917 4642 gene locus_tag LOCUS_26170 gene tusB 4917 4642 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 protein_id gnl|my_center|LOCUS_26170 5281 4925 gene locus_tag LOCUS_26180 gene tusC 5281 4925 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458285.1 protein_id gnl|my_center|LOCUS_26180 5673 5278 gene locus_tag LOCUS_26190 gene tusD 5673 5278 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 protein_id gnl|my_center|LOCUS_26190 6392 5676 gene locus_tag LOCUS_26200 6392 5676 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438378.1 protein_id gnl|my_center|LOCUS_26200 7319 6537 gene locus_tag LOCUS_26210 gene fkpA 7319 6537 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 protein_id gnl|my_center|LOCUS_26210 7448 8434 gene locus_tag LOCUS_26220 7448 8434 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458292.1 protein_id gnl|my_center|LOCUS_26220 8431 8658 gene locus_tag LOCUS_26230 8431 8658 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458294.1 protein_id gnl|my_center|LOCUS_26230 9706 8753 gene locus_tag LOCUS_26240 9706 8753 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106089.1 protein_id gnl|my_center|LOCUS_26240 10400 9825 gene locus_tag LOCUS_26250 gene slyD 10400 9825 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464765.1 protein_id gnl|my_center|LOCUS_26250 10689 10489 gene locus_tag LOCUS_26260 10689 10489 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464767.1 protein_id gnl|my_center|LOCUS_26260 12521 10725 gene locus_tag LOCUS_26270 gene kefB 12521 10725 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480060.1 protein_id gnl|my_center|LOCUS_26270 13056 12505 gene locus_tag LOCUS_26280 gene kefG 13056 12505 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480062.1 protein_id gnl|my_center|LOCUS_26280 13270 15189 gene locus_tag LOCUS_26290 13270 15189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 protein_id gnl|my_center|LOCUS_26290 15186 15665 gene locus_tag LOCUS_26300 15186 15665 CDS product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458139.1 protein_id gnl|my_center|LOCUS_26300 15880 16887 gene locus_tag LOCUS_26310 15880 16887 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480025.1 protein_id gnl|my_center|LOCUS_26310 16950 17159 gene locus_tag LOCUS_26320 16950 17159 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480073.1 protein_id gnl|my_center|LOCUS_26320 17287 18156 gene locus_tag LOCUS_26330 17287 18156 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458134.1 protein_id gnl|my_center|LOCUS_26330 18396 19028 gene locus_tag LOCUS_26340 gene crp 18396 19028 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 protein_id gnl|my_center|LOCUS_26340 19968 19177 gene locus_tag LOCUS_26350 19968 19177 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480067.1 protein_id gnl|my_center|LOCUS_26350 21690 20233 gene locus_tag LOCUS_26360 gene astD 21690 20233 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480036.1 protein_id gnl|my_center|LOCUS_26360 22738 21719 gene locus_tag LOCUS_26370 gene astA 22738 21719 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480046.1 protein_id gnl|my_center|LOCUS_26370 24058 22847 gene locus_tag LOCUS_26380 24058 22847 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458126.1 protein_id gnl|my_center|LOCUS_26380 24247 24432 gene locus_tag LOCUS_26390 24247 24432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 25007 24429 gene locus_tag LOCUS_26400 25007 24429 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458124.1 protein_id gnl|my_center|LOCUS_26400 28142 25197 gene locus_tag LOCUS_26410 28142 25197 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488937.1 protein_id gnl|my_center|LOCUS_26410 29553 28516 gene locus_tag LOCUS_26420 gene trpS 29553 28516 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468382.1 protein_id gnl|my_center|LOCUS_26420 30355 29669 gene locus_tag LOCUS_26430 30355 29669 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 protein_id gnl|my_center|LOCUS_26430 31224 30481 gene locus_tag LOCUS_26440 gene rlmB 31224 30481 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480034.1 protein_id gnl|my_center|LOCUS_26440 33787 31301 gene locus_tag LOCUS_26450 gene rnr 33787 31301 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480076.1 protein_id gnl|my_center|LOCUS_26450 34093 33905 gene locus_tag LOCUS_26460 34093 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26460 34332 34081 gene locus_tag LOCUS_26470 34332 34081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26470 34444 35628 gene locus_tag LOCUS_26480 gene hmpA 34444 35628 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480052.1 protein_id gnl|my_center|LOCUS_26480 36370 35735 gene locus_tag LOCUS_26490 36370 35735 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480078.1 protein_id gnl|my_center|LOCUS_26490 37918 36602 gene locus_tag LOCUS_26500 37918 36602 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 protein_id gnl|my_center|LOCUS_26500 38092 38277 gene locus_tag LOCUS_26510 38092 38277 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480030.1 protein_id gnl|my_center|LOCUS_26510 39356 38376 gene locus_tag LOCUS_26520 gene hflC 39356 38376 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460668.1 protein_id gnl|my_center|LOCUS_26520 40561 39359 gene locus_tag LOCUS_26530 gene hflK 40561 39359 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460667.1 protein_id gnl|my_center|LOCUS_26530 41896 40607 gene locus_tag LOCUS_26540 gene hflX 41896 40607 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 protein_id gnl|my_center|LOCUS_26540 42198 41935 gene locus_tag LOCUS_26550 gene hfq 42198 41935 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438329.1 protein_id gnl|my_center|LOCUS_26550 43324 42392 gene locus_tag LOCUS_26560 gene miaA 43324 42392 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480058.1 protein_id gnl|my_center|LOCUS_26560 45366 43321 gene locus_tag LOCUS_26570 gene mutL 45366 43321 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480064.1 protein_id gnl|my_center|LOCUS_26570 47112 45385 gene locus_tag LOCUS_26580 47112 45385 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480021.1 protein_id gnl|my_center|LOCUS_26580 47570 47106 gene locus_tag LOCUS_26590 gene tsaE 47570 47106 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 protein_id gnl|my_center|LOCUS_26590 47868 48995 gene locus_tag LOCUS_26600 gene queG 47868 48995 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480032.1 protein_id gnl|my_center|LOCUS_26600 49675 49599 gene locus_tag LOCUS_t00780 49675 49599 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 49785 49710 gene locus_tag LOCUS_t00790 49785 49710 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49896 49821 gene locus_tag LOCUS_t00800 49896 49821 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50006 49931 gene locus_tag LOCUS_t00810 50006 49931 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50133 50058 gene locus_tag LOCUS_t00820 50133 50058 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50212 50136 gene locus_tag LOCUS_t00830 50212 50136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50327 50252 gene locus_tag LOCUS_t00840 50327 50252 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50459 50383 gene locus_tag LOCUS_t00850 50459 50383 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50589 50514 gene locus_tag LOCUS_t00860 50589 50514 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51291 50746 gene locus_tag LOCUS_26610 gene orn 51291 50746 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 protein_id gnl|my_center|LOCUS_26610 51367 52485 gene locus_tag LOCUS_26620 gene rsgA 51367 52485 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456985.1 protein_id gnl|my_center|LOCUS_26620 52602 53459 gene locus_tag LOCUS_26630 gene asd 52602 53459 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482194.1 protein_id gnl|my_center|LOCUS_26630 53634 55049 gene locus_tag LOCUS_26640 53634 55049 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482205.1 protein_id gnl|my_center|LOCUS_26640 55334 57214 gene locus_tag LOCUS_26650 55334 57214 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482186.1 protein_id gnl|my_center|LOCUS_26650 57335 58060 gene locus_tag LOCUS_26660 57335 58060 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26660 59851 58319 gene locus_tag LOCUS_26670 gene gpmM 59851 58319 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456931.1 protein_id gnl|my_center|LOCUS_26670 60338 60772 gene locus_tag LOCUS_26680 60338 60772 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381472.1 protein_id gnl|my_center|LOCUS_26680 60954 61424 gene locus_tag LOCUS_26690 gene secB 60954 61424 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456911.1 protein_id gnl|my_center|LOCUS_26690 61629 62666 gene locus_tag LOCUS_26700 gene gpsA 61629 62666 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482209.1 protein_id gnl|my_center|LOCUS_26700 62759 63580 gene locus_tag LOCUS_26710 gene cysE 62759 63580 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456939.1 protein_id gnl|my_center|LOCUS_26710 63628 64758 gene locus_tag LOCUS_26720 63628 64758 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456946.1 protein_id gnl|my_center|LOCUS_26720 65803 64847 gene locus_tag LOCUS_26730 65803 64847 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456983.1 protein_id gnl|my_center|LOCUS_26730 66624 65989 gene locus_tag LOCUS_26740 66624 65989 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456944.1 protein_id gnl|my_center|LOCUS_26740 67739 66768 gene locus_tag LOCUS_26750 gene epmA 67739 66768 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 protein_id gnl|my_center|LOCUS_26750 68189 70009 gene locus_tag LOCUS_26760 gene frdA 68189 70009 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456980.1 protein_id gnl|my_center|LOCUS_26760 70009 70767 gene locus_tag LOCUS_26770 70009 70767 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 protein_id gnl|my_center|LOCUS_26770 70770 71153 gene locus_tag LOCUS_26780 gene frdC 70770 71153 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381491.1 protein_id gnl|my_center|LOCUS_26780 71166 71543 gene locus_tag LOCUS_26790 gene frdD 71166 71543 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456924.1 protein_id gnl|my_center|LOCUS_26790 72304 71621 gene locus_tag LOCUS_26800 72304 71621 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_26800 73071 72505 gene locus_tag LOCUS_26810 gene efp 73071 72505 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456976.1 protein_id gnl|my_center|LOCUS_26810 73104 74126 gene locus_tag LOCUS_26820 gene epmB 73104 74126 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482201.1 protein_id gnl|my_center|LOCUS_26820 74223 74720 gene locus_tag LOCUS_26830 74223 74720 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482203.1 protein_id gnl|my_center|LOCUS_26830 75361 74798 gene locus_tag LOCUS_26840 75361 74798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457036.1 protein_id gnl|my_center|LOCUS_26840 76180 75959 gene locus_tag LOCUS_26850 76180 75959 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_26850 77921 76245 gene locus_tag LOCUS_26860 gene ltrA 77921 76245 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 protein_id gnl|my_center|LOCUS_26860 78141 77968 gene locus_tag LOCUS_26870 78141 77968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 80812 79166 gene locus_tag LOCUS_26880 gene groL 80812 79166 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482180.1 protein_id gnl|my_center|LOCUS_26880 81179 80889 gene locus_tag LOCUS_26890 81179 80889 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381516.1 protein_id gnl|my_center|LOCUS_26890 81407 81610 gene locus_tag LOCUS_26900 81407 81610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26900 81607 82785 gene locus_tag LOCUS_26910 81607 82785 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106102.1 protein_id gnl|my_center|LOCUS_26910 83859 82897 gene locus_tag LOCUS_26920 gene pfkA 83859 82897 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460467.1 protein_id gnl|my_center|LOCUS_26920 85059 84145 gene locus_tag LOCUS_26930 gene fieF 85059 84145 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 protein_id gnl|my_center|LOCUS_26930 85686 85177 gene locus_tag LOCUS_26940 85686 85177 CDS product CpxP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487153.1 protein_id gnl|my_center|LOCUS_26940 85878 86567 gene locus_tag LOCUS_26950 85878 86567 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478591.1 protein_id gnl|my_center|LOCUS_26950 86567 87970 gene locus_tag LOCUS_26960 gene cpxA 86567 87970 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478578.1 protein_id gnl|my_center|LOCUS_26960 88043 88651 gene locus_tag LOCUS_26970 88043 88651 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478593.1 protein_id gnl|my_center|LOCUS_26970 88785 89264 gene locus_tag LOCUS_26980 gene trmL 88785 89264 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478594.1 protein_id gnl|my_center|LOCUS_26980 89849 89331 gene locus_tag LOCUS_26990 gene fxsA 89849 89331 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_26990 90272 91723 gene locus_tag LOCUS_27000 gene aspA 90272 91723 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460458.1 protein_id gnl|my_center|LOCUS_27000 91901 93208 gene locus_tag LOCUS_27010 91901 93208 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457503.1 protein_id gnl|my_center|LOCUS_27010 93370 95190 gene locus_tag LOCUS_27020 93370 95190 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 protein_id gnl|my_center|LOCUS_27020 95374 96021 gene locus_tag LOCUS_27030 95374 96021 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 protein_id gnl|my_center|LOCUS_27030 96150 96776 gene locus_tag LOCUS_27040 96150 96776 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 protein_id gnl|my_center|LOCUS_27040 96977 97240 gene locus_tag LOCUS_27050 96977 97240 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_27050 97253 98980 gene locus_tag LOCUS_27060 97253 98980 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 protein_id gnl|my_center|LOCUS_27060 99241 99726 gene locus_tag LOCUS_27070 99241 99726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458018.1 protein_id gnl|my_center|LOCUS_27070 99942 100322 gene locus_tag LOCUS_27080 99942 100322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458016.1 protein_id gnl|my_center|LOCUS_27080 100339 101724 gene locus_tag LOCUS_27090 100339 101724 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478601.1 protein_id gnl|my_center|LOCUS_27090 105211 101780 gene locus_tag LOCUS_27100 105211 101780 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 protein_id gnl|my_center|LOCUS_27100 106540 105452 gene locus_tag LOCUS_27110 106540 105452 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478595.1 protein_id gnl|my_center|LOCUS_27110 106780 108606 gene locus_tag LOCUS_27120 106780 108606 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 protein_id gnl|my_center|LOCUS_27120 108642 109274 gene locus_tag LOCUS_27130 108642 109274 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478580.1 protein_id gnl|my_center|LOCUS_27130 109492 111444 gene locus_tag LOCUS_27140 gene acs 109492 111444 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478589.1 protein_id gnl|my_center|LOCUS_27140 111752 112201 gene locus_tag LOCUS_27150 gene aroQ 111752 112201 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478606.1 protein_id gnl|my_center|LOCUS_27150 112261 112728 gene locus_tag LOCUS_27160 gene accB 112261 112728 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_27160 112743 114086 gene locus_tag LOCUS_27170 gene accC 112743 114086 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_27170 114217 115104 gene locus_tag LOCUS_27180 gene prmA 114217 115104 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459549.1 protein_id gnl|my_center|LOCUS_27180 115292 116212 gene locus_tag LOCUS_27190 gene dusB 115292 116212 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496441.1 protein_id gnl|my_center|LOCUS_27190 116236 116532 gene locus_tag LOCUS_27200 gene fis 116236 116532 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 protein_id gnl|my_center|LOCUS_27200 116735 117724 gene locus_tag LOCUS_27210 116735 117724 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459545.1 protein_id gnl|my_center|LOCUS_27210 118160 118049 gene locus_tag LOCUS_r00060 118160 118049 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence031 2593 1007 gene locus_tag LOCUS_27220 2593 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27220 3144 2581 gene locus_tag LOCUS_27230 3144 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 4608 3262 gene locus_tag LOCUS_27240 gene cadB 4608 3262 CDS product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383654.1 protein_id gnl|my_center|LOCUS_27240 6943 5372 gene locus_tag LOCUS_27250 gene cadC 6943 5372 CDS product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481778.1 protein_id gnl|my_center|LOCUS_27250 7498 7100 gene locus_tag LOCUS_27260 gene zntR 7498 7100 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456436.1 protein_id gnl|my_center|LOCUS_27260 7732 7556 gene locus_tag LOCUS_27270 7732 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7766 9358 gene locus_tag LOCUS_27280 gene purH 7766 9358 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 protein_id gnl|my_center|LOCUS_27280 9477 10766 gene locus_tag LOCUS_27290 gene purD 9477 10766 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_27290 11549 10851 gene locus_tag LOCUS_27300 11549 10851 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456449.1 protein_id gnl|my_center|LOCUS_27300 11861 11589 gene locus_tag LOCUS_27310 gene hupA 11861 11589 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 protein_id gnl|my_center|LOCUS_27310 12115 13248 gene locus_tag LOCUS_27320 12115 13248 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456452.1 protein_id gnl|my_center|LOCUS_27320 13916 13329 gene locus_tag LOCUS_27330 13916 13329 CDS product DUF416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456454.1 protein_id gnl|my_center|LOCUS_27330 13983 14906 gene locus_tag LOCUS_27340 13983 14906 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456455.1 protein_id gnl|my_center|LOCUS_27340 14914 15486 gene locus_tag LOCUS_27350 14914 15486 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_27350 16774 15707 gene locus_tag LOCUS_27360 gene hemE 16774 15707 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456478.1 protein_id gnl|my_center|LOCUS_27360 17819 17037 gene locus_tag LOCUS_27370 gene nudC 17819 17037 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456481.1 protein_id gnl|my_center|LOCUS_27370 18004 18489 gene locus_tag LOCUS_27380 18004 18489 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 protein_id gnl|my_center|LOCUS_27380 22990 18788 gene locus_tag LOCUS_27390 gene rpoC 22990 18788 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456484.1 protein_id gnl|my_center|LOCUS_27390 27125 23097 gene locus_tag LOCUS_27400 gene rpoB 27125 23097 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456486.1 protein_id gnl|my_center|LOCUS_27400 27745 27377 gene locus_tag LOCUS_27410 gene rplL 27745 27377 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466152.1 protein_id gnl|my_center|LOCUS_27410 28297 27803 gene locus_tag LOCUS_27420 gene rplJ 28297 27803 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 protein_id gnl|my_center|LOCUS_27420 29279 28578 gene locus_tag LOCUS_27430 gene rplA 29279 28578 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 protein_id gnl|my_center|LOCUS_27430 29712 29284 gene locus_tag LOCUS_27440 gene rplK 29712 29284 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489784.1 protein_id gnl|my_center|LOCUS_27440 30403 29855 gene locus_tag LOCUS_27450 gene nusG 30403 29855 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384681.1 protein_id gnl|my_center|LOCUS_27450 30797 30417 gene locus_tag LOCUS_27460 gene secE 30797 30417 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384680.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence032 1197 1122 gene locus_tag LOCUS_t00870 1197 1122 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1285 1211 gene locus_tag LOCUS_t00880 1285 1211 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1405 1321 gene locus_tag LOCUS_t00890 1405 1321 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1517 1442 gene locus_tag LOCUS_t00900 1517 1442 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1724 2647 gene locus_tag LOCUS_27470 gene coaA 1724 2647 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075698.1 protein_id gnl|my_center|LOCUS_27470 3437 2664 gene locus_tag LOCUS_27480 gene birA 3437 2664 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27480 3631 3425 gene locus_tag LOCUS_27490 3631 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27490 4671 3628 gene locus_tag LOCUS_27500 gene murB 4671 3628 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458754.1 protein_id gnl|my_center|LOCUS_27500 4983 5204 gene locus_tag LOCUS_27510 4983 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 5276 6616 gene locus_tag LOCUS_27520 gene pssA 5276 6616 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458751.1 protein_id gnl|my_center|LOCUS_27520 7246 7170 gene locus_tag LOCUS_t00910 7246 7170 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7430 7319 gene locus_tag LOCUS_r00070 7430 7319 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence033 562 1017 gene locus_tag LOCUS_27530 562 1017 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480876.1 protein_id gnl|my_center|LOCUS_27530 1756 980 gene locus_tag LOCUS_27540 gene murI 1756 980 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480859.1 protein_id gnl|my_center|LOCUS_27540 2510 1827 gene locus_tag LOCUS_27550 2510 1827 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480862.1 protein_id gnl|my_center|LOCUS_27550 4468 2594 gene locus_tag LOCUS_27560 4468 2594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454756.1 protein_id gnl|my_center|LOCUS_27560 4912 6021 gene locus_tag LOCUS_27570 gene trmA 4912 6021 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 protein_id gnl|my_center|LOCUS_27570 6452 6087 gene locus_tag LOCUS_27580 6452 6087 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460363.1 protein_id gnl|my_center|LOCUS_27580 7093 6452 gene locus_tag LOCUS_27590 gene fabR 7093 6452 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480868.1 protein_id gnl|my_center|LOCUS_27590 7388 8788 gene locus_tag LOCUS_27600 gene sthA 7388 8788 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 protein_id gnl|my_center|LOCUS_27600 10200 8857 gene locus_tag LOCUS_27610 gene dinF 10200 8857 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480864.1 protein_id gnl|my_center|LOCUS_27610 10921 10256 gene locus_tag LOCUS_27620 10921 10256 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480879.1 protein_id gnl|my_center|LOCUS_27620 11884 11264 gene locus_tag LOCUS_27630 gene lexA 11884 11264 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480871.1 protein_id gnl|my_center|LOCUS_27630 12253 14679 gene locus_tag LOCUS_27640 gene plsB 12253 14679 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460370.1 protein_id gnl|my_center|LOCUS_27640 15622 14768 gene locus_tag LOCUS_27650 gene ubiA 15622 14768 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460372.1 protein_id gnl|my_center|LOCUS_27650 16174 15623 gene locus_tag LOCUS_27660 16174 15623 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460374.1 protein_id gnl|my_center|LOCUS_27660 16316 16726 gene locus_tag LOCUS_27670 16316 16726 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460376.1 protein_id gnl|my_center|LOCUS_27670 17637 16795 gene locus_tag LOCUS_27680 gene glpG 17637 16795 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460378.1 protein_id gnl|my_center|LOCUS_27680 17957 17637 gene locus_tag LOCUS_27690 gene glpE 17957 17637 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 protein_id gnl|my_center|LOCUS_27690 19226 18369 gene locus_tag LOCUS_27700 gene rpoH 19226 18369 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 protein_id gnl|my_center|LOCUS_27700 20364 19402 gene locus_tag LOCUS_27710 gene ftsX 20364 19402 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481956.1 protein_id gnl|my_center|LOCUS_27710 20941 20354 gene locus_tag LOCUS_27720 gene ftsE 20941 20354 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481953.1 protein_id gnl|my_center|LOCUS_27720 <22118 21051 gene locus_tag LOCUS_27730 <22118 21051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481951.1:signal recognition particle-docking protein FtsY >Feature sequence034 528 1127 gene locus_tag LOCUS_27740 gene rsmD 528 1127 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455148.1 protein_id gnl|my_center|LOCUS_27740 1153 1419 gene locus_tag LOCUS_27750 1153 1419 CDS product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455146.1 protein_id gnl|my_center|LOCUS_27750 2071 1511 gene locus_tag LOCUS_27760 2071 1511 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 protein_id gnl|my_center|LOCUS_27760 2408 2184 gene locus_tag LOCUS_27770 2408 2184 CDS product YecH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455142.1 protein_id gnl|my_center|LOCUS_27770 3095 2475 gene locus_tag LOCUS_27780 3095 2475 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481960.1 protein_id gnl|my_center|LOCUS_27780 4454 4089 gene locus_tag LOCUS_27790 4454 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489749.1 protein_id gnl|my_center|LOCUS_27790 4696 5025 gene locus_tag LOCUS_27800 4696 5025 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459127.1 protein_id gnl|my_center|LOCUS_27800 6040 5027 gene locus_tag LOCUS_27810 6040 5027 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489757.1 protein_id gnl|my_center|LOCUS_27810 6290 6670 gene locus_tag LOCUS_27820 6290 6670 CDS product cystatin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478972.1 protein_id gnl|my_center|LOCUS_27820 7977 6760 gene locus_tag LOCUS_27830 gene arsJ 7977 6760 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 protein_id gnl|my_center|LOCUS_27830 8729 8235 gene locus_tag LOCUS_27840 8729 8235 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478982.1 protein_id gnl|my_center|LOCUS_27840 9742 8741 gene locus_tag LOCUS_27850 9742 8741 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 protein_id gnl|my_center|LOCUS_27850 10121 9786 gene locus_tag LOCUS_27860 10121 9786 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478993.1 protein_id gnl|my_center|LOCUS_27860 11447 10224 gene locus_tag LOCUS_27870 11447 10224 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_27870 11607 11473 gene locus_tag LOCUS_27880 11607 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27880 12091 11618 gene locus_tag LOCUS_27890 12091 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27890 12157 13146 gene locus_tag LOCUS_27900 12157 13146 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459120.1 protein_id gnl|my_center|LOCUS_27900 13320 14144 gene locus_tag LOCUS_27910 13320 14144 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478981.1 protein_id gnl|my_center|LOCUS_27910 14577 14215 gene locus_tag LOCUS_27920 14577 14215 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_27920 14727 16277 gene locus_tag LOCUS_27930 14727 16277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478985.1 protein_id gnl|my_center|LOCUS_27930 16277 16873 gene locus_tag LOCUS_27940 16277 16873 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478979.1 protein_id gnl|my_center|LOCUS_27940 19350 16954 gene locus_tag LOCUS_27950 19350 16954 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478977.1 protein_id gnl|my_center|LOCUS_27950 20297 19581 gene locus_tag LOCUS_27960 gene yigB 20297 19581 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478999.1 protein_id gnl|my_center|LOCUS_27960 21159 20311 gene locus_tag LOCUS_27970 gene xerC 21159 20311 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459099.1 protein_id gnl|my_center|LOCUS_27970 21949 21218 gene locus_tag LOCUS_27980 21949 21218 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479000.1 protein_id gnl|my_center|LOCUS_27980 22773 21943 gene locus_tag LOCUS_27990 gene dapF 22773 21943 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459097.1 protein_id gnl|my_center|LOCUS_27990 24037 22784 gene locus_tag LOCUS_28000 gene lysA 24037 22784 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_28000 24289 24603 gene locus_tag LOCUS_28010 gene cyaY 24289 24603 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459084.1 protein_id gnl|my_center|LOCUS_28010 27191 24663 gene locus_tag LOCUS_28020 27191 24663 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459083.1 protein_id gnl|my_center|LOCUS_28020 27539 28477 gene locus_tag LOCUS_28030 gene hemC 27539 28477 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 protein_id gnl|my_center|LOCUS_28030 28480 29208 gene locus_tag LOCUS_28040 28480 29208 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459101.1 protein_id gnl|my_center|LOCUS_28040 29226 30437 gene locus_tag LOCUS_28050 29226 30437 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 protein_id gnl|my_center|LOCUS_28050 30437 31618 gene locus_tag LOCUS_28060 30437 31618 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478975.1 protein_id gnl|my_center|LOCUS_28060 32563 32473 gene locus_tag LOCUS_t00920 32563 32473 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32762 32651 gene locus_tag LOCUS_r00080 32762 32651 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence035 1225 512 gene locus_tag LOCUS_28070 gene fre 1225 512 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 protein_id gnl|my_center|LOCUS_28070 1509 1240 gene locus_tag LOCUS_28080 1509 1240 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459133.1 protein_id gnl|my_center|LOCUS_28080 3359 1506 gene locus_tag LOCUS_28090 gene ubiD 3359 1506 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 protein_id gnl|my_center|LOCUS_28090 4488 3496 gene locus_tag LOCUS_28100 4488 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480957.1 protein_id gnl|my_center|LOCUS_28100 5854 4595 gene locus_tag LOCUS_28110 gene rho 5854 4595 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 protein_id gnl|my_center|LOCUS_28110 6377 6051 gene locus_tag LOCUS_28120 gene trxA 6377 6051 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458583.1 protein_id gnl|my_center|LOCUS_28120 6489 7802 gene locus_tag LOCUS_28130 gene rhlB 6489 7802 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458582.1 protein_id gnl|my_center|LOCUS_28130 7885 9315 gene locus_tag LOCUS_28140 gene gppA 7885 9315 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480964.1 protein_id gnl|my_center|LOCUS_28140 10195 9521 gene locus_tag LOCUS_28150 10195 9521 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480953.1 protein_id gnl|my_center|LOCUS_28150 10735 10430 gene locus_tag LOCUS_28160 10735 10430 CDS product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458579.1 protein_id gnl|my_center|LOCUS_28160 12580 10745 gene locus_tag LOCUS_28170 gene recQ 12580 10745 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458577.1 protein_id gnl|my_center|LOCUS_28170 12757 13671 gene locus_tag LOCUS_28180 gene rarD 12757 13671 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480950.1 protein_id gnl|my_center|LOCUS_28180 13744 14541 gene locus_tag LOCUS_28190 13744 14541 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458575.1 protein_id gnl|my_center|LOCUS_28190 14633 15292 gene locus_tag LOCUS_28200 14633 15292 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 protein_id gnl|my_center|LOCUS_28200 15404 16324 gene locus_tag LOCUS_28210 15404 16324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28210 16213 17169 gene locus_tag LOCUS_28220 16213 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28220 20141 17967 gene locus_tag LOCUS_28230 gene uvrD 20141 17967 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 protein_id gnl|my_center|LOCUS_28230 20422 20682 gene locus_tag LOCUS_28240 20422 20682 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 protein_id gnl|my_center|LOCUS_28240 20768 21640 gene locus_tag LOCUS_28250 20768 21640 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458570.1 protein_id gnl|my_center|LOCUS_28250 21637 22395 gene locus_tag LOCUS_28260 21637 22395 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458569.1 protein_id gnl|my_center|LOCUS_28260 22406 22861 gene locus_tag LOCUS_28270 22406 22861 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_28270 23174 22893 gene locus_tag LOCUS_28280 23174 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458563.1 protein_id gnl|my_center|LOCUS_28280 24459 23266 gene locus_tag LOCUS_28290 24459 23266 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106131.1 protein_id gnl|my_center|LOCUS_28290 24537 25508 gene locus_tag LOCUS_28300 24537 25508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465075.1 protein_id gnl|my_center|LOCUS_28300 25712 27070 gene locus_tag LOCUS_28310 25712 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28310 27187 27501 gene locus_tag LOCUS_28320 27187 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28320 28743 27673 gene locus_tag LOCUS_28330 gene thiH 28743 27673 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465071.1 protein_id gnl|my_center|LOCUS_28330 29545 28778 gene locus_tag LOCUS_28340 29545 28778 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 protein_id gnl|my_center|LOCUS_28340 29861 29538 gene locus_tag LOCUS_28350 29861 29538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 30619 29846 gene locus_tag LOCUS_28360 gene thiF 30619 29846 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465065.1 protein_id gnl|my_center|LOCUS_28360 32021 30606 gene locus_tag LOCUS_28370 32021 30606 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480955.1 protein_id gnl|my_center|LOCUS_28370 33961 32021 gene locus_tag LOCUS_28380 gene thiC 33961 32021 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465061.1 protein_id gnl|my_center|LOCUS_28380 34670 34287 gene locus_tag LOCUS_28390 gene crcB 34670 34287 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_28390 36188 34794 gene locus_tag LOCUS_28400 36188 34794 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_28400 36514 36438 gene locus_tag LOCUS_t00930 36514 36438 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence036 618 1169 gene locus_tag LOCUS_28410 618 1169 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 protein_id gnl|my_center|LOCUS_28410 1447 1184 gene locus_tag LOCUS_28420 1447 1184 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461429.1 protein_id gnl|my_center|LOCUS_28420 2284 1451 gene locus_tag LOCUS_28430 gene aroE 2284 1451 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 protein_id gnl|my_center|LOCUS_28430 3249 2371 gene locus_tag LOCUS_28440 gene hemF 3249 2371 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461426.1 protein_id gnl|my_center|LOCUS_28440 3880 3323 gene locus_tag LOCUS_28450 3880 3323 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 protein_id gnl|my_center|LOCUS_28450 4080 4565 gene locus_tag LOCUS_28460 gene purE 4080 4565 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 protein_id gnl|my_center|LOCUS_28460 4570 5703 gene locus_tag LOCUS_28470 4570 5703 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461432.1 protein_id gnl|my_center|LOCUS_28470 6337 5768 gene locus_tag LOCUS_28480 6337 5768 CDS product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461441.1 protein_id gnl|my_center|LOCUS_28480 6839 6360 gene locus_tag LOCUS_28490 6839 6360 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461440.1 protein_id gnl|my_center|LOCUS_28490 7951 6842 gene locus_tag LOCUS_28500 gene dprA 7951 6842 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461424.1 protein_id gnl|my_center|LOCUS_28500 8888 7935 gene locus_tag LOCUS_28510 8888 7935 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461388.1 protein_id gnl|my_center|LOCUS_28510 9168 9686 gene locus_tag LOCUS_28520 gene def 9168 9686 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 protein_id gnl|my_center|LOCUS_28520 9720 10667 gene locus_tag LOCUS_28530 gene fmt 9720 10667 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481155.1 protein_id gnl|my_center|LOCUS_28530 10749 12032 gene locus_tag LOCUS_28540 gene rsmB 10749 12032 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 protein_id gnl|my_center|LOCUS_28540 12097 13473 gene locus_tag LOCUS_28550 gene trkA 12097 13473 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461427.1 protein_id gnl|my_center|LOCUS_28550 13483 14928 gene locus_tag LOCUS_28560 13483 14928 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 protein_id gnl|my_center|LOCUS_28560 14954 15592 gene locus_tag LOCUS_28570 14954 15592 CDS product DUF3157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461438.1 protein_id gnl|my_center|LOCUS_28570 16284 15631 gene locus_tag LOCUS_28580 16284 15631 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461458.1 protein_id gnl|my_center|LOCUS_28580 17162 16356 gene locus_tag LOCUS_28590 17162 16356 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461450.1 protein_id gnl|my_center|LOCUS_28590 17458 17625 gene locus_tag LOCUS_28600 17458 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106137.1 protein_id gnl|my_center|LOCUS_28600 17748 18014 gene locus_tag LOCUS_28610 17748 18014 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461387.1 protein_id gnl|my_center|LOCUS_28610 18324 19745 gene locus_tag LOCUS_28620 gene ccoG 18324 19745 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481163.1 protein_id gnl|my_center|LOCUS_28620 19758 20780 gene locus_tag LOCUS_28630 19758 20780 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 protein_id gnl|my_center|LOCUS_28630 20815 21081 gene locus_tag LOCUS_28640 20815 21081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28640 21066 21419 gene locus_tag LOCUS_28650 21066 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28650 22340 21462 gene locus_tag LOCUS_28660 22340 21462 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481175.1 protein_id gnl|my_center|LOCUS_28660 22505 23461 gene locus_tag LOCUS_28670 22505 23461 CDS product DUF2860 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461468.1 protein_id gnl|my_center|LOCUS_28670 24209 23511 gene locus_tag LOCUS_28680 24209 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 24440 26257 gene locus_tag LOCUS_28690 24440 26257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 26706 27395 gene locus_tag LOCUS_28700 26706 27395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 27370 27519 gene locus_tag LOCUS_28710 27370 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 27519 27803 gene locus_tag LOCUS_28720 27519 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 29159 27978 gene locus_tag LOCUS_28730 29159 27978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 29552 31972 gene locus_tag LOCUS_28740 29552 31972 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476616.1 protein_id gnl|my_center|LOCUS_28740 32073 32480 gene locus_tag LOCUS_28750 32073 32480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 33162 32515 gene locus_tag LOCUS_28760 33162 32515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 33625 35271 gene locus_tag LOCUS_28770 gene ilvG 33625 35271 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461385.1 protein_id gnl|my_center|LOCUS_28770 35283 35567 gene locus_tag LOCUS_28780 gene ilvM 35283 35567 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378958.1 protein_id gnl|my_center|LOCUS_28780 35580 36518 gene locus_tag LOCUS_28790 gene ilvE 35580 36518 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457316.1 protein_id gnl|my_center|LOCUS_28790 36532 38373 gene locus_tag LOCUS_28800 gene ilvD 36532 38373 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 protein_id gnl|my_center|LOCUS_28800 38377 39906 gene locus_tag LOCUS_28810 gene ilvA 38377 39906 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481158.1 protein_id gnl|my_center|LOCUS_28810 40829 39945 gene locus_tag LOCUS_28820 gene punR 40829 39945 CDS product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465352.1 protein_id gnl|my_center|LOCUS_28820 41046 42206 gene locus_tag LOCUS_28830 gene punC 41046 42206 CDS product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481162.1 protein_id gnl|my_center|LOCUS_28830 43066 42290 gene locus_tag LOCUS_28840 43066 42290 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456015.1 protein_id gnl|my_center|LOCUS_28840 43169 43909 gene locus_tag LOCUS_28850 43169 43909 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456023.1 protein_id gnl|my_center|LOCUS_28850 45356 43995 gene locus_tag LOCUS_28860 gene glmU 45356 43995 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456025.1 protein_id gnl|my_center|LOCUS_28860 45926 45504 gene locus_tag LOCUS_28870 45926 45504 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456027.1 protein_id gnl|my_center|LOCUS_28870 47348 45945 gene locus_tag LOCUS_28880 gene atpD 47348 45945 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481178.1 protein_id gnl|my_center|LOCUS_28880 48250 47384 gene locus_tag LOCUS_28890 gene atpG 48250 47384 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 protein_id gnl|my_center|LOCUS_28890 49836 48295 gene locus_tag LOCUS_28900 gene atpA 49836 48295 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 protein_id gnl|my_center|LOCUS_28900 50383 49850 gene locus_tag LOCUS_28910 gene atpH 50383 49850 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 protein_id gnl|my_center|LOCUS_28910 50868 50398 gene locus_tag LOCUS_28920 gene atpF 50868 50398 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 protein_id gnl|my_center|LOCUS_28920 51194 50940 gene locus_tag LOCUS_28930 gene atpE 51194 50940 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002540812.1 protein_id gnl|my_center|LOCUS_28930 52062 51250 gene locus_tag LOCUS_28940 gene atpB 52062 51250 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458499.1 protein_id gnl|my_center|LOCUS_28940 52460 52071 gene locus_tag LOCUS_28950 52460 52071 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458481.1 protein_id gnl|my_center|LOCUS_28950 53531 52650 gene locus_tag LOCUS_28960 53531 52650 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458443.1 protein_id gnl|my_center|LOCUS_28960 54328 53555 gene locus_tag LOCUS_28970 54328 53555 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458453.1 protein_id gnl|my_center|LOCUS_28970 54974 54339 gene locus_tag LOCUS_28980 gene rsmG 54974 54339 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458456.1 protein_id gnl|my_center|LOCUS_28980 56869 54974 gene locus_tag LOCUS_28990 gene mnmG 56869 54974 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 protein_id gnl|my_center|LOCUS_28990 57779 57339 gene locus_tag LOCUS_29000 gene mioC 57779 57339 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458506.1 protein_id gnl|my_center|LOCUS_29000 59242 57881 gene locus_tag LOCUS_29010 gene mnmE 59242 57881 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458483.1 protein_id gnl|my_center|LOCUS_29010 60997 59375 gene locus_tag LOCUS_29020 gene yidC 60997 59375 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458471.1 protein_id gnl|my_center|LOCUS_29020 61549 61226 gene locus_tag LOCUS_29030 gene rnpA 61549 61226 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 protein_id gnl|my_center|LOCUS_29030 61730 61596 gene locus_tag LOCUS_29040 gene rpmH 61730 61596 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 protein_id gnl|my_center|LOCUS_29040 62711 61974 gene locus_tag LOCUS_29050 62711 61974 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481188.1 protein_id gnl|my_center|LOCUS_29050 63379 62708 gene locus_tag LOCUS_29060 63379 62708 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481192.1 protein_id gnl|my_center|LOCUS_29060 64246 63485 gene locus_tag LOCUS_29070 64246 63485 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481168.1 protein_id gnl|my_center|LOCUS_29070 64746 66083 gene locus_tag LOCUS_29080 gene dnaA 64746 66083 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488867.1 protein_id gnl|my_center|LOCUS_29080 66147 67247 gene locus_tag LOCUS_29090 gene dnaN 66147 67247 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 protein_id gnl|my_center|LOCUS_29090 67257 68336 gene locus_tag LOCUS_29100 gene recF 67257 68336 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 protein_id gnl|my_center|LOCUS_29100 68350 70767 gene locus_tag LOCUS_29110 gene gyrB 68350 70767 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458663.1 protein_id gnl|my_center|LOCUS_29110 71418 71855 gene locus_tag LOCUS_29120 71418 71855 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458680.1 protein_id gnl|my_center|LOCUS_29120 73247 71994 gene locus_tag LOCUS_29130 73247 71994 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_29130 75561 73477 gene locus_tag LOCUS_29140 75561 73477 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458684.1 protein_id gnl|my_center|LOCUS_29140 77845 75779 gene locus_tag LOCUS_29150 gene glyS 77845 75779 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458686.1 protein_id gnl|my_center|LOCUS_29150 78776 77859 gene locus_tag LOCUS_29160 gene glyQ 78776 77859 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458688.1 protein_id gnl|my_center|LOCUS_29160 79260 79814 gene locus_tag LOCUS_29170 79260 79814 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458690.1 protein_id gnl|my_center|LOCUS_29170 79976 80236 gene locus_tag LOCUS_29180 79976 80236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458691.1 protein_id gnl|my_center|LOCUS_29180 80528 80280 gene locus_tag LOCUS_29190 gene tusA 80528 80280 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005426051.1 protein_id gnl|my_center|LOCUS_29190 80661 80843 gene locus_tag LOCUS_29200 80661 80843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458692.1 protein_id gnl|my_center|LOCUS_29200 81011 81952 gene locus_tag LOCUS_29210 81011 81952 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105599.1 protein_id gnl|my_center|LOCUS_29210 83006 82026 gene locus_tag LOCUS_29220 83006 82026 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458694.1 protein_id gnl|my_center|LOCUS_29220 84448 83273 gene locus_tag LOCUS_29230 gene fadA 84448 83273 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458696.1 protein_id gnl|my_center|LOCUS_29230 86634 84463 gene locus_tag LOCUS_29240 gene fadB 86634 84463 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481023.1 protein_id gnl|my_center|LOCUS_29240 86903 87526 gene locus_tag LOCUS_29250 86903 87526 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465047.1 protein_id gnl|my_center|LOCUS_29250 87573 89030 gene locus_tag LOCUS_29260 87573 89030 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_29260 89040 89567 gene locus_tag LOCUS_29270 gene hemG 89040 89567 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465051.1 protein_id gnl|my_center|LOCUS_29270 90021 91570 gene locus_tag LOCUS_r00090 90021 91570 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence037 1428 262 gene locus_tag LOCUS_29280 1428 262 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480140.1 protein_id gnl|my_center|LOCUS_29280 1685 2980 gene locus_tag LOCUS_29290 1685 2980 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 protein_id gnl|my_center|LOCUS_29290 3569 3081 gene locus_tag LOCUS_29300 3569 3081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462686.1 protein_id gnl|my_center|LOCUS_29300 4334 4092 gene locus_tag LOCUS_29310 4334 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 5292 4360 gene locus_tag LOCUS_29320 5292 4360 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_29320 7603 5345 gene locus_tag LOCUS_29330 7603 5345 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_29330 8069 9049 gene locus_tag LOCUS_29340 8069 9049 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480142.1 protein_id gnl|my_center|LOCUS_29340 9412 9107 gene locus_tag LOCUS_29350 9412 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 9522 11003 gene locus_tag LOCUS_29360 9522 11003 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411504.1 protein_id gnl|my_center|LOCUS_29360 11020 11769 gene locus_tag LOCUS_29370 11020 11769 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_29370 12661 11789 gene locus_tag LOCUS_29380 12661 11789 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458402.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence038 1092 568 gene locus_tag LOCUS_29390 1092 568 CDS product DUF3087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459966.1 protein_id gnl|my_center|LOCUS_29390 1251 1850 gene locus_tag LOCUS_29400 gene trmY 1251 1850 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459965.1 protein_id gnl|my_center|LOCUS_29400 3257 1914 gene locus_tag LOCUS_29410 3257 1914 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459964.1 protein_id gnl|my_center|LOCUS_29410 4642 3257 gene locus_tag LOCUS_29420 4642 3257 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459963.1 protein_id gnl|my_center|LOCUS_29420 5345 6217 gene locus_tag LOCUS_29430 gene thiD 5345 6217 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459962.1 protein_id gnl|my_center|LOCUS_29430 6207 6962 gene locus_tag LOCUS_29440 6207 6962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482853.1 protein_id gnl|my_center|LOCUS_29440 6955 7755 gene locus_tag LOCUS_29450 6955 7755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 protein_id gnl|my_center|LOCUS_29450 7803 8753 gene locus_tag LOCUS_29460 7803 8753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 protein_id gnl|my_center|LOCUS_29460 8808 9476 gene locus_tag LOCUS_29470 gene tenA 8808 9476 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391859.1 protein_id gnl|my_center|LOCUS_29470 9489 9956 gene locus_tag LOCUS_29480 9489 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29480 9977 10279 gene locus_tag LOCUS_29490 9977 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 10344 10958 gene locus_tag LOCUS_29500 gene thiE 10344 10958 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482839.1 protein_id gnl|my_center|LOCUS_29500 11147 11872 gene locus_tag LOCUS_29510 11147 11872 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459943.1 protein_id gnl|my_center|LOCUS_29510 12029 12547 gene locus_tag LOCUS_29520 12029 12547 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106219.1 protein_id gnl|my_center|LOCUS_29520 12557 13288 gene locus_tag LOCUS_29530 12557 13288 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459933.1 protein_id gnl|my_center|LOCUS_29530 13298 13762 gene locus_tag LOCUS_29540 13298 13762 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459931.1 protein_id gnl|my_center|LOCUS_29540 13881 14351 gene locus_tag LOCUS_29550 13881 14351 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459929.1 protein_id gnl|my_center|LOCUS_29550 14412 14912 gene locus_tag LOCUS_29560 14412 14912 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459926.1 protein_id gnl|my_center|LOCUS_29560 14987 15436 gene locus_tag LOCUS_29570 14987 15436 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705323.1 protein_id gnl|my_center|LOCUS_29570 16110 15451 gene locus_tag LOCUS_29580 16110 15451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 16623 16180 gene locus_tag LOCUS_29590 16623 16180 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263920.1 protein_id gnl|my_center|LOCUS_29590 16756 17397 gene locus_tag LOCUS_29600 16756 17397 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263921.1 protein_id gnl|my_center|LOCUS_29600 17408 17836 gene locus_tag LOCUS_29610 17408 17836 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263922.1 protein_id gnl|my_center|LOCUS_29610 18255 17881 gene locus_tag LOCUS_29620 18255 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 18617 18330 gene locus_tag LOCUS_29630 18617 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 protein_id gnl|my_center|LOCUS_29630 19597 18680 gene locus_tag LOCUS_29640 19597 18680 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460847.1 protein_id gnl|my_center|LOCUS_29640 19707 21143 gene locus_tag LOCUS_29650 19707 21143 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482870.1 protein_id gnl|my_center|LOCUS_29650 22388 21255 gene locus_tag LOCUS_29660 22388 21255 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460822.1 protein_id gnl|my_center|LOCUS_29660 22611 22784 gene locus_tag LOCUS_29670 22611 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460772.1 protein_id gnl|my_center|LOCUS_29670 23186 22845 gene locus_tag LOCUS_29680 23186 22845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482939.1 protein_id gnl|my_center|LOCUS_29680 23456 25303 gene locus_tag LOCUS_29690 23456 25303 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482888.1 protein_id gnl|my_center|LOCUS_29690 25365 25901 gene locus_tag LOCUS_29700 25365 25901 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_29700 26045 26335 gene locus_tag LOCUS_29710 26045 26335 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921421.1 protein_id gnl|my_center|LOCUS_29710 26527 27237 gene locus_tag LOCUS_29720 26527 27237 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482805.1 protein_id gnl|my_center|LOCUS_29720 27393 27710 gene locus_tag LOCUS_29730 27393 27710 CDS product DUF4144 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482865.1 protein_id gnl|my_center|LOCUS_29730 27932 28870 gene locus_tag LOCUS_29740 27932 28870 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263006.1 protein_id gnl|my_center|LOCUS_29740 29024 29515 gene locus_tag LOCUS_29750 29024 29515 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482882.1 protein_id gnl|my_center|LOCUS_29750 29723 30916 gene locus_tag LOCUS_29760 29723 30916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 31819 31517 gene locus_tag LOCUS_29770 31819 31517 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261420.1 protein_id gnl|my_center|LOCUS_29770 32283 31822 gene locus_tag LOCUS_29780 gene eco 32283 31822 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114416.1 protein_id gnl|my_center|LOCUS_29780 32495 33091 gene locus_tag LOCUS_29790 32495 33091 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_29790 33131 33550 gene locus_tag LOCUS_29800 33131 33550 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482828.1 protein_id gnl|my_center|LOCUS_29800 33654 33905 gene locus_tag LOCUS_29810 33654 33905 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890111.1 protein_id gnl|my_center|LOCUS_29810 34654 33935 gene locus_tag LOCUS_29820 34654 33935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 37866 35176 gene locus_tag LOCUS_29830 gene ygjK 37866 35176 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482903.1 protein_id gnl|my_center|LOCUS_29830 38894 38127 gene locus_tag LOCUS_29840 38894 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482920.1 protein_id gnl|my_center|LOCUS_29840 39599 39844 gene locus_tag LOCUS_29850 39599 39844 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460845.1 protein_id gnl|my_center|LOCUS_29850 41422 39935 gene locus_tag LOCUS_29860 41422 39935 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460814.1 protein_id gnl|my_center|LOCUS_29860 42444 41419 gene locus_tag LOCUS_29870 42444 41419 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482880.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence039 3642 1042 gene locus_tag LOCUS_29880 3642 1042 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_29880 4682 3711 gene locus_tag LOCUS_29890 4682 3711 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349123.1 protein_id gnl|my_center|LOCUS_29890 5758 5114 gene locus_tag LOCUS_29900 gene ompW 5758 5114 CDS product outer membrane protein OmpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460838.1 protein_id gnl|my_center|LOCUS_29900 6191 6841 gene locus_tag LOCUS_29910 6191 6841 CDS product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482928.1 protein_id gnl|my_center|LOCUS_29910 6850 7161 gene locus_tag LOCUS_29920 6850 7161 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_29920 8098 7352 gene locus_tag LOCUS_29930 8098 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 8446 8616 gene locus_tag LOCUS_29940 8446 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29940 8633 9262 gene locus_tag LOCUS_29950 8633 9262 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482817.1 protein_id gnl|my_center|LOCUS_29950 >Feature sequence040 <1 588 gene locus_tag LOCUS_29960 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071337.1:IS4-like element ISSod7 family transposase 1829 651 gene locus_tag LOCUS_29970 1829 651 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482868.1 protein_id gnl|my_center|LOCUS_29970 2483 2043 gene locus_tag LOCUS_29980 2483 2043 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_29980 2632 3216 gene locus_tag LOCUS_29990 2632 3216 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482872.1 protein_id gnl|my_center|LOCUS_29990 3495 5417 gene locus_tag LOCUS_30000 3495 5417 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_30000 5651 6424 gene locus_tag LOCUS_30010 5651 6424 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482849.1 protein_id gnl|my_center|LOCUS_30010 7370 6501 gene locus_tag LOCUS_30020 7370 6501 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 protein_id gnl|my_center|LOCUS_30020 7951 7439 gene locus_tag LOCUS_30030 7951 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 8936 8130 gene locus_tag LOCUS_30040 8936 8130 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482900.1 protein_id gnl|my_center|LOCUS_30040 9228 10376 gene locus_tag LOCUS_30050 9228 10376 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464962.1 protein_id gnl|my_center|LOCUS_30050 10583 11422 gene locus_tag LOCUS_30060 gene fghA 10583 11422 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464966.1 protein_id gnl|my_center|LOCUS_30060 11670 12815 gene locus_tag LOCUS_30070 11670 12815 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262756.1 protein_id gnl|my_center|LOCUS_30070 13222 12851 gene locus_tag LOCUS_30080 13222 12851 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_30080 13497 13958 gene locus_tag LOCUS_30090 13497 13958 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482833.1 protein_id gnl|my_center|LOCUS_30090 13958 15049 gene locus_tag LOCUS_30100 13958 15049 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464959.1 protein_id gnl|my_center|LOCUS_30100 15060 15464 gene locus_tag LOCUS_30110 15060 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106212.1 protein_id gnl|my_center|LOCUS_30110 16360 15563 gene locus_tag LOCUS_30120 16360 15563 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_30120 16558 18237 gene locus_tag LOCUS_30130 16558 18237 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482837.1 protein_id gnl|my_center|LOCUS_30130 18659 18309 gene locus_tag LOCUS_30140 18659 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 19113 19280 gene locus_tag LOCUS_30150 19113 19280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466428.1 protein_id gnl|my_center|LOCUS_30150 19538 19290 gene locus_tag LOCUS_30160 19538 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106558.1 protein_id gnl|my_center|LOCUS_30160 19855 20460 gene locus_tag LOCUS_30170 19855 20460 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887247.1 protein_id gnl|my_center|LOCUS_30170 20468 21013 gene locus_tag LOCUS_30180 20468 21013 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_30180 21000 21449 gene locus_tag LOCUS_30190 21000 21449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477477.1 protein_id gnl|my_center|LOCUS_30190 21734 22171 gene locus_tag LOCUS_30200 21734 22171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 22456 22190 gene locus_tag LOCUS_30210 22456 22190 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 protein_id gnl|my_center|LOCUS_30210 22843 23373 gene locus_tag LOCUS_30220 22843 23373 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477406.1 protein_id gnl|my_center|LOCUS_30220 23991 23482 gene locus_tag LOCUS_30230 23991 23482 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263861.1 protein_id gnl|my_center|LOCUS_30230 25665 24172 gene locus_tag LOCUS_30240 gene putP 25665 24172 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_30240 26510 25803 gene locus_tag LOCUS_30250 26510 25803 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467523.1 protein_id gnl|my_center|LOCUS_30250 29653 26522 gene locus_tag LOCUS_30260 gene putA 29653 26522 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477456.1 protein_id gnl|my_center|LOCUS_30260 30877 30068 gene locus_tag LOCUS_30270 30877 30068 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468852.1 protein_id gnl|my_center|LOCUS_30270 31713 32432 gene locus_tag LOCUS_30280 31713 32432 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477494.1 protein_id gnl|my_center|LOCUS_30280 33012 33704 gene locus_tag LOCUS_30290 33012 33704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477484.1 protein_id gnl|my_center|LOCUS_30290 35087 33747 gene locus_tag LOCUS_30300 35087 33747 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482935.1 protein_id gnl|my_center|LOCUS_30300 38196 35284 gene locus_tag LOCUS_30310 38196 35284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 38319 39197 gene locus_tag LOCUS_30320 38319 39197 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence041 1753 458 gene locus_tag LOCUS_30330 1753 458 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261353.1 protein_id gnl|my_center|LOCUS_30330 3178 2096 gene locus_tag LOCUS_30340 3178 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 4098 3169 gene locus_tag LOCUS_30350 4098 3169 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918268.1 protein_id gnl|my_center|LOCUS_30350 4487 5491 gene locus_tag LOCUS_30360 4487 5491 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705456.1 protein_id gnl|my_center|LOCUS_30360 9031 5582 gene locus_tag LOCUS_30370 9031 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 10082 9099 gene locus_tag LOCUS_30380 10082 9099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420816.1 protein_id gnl|my_center|LOCUS_30380 11048 10116 gene locus_tag LOCUS_30390 11048 10116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706885.1 protein_id gnl|my_center|LOCUS_30390 12037 11045 gene locus_tag LOCUS_30400 12037 11045 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706884.1 protein_id gnl|my_center|LOCUS_30400 13020 12046 gene locus_tag LOCUS_30410 13020 12046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706883.1 protein_id gnl|my_center|LOCUS_30410 14758 13124 gene locus_tag LOCUS_30420 14758 13124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383105.1 protein_id gnl|my_center|LOCUS_30420 15284 16063 gene locus_tag LOCUS_30430 15284 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 17093 16113 gene locus_tag LOCUS_30440 17093 16113 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_30440 18323 17229 gene locus_tag LOCUS_30450 gene ugpC 18323 17229 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_30450 19672 18323 gene locus_tag LOCUS_30460 19672 18323 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_30460 20582 19698 gene locus_tag LOCUS_30470 20582 19698 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_30470 21375 20584 gene locus_tag LOCUS_30480 21375 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30480 21572 21336 gene locus_tag LOCUS_30490 21572 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 22882 21635 gene locus_tag LOCUS_30500 22882 21635 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_30500 23909 22905 gene locus_tag LOCUS_30510 23909 22905 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456547.1 protein_id gnl|my_center|LOCUS_30510 25596 24301 gene locus_tag LOCUS_30520 25596 24301 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261353.1 protein_id gnl|my_center|LOCUS_30520 26104 27297 gene locus_tag LOCUS_30530 26104 27297 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482807.1 protein_id gnl|my_center|LOCUS_30530 27632 27351 gene locus_tag LOCUS_30540 27632 27351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464981.1 protein_id gnl|my_center|LOCUS_30540 28063 27779 gene locus_tag LOCUS_30550 28063 27779 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464991.1 protein_id gnl|my_center|LOCUS_30550 28297 28800 gene locus_tag LOCUS_30560 28297 28800 CDS product DUF2850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464988.1 protein_id gnl|my_center|LOCUS_30560 29190 31730 gene locus_tag LOCUS_30570 29190 31730 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482861.1 protein_id gnl|my_center|LOCUS_30570 32702 31848 gene locus_tag LOCUS_30580 32702 31848 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 protein_id gnl|my_center|LOCUS_30580 33414 32824 gene locus_tag LOCUS_30590 33414 32824 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468576.1 protein_id gnl|my_center|LOCUS_30590 33667 34692 gene locus_tag LOCUS_30600 33667 34692 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464923.1 protein_id gnl|my_center|LOCUS_30600 34834 34652 gene locus_tag LOCUS_30610 34834 34652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 35132 36562 gene locus_tag LOCUS_30620 gene nhaD 35132 36562 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_30620 36984 36589 gene locus_tag LOCUS_30630 36984 36589 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464875.1 protein_id gnl|my_center|LOCUS_30630 37203 37811 gene locus_tag LOCUS_30640 37203 37811 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 protein_id gnl|my_center|LOCUS_30640 38718 37897 gene locus_tag LOCUS_30650 38718 37897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464915.1 protein_id gnl|my_center|LOCUS_30650 39309 38827 gene locus_tag LOCUS_30660 39309 38827 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_30660 40382 39306 gene locus_tag LOCUS_30670 40382 39306 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482874.1 protein_id gnl|my_center|LOCUS_30670 40867 41070 gene locus_tag LOCUS_30680 40867 41070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 42160 41267 gene locus_tag LOCUS_30690 42160 41267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464903.1 protein_id gnl|my_center|LOCUS_30690 42308 42661 gene locus_tag LOCUS_30700 42308 42661 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464927.1 protein_id gnl|my_center|LOCUS_30700 43012 42761 gene locus_tag LOCUS_30710 43012 42761 CDS product DUF3081 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464900.1 protein_id gnl|my_center|LOCUS_30710 43398 44198 gene locus_tag LOCUS_30720 gene nagB 43398 44198 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464933.1 protein_id gnl|my_center|LOCUS_30720 45151 44285 gene locus_tag LOCUS_30730 45151 44285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464929.1 protein_id gnl|my_center|LOCUS_30730 46567 45863 gene locus_tag LOCUS_30740 46567 45863 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_30740 46934 47140 gene locus_tag LOCUS_30750 46934 47140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 48048 47425 gene locus_tag LOCUS_30760 gene ureG 48048 47425 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 protein_id gnl|my_center|LOCUS_30760 48822 49667 gene locus_tag LOCUS_30770 48822 49667 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263889.1 protein_id gnl|my_center|LOCUS_30770 49891 50283 gene locus_tag LOCUS_30780 gene rnk 49891 50283 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480352.1 protein_id gnl|my_center|LOCUS_30780 51568 50351 gene locus_tag LOCUS_30790 51568 50351 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706908.1 protein_id gnl|my_center|LOCUS_30790 51917 51735 gene locus_tag LOCUS_30800 51917 51735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 52336 52647 gene locus_tag LOCUS_30810 52336 52647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 52669 52914 gene locus_tag LOCUS_30820 52669 52914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 52911 54443 gene locus_tag LOCUS_30830 52911 54443 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_30830 54549 54776 gene locus_tag LOCUS_30840 54549 54776 CDS product PAS factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479230.1 protein_id gnl|my_center|LOCUS_30840 55351 54899 gene locus_tag LOCUS_30850 55351 54899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30850 55905 55330 gene locus_tag LOCUS_30860 55905 55330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30860 56422 55898 gene locus_tag LOCUS_30870 56422 55898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30870 56886 56350 gene locus_tag LOCUS_30880 56886 56350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30880 57657 56896 gene locus_tag LOCUS_30890 57657 56896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040904057.1 protein_id gnl|my_center|LOCUS_30890 57931 58707 gene locus_tag LOCUS_30900 57931 58707 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263889.1 protein_id gnl|my_center|LOCUS_30900 59873 58821 gene locus_tag LOCUS_30910 59873 58821 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728967.1 protein_id gnl|my_center|LOCUS_30910 60677 60063 gene locus_tag LOCUS_30920 gene ureG 60677 60063 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_30920 61415 60708 gene locus_tag LOCUS_30930 61415 60708 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 protein_id gnl|my_center|LOCUS_30930 61914 61405 gene locus_tag LOCUS_30940 gene ureE 61914 61405 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_30940 63637 61934 gene locus_tag LOCUS_30950 gene ureC 63637 61934 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_30950 63969 63649 gene locus_tag LOCUS_30960 63969 63649 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612150.1 protein_id gnl|my_center|LOCUS_30960 64282 63980 gene locus_tag LOCUS_30970 64282 63980 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_30970 65268 64360 gene locus_tag LOCUS_30980 65268 64360 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185533.1 protein_id gnl|my_center|LOCUS_30980 65684 65938 gene locus_tag LOCUS_30990 65684 65938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 67891 66782 gene locus_tag LOCUS_31000 67891 66782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 69392 67947 gene locus_tag LOCUS_31010 69392 67947 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 protein_id gnl|my_center|LOCUS_31010 70643 69996 gene locus_tag LOCUS_31020 70643 69996 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263889.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31020 71350 72126 gene locus_tag LOCUS_31030 71350 72126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226571285.1 protein_id gnl|my_center|LOCUS_31030 72933 72178 gene locus_tag LOCUS_31040 72933 72178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 74403 73177 gene locus_tag LOCUS_31050 gene gltS 74403 73177 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464942.1 protein_id gnl|my_center|LOCUS_31050 74851 75222 gene locus_tag LOCUS_31060 74851 75222 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464887.1 protein_id gnl|my_center|LOCUS_31060 75219 76076 gene locus_tag LOCUS_31070 75219 76076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464877.1 protein_id gnl|my_center|LOCUS_31070 76076 76906 gene locus_tag LOCUS_31080 76076 76906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451233.1 protein_id gnl|my_center|LOCUS_31080 77110 77628 gene locus_tag LOCUS_31090 77110 77628 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213751.1 protein_id gnl|my_center|LOCUS_31090 78954 77719 gene locus_tag LOCUS_31100 gene gltS 78954 77719 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464899.1 protein_id gnl|my_center|LOCUS_31100 80148 79516 gene locus_tag LOCUS_31110 80148 79516 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481729.1 protein_id gnl|my_center|LOCUS_31110 80347 81120 gene locus_tag LOCUS_31120 80347 81120 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464873.1 protein_id gnl|my_center|LOCUS_31120 81162 81548 gene locus_tag LOCUS_31130 81162 81548 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464876.1 protein_id gnl|my_center|LOCUS_31130 81724 83385 gene locus_tag LOCUS_31140 81724 83385 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464936.1 protein_id gnl|my_center|LOCUS_31140 83508 84002 gene locus_tag LOCUS_31150 83508 84002 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481711.1 protein_id gnl|my_center|LOCUS_31150 84741 84106 gene locus_tag LOCUS_31160 84741 84106 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481726.1 protein_id gnl|my_center|LOCUS_31160 85601 84810 gene locus_tag LOCUS_31170 85601 84810 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481713.1 protein_id gnl|my_center|LOCUS_31170 86640 85618 gene locus_tag LOCUS_31180 86640 85618 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481721.1 protein_id gnl|my_center|LOCUS_31180 87969 86641 gene locus_tag LOCUS_31190 87969 86641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481704.1 protein_id gnl|my_center|LOCUS_31190 88800 88015 gene locus_tag LOCUS_31200 88800 88015 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481719.1 protein_id gnl|my_center|LOCUS_31200 90061 88793 gene locus_tag LOCUS_31210 90061 88793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481724.1 protein_id gnl|my_center|LOCUS_31210 90747 90049 gene locus_tag LOCUS_31220 90747 90049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481731.1 protein_id gnl|my_center|LOCUS_31220 91425 90757 gene locus_tag LOCUS_31230 91425 90757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481717.1 protein_id gnl|my_center|LOCUS_31230 92382 91510 gene locus_tag LOCUS_31240 92382 91510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065641382.1 protein_id gnl|my_center|LOCUS_31240 92550 93599 gene locus_tag LOCUS_31250 92550 93599 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263571.1 protein_id gnl|my_center|LOCUS_31250 93610 94620 gene locus_tag LOCUS_31260 93610 94620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 94925 96007 gene locus_tag LOCUS_31270 gene rodA 94925 96007 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481706.1 protein_id gnl|my_center|LOCUS_31270 96807 96091 gene locus_tag LOCUS_31280 96807 96091 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464874.1 protein_id gnl|my_center|LOCUS_31280 97153 96944 gene locus_tag LOCUS_31290 97153 96944 CDS product DUF3283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477463.1 protein_id gnl|my_center|LOCUS_31290 97834 97244 gene locus_tag LOCUS_31300 97834 97244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31300 99164 97797 gene locus_tag LOCUS_31310 99164 97797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31310 99233 99988 gene locus_tag LOCUS_31320 99233 99988 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477460.1 protein_id gnl|my_center|LOCUS_31320 101125 100067 gene locus_tag LOCUS_31330 gene ribA 101125 100067 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477438.1 protein_id gnl|my_center|LOCUS_31330 101487 101290 gene locus_tag LOCUS_31340 101487 101290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477395.1 protein_id gnl|my_center|LOCUS_31340 101849 102703 gene locus_tag LOCUS_31350 101849 102703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699219.1 protein_id gnl|my_center|LOCUS_31350 102700 103434 gene locus_tag LOCUS_31360 102700 103434 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464829.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31360 103407 103634 gene locus_tag LOCUS_31370 103407 103634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31370 103634 104098 gene locus_tag LOCUS_31380 103634 104098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451231.1 protein_id gnl|my_center|LOCUS_31380 106707 104737 gene locus_tag LOCUS_31390 106707 104737 CDS product DUF3346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477480.1 protein_id gnl|my_center|LOCUS_31390 107948 109165 gene locus_tag LOCUS_31400 107948 109165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005500197.1 protein_id gnl|my_center|LOCUS_31400 109173 110147 gene locus_tag LOCUS_31410 109173 110147 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464865.1 protein_id gnl|my_center|LOCUS_31410 110263 112287 gene locus_tag LOCUS_31420 110263 112287 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464868.1 protein_id gnl|my_center|LOCUS_31420 113172 114848 gene locus_tag LOCUS_31430 113172 114848 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464872.1 protein_id gnl|my_center|LOCUS_31430 115829 115170 gene locus_tag LOCUS_31440 gene catC 115829 115170 CDS product type C chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464860.1 protein_id gnl|my_center|LOCUS_31440 115922 116821 gene locus_tag LOCUS_31450 115922 116821 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464837.1 protein_id gnl|my_center|LOCUS_31450 116962 117204 gene locus_tag LOCUS_31460 116962 117204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 117591 118001 gene locus_tag LOCUS_31470 117591 118001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 118629 118063 gene locus_tag LOCUS_31480 118629 118063 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464841.1 protein_id gnl|my_center|LOCUS_31480 119380 118781 gene locus_tag LOCUS_31490 119380 118781 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464867.1 protein_id gnl|my_center|LOCUS_31490 121876 119762 gene locus_tag LOCUS_31500 121876 119762 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 protein_id gnl|my_center|LOCUS_31500 123801 121888 gene locus_tag LOCUS_31510 123801 121888 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005500162.1 protein_id gnl|my_center|LOCUS_31510 124490 123807 gene locus_tag LOCUS_31520 124490 123807 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464869.1 protein_id gnl|my_center|LOCUS_31520 125975 124584 gene locus_tag LOCUS_31530 125975 124584 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464847.1 protein_id gnl|my_center|LOCUS_31530 127298 126075 gene locus_tag LOCUS_31540 127298 126075 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477499.1 protein_id gnl|my_center|LOCUS_31540 129168 127291 gene locus_tag LOCUS_31550 129168 127291 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477467.1 protein_id gnl|my_center|LOCUS_31550 129349 129984 gene locus_tag LOCUS_31560 gene pdxH 129349 129984 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464858.1 protein_id gnl|my_center|LOCUS_31560 131897 130065 gene locus_tag LOCUS_31570 131897 130065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 protein_id gnl|my_center|LOCUS_31570 132303 133304 gene locus_tag LOCUS_31580 132303 133304 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468268.1 protein_id gnl|my_center|LOCUS_31580 134338 133943 gene locus_tag LOCUS_31590 134338 133943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 136457 134406 gene locus_tag LOCUS_31600 136457 134406 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_31600 137300 136776 gene locus_tag LOCUS_31610 137300 136776 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477487.1 protein_id gnl|my_center|LOCUS_31610 138261 137632 gene locus_tag LOCUS_31620 138261 137632 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477517.1 protein_id gnl|my_center|LOCUS_31620 139248 138271 gene locus_tag LOCUS_31630 139248 138271 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477410.1 protein_id gnl|my_center|LOCUS_31630 140664 139252 gene locus_tag LOCUS_31640 gene uxaC 140664 139252 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477444.1 protein_id gnl|my_center|LOCUS_31640 142140 140677 gene locus_tag LOCUS_31650 142140 140677 CDS product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477431.1 protein_id gnl|my_center|LOCUS_31650 143532 142231 gene locus_tag LOCUS_31660 143532 142231 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_31660 143903 143544 gene locus_tag LOCUS_31670 143903 143544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 144382 145365 gene locus_tag LOCUS_31680 144382 145365 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_31680 145473 146264 gene locus_tag LOCUS_31690 145473 146264 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477441.1 protein_id gnl|my_center|LOCUS_31690 146394 147581 gene locus_tag LOCUS_31700 gene uxuA 146394 147581 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477427.1 protein_id gnl|my_center|LOCUS_31700 147884 147666 gene locus_tag LOCUS_31710 147884 147666 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262957.1 protein_id gnl|my_center|LOCUS_31710 148423 147896 gene locus_tag LOCUS_31720 148423 147896 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188863598.1 protein_id gnl|my_center|LOCUS_31720 148581 148925 gene locus_tag LOCUS_31730 148581 148925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 149083 150258 gene locus_tag LOCUS_31740 149083 150258 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_31740 150283 150681 gene locus_tag LOCUS_31750 150283 150681 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_31750 150758 151318 gene locus_tag LOCUS_31760 gene sigZ 150758 151318 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 protein_id gnl|my_center|LOCUS_31760 152391 151432 gene locus_tag LOCUS_31770 152391 151432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367316.1 protein_id gnl|my_center|LOCUS_31770 152452 153435 gene locus_tag LOCUS_31780 152452 153435 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142835.1 protein_id gnl|my_center|LOCUS_31780 153635 154873 gene locus_tag LOCUS_31790 153635 154873 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477404.1 protein_id gnl|my_center|LOCUS_31790 155729 154953 gene locus_tag LOCUS_31800 155729 154953 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464165.1 protein_id gnl|my_center|LOCUS_31800 156138 155911 gene locus_tag LOCUS_31810 156138 155911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 156988 156296 gene locus_tag LOCUS_31820 156988 156296 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477393.1 protein_id gnl|my_center|LOCUS_31820 157275 157033 gene locus_tag LOCUS_31830 157275 157033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 157360 158178 gene locus_tag LOCUS_31840 157360 158178 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451228.1 protein_id gnl|my_center|LOCUS_31840 159101 158202 gene locus_tag LOCUS_31850 159101 158202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481319.1 protein_id gnl|my_center|LOCUS_31850 160867 159335 gene locus_tag LOCUS_31860 160867 159335 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946934.1 protein_id gnl|my_center|LOCUS_31860 161611 162753 gene locus_tag LOCUS_31870 161611 162753 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262009.1 protein_id gnl|my_center|LOCUS_31870 162773 164218 gene locus_tag LOCUS_31880 162773 164218 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_31880 164245 165024 gene locus_tag LOCUS_31890 164245 165024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 165607 165125 gene locus_tag LOCUS_31900 165607 165125 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188527.1 protein_id gnl|my_center|LOCUS_31900 165728 166327 gene locus_tag LOCUS_31910 165728 166327 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_31910 166466 167329 gene locus_tag LOCUS_31920 166466 167329 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 protein_id gnl|my_center|LOCUS_31920 168693 167380 gene locus_tag LOCUS_31930 168693 167380 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477481.1 protein_id gnl|my_center|LOCUS_31930 168794 169735 gene locus_tag LOCUS_31940 168794 169735 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477420.1 protein_id gnl|my_center|LOCUS_31940 170897 169812 gene locus_tag LOCUS_31950 170897 169812 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_31950 171226 173259 gene locus_tag LOCUS_31960 171226 173259 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530812.1 protein_id gnl|my_center|LOCUS_31960 173976 173359 gene locus_tag LOCUS_31970 173976 173359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_31970 174572 175111 gene locus_tag LOCUS_31980 174572 175111 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477501.1 protein_id gnl|my_center|LOCUS_31980 175364 176320 gene locus_tag LOCUS_31990 gene pip 175364 176320 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087175.1 protein_id gnl|my_center|LOCUS_31990 178389 176827 gene locus_tag LOCUS_32000 178389 176827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007465074.1 protein_id gnl|my_center|LOCUS_32000 180292 178724 gene locus_tag LOCUS_32010 gene ahpF 180292 178724 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 protein_id gnl|my_center|LOCUS_32010 181173 180616 gene locus_tag LOCUS_32020 gene ahpC 181173 180616 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 protein_id gnl|my_center|LOCUS_32020 181937 181479 gene locus_tag LOCUS_32030 181937 181479 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 protein_id gnl|my_center|LOCUS_32030 182075 182497 gene locus_tag LOCUS_32040 182075 182497 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460420.1 protein_id gnl|my_center|LOCUS_32040 183452 182553 gene locus_tag LOCUS_32050 183452 182553 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707674.1 protein_id gnl|my_center|LOCUS_32050 183907 183641 gene locus_tag LOCUS_32060 183907 183641 CDS product DUF2999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395194.1 protein_id gnl|my_center|LOCUS_32060 184797 183982 gene locus_tag LOCUS_32070 184797 183982 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836388.1 protein_id gnl|my_center|LOCUS_32070 185995 184871 gene locus_tag LOCUS_32080 185995 184871 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925824.1 protein_id gnl|my_center|LOCUS_32080 188505 185995 gene locus_tag LOCUS_32090 188505 185995 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071146.1 protein_id gnl|my_center|LOCUS_32090 189214 188492 gene locus_tag LOCUS_32100 189214 188492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071147.1 protein_id gnl|my_center|LOCUS_32100 190273 189317 gene locus_tag LOCUS_32110 gene amrS 190273 189317 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_32110 190828 191289 gene locus_tag LOCUS_32120 190828 191289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 191246 191863 gene locus_tag LOCUS_32130 191246 191863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 192177 191932 gene locus_tag LOCUS_32140 192177 191932 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460424.1 protein_id gnl|my_center|LOCUS_32140 192684 192298 gene locus_tag LOCUS_32150 192684 192298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 194718 192727 gene locus_tag LOCUS_32160 194718 192727 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477466.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence042 429 238 gene locus_tag LOCUS_32170 429 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2254 422 gene locus_tag LOCUS_32180 2254 422 CDS product siderophore biosynthesis protein PvsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477449.1 protein_id gnl|my_center|LOCUS_32180 3425 2226 gene locus_tag LOCUS_32190 3425 2226 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477388.1 protein_id gnl|my_center|LOCUS_32190 5243 3432 gene locus_tag LOCUS_32200 5243 3432 CDS product siderophore biosynthesis protein PsvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477461.1 protein_id gnl|my_center|LOCUS_32200 5974 5240 gene locus_tag LOCUS_32210 5974 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32210 6447 6100 gene locus_tag LOCUS_32220 6447 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32220 6689 8725 gene locus_tag LOCUS_32230 6689 8725 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477483.1 protein_id gnl|my_center|LOCUS_32230 8847 10964 gene locus_tag LOCUS_32240 gene pvuA 8847 10964 CDS product TonB-dependent siderophore vibrioferrin receptor PvuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460644.1 protein_id gnl|my_center|LOCUS_32240 11065 11988 gene locus_tag LOCUS_32250 11065 11988 CDS product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106550.1 protein_id gnl|my_center|LOCUS_32250 12000 13019 gene locus_tag LOCUS_32260 12000 13019 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460640.1 protein_id gnl|my_center|LOCUS_32260 13019 13990 gene locus_tag LOCUS_32270 13019 13990 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460642.1 protein_id gnl|my_center|LOCUS_32270 13993 14757 gene locus_tag LOCUS_32280 gene fecE 13993 14757 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_32280 16710 14896 gene locus_tag LOCUS_32290 16710 14896 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477512.1 protein_id gnl|my_center|LOCUS_32290 17089 19839 gene locus_tag LOCUS_32300 17089 19839 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460662.1 protein_id gnl|my_center|LOCUS_32300 20274 19888 gene locus_tag LOCUS_32310 20274 19888 CDS product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070822.1 protein_id gnl|my_center|LOCUS_32310 20868 20413 gene locus_tag LOCUS_32320 20868 20413 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882826.1 protein_id gnl|my_center|LOCUS_32320 21623 20754 gene locus_tag LOCUS_32330 21623 20754 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455166.1 protein_id gnl|my_center|LOCUS_32330 22079 23812 gene locus_tag LOCUS_32340 22079 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458398.1 protein_id gnl|my_center|LOCUS_32340 24049 25062 gene locus_tag LOCUS_32350 24049 25062 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210127.1 protein_id gnl|my_center|LOCUS_32350 25068 26600 gene locus_tag LOCUS_32360 25068 26600 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982172.1 protein_id gnl|my_center|LOCUS_32360 27305 26703 gene locus_tag LOCUS_32370 27305 26703 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973885.1 protein_id gnl|my_center|LOCUS_32370 28591 27407 gene locus_tag LOCUS_32380 28591 27407 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458342.1 protein_id gnl|my_center|LOCUS_32380 29217 28588 gene locus_tag LOCUS_32390 29217 28588 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458375.1 protein_id gnl|my_center|LOCUS_32390 29643 29407 gene locus_tag LOCUS_32400 29643 29407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 31654 29933 gene locus_tag LOCUS_32410 31654 29933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 33848 31893 gene locus_tag LOCUS_32420 gene glgX 33848 31893 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458345.1 protein_id gnl|my_center|LOCUS_32420 34292 35512 gene locus_tag LOCUS_32430 gene lamB 34292 35512 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757932.1 protein_id gnl|my_center|LOCUS_32430 35667 36497 gene locus_tag LOCUS_32440 35667 36497 CDS product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244228.1 protein_id gnl|my_center|LOCUS_32440 36660 37178 gene locus_tag LOCUS_32450 36660 37178 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458394.1 protein_id gnl|my_center|LOCUS_32450 37269 38891 gene locus_tag LOCUS_32460 37269 38891 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482111.1 protein_id gnl|my_center|LOCUS_32460 39154 40773 gene locus_tag LOCUS_32470 39154 40773 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458327.1 protein_id gnl|my_center|LOCUS_32470 44886 40897 gene locus_tag LOCUS_32480 gene pulA 44886 40897 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 protein_id gnl|my_center|LOCUS_32480 45355 46551 gene locus_tag LOCUS_32490 45355 46551 CDS product SEL1-like repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499994.1 protein_id gnl|my_center|LOCUS_32490 47438 47884 gene locus_tag LOCUS_32500 47438 47884 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458369.1 protein_id gnl|my_center|LOCUS_32500 48296 50476 gene locus_tag LOCUS_32510 gene speF 48296 50476 CDS product ornithine decarboxylase SpeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106546.1 protein_id gnl|my_center|LOCUS_32510 50541 51851 gene locus_tag LOCUS_32520 gene potE 50541 51851 CDS product putrescine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374814.1 protein_id gnl|my_center|LOCUS_32520 51976 52164 gene locus_tag LOCUS_32530 51976 52164 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458312.1 protein_id gnl|my_center|LOCUS_32530 52265 53131 gene locus_tag LOCUS_32540 gene pdxY 52265 53131 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458347.1 protein_id gnl|my_center|LOCUS_32540 54411 53194 gene locus_tag LOCUS_32550 gene sstT 54411 53194 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458382.1 protein_id gnl|my_center|LOCUS_32550 55746 54670 gene locus_tag LOCUS_32560 gene rsgA 55746 54670 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458373.1 protein_id gnl|my_center|LOCUS_32560 56302 56000 gene locus_tag LOCUS_32570 56302 56000 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480175.1 protein_id gnl|my_center|LOCUS_32570 56959 56492 gene locus_tag LOCUS_32580 56959 56492 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458360.1 protein_id gnl|my_center|LOCUS_32580 57560 56949 gene locus_tag LOCUS_32590 57560 56949 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458304.1 protein_id gnl|my_center|LOCUS_32590 57995 57570 gene locus_tag LOCUS_32600 57995 57570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480121.1 protein_id gnl|my_center|LOCUS_32600 59076 58195 gene locus_tag LOCUS_32610 59076 58195 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_32610 62370 59662 gene locus_tag LOCUS_32620 gene malT 62370 59662 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480178.1 protein_id gnl|my_center|LOCUS_32620 63041 65494 gene locus_tag LOCUS_32630 63041 65494 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480123.1 protein_id gnl|my_center|LOCUS_32630 65611 67791 gene locus_tag LOCUS_32640 gene malQ 65611 67791 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480181.1 protein_id gnl|my_center|LOCUS_32640 67970 70228 gene locus_tag LOCUS_32650 gene glgB 67970 70228 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031778752.1 protein_id gnl|my_center|LOCUS_32650 70412 71089 gene locus_tag LOCUS_32660 gene mtgA 70412 71089 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480120.1 protein_id gnl|my_center|LOCUS_32660 71664 72695 gene locus_tag LOCUS_32670 71664 72695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 72988 75048 gene locus_tag LOCUS_32680 72988 75048 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480125.1 protein_id gnl|my_center|LOCUS_32680 75882 75166 gene locus_tag LOCUS_32690 75882 75166 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480164.1 protein_id gnl|my_center|LOCUS_32690 76287 75979 gene locus_tag LOCUS_32700 76287 75979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106542.1 protein_id gnl|my_center|LOCUS_32700 76725 77465 gene locus_tag LOCUS_32710 76725 77465 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480162.1 protein_id gnl|my_center|LOCUS_32710 77465 77932 gene locus_tag LOCUS_32720 77465 77932 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480147.1 protein_id gnl|my_center|LOCUS_32720 77942 79066 gene locus_tag LOCUS_32730 77942 79066 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480156.1 protein_id gnl|my_center|LOCUS_32730 79254 79628 gene locus_tag LOCUS_32740 79254 79628 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458336.1 protein_id gnl|my_center|LOCUS_32740 79805 80248 gene locus_tag LOCUS_32750 79805 80248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 81659 80355 gene locus_tag LOCUS_32760 81659 80355 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_32760 83044 81980 gene locus_tag LOCUS_32770 83044 81980 CDS product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211065.1 protein_id gnl|my_center|LOCUS_32770 84178 83054 gene locus_tag LOCUS_32780 84178 83054 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061893279.1 protein_id gnl|my_center|LOCUS_32780 85030 84191 gene locus_tag LOCUS_32790 85030 84191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603461.1 protein_id gnl|my_center|LOCUS_32790 85313 85909 gene locus_tag LOCUS_32800 gene breR 85313 85909 CDS product bile response transcriptional repressor BreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777169.1 protein_id gnl|my_center|LOCUS_32800 87191 85923 gene locus_tag LOCUS_32810 87191 85923 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480179.1 protein_id gnl|my_center|LOCUS_32810 88412 87519 gene locus_tag LOCUS_32820 88412 87519 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458320.1 protein_id gnl|my_center|LOCUS_32820 88522 88830 gene locus_tag LOCUS_32830 88522 88830 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458351.1 protein_id gnl|my_center|LOCUS_32830 88835 89209 gene locus_tag LOCUS_32840 88835 89209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458364.1 protein_id gnl|my_center|LOCUS_32840 93325 89258 gene locus_tag LOCUS_32850 93325 89258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 94466 93744 gene locus_tag LOCUS_32860 gene nfsA 94466 93744 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458388.1 protein_id gnl|my_center|LOCUS_32860 94678 95319 gene locus_tag LOCUS_32870 94678 95319 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458325.1 protein_id gnl|my_center|LOCUS_32870 97318 95435 gene locus_tag LOCUS_32880 97318 95435 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458057.1 protein_id gnl|my_center|LOCUS_32880 97833 97519 gene locus_tag LOCUS_32890 97833 97519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence043 606 235 gene locus_tag LOCUS_32900 606 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482732.1 protein_id gnl|my_center|LOCUS_32900 2567 759 gene locus_tag LOCUS_32910 2567 759 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_32910 3322 2711 gene locus_tag LOCUS_32920 3322 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 7977 3739 gene locus_tag LOCUS_32930 gene fdhF 7977 3739 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482725.1 protein_id gnl|my_center|LOCUS_32930 8383 8730 gene locus_tag LOCUS_32940 8383 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489340.1 protein_id gnl|my_center|LOCUS_32940 8865 10253 gene locus_tag LOCUS_32950 8865 10253 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_32950 10266 11972 gene locus_tag LOCUS_32960 10266 11972 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_32960 11975 15154 gene locus_tag LOCUS_32970 11975 15154 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_32970 15233 15754 gene locus_tag LOCUS_32980 15233 15754 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482705.1 protein_id gnl|my_center|LOCUS_32980 16258 15833 gene locus_tag LOCUS_32990 16258 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 16514 17422 gene locus_tag LOCUS_33000 16514 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 18059 17529 gene locus_tag LOCUS_33010 18059 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 19069 18161 gene locus_tag LOCUS_33020 19069 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33020 19331 19516 gene locus_tag LOCUS_33030 19331 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 19705 20556 gene locus_tag LOCUS_33040 gene blaCARB 19705 20556 CDS product carbenicillin-hydrolyzing class A beta-lactamase CARB-22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479236.1 protein_id gnl|my_center|LOCUS_33040 21120 20614 gene locus_tag LOCUS_33050 21120 20614 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011716.1 protein_id gnl|my_center|LOCUS_33050 22357 21194 gene locus_tag LOCUS_33060 22357 21194 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263014.1 protein_id gnl|my_center|LOCUS_33060 22552 23205 gene locus_tag LOCUS_33070 22552 23205 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_33070 23674 23276 gene locus_tag LOCUS_33080 23674 23276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 24209 23694 gene locus_tag LOCUS_33090 24209 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 24699 24337 gene locus_tag LOCUS_33100 24699 24337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 26221 24815 gene locus_tag LOCUS_33110 26221 24815 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262523.1 protein_id gnl|my_center|LOCUS_33110 26719 26567 gene locus_tag LOCUS_33120 26719 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459713.1 protein_id gnl|my_center|LOCUS_33120 26991 27521 gene locus_tag LOCUS_33130 gene speG 26991 27521 CDS product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459711.1 protein_id gnl|my_center|LOCUS_33130 29725 27569 gene locus_tag LOCUS_33140 29725 27569 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_33140 31473 29902 gene locus_tag LOCUS_33150 31473 29902 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479209.1 protein_id gnl|my_center|LOCUS_33150 31869 32120 gene locus_tag LOCUS_33160 31869 32120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 32277 32702 gene locus_tag LOCUS_33170 32277 32702 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459700.1 protein_id gnl|my_center|LOCUS_33170 32811 32692 gene locus_tag LOCUS_33180 32811 32692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 32876 33049 gene locus_tag LOCUS_33190 32876 33049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 33115 33603 gene locus_tag LOCUS_33200 33115 33603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 33982 34317 gene locus_tag LOCUS_33210 33982 34317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463379.1 protein_id gnl|my_center|LOCUS_33210 34491 34619 gene locus_tag LOCUS_33220 34491 34619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 35111 34695 gene locus_tag LOCUS_33230 35111 34695 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463375.1 protein_id gnl|my_center|LOCUS_33230 36025 35111 gene locus_tag LOCUS_33240 gene dmeF 36025 35111 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477256.1 protein_id gnl|my_center|LOCUS_33240 37246 36242 gene locus_tag LOCUS_33250 37246 36242 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262762.1 protein_id gnl|my_center|LOCUS_33250 37796 37236 gene locus_tag LOCUS_33260 37796 37236 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262761.1 protein_id gnl|my_center|LOCUS_33260 39278 37944 gene locus_tag LOCUS_33270 39278 37944 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_33270 39848 39390 gene locus_tag LOCUS_33280 39848 39390 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975836.1 protein_id gnl|my_center|LOCUS_33280 40028 40876 gene locus_tag LOCUS_33290 40028 40876 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477139.1 protein_id gnl|my_center|LOCUS_33290 41325 41056 gene locus_tag LOCUS_33300 41325 41056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33300 41903 41331 gene locus_tag LOCUS_33310 41903 41331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33310 42224 42436 gene locus_tag LOCUS_33320 42224 42436 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463371.1 protein_id gnl|my_center|LOCUS_33320 42735 42944 gene locus_tag LOCUS_33330 42735 42944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 43007 43147 gene locus_tag LOCUS_33340 43007 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463370.1 protein_id gnl|my_center|LOCUS_33340 43663 44667 gene locus_tag LOCUS_33350 43663 44667 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 protein_id gnl|my_center|LOCUS_33350 46029 45094 gene locus_tag LOCUS_33360 46029 45094 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454286.1 protein_id gnl|my_center|LOCUS_33360 46187 46681 gene locus_tag LOCUS_33370 46187 46681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 46685 47674 gene locus_tag LOCUS_33380 46685 47674 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706439.1 protein_id gnl|my_center|LOCUS_33380 47774 48991 gene locus_tag LOCUS_33390 47774 48991 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263662.1 protein_id gnl|my_center|LOCUS_33390 49131 49604 gene locus_tag LOCUS_33400 49131 49604 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 protein_id gnl|my_center|LOCUS_33400 50379 49675 gene locus_tag LOCUS_33410 50379 49675 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261725.1 protein_id gnl|my_center|LOCUS_33410 50894 50487 gene locus_tag LOCUS_33420 50894 50487 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499396.1 protein_id gnl|my_center|LOCUS_33420 52920 51025 gene locus_tag LOCUS_33430 52920 51025 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480246.1 protein_id gnl|my_center|LOCUS_33430 56096 53439 gene locus_tag LOCUS_33440 56096 53439 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106540.1 protein_id gnl|my_center|LOCUS_33440 57692 56226 gene locus_tag LOCUS_33450 57692 56226 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480177.1 protein_id gnl|my_center|LOCUS_33450 57848 58138 gene locus_tag LOCUS_33460 57848 58138 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480132.1 protein_id gnl|my_center|LOCUS_33460 59064 58135 gene locus_tag LOCUS_33470 59064 58135 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480137.1 protein_id gnl|my_center|LOCUS_33470 59197 59415 gene locus_tag LOCUS_33480 59197 59415 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_33480 60509 60039 gene locus_tag LOCUS_33490 60509 60039 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_33490 60719 61483 gene locus_tag LOCUS_33500 60719 61483 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480112.1 protein_id gnl|my_center|LOCUS_33500 61675 62511 gene locus_tag LOCUS_33510 61675 62511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925870.1 protein_id gnl|my_center|LOCUS_33510 63665 62556 gene locus_tag LOCUS_33520 63665 62556 CDS product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479954.1 protein_id gnl|my_center|LOCUS_33520 64367 63774 gene locus_tag LOCUS_33530 64367 63774 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_33530 64650 65864 gene locus_tag LOCUS_33540 64650 65864 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479983.1 protein_id gnl|my_center|LOCUS_33540 67715 65901 gene locus_tag LOCUS_33550 67715 65901 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479990.1 protein_id gnl|my_center|LOCUS_33550 69757 68294 gene locus_tag LOCUS_33560 69757 68294 CDS product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479975.1 protein_id gnl|my_center|LOCUS_33560 70025 70603 gene locus_tag LOCUS_33570 70025 70603 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479980.1 protein_id gnl|my_center|LOCUS_33570 71674 70715 gene locus_tag LOCUS_33580 71674 70715 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479978.1 protein_id gnl|my_center|LOCUS_33580 71999 73333 gene locus_tag LOCUS_33590 71999 73333 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479934.1 protein_id gnl|my_center|LOCUS_33590 73345 74889 gene locus_tag LOCUS_33600 73345 74889 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479939.1 protein_id gnl|my_center|LOCUS_33600 74889 75596 gene locus_tag LOCUS_33610 74889 75596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480002.1 protein_id gnl|my_center|LOCUS_33610 76983 75841 gene locus_tag LOCUS_33620 gene msrB 76983 75841 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_33620 77168 77566 gene locus_tag LOCUS_33630 77168 77566 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479962.1 protein_id gnl|my_center|LOCUS_33630 77679 78233 gene locus_tag LOCUS_33640 77679 78233 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479970.1 protein_id gnl|my_center|LOCUS_33640 78355 79200 gene locus_tag LOCUS_33650 78355 79200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 79231 79464 gene locus_tag LOCUS_33660 79231 79464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393681.1 protein_id gnl|my_center|LOCUS_33660 79646 79969 gene locus_tag LOCUS_33670 79646 79969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 80237 80055 gene locus_tag LOCUS_33680 80237 80055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479943.1 protein_id gnl|my_center|LOCUS_33680 81277 80369 gene locus_tag LOCUS_33690 81277 80369 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_33690 81427 82101 gene locus_tag LOCUS_33700 gene yjjG 81427 82101 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374109.1 protein_id gnl|my_center|LOCUS_33700 82678 82187 gene locus_tag LOCUS_33710 82678 82187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 82938 83477 gene locus_tag LOCUS_33720 82938 83477 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374107.1 protein_id gnl|my_center|LOCUS_33720 83883 83545 gene locus_tag LOCUS_33730 83883 83545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 85286 84033 gene locus_tag LOCUS_33740 85286 84033 CDS product type 2 secretion system lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481504.1 protein_id gnl|my_center|LOCUS_33740 85596 85375 gene locus_tag LOCUS_33750 85596 85375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 85724 88099 gene locus_tag LOCUS_33760 85724 88099 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069688011.1 protein_id gnl|my_center|LOCUS_33760 88109 88471 gene locus_tag LOCUS_33770 88109 88471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464009.1 protein_id gnl|my_center|LOCUS_33770 89372 88557 gene locus_tag LOCUS_33780 89372 88557 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464042.1 protein_id gnl|my_center|LOCUS_33780 91107 89728 gene locus_tag LOCUS_33790 91107 89728 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 protein_id gnl|my_center|LOCUS_33790 92249 91134 gene locus_tag LOCUS_33800 gene phnW 92249 91134 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481450.1 protein_id gnl|my_center|LOCUS_33800 92507 93514 gene locus_tag LOCUS_33810 92507 93514 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481434.1 protein_id gnl|my_center|LOCUS_33810 94817 94656 gene locus_tag LOCUS_33820 94817 94656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 94905 96011 gene locus_tag LOCUS_33830 94905 96011 CDS product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481435.1 protein_id gnl|my_center|LOCUS_33830 96020 97744 gene locus_tag LOCUS_33840 96020 97744 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481462.1 protein_id gnl|my_center|LOCUS_33840 97754 98458 gene locus_tag LOCUS_33850 gene phnR 97754 98458 CDS product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481525.1 protein_id gnl|my_center|LOCUS_33850 98525 99430 gene locus_tag LOCUS_33860 98525 99430 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481519.1 protein_id gnl|my_center|LOCUS_33860 99622 99981 gene locus_tag LOCUS_33870 99622 99981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 100241 101641 gene locus_tag LOCUS_33880 100241 101641 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481488.1 protein_id gnl|my_center|LOCUS_33880 101677 102879 gene locus_tag LOCUS_33890 101677 102879 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481455.1 protein_id gnl|my_center|LOCUS_33890 103496 104473 gene locus_tag LOCUS_33900 103496 104473 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481521.1 protein_id gnl|my_center|LOCUS_33900 104594 105475 gene locus_tag LOCUS_33910 104594 105475 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451302.1 protein_id gnl|my_center|LOCUS_33910 105630 106415 gene locus_tag LOCUS_33920 105630 106415 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451301.1 protein_id gnl|my_center|LOCUS_33920 106789 106412 gene locus_tag LOCUS_33930 106789 106412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33930 107303 106884 gene locus_tag LOCUS_33940 107303 106884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33940 107513 107752 gene locus_tag LOCUS_33950 107513 107752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464033.1 protein_id gnl|my_center|LOCUS_33950 107981 109252 gene locus_tag LOCUS_33960 107981 109252 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349448.1 protein_id gnl|my_center|LOCUS_33960 110806 109331 gene locus_tag LOCUS_33970 110806 109331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463935.1 protein_id gnl|my_center|LOCUS_33970 112551 111181 gene locus_tag LOCUS_33980 112551 111181 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481453.1 protein_id gnl|my_center|LOCUS_33980 112696 113532 gene locus_tag LOCUS_33990 112696 113532 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481531.1 protein_id gnl|my_center|LOCUS_33990 114225 113548 gene locus_tag LOCUS_34000 114225 113548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481502.1 protein_id gnl|my_center|LOCUS_34000 114745 114485 gene locus_tag LOCUS_34010 114745 114485 CDS product DUF333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463993.1 protein_id gnl|my_center|LOCUS_34010 115006 115524 gene locus_tag LOCUS_34020 115006 115524 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 protein_id gnl|my_center|LOCUS_34020 116524 115877 gene locus_tag LOCUS_34030 116524 115877 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481481.1 protein_id gnl|my_center|LOCUS_34030 117038 116601 gene locus_tag LOCUS_34040 gene flgN 117038 116601 CDS product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481448.1 protein_id gnl|my_center|LOCUS_34040 117360 117061 gene locus_tag LOCUS_34050 gene flgM 117360 117061 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464040.1 protein_id gnl|my_center|LOCUS_34050 118225 117506 gene locus_tag LOCUS_34060 gene flgA 118225 117506 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106239.1 protein_id gnl|my_center|LOCUS_34060 118382 118744 gene locus_tag LOCUS_34070 gene flgB 118382 118744 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463947.1 protein_id gnl|my_center|LOCUS_34070 118747 119181 gene locus_tag LOCUS_34080 gene flgC 118747 119181 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464013.1 protein_id gnl|my_center|LOCUS_34080 119181 119864 gene locus_tag LOCUS_34090 gene flgD 119181 119864 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463939.1 protein_id gnl|my_center|LOCUS_34090 119891 121198 gene locus_tag LOCUS_34100 gene flgE 119891 121198 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463978.1 protein_id gnl|my_center|LOCUS_34100 121210 121941 gene locus_tag LOCUS_34110 121210 121941 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464045.1 protein_id gnl|my_center|LOCUS_34110 121966 122751 gene locus_tag LOCUS_34120 gene flgG 121966 122751 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481471.1 protein_id gnl|my_center|LOCUS_34120 122766 123452 gene locus_tag LOCUS_34130 gene flgH 122766 123452 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106240.1 protein_id gnl|my_center|LOCUS_34130 123488 124573 gene locus_tag LOCUS_34140 123488 124573 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463987.1 protein_id gnl|my_center|LOCUS_34140 124585 125142 gene locus_tag LOCUS_34150 124585 125142 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481473.1 protein_id gnl|my_center|LOCUS_34150 125143 126516 gene locus_tag LOCUS_34160 gene flgK 125143 126516 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481537.1 protein_id gnl|my_center|LOCUS_34160 126530 127429 gene locus_tag LOCUS_34170 gene flgL 126530 127429 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463980.1 protein_id gnl|my_center|LOCUS_34170 127447 128487 gene locus_tag LOCUS_34180 127447 128487 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481431.1 protein_id gnl|my_center|LOCUS_34180 131408 128733 gene locus_tag LOCUS_34190 131408 128733 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481511.1 protein_id gnl|my_center|LOCUS_34190 131643 133436 gene locus_tag LOCUS_34200 131643 133436 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 protein_id gnl|my_center|LOCUS_34200 133686 134705 gene locus_tag LOCUS_34210 gene fni 133686 134705 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481444.1 protein_id gnl|my_center|LOCUS_34210 134868 135131 gene locus_tag LOCUS_34220 134868 135131 CDS product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481466.1 protein_id gnl|my_center|LOCUS_34220 135301 135702 gene locus_tag LOCUS_34230 135301 135702 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481510.1 protein_id gnl|my_center|LOCUS_34230 135859 136572 gene locus_tag LOCUS_34240 135859 136572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 136872 137117 gene locus_tag LOCUS_34250 136872 137117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 137258 137710 gene locus_tag LOCUS_34260 137258 137710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 137896 138318 gene locus_tag LOCUS_34270 137896 138318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420220.1 protein_id gnl|my_center|LOCUS_34270 138513 138728 gene locus_tag LOCUS_34280 138513 138728 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478080.1 protein_id gnl|my_center|LOCUS_34280 138852 139229 gene locus_tag LOCUS_34290 138852 139229 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_34290 139684 139397 gene locus_tag LOCUS_34300 139684 139397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478379.1 protein_id gnl|my_center|LOCUS_34300 140794 139802 gene locus_tag LOCUS_34310 140794 139802 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478256.1 protein_id gnl|my_center|LOCUS_34310 141651 140794 gene locus_tag LOCUS_34320 gene motA 141651 140794 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462768.1 protein_id gnl|my_center|LOCUS_34320 142390 141662 gene locus_tag LOCUS_34330 gene lafS 142390 141662 CDS product lateral flagellar system RNA polymerase sigma factor LafS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462772.1 protein_id gnl|my_center|LOCUS_34330 142900 142403 gene locus_tag LOCUS_34340 142900 142403 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462773.1 protein_id gnl|my_center|LOCUS_34340 144074 143034 gene locus_tag LOCUS_34350 144074 143034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 144391 144071 gene locus_tag LOCUS_34360 144391 144071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478392.1 protein_id gnl|my_center|LOCUS_34360 144761 144375 gene locus_tag LOCUS_34370 gene fliS 144761 144375 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462778.1 protein_id gnl|my_center|LOCUS_34370 146121 144784 gene locus_tag LOCUS_34380 gene fliD 146121 144784 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462779.1 protein_id gnl|my_center|LOCUS_34380 147295 146441 gene locus_tag LOCUS_34390 gene lafA 147295 146441 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462780.1 protein_id gnl|my_center|LOCUS_34390 148241 147444 gene locus_tag LOCUS_34400 148241 147444 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106532.1 protein_id gnl|my_center|LOCUS_34400 150324 148234 gene locus_tag LOCUS_34410 gene flhA 150324 148234 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478396.1 protein_id gnl|my_center|LOCUS_34410 151483 150356 gene locus_tag LOCUS_34420 gene flhB 151483 150356 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462787.1 protein_id gnl|my_center|LOCUS_34420 152258 151428 gene locus_tag LOCUS_34430 gene fliR 152258 151428 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462790.1 protein_id gnl|my_center|LOCUS_34430 152527 152258 gene locus_tag LOCUS_34440 gene fliQ 152527 152258 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462792.1 protein_id gnl|my_center|LOCUS_34440 153305 152544 gene locus_tag LOCUS_34450 gene fliP 153305 152544 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462793.1 protein_id gnl|my_center|LOCUS_34450 153692 153324 gene locus_tag LOCUS_34460 gene fliN 153692 153324 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462794.1 protein_id gnl|my_center|LOCUS_34460 154489 153692 gene locus_tag LOCUS_34470 154489 153692 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462796.1 protein_id gnl|my_center|LOCUS_34470 154896 155906 gene locus_tag LOCUS_34480 154896 155906 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462797.1 protein_id gnl|my_center|LOCUS_34480 155906 157237 gene locus_tag LOCUS_34490 155906 157237 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478291.1 protein_id gnl|my_center|LOCUS_34490 157250 157609 gene locus_tag LOCUS_34500 gene fliE 157250 157609 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462799.1 protein_id gnl|my_center|LOCUS_34500 157613 159373 gene locus_tag LOCUS_34510 gene fliF 157613 159373 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106531.1 protein_id gnl|my_center|LOCUS_34510 159336 160355 gene locus_tag LOCUS_34520 159336 160355 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478340.1 protein_id gnl|my_center|LOCUS_34520 160360 161124 gene locus_tag LOCUS_34530 gene fliH 160360 161124 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478070.1 protein_id gnl|my_center|LOCUS_34530 161117 162463 gene locus_tag LOCUS_34540 gene fliI 161117 162463 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478244.1 protein_id gnl|my_center|LOCUS_34540 162474 162914 gene locus_tag LOCUS_34550 gene fliJ 162474 162914 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462826.1 protein_id gnl|my_center|LOCUS_34550 163497 162946 gene locus_tag LOCUS_34560 163497 162946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 164743 163970 gene locus_tag LOCUS_34570 164743 163970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 166316 165267 gene locus_tag LOCUS_34580 166316 165267 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478390.1 protein_id gnl|my_center|LOCUS_34580 167205 166684 gene locus_tag LOCUS_34590 167205 166684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34590 167582 167193 gene locus_tag LOCUS_34600 167582 167193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34600 167728 168651 gene locus_tag LOCUS_34610 167728 168651 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462829.1 protein_id gnl|my_center|LOCUS_34610 168760 169200 gene locus_tag LOCUS_34620 168760 169200 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462830.1 protein_id gnl|my_center|LOCUS_34620 169285 170040 gene locus_tag LOCUS_34630 169285 170040 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451265.1 protein_id gnl|my_center|LOCUS_34630 170141 170530 gene locus_tag LOCUS_34640 170141 170530 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462833.1 protein_id gnl|my_center|LOCUS_34640 171216 170719 gene locus_tag LOCUS_34650 171216 170719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34650 171242 171463 gene locus_tag LOCUS_34660 171242 171463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 171664 171999 gene locus_tag LOCUS_34670 171664 171999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106530.1 protein_id gnl|my_center|LOCUS_34670 172362 171979 gene locus_tag LOCUS_34680 172362 171979 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462837.1 protein_id gnl|my_center|LOCUS_34680 173303 172365 gene locus_tag LOCUS_34690 173303 172365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462838.1 protein_id gnl|my_center|LOCUS_34690 173854 173381 gene locus_tag LOCUS_34700 173854 173381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478242.1 protein_id gnl|my_center|LOCUS_34700 174142 174825 gene locus_tag LOCUS_34710 174142 174825 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_34710 174835 175530 gene locus_tag LOCUS_34720 174835 175530 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_34720 175676 176407 gene locus_tag LOCUS_34730 175676 176407 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478271.1 protein_id gnl|my_center|LOCUS_34730 176448 177449 gene locus_tag LOCUS_34740 176448 177449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34740 177449 177826 gene locus_tag LOCUS_34750 177449 177826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34750 178120 179313 gene locus_tag LOCUS_34760 178120 179313 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478319.1 protein_id gnl|my_center|LOCUS_34760 179565 180548 gene locus_tag LOCUS_34770 gene tdh 179565 180548 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_34770 180889 181407 gene locus_tag LOCUS_34780 gene hcp-2 180889 181407 CDS product type VI secretion system effector Hcp-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142947.1 protein_id gnl|my_center|LOCUS_34780 181544 181816 gene locus_tag LOCUS_34790 181544 181816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 182038 182757 gene locus_tag LOCUS_34800 182038 182757 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_34800 183925 182822 gene locus_tag LOCUS_34810 183925 182822 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_34810 184275 184622 gene locus_tag LOCUS_34820 184275 184622 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462888.1 protein_id gnl|my_center|LOCUS_34820 185096 185770 gene locus_tag LOCUS_34830 185096 185770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34830 186971 185832 gene locus_tag LOCUS_34840 gene lldD 186971 185832 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478054.1 protein_id gnl|my_center|LOCUS_34840 188952 187261 gene locus_tag LOCUS_34850 188952 187261 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462890.1 protein_id gnl|my_center|LOCUS_34850 189109 190008 gene locus_tag LOCUS_34860 189109 190008 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462891.1 protein_id gnl|my_center|LOCUS_34860 190147 192186 gene locus_tag LOCUS_34870 190147 192186 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462892.1 protein_id gnl|my_center|LOCUS_34870 194063 192432 gene locus_tag LOCUS_34880 194063 192432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478061.1 protein_id gnl|my_center|LOCUS_34880 194640 194143 gene locus_tag LOCUS_34890 194640 194143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478146.1 protein_id gnl|my_center|LOCUS_34890 194839 197199 gene locus_tag LOCUS_34900 194839 197199 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478132.1 protein_id gnl|my_center|LOCUS_34900 197425 199053 gene locus_tag LOCUS_34910 197425 199053 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478090.1 protein_id gnl|my_center|LOCUS_34910 199561 201189 gene locus_tag LOCUS_34920 199561 201189 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478090.1 protein_id gnl|my_center|LOCUS_34920 201979 201236 gene locus_tag LOCUS_34930 201979 201236 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478273.1 protein_id gnl|my_center|LOCUS_34930 202107 202382 gene locus_tag LOCUS_34940 202107 202382 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478017.1 protein_id gnl|my_center|LOCUS_34940 202361 203365 gene locus_tag LOCUS_34950 202361 203365 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478306.1 protein_id gnl|my_center|LOCUS_34950 203925 203425 gene locus_tag LOCUS_34960 203925 203425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462908.1 protein_id gnl|my_center|LOCUS_34960 204331 205101 gene locus_tag LOCUS_34970 gene napG 204331 205101 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462912.1 protein_id gnl|my_center|LOCUS_34970 205101 205955 gene locus_tag LOCUS_34980 gene napH 205101 205955 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462914.1 protein_id gnl|my_center|LOCUS_34980 206122 207303 gene locus_tag LOCUS_34990 206122 207303 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 protein_id gnl|my_center|LOCUS_34990 208247 207408 gene locus_tag LOCUS_35000 208247 207408 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462918.1 protein_id gnl|my_center|LOCUS_35000 210025 208244 gene locus_tag LOCUS_35010 210025 208244 CDS product DUF3744 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478313.1 protein_id gnl|my_center|LOCUS_35010 210667 210032 gene locus_tag LOCUS_35020 210667 210032 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375133.1 protein_id gnl|my_center|LOCUS_35020 212021 210891 gene locus_tag LOCUS_35030 212021 210891 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364999.1 protein_id gnl|my_center|LOCUS_35030 212407 212021 gene locus_tag LOCUS_35040 212407 212021 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478107.1 protein_id gnl|my_center|LOCUS_35040 212554 213444 gene locus_tag LOCUS_35050 212554 213444 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619521.1 protein_id gnl|my_center|LOCUS_35050 215124 213541 gene locus_tag LOCUS_35060 215124 213541 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478159.1 protein_id gnl|my_center|LOCUS_35060 216600 215125 gene locus_tag LOCUS_35070 216600 215125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462926.1 protein_id gnl|my_center|LOCUS_35070 218026 216857 gene locus_tag LOCUS_35080 218026 216857 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462928.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35080 218216 218040 gene locus_tag LOCUS_35090 218216 218040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35090 218995 218285 gene locus_tag LOCUS_35100 gene deoD 218995 218285 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462930.1 protein_id gnl|my_center|LOCUS_35100 219393 220343 gene locus_tag LOCUS_35110 219393 220343 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 protein_id gnl|my_center|LOCUS_35110 220333 221136 gene locus_tag LOCUS_35120 220333 221136 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478375.1 protein_id gnl|my_center|LOCUS_35120 221160 222278 gene locus_tag LOCUS_35130 gene phrB 221160 222278 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478177.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35130 222271 222576 gene locus_tag LOCUS_35140 222271 222576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35140 222604 223509 gene locus_tag LOCUS_35150 222604 223509 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478383.1 protein_id gnl|my_center|LOCUS_35150 223790 223536 gene locus_tag LOCUS_35160 223790 223536 CDS product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462467.1 protein_id gnl|my_center|LOCUS_35160 224177 225556 gene locus_tag LOCUS_35170 224177 225556 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499754.1 protein_id gnl|my_center|LOCUS_35170 226332 228311 gene locus_tag LOCUS_35180 226332 228311 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491046.1 protein_id gnl|my_center|LOCUS_35180 228312 230453 gene locus_tag LOCUS_35190 228312 230453 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478149.1 protein_id gnl|my_center|LOCUS_35190 230463 232715 gene locus_tag LOCUS_35200 230463 232715 CDS product proprotein convertase P-domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478267.1 protein_id gnl|my_center|LOCUS_35200 232741 234174 gene locus_tag LOCUS_35210 232741 234174 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478059.1 protein_id gnl|my_center|LOCUS_35210 234176 234745 gene locus_tag LOCUS_35220 234176 234745 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462950.1 protein_id gnl|my_center|LOCUS_35220 236482 234839 gene locus_tag LOCUS_35230 236482 234839 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478327.1 protein_id gnl|my_center|LOCUS_35230 236816 237637 gene locus_tag LOCUS_35240 236816 237637 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 protein_id gnl|my_center|LOCUS_35240 237736 238668 gene locus_tag LOCUS_35250 gene pstC 237736 238668 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 protein_id gnl|my_center|LOCUS_35250 238691 239554 gene locus_tag LOCUS_35260 gene pstA 238691 239554 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 protein_id gnl|my_center|LOCUS_35260 239615 240364 gene locus_tag LOCUS_35270 gene pstB 239615 240364 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 protein_id gnl|my_center|LOCUS_35270 240735 242810 gene locus_tag LOCUS_35280 240735 242810 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699275.1 protein_id gnl|my_center|LOCUS_35280 244642 242996 gene locus_tag LOCUS_35290 244642 242996 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106518.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence044 2418 1414 gene locus_tag LOCUS_35300 2418 1414 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492076.1 protein_id gnl|my_center|LOCUS_35300 2887 2411 gene locus_tag LOCUS_35310 2887 2411 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462967.1 protein_id gnl|my_center|LOCUS_35310 3857 2931 gene locus_tag LOCUS_35320 3857 2931 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478115.1 protein_id gnl|my_center|LOCUS_35320 4828 3872 gene locus_tag LOCUS_35330 4828 3872 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 protein_id gnl|my_center|LOCUS_35330 5147 7063 gene locus_tag LOCUS_35340 5147 7063 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478023.1 protein_id gnl|my_center|LOCUS_35340 7119 7319 gene locus_tag LOCUS_35350 7119 7319 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462979.1 protein_id gnl|my_center|LOCUS_35350 7465 7316 gene locus_tag LOCUS_35360 7465 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 7494 8165 gene locus_tag LOCUS_35370 7494 8165 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462981.1 protein_id gnl|my_center|LOCUS_35370 8389 9033 gene locus_tag LOCUS_35380 gene cpsQ 8389 9033 CDS product cyclic-di-GMP-binding transcriptional regulator CpsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462983.1 protein_id gnl|my_center|LOCUS_35380 9232 9825 gene locus_tag LOCUS_35390 9232 9825 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462984.1 protein_id gnl|my_center|LOCUS_35390 9941 11599 gene locus_tag LOCUS_35400 9941 11599 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478308.1 protein_id gnl|my_center|LOCUS_35400 11574 12914 gene locus_tag LOCUS_35410 11574 12914 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462986.1 protein_id gnl|my_center|LOCUS_35410 13041 13595 gene locus_tag LOCUS_35420 13041 13595 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707527.1 protein_id gnl|my_center|LOCUS_35420 13734 14426 gene locus_tag LOCUS_35430 13734 14426 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202283.1 protein_id gnl|my_center|LOCUS_35430 16671 14533 gene locus_tag LOCUS_35440 16671 14533 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261819.1 protein_id gnl|my_center|LOCUS_35440 16905 17111 gene locus_tag LOCUS_35450 16905 17111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 17108 17386 gene locus_tag LOCUS_35460 17108 17386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35460 17536 18384 gene locus_tag LOCUS_35470 17536 18384 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463003.1 protein_id gnl|my_center|LOCUS_35470 18665 20713 gene locus_tag LOCUS_35480 18665 20713 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478042.1 protein_id gnl|my_center|LOCUS_35480 21208 20756 gene locus_tag LOCUS_35490 gene azu 21208 20756 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463034.1 protein_id gnl|my_center|LOCUS_35490 21820 25443 gene locus_tag LOCUS_35500 21820 25443 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700213.1 protein_id gnl|my_center|LOCUS_35500 25662 26891 gene locus_tag LOCUS_35510 25662 26891 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262757.1 protein_id gnl|my_center|LOCUS_35510 26975 28285 gene locus_tag LOCUS_35520 26975 28285 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261378.1 protein_id gnl|my_center|LOCUS_35520 29169 28378 gene locus_tag LOCUS_35530 29169 28378 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 protein_id gnl|my_center|LOCUS_35530 29359 29892 gene locus_tag LOCUS_35540 29359 29892 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482606.1 protein_id gnl|my_center|LOCUS_35540 30145 30702 gene locus_tag LOCUS_35550 30145 30702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 31806 30751 gene locus_tag LOCUS_35560 gene arsB 31806 30751 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 protein_id gnl|my_center|LOCUS_35560 32233 31892 gene locus_tag LOCUS_35570 32233 31892 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482591.1 protein_id gnl|my_center|LOCUS_35570 32608 32474 gene locus_tag LOCUS_35580 32608 32474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 32848 32636 gene locus_tag LOCUS_35590 32848 32636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 32835 34583 gene locus_tag LOCUS_35600 32835 34583 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482583.1 protein_id gnl|my_center|LOCUS_35600 35037 35480 gene locus_tag LOCUS_35610 35037 35480 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005391226.1 protein_id gnl|my_center|LOCUS_35610 35493 36914 gene locus_tag LOCUS_35620 35493 36914 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482596.1 protein_id gnl|my_center|LOCUS_35620 36962 38233 gene locus_tag LOCUS_35630 36962 38233 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482604.1 protein_id gnl|my_center|LOCUS_35630 38293 38811 gene locus_tag LOCUS_35640 38293 38811 CDS product MltR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462031.1 protein_id gnl|my_center|LOCUS_35640 38821 39555 gene locus_tag LOCUS_35650 38821 39555 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462052.1 protein_id gnl|my_center|LOCUS_35650 39582 40328 gene locus_tag LOCUS_35660 39582 40328 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482669.1 protein_id gnl|my_center|LOCUS_35660 40638 40444 gene locus_tag LOCUS_35670 40638 40444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35670 40772 40635 gene locus_tag LOCUS_35680 40772 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35680 40967 41224 gene locus_tag LOCUS_35690 40967 41224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021448112.1 protein_id gnl|my_center|LOCUS_35690 42327 41269 gene locus_tag LOCUS_35700 42327 41269 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263555.1 protein_id gnl|my_center|LOCUS_35700 42470 43363 gene locus_tag LOCUS_35710 42470 43363 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061369.1 protein_id gnl|my_center|LOCUS_35710 43679 43398 gene locus_tag LOCUS_35720 43679 43398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 44562 44002 gene locus_tag LOCUS_35730 gene sigZ 44562 44002 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 protein_id gnl|my_center|LOCUS_35730 44842 44549 gene locus_tag LOCUS_35740 44842 44549 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459687.1 protein_id gnl|my_center|LOCUS_35740 45094 46191 gene locus_tag LOCUS_35750 45094 46191 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070848.1 protein_id gnl|my_center|LOCUS_35750 46637 46266 gene locus_tag LOCUS_35760 46637 46266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 46754 47620 gene locus_tag LOCUS_35770 46754 47620 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_35770 47770 48063 gene locus_tag LOCUS_35780 47770 48063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459692.1 protein_id gnl|my_center|LOCUS_35780 50073 48115 gene locus_tag LOCUS_35790 50073 48115 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479240.1 protein_id gnl|my_center|LOCUS_35790 50687 50070 gene locus_tag LOCUS_35800 50687 50070 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479200.1 protein_id gnl|my_center|LOCUS_35800 51085 51951 gene locus_tag LOCUS_35810 51085 51951 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262445.1 protein_id gnl|my_center|LOCUS_35810 52131 52931 gene locus_tag LOCUS_35820 52131 52931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 53018 53668 gene locus_tag LOCUS_35830 53018 53668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 54209 53778 gene locus_tag LOCUS_35840 54209 53778 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477329.1 protein_id gnl|my_center|LOCUS_35840 54274 54411 gene locus_tag LOCUS_35850 54274 54411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 55611 54397 gene locus_tag LOCUS_35860 55611 54397 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477167.1 protein_id gnl|my_center|LOCUS_35860 56577 56044 gene locus_tag LOCUS_35870 56577 56044 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455994.1 protein_id gnl|my_center|LOCUS_35870 57356 56838 gene locus_tag LOCUS_35880 57356 56838 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 protein_id gnl|my_center|LOCUS_35880 57558 58400 gene locus_tag LOCUS_35890 57558 58400 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481635.1 protein_id gnl|my_center|LOCUS_35890 59333 58401 gene locus_tag LOCUS_35900 59333 58401 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477131.1 protein_id gnl|my_center|LOCUS_35900 61245 59593 gene locus_tag LOCUS_35910 61245 59593 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477155.1 protein_id gnl|my_center|LOCUS_35910 61669 61268 gene locus_tag LOCUS_35920 61669 61268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 62136 61786 gene locus_tag LOCUS_35930 62136 61786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463395.1 protein_id gnl|my_center|LOCUS_35930 63598 62312 gene locus_tag LOCUS_35940 63598 62312 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477098.1 protein_id gnl|my_center|LOCUS_35940 64311 63598 gene locus_tag LOCUS_35950 64311 63598 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463399.1 protein_id gnl|my_center|LOCUS_35950 64584 65015 gene locus_tag LOCUS_35960 64584 65015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 65798 65079 gene locus_tag LOCUS_35970 65798 65079 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477212.1 protein_id gnl|my_center|LOCUS_35970 66317 66012 gene locus_tag LOCUS_35980 66317 66012 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_35980 66511 66888 gene locus_tag LOCUS_35990 66511 66888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491015.1 protein_id gnl|my_center|LOCUS_35990 66974 67573 gene locus_tag LOCUS_36000 66974 67573 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477286.1 protein_id gnl|my_center|LOCUS_36000 67909 67613 gene locus_tag LOCUS_36010 67909 67613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 68458 68012 gene locus_tag LOCUS_36020 68458 68012 CDS product DUF3429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477135.1 protein_id gnl|my_center|LOCUS_36020 69015 68470 gene locus_tag LOCUS_36030 69015 68470 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477262.1 protein_id gnl|my_center|LOCUS_36030 69780 69124 gene locus_tag LOCUS_36040 gene ribB 69780 69124 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477276.1 protein_id gnl|my_center|LOCUS_36040 70835 70218 gene locus_tag LOCUS_36050 70835 70218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477309.1 protein_id gnl|my_center|LOCUS_36050 72751 70895 gene locus_tag LOCUS_36060 72751 70895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477111.1 protein_id gnl|my_center|LOCUS_36060 73293 72964 gene locus_tag LOCUS_36070 73293 72964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 74041 73304 gene locus_tag LOCUS_36080 74041 73304 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 protein_id gnl|my_center|LOCUS_36080 74696 74043 gene locus_tag LOCUS_36090 74696 74043 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477263.1 protein_id gnl|my_center|LOCUS_36090 75572 74802 gene locus_tag LOCUS_36100 75572 74802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 75913 76095 gene locus_tag LOCUS_36110 75913 76095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463425.1 protein_id gnl|my_center|LOCUS_36110 77424 76147 gene locus_tag LOCUS_36120 77424 76147 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477214.1 protein_id gnl|my_center|LOCUS_36120 78672 77434 gene locus_tag LOCUS_36130 gene codB 78672 77434 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477307.1 protein_id gnl|my_center|LOCUS_36130 80832 79486 gene locus_tag LOCUS_36140 80832 79486 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477172.1 protein_id gnl|my_center|LOCUS_36140 82229 80907 gene locus_tag LOCUS_36150 82229 80907 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477129.1 protein_id gnl|my_center|LOCUS_36150 83713 82613 gene locus_tag LOCUS_36160 83713 82613 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263714.1 protein_id gnl|my_center|LOCUS_36160 83835 83701 gene locus_tag LOCUS_36170 83835 83701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36170 84161 83835 gene locus_tag LOCUS_36180 84161 83835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263713.1 protein_id gnl|my_center|LOCUS_36180 84269 85270 gene locus_tag LOCUS_36190 84269 85270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 85936 86634 gene locus_tag LOCUS_36200 85936 86634 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_36200 86639 87988 gene locus_tag LOCUS_36210 86639 87988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 88598 87942 gene locus_tag LOCUS_36220 88598 87942 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477285.1 protein_id gnl|my_center|LOCUS_36220 88703 90142 gene locus_tag LOCUS_36230 88703 90142 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477085.1 protein_id gnl|my_center|LOCUS_36230 90371 91468 gene locus_tag LOCUS_36240 gene vexC 90371 91468 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 protein_id gnl|my_center|LOCUS_36240 91468 94518 gene locus_tag LOCUS_36250 gene vexD 91468 94518 CDS product efflux RND transporter permease subunit VexD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350250.1 protein_id gnl|my_center|LOCUS_36250 95647 94775 gene locus_tag LOCUS_36260 95647 94775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 97091 95829 gene locus_tag LOCUS_36270 gene yjeH 97091 95829 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477288.1 protein_id gnl|my_center|LOCUS_36270 97267 97722 gene locus_tag LOCUS_36280 97267 97722 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477070.1 protein_id gnl|my_center|LOCUS_36280 97719 98096 gene locus_tag LOCUS_36290 97719 98096 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477828.1 protein_id gnl|my_center|LOCUS_36290 98086 99000 gene locus_tag LOCUS_36300 98086 99000 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477202.1 protein_id gnl|my_center|LOCUS_36300 99109 99723 gene locus_tag LOCUS_36310 99109 99723 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463452.1 protein_id gnl|my_center|LOCUS_36310 100104 99877 gene locus_tag LOCUS_36320 100104 99877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079005.1 protein_id gnl|my_center|LOCUS_36320 102035 100602 gene locus_tag LOCUS_36330 102035 100602 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477274.1 protein_id gnl|my_center|LOCUS_36330 102688 104460 gene locus_tag LOCUS_36340 102688 104460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36340 104361 105281 gene locus_tag LOCUS_36350 104361 105281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36350 105340 106332 gene locus_tag LOCUS_36360 105340 106332 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477354.1 protein_id gnl|my_center|LOCUS_36360 107680 106397 gene locus_tag LOCUS_36370 107680 106397 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477179.1 protein_id gnl|my_center|LOCUS_36370 108172 107858 gene locus_tag LOCUS_36380 108172 107858 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453573.1 protein_id gnl|my_center|LOCUS_36380 108410 108613 gene locus_tag LOCUS_36390 108410 108613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477197.1 protein_id gnl|my_center|LOCUS_36390 108707 109360 gene locus_tag LOCUS_36400 108707 109360 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 protein_id gnl|my_center|LOCUS_36400 109393 109662 gene locus_tag LOCUS_36410 109393 109662 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463466.1 protein_id gnl|my_center|LOCUS_36410 109886 110983 gene locus_tag LOCUS_36420 109886 110983 CDS product autoinducer 2-binding periplasmic protein LuxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463467.1 protein_id gnl|my_center|LOCUS_36420 110983 113568 gene locus_tag LOCUS_36430 110983 113568 CDS product LuxQ periplasmic sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477121.1 protein_id gnl|my_center|LOCUS_36430 114350 113688 gene locus_tag LOCUS_36440 114350 113688 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477181.1 protein_id gnl|my_center|LOCUS_36440 115578 116033 gene locus_tag LOCUS_36450 115578 116033 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477216.1 protein_id gnl|my_center|LOCUS_36450 116096 116719 gene locus_tag LOCUS_36460 116096 116719 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 protein_id gnl|my_center|LOCUS_36460 116997 116743 gene locus_tag LOCUS_36470 116997 116743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170618937.1 protein_id gnl|my_center|LOCUS_36470 117712 117149 gene locus_tag LOCUS_36480 117712 117149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477241.1 protein_id gnl|my_center|LOCUS_36480 117800 118468 gene locus_tag LOCUS_36490 117800 118468 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477076.1 protein_id gnl|my_center|LOCUS_36490 118600 119076 gene locus_tag LOCUS_36500 118600 119076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477272.1 protein_id gnl|my_center|LOCUS_36500 119241 121079 gene locus_tag LOCUS_36510 gene secD 119241 121079 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477067.1 protein_id gnl|my_center|LOCUS_36510 121082 121984 gene locus_tag LOCUS_36520 gene secF 121082 121984 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463489.1 protein_id gnl|my_center|LOCUS_36520 122412 122146 gene locus_tag LOCUS_36530 122412 122146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477321.1 protein_id gnl|my_center|LOCUS_36530 122926 122429 gene locus_tag LOCUS_36540 122926 122429 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106442.1 protein_id gnl|my_center|LOCUS_36540 123804 124544 gene locus_tag LOCUS_36550 123804 124544 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477336.1 protein_id gnl|my_center|LOCUS_36550 124556 125764 gene locus_tag LOCUS_36560 124556 125764 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106441.1 protein_id gnl|my_center|LOCUS_36560 125809 126156 gene locus_tag LOCUS_36570 125809 126156 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005398278.1 protein_id gnl|my_center|LOCUS_36570 126222 127997 gene locus_tag LOCUS_36580 gene phaC 126222 127997 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477137.1 protein_id gnl|my_center|LOCUS_36580 128379 128245 gene locus_tag LOCUS_36590 128379 128245 CDS product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 protein_id gnl|my_center|LOCUS_36590 128973 128395 gene locus_tag LOCUS_36600 128973 128395 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463498.1 protein_id gnl|my_center|LOCUS_36600 129458 129003 gene locus_tag LOCUS_36610 129458 129003 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106440.1 protein_id gnl|my_center|LOCUS_36610 132020 129531 gene locus_tag LOCUS_36620 gene napA 132020 129531 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463500.1 protein_id gnl|my_center|LOCUS_36620 132325 132017 gene locus_tag LOCUS_36630 132325 132017 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463501.1 protein_id gnl|my_center|LOCUS_36630 133099 134820 gene locus_tag LOCUS_36640 gene narQ 133099 134820 CDS product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477087.1 protein_id gnl|my_center|LOCUS_36640 134822 135454 gene locus_tag LOCUS_36650 134822 135454 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477224.1 protein_id gnl|my_center|LOCUS_36650 135753 136757 gene locus_tag LOCUS_36660 135753 136757 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463571.1 protein_id gnl|my_center|LOCUS_36660 136757 137194 gene locus_tag LOCUS_36670 136757 137194 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463573.1 protein_id gnl|my_center|LOCUS_36670 137257 138807 gene locus_tag LOCUS_36680 137257 138807 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477340.1 protein_id gnl|my_center|LOCUS_36680 139251 140294 gene locus_tag LOCUS_36690 139251 140294 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463577.1 protein_id gnl|my_center|LOCUS_36690 141257 141898 gene locus_tag LOCUS_36700 141257 141898 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080009.1 protein_id gnl|my_center|LOCUS_36700 141986 142621 gene locus_tag LOCUS_36710 141986 142621 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397610.1 protein_id gnl|my_center|LOCUS_36710 142750 143094 gene locus_tag LOCUS_36720 142750 143094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082000.1 protein_id gnl|my_center|LOCUS_36720 145615 143363 gene locus_tag LOCUS_36730 145615 143363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 146082 145780 gene locus_tag LOCUS_36740 146082 145780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 146161 146737 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgttataaccgggcacttcataaac 147232 146954 gene locus_tag LOCUS_36750 gene cas2 147232 146954 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683530.1 protein_id gnl|my_center|LOCUS_36750 147525 147241 gene locus_tag LOCUS_36760 gene cas2 147525 147241 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683530.1 protein_id gnl|my_center|LOCUS_36760 149598 148126 gene locus_tag LOCUS_36770 149598 148126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 150451 149648 gene locus_tag LOCUS_36780 150451 149648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 150669 150854 gene locus_tag LOCUS_36790 150669 150854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 152173 150926 gene locus_tag LOCUS_36800 152173 150926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 152423 152839 gene locus_tag LOCUS_36810 152423 152839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36810 152844 153731 gene locus_tag LOCUS_36820 152844 153731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 153757 154650 gene locus_tag LOCUS_36830 153757 154650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 155824 154694 gene locus_tag LOCUS_36840 155824 154694 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419707.1 protein_id gnl|my_center|LOCUS_36840 156684 155818 gene locus_tag LOCUS_36850 156684 155818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 158822 156681 gene locus_tag LOCUS_36860 158822 156681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 159301 158825 gene locus_tag LOCUS_36870 159301 158825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 160689 159298 gene locus_tag LOCUS_36880 160689 159298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 161405 160686 gene locus_tag LOCUS_36890 161405 160686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 162259 161891 gene locus_tag LOCUS_36900 162259 161891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 162878 162261 gene locus_tag LOCUS_36910 162878 162261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 164611 162869 gene locus_tag LOCUS_36920 164611 162869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 165335 166552 gene locus_tag LOCUS_36930 165335 166552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 168329 166908 gene locus_tag LOCUS_36940 gene scrG 168329 166908 CDS product regulatory protein ScrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105816.1 protein_id gnl|my_center|LOCUS_36940 169985 168819 gene locus_tag LOCUS_36950 169985 168819 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015478.1 protein_id gnl|my_center|LOCUS_36950 170962 171231 gene locus_tag LOCUS_36960 170962 171231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 171804 171226 gene locus_tag LOCUS_36970 171804 171226 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_36970 172478 172107 gene locus_tag LOCUS_36980 172478 172107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36980 173151 172462 gene locus_tag LOCUS_36990 173151 172462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 174172 173360 gene locus_tag LOCUS_37000 174172 173360 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_37000 176280 174214 gene locus_tag LOCUS_37010 176280 174214 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_37010 176447 176665 gene locus_tag LOCUS_37020 176447 176665 CDS product DUF2798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261740.1 protein_id gnl|my_center|LOCUS_37020 176763 178112 gene locus_tag LOCUS_37030 176763 178112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 179085 178303 gene locus_tag LOCUS_37040 179085 178303 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262191.1 protein_id gnl|my_center|LOCUS_37040 179535 180092 gene locus_tag LOCUS_37050 179535 180092 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073454.1 protein_id gnl|my_center|LOCUS_37050 180273 181535 gene locus_tag LOCUS_37060 180273 181535 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_37060 181691 183121 gene locus_tag LOCUS_37070 181691 183121 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_37070 183764 183444 gene locus_tag LOCUS_37080 183764 183444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 185300 184074 gene locus_tag LOCUS_37090 185300 184074 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704678.1 protein_id gnl|my_center|LOCUS_37090 186007 186606 gene locus_tag LOCUS_37100 gene betI 186007 186606 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477071.1 protein_id gnl|my_center|LOCUS_37100 186623 188083 gene locus_tag LOCUS_37110 gene betB 186623 188083 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 protein_id gnl|my_center|LOCUS_37110 188103 189803 gene locus_tag LOCUS_37120 gene betA 188103 189803 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477133.1 protein_id gnl|my_center|LOCUS_37120 189833 190771 gene locus_tag LOCUS_37130 189833 190771 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463665.1 protein_id gnl|my_center|LOCUS_37130 190876 191676 gene locus_tag LOCUS_37140 gene choW 190876 191676 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463667.1 protein_id gnl|my_center|LOCUS_37140 191678 192862 gene locus_tag LOCUS_37150 gene choV 191678 192862 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477289.1 protein_id gnl|my_center|LOCUS_37150 193812 192958 gene locus_tag LOCUS_37160 193812 192958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 194731 194075 gene locus_tag LOCUS_37170 194731 194075 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106424.1 protein_id gnl|my_center|LOCUS_37170 195014 195418 gene locus_tag LOCUS_37180 195014 195418 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477079.1 protein_id gnl|my_center|LOCUS_37180 196271 195483 gene locus_tag LOCUS_37190 196271 195483 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477264.1 protein_id gnl|my_center|LOCUS_37190 197651 196281 gene locus_tag LOCUS_37200 197651 196281 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477226.1 protein_id gnl|my_center|LOCUS_37200 200512 197792 gene locus_tag LOCUS_37210 200512 197792 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477084.1 protein_id gnl|my_center|LOCUS_37210 202580 200928 gene locus_tag LOCUS_37220 202580 200928 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290511.1 protein_id gnl|my_center|LOCUS_37220 203779 202637 gene locus_tag LOCUS_37230 203779 202637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 207350 203784 gene locus_tag LOCUS_37240 207350 203784 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626040.1 protein_id gnl|my_center|LOCUS_37240 207590 208057 gene locus_tag LOCUS_37250 207590 208057 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477208.1 protein_id gnl|my_center|LOCUS_37250 208294 209316 gene locus_tag LOCUS_37260 208294 209316 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477166.1 protein_id gnl|my_center|LOCUS_37260 209326 210183 gene locus_tag LOCUS_37270 209326 210183 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477210.1 protein_id gnl|my_center|LOCUS_37270 210827 210213 gene locus_tag LOCUS_37280 210827 210213 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482630.1 protein_id gnl|my_center|LOCUS_37280 210953 211948 gene locus_tag LOCUS_37290 210953 211948 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964920.1 protein_id gnl|my_center|LOCUS_37290 213053 211977 gene locus_tag LOCUS_37300 213053 211977 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482589.1 protein_id gnl|my_center|LOCUS_37300 214345 213197 gene locus_tag LOCUS_37310 gene yiaY 214345 213197 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482586.1 protein_id gnl|my_center|LOCUS_37310 215329 214679 gene locus_tag LOCUS_37320 gene elbB 215329 214679 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482741.1 protein_id gnl|my_center|LOCUS_37320 215488 215342 gene locus_tag LOCUS_37330 215488 215342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 215738 216520 gene locus_tag LOCUS_37340 gene yddG 215738 216520 CDS product aromatic amino acid DMT transporter YddG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482638.1 protein_id gnl|my_center|LOCUS_37340 216545 216877 gene locus_tag LOCUS_37350 216545 216877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 218653 217841 gene locus_tag LOCUS_37360 218653 217841 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462012.1 protein_id gnl|my_center|LOCUS_37360 219788 218910 gene locus_tag LOCUS_37370 219788 218910 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461877.1 protein_id gnl|my_center|LOCUS_37370 219961 220536 gene locus_tag LOCUS_37380 219961 220536 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461928.1 protein_id gnl|my_center|LOCUS_37380 220980 220600 gene locus_tag LOCUS_37390 220980 220600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37390 222569 221028 gene locus_tag LOCUS_37400 222569 221028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37400 222655 222849 gene locus_tag LOCUS_37410 222655 222849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 222791 223585 gene locus_tag LOCUS_37420 gene phhA 222791 223585 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482734.1 protein_id gnl|my_center|LOCUS_37420 223575 223913 gene locus_tag LOCUS_37430 223575 223913 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482617.1 protein_id gnl|my_center|LOCUS_37430 225955 224186 gene locus_tag LOCUS_37440 225955 224186 CDS product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106299.1 protein_id gnl|my_center|LOCUS_37440 226472 226816 gene locus_tag LOCUS_37450 226472 226816 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451084.1 protein_id gnl|my_center|LOCUS_37450 227184 226876 gene locus_tag LOCUS_37460 227184 226876 CDS product cysteine-rich CWC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106302.1 protein_id gnl|my_center|LOCUS_37460 227346 228044 gene locus_tag LOCUS_37470 227346 228044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 228048 228263 gene locus_tag LOCUS_37480 228048 228263 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 protein_id gnl|my_center|LOCUS_37480 228305 228547 gene locus_tag LOCUS_37490 228305 228547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 228927 229688 gene locus_tag LOCUS_37500 228927 229688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 230360 230112 gene locus_tag LOCUS_37510 230360 230112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462100.1 protein_id gnl|my_center|LOCUS_37510 230620 231258 gene locus_tag LOCUS_37520 gene pcp 230620 231258 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482616.1 protein_id gnl|my_center|LOCUS_37520 231437 231700 gene locus_tag LOCUS_37530 231437 231700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462091.1 protein_id gnl|my_center|LOCUS_37530 231765 232751 gene locus_tag LOCUS_37540 231765 232751 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482750.1 protein_id gnl|my_center|LOCUS_37540 232865 234157 gene locus_tag LOCUS_37550 232865 234157 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482719.1 protein_id gnl|my_center|LOCUS_37550 237232 234221 gene locus_tag LOCUS_37560 237232 234221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482602.1 protein_id gnl|my_center|LOCUS_37560 237851 237507 gene locus_tag LOCUS_37570 237851 237507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 239084 238350 gene locus_tag LOCUS_37580 239084 238350 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482748.1 protein_id gnl|my_center|LOCUS_37580 239495 240964 gene locus_tag LOCUS_37590 239495 240964 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482723.1 protein_id gnl|my_center|LOCUS_37590 242510 241047 gene locus_tag LOCUS_37600 gene modF 242510 241047 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482730.1 protein_id gnl|my_center|LOCUS_37600 242796 243401 gene locus_tag LOCUS_37610 242796 243401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 243697 243607 gene locus_tag LOCUS_t00940 243697 243607 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 244027 244707 gene locus_tag LOCUS_37620 244027 244707 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462115.1 protein_id gnl|my_center|LOCUS_37620 245586 244759 gene locus_tag LOCUS_37630 245586 244759 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462121.1 protein_id gnl|my_center|LOCUS_37630 245743 246099 gene locus_tag LOCUS_37640 245743 246099 CDS product DUF3024 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489200.1 protein_id gnl|my_center|LOCUS_37640 246897 246100 gene locus_tag LOCUS_37650 246897 246100 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489357.1 protein_id gnl|my_center|LOCUS_37650 248968 246965 gene locus_tag LOCUS_37660 gene rnb 248968 246965 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489296.1 protein_id gnl|my_center|LOCUS_37660 249349 251280 gene locus_tag LOCUS_37670 249349 251280 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483383.1 protein_id gnl|my_center|LOCUS_37670 251641 252834 gene locus_tag LOCUS_37680 251641 252834 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483382.1 protein_id gnl|my_center|LOCUS_37680 255070 252914 gene locus_tag LOCUS_37690 255070 252914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 255678 255067 gene locus_tag LOCUS_37700 gene ccoO 255678 255067 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072350.1 protein_id gnl|my_center|LOCUS_37700 257089 255680 gene locus_tag LOCUS_37710 gene ccoN 257089 255680 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350679.1 protein_id gnl|my_center|LOCUS_37710 257434 257105 gene locus_tag LOCUS_37720 257434 257105 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513613.1 protein_id gnl|my_center|LOCUS_37720 258324 258157 gene locus_tag LOCUS_37730 258324 258157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 258668 259546 gene locus_tag LOCUS_37740 258668 259546 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 protein_id gnl|my_center|LOCUS_37740 259626 260177 gene locus_tag LOCUS_37750 259626 260177 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483385.1 protein_id gnl|my_center|LOCUS_37750 261070 260174 gene locus_tag LOCUS_37760 261070 260174 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483384.1 protein_id gnl|my_center|LOCUS_37760 261912 261067 gene locus_tag LOCUS_37770 261912 261067 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483374.1 protein_id gnl|my_center|LOCUS_37770 263534 261930 gene locus_tag LOCUS_37780 263534 261930 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455777.1 protein_id gnl|my_center|LOCUS_37780 264725 263556 gene locus_tag LOCUS_37790 264725 263556 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483372.1 protein_id gnl|my_center|LOCUS_37790 265481 265113 gene locus_tag LOCUS_37800 265481 265113 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455792.1 protein_id gnl|my_center|LOCUS_37800 265783 266994 gene locus_tag LOCUS_37810 265783 266994 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483348.1 protein_id gnl|my_center|LOCUS_37810 267031 268524 gene locus_tag LOCUS_37820 267031 268524 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483387.1 protein_id gnl|my_center|LOCUS_37820 268542 269696 gene locus_tag LOCUS_37830 268542 269696 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483354.1 protein_id gnl|my_center|LOCUS_37830 269765 270217 gene locus_tag LOCUS_37840 269765 270217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37840 270187 270552 gene locus_tag LOCUS_37850 270187 270552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37850 270561 271685 gene locus_tag LOCUS_37860 270561 271685 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483393.1 protein_id gnl|my_center|LOCUS_37860 271697 272602 gene locus_tag LOCUS_37870 gene mmsB 271697 272602 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455759.1 protein_id gnl|my_center|LOCUS_37870 272815 273438 gene locus_tag LOCUS_37880 272815 273438 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483376.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37880 274203 275084 gene locus_tag LOCUS_37890 gene cyoA 274203 275084 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455699.1 protein_id gnl|my_center|LOCUS_37890 275090 277126 gene locus_tag LOCUS_37900 gene cyoB 275090 277126 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483356.1 protein_id gnl|my_center|LOCUS_37900 277116 277715 gene locus_tag LOCUS_37910 gene cyoC 277116 277715 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483335.1 protein_id gnl|my_center|LOCUS_37910 277715 278026 gene locus_tag LOCUS_37920 gene cyoD 277715 278026 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483339.1 protein_id gnl|my_center|LOCUS_37920 278035 278907 gene locus_tag LOCUS_37930 gene cyoE 278035 278907 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195157148.1 protein_id gnl|my_center|LOCUS_37930 279131 279577 gene locus_tag LOCUS_37940 279131 279577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 279782 280876 gene locus_tag LOCUS_37950 279782 280876 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 protein_id gnl|my_center|LOCUS_37950 281849 280953 gene locus_tag LOCUS_37960 gene cynR 281849 280953 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256690.1 protein_id gnl|my_center|LOCUS_37960 282005 282403 gene locus_tag LOCUS_37970 282005 282403 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 protein_id gnl|my_center|LOCUS_37970 282498 283958 gene locus_tag LOCUS_37980 282498 283958 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528145.1 protein_id gnl|my_center|LOCUS_37980 284026 285012 gene locus_tag LOCUS_37990 284026 285012 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_37990 285127 286731 gene locus_tag LOCUS_38000 285127 286731 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 protein_id gnl|my_center|LOCUS_38000 286844 288583 gene locus_tag LOCUS_38010 286844 288583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 288580 289311 gene locus_tag LOCUS_38020 288580 289311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 289446 289688 gene locus_tag LOCUS_38030 289446 289688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 290102 290992 gene locus_tag LOCUS_38040 290102 290992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 290989 291477 gene locus_tag LOCUS_38050 290989 291477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 291696 292424 gene locus_tag LOCUS_38060 gene artP 291696 292424 CDS product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483352.1 protein_id gnl|my_center|LOCUS_38060 292513 293244 gene locus_tag LOCUS_38070 292513 293244 CDS product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483358.1 protein_id gnl|my_center|LOCUS_38070 293246 293935 gene locus_tag LOCUS_38080 gene artQ 293246 293935 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483395.1 protein_id gnl|my_center|LOCUS_38080 293932 294600 gene locus_tag LOCUS_38090 gene artM 293932 294600 CDS product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455704.1 protein_id gnl|my_center|LOCUS_38090 295210 295953 gene locus_tag LOCUS_38100 295210 295953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 296100 296603 gene locus_tag LOCUS_38110 296100 296603 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483331.1 protein_id gnl|my_center|LOCUS_38110 297443 296613 gene locus_tag LOCUS_38120 297443 296613 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483391.1 protein_id gnl|my_center|LOCUS_38120 297562 298209 gene locus_tag LOCUS_38130 297562 298209 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483337.1 protein_id gnl|my_center|LOCUS_38130 298441 299874 gene locus_tag LOCUS_38140 298441 299874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 301578 300064 gene locus_tag LOCUS_38150 301578 300064 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460970.1 protein_id gnl|my_center|LOCUS_38150 302678 302100 gene locus_tag LOCUS_38160 302678 302100 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461003.1 protein_id gnl|my_center|LOCUS_38160 304030 302723 gene locus_tag LOCUS_38170 304030 302723 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460991.1 protein_id gnl|my_center|LOCUS_38170 304400 305446 gene locus_tag LOCUS_38180 304400 305446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence045 1451 351 gene locus_tag LOCUS_38190 1451 351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005498311.1 protein_id gnl|my_center|LOCUS_38190 2374 1448 gene locus_tag LOCUS_38200 2374 1448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482690.1 protein_id gnl|my_center|LOCUS_38200 3329 2379 gene locus_tag LOCUS_38210 3329 2379 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462020.1 protein_id gnl|my_center|LOCUS_38210 5300 3669 gene locus_tag LOCUS_38220 5300 3669 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482662.1 protein_id gnl|my_center|LOCUS_38220 5658 6698 gene locus_tag LOCUS_38230 5658 6698 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482709.1 protein_id gnl|my_center|LOCUS_38230 7426 6779 gene locus_tag LOCUS_38240 7426 6779 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_38240 9045 7513 gene locus_tag LOCUS_38250 gene norR 9045 7513 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262315.1 protein_id gnl|my_center|LOCUS_38250 9236 10723 gene locus_tag LOCUS_38260 gene norV 9236 10723 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262314.1 protein_id gnl|my_center|LOCUS_38260 10734 11882 gene locus_tag LOCUS_38270 gene norW 10734 11882 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863521.1 protein_id gnl|my_center|LOCUS_38270 11925 12263 gene locus_tag LOCUS_38280 11925 12263 CDS product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262311.1 protein_id gnl|my_center|LOCUS_38280 13933 12998 gene locus_tag LOCUS_38290 13933 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 15352 14120 gene locus_tag LOCUS_38300 gene manA 15352 14120 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478337.1 protein_id gnl|my_center|LOCUS_38300 17338 15431 gene locus_tag LOCUS_38310 17338 15431 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478109.1 protein_id gnl|my_center|LOCUS_38310 17721 18563 gene locus_tag LOCUS_38320 17721 18563 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463044.1 protein_id gnl|my_center|LOCUS_38320 19351 18575 gene locus_tag LOCUS_38330 19351 18575 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463046.1 protein_id gnl|my_center|LOCUS_38330 19663 19364 gene locus_tag LOCUS_38340 19663 19364 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463048.1 protein_id gnl|my_center|LOCUS_38340 19898 21769 gene locus_tag LOCUS_38350 19898 21769 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478378.1 protein_id gnl|my_center|LOCUS_38350 21848 22084 gene locus_tag LOCUS_38360 21848 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 22201 23079 gene locus_tag LOCUS_38370 22201 23079 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 protein_id gnl|my_center|LOCUS_38370 24704 23268 gene locus_tag LOCUS_38380 24704 23268 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478394.1 protein_id gnl|my_center|LOCUS_38380 25617 25000 gene locus_tag LOCUS_38390 25617 25000 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 protein_id gnl|my_center|LOCUS_38390 26663 25632 gene locus_tag LOCUS_38400 26663 25632 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 protein_id gnl|my_center|LOCUS_38400 27353 26766 gene locus_tag LOCUS_38410 27353 26766 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478295.1 protein_id gnl|my_center|LOCUS_38410 27724 27404 gene locus_tag LOCUS_38420 gene yqfB 27724 27404 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478088.1 protein_id gnl|my_center|LOCUS_38420 28406 28588 gene locus_tag LOCUS_38430 28406 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 30602 29571 gene locus_tag LOCUS_38440 30602 29571 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478165.1 protein_id gnl|my_center|LOCUS_38440 31432 30602 gene locus_tag LOCUS_38450 31432 30602 CDS product putative capsular polysaccharide synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478215.1 protein_id gnl|my_center|LOCUS_38450 32578 31463 gene locus_tag LOCUS_38460 32578 31463 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478236.1 protein_id gnl|my_center|LOCUS_38460 33686 32640 gene locus_tag LOCUS_38470 33686 32640 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478388.1 protein_id gnl|my_center|LOCUS_38470 35889 33706 gene locus_tag LOCUS_38480 35889 33706 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_38480 36433 35906 gene locus_tag LOCUS_38490 36433 35906 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463089.1 protein_id gnl|my_center|LOCUS_38490 37657 36449 gene locus_tag LOCUS_38500 37657 36449 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478164.1 protein_id gnl|my_center|LOCUS_38500 39047 37647 gene locus_tag LOCUS_38510 39047 37647 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_38510 40585 39467 gene locus_tag LOCUS_38520 gene malK 40585 39467 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 protein_id gnl|my_center|LOCUS_38520 41253 42431 gene locus_tag LOCUS_38530 gene malE 41253 42431 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463104.1 protein_id gnl|my_center|LOCUS_38530 42509 44083 gene locus_tag LOCUS_38540 gene malF 42509 44083 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106507.1 protein_id gnl|my_center|LOCUS_38540 44096 44986 gene locus_tag LOCUS_38550 gene malG 44096 44986 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463109.1 protein_id gnl|my_center|LOCUS_38550 45582 45340 gene locus_tag LOCUS_38560 45582 45340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017447309.1 protein_id gnl|my_center|LOCUS_38560 46247 45762 gene locus_tag LOCUS_38570 46247 45762 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478145.1 protein_id gnl|my_center|LOCUS_38570 46398 47090 gene locus_tag LOCUS_38580 46398 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 47083 48909 gene locus_tag LOCUS_38590 47083 48909 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478346.1 protein_id gnl|my_center|LOCUS_38590 48924 49916 gene locus_tag LOCUS_38600 48924 49916 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_38600 51324 49951 gene locus_tag LOCUS_38610 51324 49951 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 protein_id gnl|my_center|LOCUS_38610 51869 51324 gene locus_tag LOCUS_38620 51869 51324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106503.1 protein_id gnl|my_center|LOCUS_38620 51980 52186 gene locus_tag LOCUS_38630 51980 52186 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_38630 53205 52609 gene locus_tag LOCUS_38640 gene cas6f 53205 52609 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478386.1 protein_id gnl|my_center|LOCUS_38640 54254 53208 gene locus_tag LOCUS_38650 gene csy3 54254 53208 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478111.1 protein_id gnl|my_center|LOCUS_38650 56163 54241 gene locus_tag LOCUS_38660 56163 54241 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478157.1 protein_id gnl|my_center|LOCUS_38660 56667 56164 gene locus_tag LOCUS_38670 56667 56164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 57958 57500 gene locus_tag LOCUS_38680 57958 57500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 58111 58416 gene locus_tag LOCUS_38690 58111 58416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 58436 58927 gene locus_tag LOCUS_38700 58436 58927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 58929 59249 gene locus_tag LOCUS_38710 58929 59249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 59568 59272 gene locus_tag LOCUS_38720 59568 59272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 59813 60088 gene locus_tag LOCUS_38730 59813 60088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 60218 60616 gene locus_tag LOCUS_38740 60218 60616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 60878 61405 gene locus_tag LOCUS_38750 60878 61405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 61417 61902 gene locus_tag LOCUS_38760 61417 61902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 62124 62723 gene locus_tag LOCUS_38770 62124 62723 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 protein_id gnl|my_center|LOCUS_38770 62787 63644 gene locus_tag LOCUS_38780 62787 63644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38780 63761 64402 gene locus_tag LOCUS_38790 63761 64402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38790 64490 65632 gene locus_tag LOCUS_38800 64490 65632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 65635 66090 gene locus_tag LOCUS_38810 65635 66090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 66471 67043 gene locus_tag LOCUS_38820 66471 67043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 68533 67160 gene locus_tag LOCUS_38830 68533 67160 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460902.1 protein_id gnl|my_center|LOCUS_38830 68601 69491 gene locus_tag LOCUS_38840 68601 69491 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460892.1 protein_id gnl|my_center|LOCUS_38840 69705 69974 gene locus_tag LOCUS_38850 69705 69974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38850 70388 70819 gene locus_tag LOCUS_38860 70388 70819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 70842 71120 gene locus_tag LOCUS_38870 70842 71120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 71981 71379 gene locus_tag LOCUS_38880 71981 71379 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098828.1 protein_id gnl|my_center|LOCUS_38880 72363 72575 gene locus_tag LOCUS_38890 72363 72575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 74628 73690 gene locus_tag LOCUS_38900 gene melR 74628 73690 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106992.1 protein_id gnl|my_center|LOCUS_38900 74913 76265 gene locus_tag LOCUS_38910 gene melA 74913 76265 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001520868.1 protein_id gnl|my_center|LOCUS_38910 76453 76728 gene locus_tag LOCUS_38920 76453 76728 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_38920 77882 76953 gene locus_tag LOCUS_38930 77882 76953 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970192.1 protein_id gnl|my_center|LOCUS_38930 78140 80257 gene locus_tag LOCUS_38940 78140 80257 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213113.1 protein_id gnl|my_center|LOCUS_38940 80286 80546 gene locus_tag LOCUS_38950 80286 80546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38950 80543 81727 gene locus_tag LOCUS_38960 gene melB 80543 81727 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38960 81983 83146 gene locus_tag LOCUS_38970 81983 83146 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096165.1 protein_id gnl|my_center|LOCUS_38970 83893 85953 gene locus_tag LOCUS_38980 83893 85953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974055.1 protein_id gnl|my_center|LOCUS_38980 86003 87001 gene locus_tag LOCUS_38990 86003 87001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974056.1 protein_id gnl|my_center|LOCUS_38990 87011 88090 gene locus_tag LOCUS_39000 87011 88090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527991.1 protein_id gnl|my_center|LOCUS_39000 88113 89768 gene locus_tag LOCUS_39010 88113 89768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400883.1 protein_id gnl|my_center|LOCUS_39010 89951 91399 gene locus_tag LOCUS_39020 89951 91399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 91560 92594 gene locus_tag LOCUS_39030 91560 92594 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038157782.1 protein_id gnl|my_center|LOCUS_39030 92907 93191 gene locus_tag LOCUS_39040 92907 93191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39040 94177 95550 gene locus_tag LOCUS_39050 94177 95550 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706779.1 protein_id gnl|my_center|LOCUS_39050 96672 95686 gene locus_tag LOCUS_39060 96672 95686 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157570.1 protein_id gnl|my_center|LOCUS_39060 96907 98346 gene locus_tag LOCUS_39070 96907 98346 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 protein_id gnl|my_center|LOCUS_39070 98511 99470 gene locus_tag LOCUS_39080 98511 99470 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_39080 99467 100912 gene locus_tag LOCUS_39090 99467 100912 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 protein_id gnl|my_center|LOCUS_39090 101556 101296 gene locus_tag LOCUS_39100 101556 101296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39100 102182 101694 gene locus_tag LOCUS_39110 102182 101694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39110 102862 102509 gene locus_tag LOCUS_39120 102862 102509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39120 104680 104372 gene locus_tag LOCUS_39130 104680 104372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 105318 104866 gene locus_tag LOCUS_39140 105318 104866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39140 106656 105658 gene locus_tag LOCUS_39150 106656 105658 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 protein_id gnl|my_center|LOCUS_39150 107913 106906 gene locus_tag LOCUS_39160 107913 106906 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969764.1 protein_id gnl|my_center|LOCUS_39160 109095 107992 gene locus_tag LOCUS_39170 109095 107992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209902.1 protein_id gnl|my_center|LOCUS_39170 109309 110544 gene locus_tag LOCUS_39180 109309 110544 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209901.1 protein_id gnl|my_center|LOCUS_39180 110644 111951 gene locus_tag LOCUS_39190 110644 111951 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097216.1 protein_id gnl|my_center|LOCUS_39190 111956 112798 gene locus_tag LOCUS_39200 111956 112798 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097215.1 protein_id gnl|my_center|LOCUS_39200 112815 114047 gene locus_tag LOCUS_39210 112815 114047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 114047 116113 gene locus_tag LOCUS_39220 114047 116113 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097213.1 protein_id gnl|my_center|LOCUS_39220 116262 117524 gene locus_tag LOCUS_39230 116262 117524 CDS product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215759.1 protein_id gnl|my_center|LOCUS_39230 119150 118161 gene locus_tag LOCUS_39240 gene araH 119150 118161 CDS product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477508.1 protein_id gnl|my_center|LOCUS_39240 120693 119176 gene locus_tag LOCUS_39250 gene araG 120693 119176 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460653.1 protein_id gnl|my_center|LOCUS_39250 121751 120753 gene locus_tag LOCUS_39260 121751 120753 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460652.1 protein_id gnl|my_center|LOCUS_39260 122123 123826 gene locus_tag LOCUS_39270 122123 123826 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460432.1 protein_id gnl|my_center|LOCUS_39270 123819 124559 gene locus_tag LOCUS_39280 123819 124559 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460645.1 protein_id gnl|my_center|LOCUS_39280 124569 126056 gene locus_tag LOCUS_39290 gene araA 124569 126056 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477429.1 protein_id gnl|my_center|LOCUS_39290 126105 126491 gene locus_tag LOCUS_39300 126105 126491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39300 126683 127522 gene locus_tag LOCUS_39310 gene araC 126683 127522 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460426.1 protein_id gnl|my_center|LOCUS_39310 127574 128398 gene locus_tag LOCUS_39320 127574 128398 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278836.1 protein_id gnl|my_center|LOCUS_39320 129741 128899 gene locus_tag LOCUS_39330 129741 128899 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479818.1 protein_id gnl|my_center|LOCUS_39330 129970 130692 gene locus_tag LOCUS_39340 129970 130692 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479930.1 protein_id gnl|my_center|LOCUS_39340 131604 130687 gene locus_tag LOCUS_39350 131604 130687 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 protein_id gnl|my_center|LOCUS_39350 131779 132684 gene locus_tag LOCUS_39360 131779 132684 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_39360 133815 132787 gene locus_tag LOCUS_39370 gene pyrC 133815 132787 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480191.1 protein_id gnl|my_center|LOCUS_39370 134134 133970 gene locus_tag LOCUS_39380 134134 133970 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480188.1 protein_id gnl|my_center|LOCUS_39380 134424 136241 gene locus_tag LOCUS_39390 134424 136241 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491107.1 protein_id gnl|my_center|LOCUS_39390 137182 136352 gene locus_tag LOCUS_39400 gene nadE 137182 136352 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480808.1 protein_id gnl|my_center|LOCUS_39400 137393 137926 gene locus_tag LOCUS_39410 137393 137926 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480803.1 protein_id gnl|my_center|LOCUS_39410 137941 138423 gene locus_tag LOCUS_39420 137941 138423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480810.1 protein_id gnl|my_center|LOCUS_39420 139077 138469 gene locus_tag LOCUS_39430 139077 138469 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480809.1 protein_id gnl|my_center|LOCUS_39430 139272 140381 gene locus_tag LOCUS_39440 139272 140381 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 protein_id gnl|my_center|LOCUS_39440 140831 140493 gene locus_tag LOCUS_39450 140831 140493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39450 141359 141631 gene locus_tag LOCUS_39460 141359 141631 CDS product YnjH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005498191.1 protein_id gnl|my_center|LOCUS_39460 141978 141679 gene locus_tag LOCUS_39470 141978 141679 CDS product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488152.1 protein_id gnl|my_center|LOCUS_39470 142502 142963 gene locus_tag LOCUS_39480 142502 142963 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481342.1 protein_id gnl|my_center|LOCUS_39480 143831 143049 gene locus_tag LOCUS_39490 143831 143049 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491112.1 protein_id gnl|my_center|LOCUS_39490 144775 143831 gene locus_tag LOCUS_39500 144775 143831 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491087.1 protein_id gnl|my_center|LOCUS_39500 145746 144877 gene locus_tag LOCUS_39510 145746 144877 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479207.1 protein_id gnl|my_center|LOCUS_39510 146185 145772 gene locus_tag LOCUS_39520 146185 145772 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454456.1 protein_id gnl|my_center|LOCUS_39520 146580 146182 gene locus_tag LOCUS_39530 146580 146182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39530 147625 146879 gene locus_tag LOCUS_39540 147625 146879 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479220.1 protein_id gnl|my_center|LOCUS_39540 147793 149163 gene locus_tag LOCUS_39550 gene hutW 147793 149163 CDS product heme anaerobic degradation radical SAM methyltransferase ChuW/HutW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479251.1 protein_id gnl|my_center|LOCUS_39550 149174 149689 gene locus_tag LOCUS_39560 gene hutX 149174 149689 CDS product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451074.1 protein_id gnl|my_center|LOCUS_39560 149704 150342 gene locus_tag LOCUS_39570 gene hutZ 149704 150342 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457554.1 protein_id gnl|my_center|LOCUS_39570 150446 150982 gene locus_tag LOCUS_39580 150446 150982 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479198.1 protein_id gnl|my_center|LOCUS_39580 151122 151532 gene locus_tag LOCUS_39590 151122 151532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 152453 151539 gene locus_tag LOCUS_39600 152453 151539 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457535.1 protein_id gnl|my_center|LOCUS_39600 152664 152942 gene locus_tag LOCUS_39610 gene ppiC 152664 152942 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 protein_id gnl|my_center|LOCUS_39610 153431 154021 gene locus_tag LOCUS_39620 153431 154021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39620 154033 154782 gene locus_tag LOCUS_39630 154033 154782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39630 155222 157318 gene locus_tag LOCUS_39640 155222 157318 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106000.1 protein_id gnl|my_center|LOCUS_39640 158310 159467 gene locus_tag LOCUS_39650 158310 159467 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462067.1 protein_id gnl|my_center|LOCUS_39650 161698 159827 gene locus_tag LOCUS_39660 161698 159827 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462077.1 protein_id gnl|my_center|LOCUS_39660 163518 162154 gene locus_tag LOCUS_39670 163518 162154 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462024.1 protein_id gnl|my_center|LOCUS_39670 164649 163978 gene locus_tag LOCUS_39680 164649 163978 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_39680 165074 164802 gene locus_tag LOCUS_39690 165074 164802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 165402 166031 gene locus_tag LOCUS_39700 165402 166031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482728.1 protein_id gnl|my_center|LOCUS_39700 166155 167444 gene locus_tag LOCUS_39710 166155 167444 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106286.1 protein_id gnl|my_center|LOCUS_39710 169309 167477 gene locus_tag LOCUS_39720 169309 167477 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461969.1 protein_id gnl|my_center|LOCUS_39720 170407 169508 gene locus_tag LOCUS_39730 170407 169508 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482673.1 protein_id gnl|my_center|LOCUS_39730 170519 171712 gene locus_tag LOCUS_39740 170519 171712 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482745.1 protein_id gnl|my_center|LOCUS_39740 171829 172176 gene locus_tag LOCUS_39750 171829 172176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461912.1 protein_id gnl|my_center|LOCUS_39750 172311 172445 gene locus_tag LOCUS_39760 172311 172445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461920.1 protein_id gnl|my_center|LOCUS_39760 173131 172517 gene locus_tag LOCUS_39770 173131 172517 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482721.1 protein_id gnl|my_center|LOCUS_39770 174032 173193 gene locus_tag LOCUS_39780 174032 173193 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491704.1 protein_id gnl|my_center|LOCUS_39780 175369 174437 gene locus_tag LOCUS_39790 175369 174437 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263347.1 protein_id gnl|my_center|LOCUS_39790 175934 177010 gene locus_tag LOCUS_39800 175934 177010 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461922.1 protein_id gnl|my_center|LOCUS_39800 177122 177529 gene locus_tag LOCUS_39810 177122 177529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39810 177838 178326 gene locus_tag LOCUS_39820 177838 178326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 178510 178962 gene locus_tag LOCUS_39830 178510 178962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39830 178959 179126 gene locus_tag LOCUS_39840 178959 179126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39840 179446 179135 gene locus_tag LOCUS_39850 179446 179135 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 protein_id gnl|my_center|LOCUS_39850 180186 179443 gene locus_tag LOCUS_39860 180186 179443 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461994.1 protein_id gnl|my_center|LOCUS_39860 180818 180258 gene locus_tag LOCUS_39870 180818 180258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39870 181084 180758 gene locus_tag LOCUS_39880 181084 180758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39880 181329 181961 gene locus_tag LOCUS_39890 181329 181961 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461971.1 protein_id gnl|my_center|LOCUS_39890 182050 182469 gene locus_tag LOCUS_39900 182050 182469 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461900.1 protein_id gnl|my_center|LOCUS_39900 183720 182557 gene locus_tag LOCUS_39910 183720 182557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence046 1422 2153 gene locus_tag LOCUS_39920 1422 2153 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463712.1 protein_id gnl|my_center|LOCUS_39920 2300 2980 gene locus_tag LOCUS_39930 2300 2980 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489362.1 protein_id gnl|my_center|LOCUS_39930 3253 3098 gene locus_tag LOCUS_39940 3253 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 3500 4408 gene locus_tag LOCUS_39950 3500 4408 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487329.1 protein_id gnl|my_center|LOCUS_39950 4497 5366 gene locus_tag LOCUS_39960 gene vctD 4497 5366 CDS product iron chelate uptake ABC transporter permease subunit VctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482134.1 protein_id gnl|my_center|LOCUS_39960 5359 6309 gene locus_tag LOCUS_39970 gene vctG 5359 6309 CDS product iron chelate uptake ABC transporter permease subunit VctG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482136.1 protein_id gnl|my_center|LOCUS_39970 6312 7067 gene locus_tag LOCUS_39980 gene vctC 6312 7067 CDS product iron chelate ABC transporter ATP-binding protein VctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482130.1 protein_id gnl|my_center|LOCUS_39980 7478 7092 gene locus_tag LOCUS_39990 gene cueR 7478 7092 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486235.1 protein_id gnl|my_center|LOCUS_39990 8539 7568 gene locus_tag LOCUS_40000 8539 7568 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482132.1 protein_id gnl|my_center|LOCUS_40000 8656 10662 gene locus_tag LOCUS_40010 8656 10662 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_40010 11227 10979 gene locus_tag LOCUS_40020 11227 10979 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454365.1 protein_id gnl|my_center|LOCUS_40020 24370 11972 gene locus_tag LOCUS_40030 24370 11972 CDS product retention module-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262086.1 protein_id gnl|my_center|LOCUS_40030 24868 24575 gene locus_tag LOCUS_40040 24868 24575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477585.1 protein_id gnl|my_center|LOCUS_40040 25141 24947 gene locus_tag LOCUS_40050 25141 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017448124.1 protein_id gnl|my_center|LOCUS_40050 27486 25333 gene locus_tag LOCUS_40060 gene yccS 27486 25333 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454352.1 protein_id gnl|my_center|LOCUS_40060 27779 29848 gene locus_tag LOCUS_40070 gene helD 27779 29848 CDS product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477569.1 protein_id gnl|my_center|LOCUS_40070 30355 29900 gene locus_tag LOCUS_40080 30355 29900 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 protein_id gnl|my_center|LOCUS_40080 31276 30425 gene locus_tag LOCUS_40090 gene torT 31276 30425 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477549.1 protein_id gnl|my_center|LOCUS_40090 31518 33710 gene locus_tag LOCUS_40100 31518 33710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40100 33716 34474 gene locus_tag LOCUS_40110 33716 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40110 34785 34594 gene locus_tag LOCUS_40120 34785 34594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454225.1 protein_id gnl|my_center|LOCUS_40120 37161 34804 gene locus_tag LOCUS_40130 37161 34804 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 protein_id gnl|my_center|LOCUS_40130 37532 38644 gene locus_tag LOCUS_40140 37532 38644 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596058.1 protein_id gnl|my_center|LOCUS_40140 38735 40555 gene locus_tag LOCUS_40150 38735 40555 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882860.1 protein_id gnl|my_center|LOCUS_40150 41180 42109 gene locus_tag LOCUS_40160 41180 42109 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463734.1 protein_id gnl|my_center|LOCUS_40160 42242 43531 gene locus_tag LOCUS_40170 42242 43531 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463736.1 protein_id gnl|my_center|LOCUS_40170 44084 43638 gene locus_tag LOCUS_40180 44084 43638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463738.1 protein_id gnl|my_center|LOCUS_40180 45875 44097 gene locus_tag LOCUS_40190 45875 44097 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480219.1 protein_id gnl|my_center|LOCUS_40190 46391 46131 gene locus_tag LOCUS_40200 46391 46131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480298.1 protein_id gnl|my_center|LOCUS_40200 48272 46470 gene locus_tag LOCUS_40210 48272 46470 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480246.1 protein_id gnl|my_center|LOCUS_40210 48575 48943 gene locus_tag LOCUS_40220 48575 48943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 49818 49312 gene locus_tag LOCUS_40230 49818 49312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40230 >Feature sequence047 2613 1144 gene locus_tag LOCUS_40240 2613 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 3705 4139 gene locus_tag LOCUS_40250 3705 4139 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480272.1 protein_id gnl|my_center|LOCUS_40250 4582 7092 gene locus_tag LOCUS_40260 4582 7092 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699236.1 protein_id gnl|my_center|LOCUS_40260 7113 8018 gene locus_tag LOCUS_40270 gene cobA 7113 8018 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463757.1 protein_id gnl|my_center|LOCUS_40270 8015 8968 gene locus_tag LOCUS_40280 8015 8968 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463759.1 protein_id gnl|my_center|LOCUS_40280 9198 9767 gene locus_tag LOCUS_40290 9198 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40290 9665 10114 gene locus_tag LOCUS_40300 9665 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40300 10188 10769 gene locus_tag LOCUS_40310 10188 10769 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480250.1 protein_id gnl|my_center|LOCUS_40310 10923 11117 gene locus_tag LOCUS_40320 10923 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 11035 12399 gene locus_tag LOCUS_40330 11035 12399 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_40330 12480 13445 gene locus_tag LOCUS_40340 12480 13445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_40340 13457 14293 gene locus_tag LOCUS_40350 13457 14293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 protein_id gnl|my_center|LOCUS_40350 14304 16823 gene locus_tag LOCUS_40360 gene nirB 14304 16823 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463769.1 protein_id gnl|my_center|LOCUS_40360 16824 17159 gene locus_tag LOCUS_40370 gene nirD 16824 17159 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463771.1 protein_id gnl|my_center|LOCUS_40370 17662 17258 gene locus_tag LOCUS_40380 17662 17258 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463773.1 protein_id gnl|my_center|LOCUS_40380 18239 17664 gene locus_tag LOCUS_40390 18239 17664 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463775.1 protein_id gnl|my_center|LOCUS_40390 18524 19138 gene locus_tag LOCUS_40400 18524 19138 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463777.1 protein_id gnl|my_center|LOCUS_40400 19393 19653 gene locus_tag LOCUS_40410 19393 19653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463779.1 protein_id gnl|my_center|LOCUS_40410 19675 21330 gene locus_tag LOCUS_40420 19675 21330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 22799 21378 gene locus_tag LOCUS_40430 22799 21378 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 protein_id gnl|my_center|LOCUS_40430 23209 23021 gene locus_tag LOCUS_40440 23209 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 24219 23470 gene locus_tag LOCUS_40450 24219 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40450 27291 25162 gene locus_tag LOCUS_40460 27291 25162 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480257.1 protein_id gnl|my_center|LOCUS_40460 27607 28791 gene locus_tag LOCUS_40470 gene tagH 27607 28791 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463793.1 protein_id gnl|my_center|LOCUS_40470 28807 29256 gene locus_tag LOCUS_40480 gene tssJ 28807 29256 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463795.1 protein_id gnl|my_center|LOCUS_40480 29420 30598 gene locus_tag LOCUS_40490 gene tssK 29420 30598 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463797.1 protein_id gnl|my_center|LOCUS_40490 30610 31059 gene locus_tag LOCUS_40500 30610 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40500 31068 31898 gene locus_tag LOCUS_40510 31068 31898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40510 31916 35434 gene locus_tag LOCUS_40520 gene tssM 31916 35434 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463801.1 protein_id gnl|my_center|LOCUS_40520 35416 36111 gene locus_tag LOCUS_40530 gene tagF 35416 36111 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463803.1 protein_id gnl|my_center|LOCUS_40530 36216 36908 gene locus_tag LOCUS_40540 36216 36908 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40540 36905 37255 gene locus_tag LOCUS_40550 36905 37255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40550 37249 37809 gene locus_tag LOCUS_40560 37249 37809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40560 37818 38036 gene locus_tag LOCUS_40570 37818 38036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40570 38049 38573 gene locus_tag LOCUS_40580 gene tssB 38049 38573 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463809.1 protein_id gnl|my_center|LOCUS_40580 38573 40066 gene locus_tag LOCUS_40590 gene tssC 38573 40066 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463811.1 protein_id gnl|my_center|LOCUS_40590 40119 41624 gene locus_tag LOCUS_40600 gene tssC 40119 41624 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480259.1 protein_id gnl|my_center|LOCUS_40600 41635 42429 gene locus_tag LOCUS_40610 41635 42429 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463815.1 protein_id gnl|my_center|LOCUS_40610 42433 42894 gene locus_tag LOCUS_40620 gene tssE 42433 42894 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463817.1 protein_id gnl|my_center|LOCUS_40620 42891 44714 gene locus_tag LOCUS_40630 gene tssF 42891 44714 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463819.1 protein_id gnl|my_center|LOCUS_40630 44711 45676 gene locus_tag LOCUS_40640 gene tssG 44711 45676 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480294.1 protein_id gnl|my_center|LOCUS_40640 45688 48243 gene locus_tag LOCUS_40650 gene tssH 45688 48243 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480296.1 protein_id gnl|my_center|LOCUS_40650 48451 48930 gene locus_tag LOCUS_40660 48451 48930 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375967.1 protein_id gnl|my_center|LOCUS_40660 48978 50813 gene locus_tag LOCUS_40670 gene tssI 48978 50813 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480263.1 protein_id gnl|my_center|LOCUS_40670 50823 50972 gene locus_tag LOCUS_40680 50823 50972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40680 51213 51947 gene locus_tag LOCUS_40690 51213 51947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480244.1 protein_id gnl|my_center|LOCUS_40690 52073 53212 gene locus_tag LOCUS_40700 52073 53212 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480232.1 protein_id gnl|my_center|LOCUS_40700 53222 54538 gene locus_tag LOCUS_40710 53222 54538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40710 54538 56277 gene locus_tag LOCUS_40720 54538 56277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40720 >Feature sequence048 875 498 gene locus_tag LOCUS_40730 875 498 CDS product cystatin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480328.1 protein_id gnl|my_center|LOCUS_40730 1251 2936 gene locus_tag LOCUS_40740 1251 2936 CDS product DUF5011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073790.1 protein_id gnl|my_center|LOCUS_40740 3126 3668 gene locus_tag LOCUS_40750 3126 3668 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480324.1 protein_id gnl|my_center|LOCUS_40750 3787 4032 gene locus_tag LOCUS_40760 3787 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 4103 4756 gene locus_tag LOCUS_40770 4103 4756 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_40770 4743 5171 gene locus_tag LOCUS_40780 4743 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261987.1 protein_id gnl|my_center|LOCUS_40780 5199 5726 gene locus_tag LOCUS_40790 5199 5726 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463834.1 protein_id gnl|my_center|LOCUS_40790 5783 6304 gene locus_tag LOCUS_40800 5783 6304 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463837.1 protein_id gnl|my_center|LOCUS_40800 7152 6322 gene locus_tag LOCUS_40810 7152 6322 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106404.1 protein_id gnl|my_center|LOCUS_40810 7238 8359 gene locus_tag LOCUS_40820 7238 8359 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480347.1 protein_id gnl|my_center|LOCUS_40820 9467 8472 gene locus_tag LOCUS_40830 9467 8472 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480234.1 protein_id gnl|my_center|LOCUS_40830 11106 9574 gene locus_tag LOCUS_40840 gene yfcC 11106 9574 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480236.1 protein_id gnl|my_center|LOCUS_40840 11651 11325 gene locus_tag LOCUS_40850 11651 11325 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488642.1 protein_id gnl|my_center|LOCUS_40850 12737 11733 gene locus_tag LOCUS_40860 gene ltaE 12737 11733 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480299.1 protein_id gnl|my_center|LOCUS_40860 13277 12762 gene locus_tag LOCUS_40870 13277 12762 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463851.1 protein_id gnl|my_center|LOCUS_40870 13561 15222 gene locus_tag LOCUS_40880 13561 15222 CDS product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106400.1 protein_id gnl|my_center|LOCUS_40880 15232 16686 gene locus_tag LOCUS_40890 gene viaA 15232 16686 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106399.1 protein_id gnl|my_center|LOCUS_40890 16923 16995 gene locus_tag LOCUS_t00950 16923 16995 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17000 17075 gene locus_tag LOCUS_t00960 17000 17075 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17292 18194 gene locus_tag LOCUS_40900 17292 18194 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490513.1 protein_id gnl|my_center|LOCUS_40900 18641 20347 gene locus_tag LOCUS_40910 gene dld 18641 20347 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480220.1 protein_id gnl|my_center|LOCUS_40910 20595 20681 gene locus_tag LOCUS_t00970 20595 20681 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20717 20790 gene locus_tag LOCUS_t00980 20717 20790 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 21203 22639 gene locus_tag LOCUS_40920 gene amyS 21203 22639 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_40920 22777 23022 gene locus_tag LOCUS_40930 22777 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460888.1 protein_id gnl|my_center|LOCUS_40930 23892 23104 gene locus_tag LOCUS_40940 23892 23104 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480237.1 protein_id gnl|my_center|LOCUS_40940 24163 26052 gene locus_tag LOCUS_40950 24163 26052 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032474545.1 protein_id gnl|my_center|LOCUS_40950 27033 26143 gene locus_tag LOCUS_40960 27033 26143 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480227.1 protein_id gnl|my_center|LOCUS_40960 28010 27852 gene locus_tag LOCUS_40970 28010 27852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 28009 29721 gene locus_tag LOCUS_40980 28009 29721 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480222.1 protein_id gnl|my_center|LOCUS_40980 31041 29788 gene locus_tag LOCUS_40990 31041 29788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 31538 31624 gene locus_tag LOCUS_t00990 31538 31624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31744 31817 gene locus_tag LOCUS_t01000 31744 31817 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32072 33853 gene locus_tag LOCUS_41000 32072 33853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 34247 34320 gene locus_tag LOCUS_t01010 34247 34320 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 34675 36282 gene locus_tag LOCUS_41010 34675 36282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480356.1 protein_id gnl|my_center|LOCUS_41010 38053 36335 gene locus_tag LOCUS_41020 38053 36335 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480222.1 protein_id gnl|my_center|LOCUS_41020 40138 38603 gene locus_tag LOCUS_41030 40138 38603 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707303.1 protein_id gnl|my_center|LOCUS_41030 40615 43173 gene locus_tag LOCUS_41040 gene nirB 40615 43173 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 protein_id gnl|my_center|LOCUS_41040 43188 43511 gene locus_tag LOCUS_41050 gene nirD 43188 43511 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460996.1 protein_id gnl|my_center|LOCUS_41050 43684 44532 gene locus_tag LOCUS_41060 43684 44532 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480256.1 protein_id gnl|my_center|LOCUS_41060 44946 45587 gene locus_tag LOCUS_41070 gene cobA 44946 45587 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480270.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41070 46050 45610 gene locus_tag LOCUS_41080 46050 45610 CDS product DUF4174 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480278.1 protein_id gnl|my_center|LOCUS_41080 46171 46659 gene locus_tag LOCUS_41090 46171 46659 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480252.1 protein_id gnl|my_center|LOCUS_41090 48095 46764 gene locus_tag LOCUS_41100 48095 46764 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460955.1 protein_id gnl|my_center|LOCUS_41100 48569 50185 gene locus_tag LOCUS_41110 48569 50185 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915500.1 protein_id gnl|my_center|LOCUS_41110 50348 51088 gene locus_tag LOCUS_41120 50348 51088 CDS product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480319.1 protein_id gnl|my_center|LOCUS_41120 51220 53349 gene locus_tag LOCUS_41130 51220 53349 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480297.1 protein_id gnl|my_center|LOCUS_41130 53608 53420 gene locus_tag LOCUS_41140 53608 53420 CDS product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480281.1 protein_id gnl|my_center|LOCUS_41140 53681 54190 gene locus_tag LOCUS_41150 53681 54190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461026.1 protein_id gnl|my_center|LOCUS_41150 54249 54638 gene locus_tag LOCUS_41160 54249 54638 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461033.1 protein_id gnl|my_center|LOCUS_41160 55830 54670 gene locus_tag LOCUS_41170 55830 54670 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460918.1 protein_id gnl|my_center|LOCUS_41170 56441 56007 gene locus_tag LOCUS_41180 gene trxC 56441 56007 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480229.1 protein_id gnl|my_center|LOCUS_41180 56607 57704 gene locus_tag LOCUS_41190 56607 57704 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460895.1 protein_id gnl|my_center|LOCUS_41190 59100 57775 gene locus_tag LOCUS_41200 59100 57775 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_41200 60657 59110 gene locus_tag LOCUS_41210 60657 59110 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_41210 62318 61050 gene locus_tag LOCUS_41220 62318 61050 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480279.1 protein_id gnl|my_center|LOCUS_41220 63873 62860 gene locus_tag LOCUS_41230 63873 62860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 64033 65154 gene locus_tag LOCUS_41240 64033 65154 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704273.1 protein_id gnl|my_center|LOCUS_41240 65144 66157 gene locus_tag LOCUS_41250 65144 66157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 66187 67308 gene locus_tag LOCUS_41260 66187 67308 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263886.1 protein_id gnl|my_center|LOCUS_41260 67305 67961 gene locus_tag LOCUS_41270 67305 67961 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 protein_id gnl|my_center|LOCUS_41270 69202 68033 gene locus_tag LOCUS_41280 gene manA 69202 68033 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480231.1 protein_id gnl|my_center|LOCUS_41280 70700 69360 gene locus_tag LOCUS_41290 70700 69360 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480243.1 protein_id gnl|my_center|LOCUS_41290 72205 70706 gene locus_tag LOCUS_41300 gene uhpB 72205 70706 CDS product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486302.1 protein_id gnl|my_center|LOCUS_41300 72813 72205 gene locus_tag LOCUS_41310 gene uhpA 72813 72205 CDS product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394558.1 protein_id gnl|my_center|LOCUS_41310 74392 72995 gene locus_tag LOCUS_41320 gene uhpT 74392 72995 CDS product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479317.1 protein_id gnl|my_center|LOCUS_41320 74827 75777 gene locus_tag LOCUS_41330 74827 75777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 76061 76411 gene locus_tag LOCUS_41340 76061 76411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 76508 77392 gene locus_tag LOCUS_41350 76508 77392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41350 77473 78105 gene locus_tag LOCUS_41360 77473 78105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 78217 79443 gene locus_tag LOCUS_41370 78217 79443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 79543 79761 gene locus_tag LOCUS_41380 79543 79761 CDS product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029304506.1 protein_id gnl|my_center|LOCUS_41380 81513 79810 gene locus_tag LOCUS_41390 81513 79810 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 protein_id gnl|my_center|LOCUS_41390 81665 81958 gene locus_tag LOCUS_41400 81665 81958 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114934.1 protein_id gnl|my_center|LOCUS_41400 81984 82385 gene locus_tag LOCUS_41410 81984 82385 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658156.1 protein_id gnl|my_center|LOCUS_41410 82400 82825 gene locus_tag LOCUS_41420 82400 82825 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_41420 83547 82840 gene locus_tag LOCUS_41430 83547 82840 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 protein_id gnl|my_center|LOCUS_41430 84011 86131 gene locus_tag LOCUS_41440 gene nrdD 84011 86131 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479384.1 protein_id gnl|my_center|LOCUS_41440 86217 86687 gene locus_tag LOCUS_41450 gene nrdG 86217 86687 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394529.1 protein_id gnl|my_center|LOCUS_41450 88222 86837 gene locus_tag LOCUS_41460 88222 86837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479328.1 protein_id gnl|my_center|LOCUS_41460 88378 89232 gene locus_tag LOCUS_41470 88378 89232 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479361.1 protein_id gnl|my_center|LOCUS_41470 89391 90578 gene locus_tag LOCUS_41480 89391 90578 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460937.1 protein_id gnl|my_center|LOCUS_41480 90591 91265 gene locus_tag LOCUS_41490 90591 91265 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460890.1 protein_id gnl|my_center|LOCUS_41490 91845 91297 gene locus_tag LOCUS_41500 91845 91297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460944.1 protein_id gnl|my_center|LOCUS_41500 92354 91983 gene locus_tag LOCUS_41510 92354 91983 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479374.1 protein_id gnl|my_center|LOCUS_41510 92519 93970 gene locus_tag LOCUS_41520 92519 93970 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479326.1 protein_id gnl|my_center|LOCUS_41520 94061 94813 gene locus_tag LOCUS_41530 gene modA 94061 94813 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479390.1 protein_id gnl|my_center|LOCUS_41530 94826 95515 gene locus_tag LOCUS_41540 gene modB 94826 95515 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479314.1 protein_id gnl|my_center|LOCUS_41540 95512 96618 gene locus_tag LOCUS_41550 gene modC 95512 96618 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479305.1 protein_id gnl|my_center|LOCUS_41550 97122 96685 gene locus_tag LOCUS_41560 97122 96685 CDS product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461031.1 protein_id gnl|my_center|LOCUS_41560 97323 97616 gene locus_tag LOCUS_41570 97323 97616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41570 97600 98262 gene locus_tag LOCUS_41580 97600 98262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41580 98275 98604 gene locus_tag LOCUS_41590 98275 98604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41590 98601 99233 gene locus_tag LOCUS_41600 98601 99233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41600 99360 100334 gene locus_tag LOCUS_41610 99360 100334 CDS product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479405.1 protein_id gnl|my_center|LOCUS_41610 100818 100372 gene locus_tag LOCUS_41620 100818 100372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41620 101866 102234 gene locus_tag LOCUS_41630 101866 102234 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479403.1 protein_id gnl|my_center|LOCUS_41630 102290 102475 gene locus_tag LOCUS_41640 102290 102475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41640 102997 104553 gene locus_tag LOCUS_41650 102997 104553 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461001.1 protein_id gnl|my_center|LOCUS_41650 104566 105960 gene locus_tag LOCUS_41660 gene pntB 104566 105960 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461042.1 protein_id gnl|my_center|LOCUS_41660 106940 107563 gene locus_tag LOCUS_41670 106940 107563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 107538 108200 gene locus_tag LOCUS_41680 107538 108200 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479407.1 protein_id gnl|my_center|LOCUS_41680 108203 108397 gene locus_tag LOCUS_41690 108203 108397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41690 108550 109083 gene locus_tag LOCUS_41700 108550 109083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41700 109143 110270 gene locus_tag LOCUS_41710 109143 110270 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479320.1 protein_id gnl|my_center|LOCUS_41710 110314 110469 gene locus_tag LOCUS_41720 110314 110469 CDS product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479401.1 protein_id gnl|my_center|LOCUS_41720 111336 111794 gene locus_tag LOCUS_41730 111336 111794 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_41730 113660 113349 gene locus_tag LOCUS_41740 gene yciH 113660 113349 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455336.1 protein_id gnl|my_center|LOCUS_41740 114046 113663 gene locus_tag LOCUS_41750 114046 113663 CDS product DUF3319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455283.1 protein_id gnl|my_center|LOCUS_41750 115193 114195 gene locus_tag LOCUS_41760 115193 114195 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455294.1 protein_id gnl|my_center|LOCUS_41760 115915 115343 gene locus_tag LOCUS_41770 115915 115343 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455347.1 protein_id gnl|my_center|LOCUS_41770 116151 118790 gene locus_tag LOCUS_41780 116151 118790 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479339.1 protein_id gnl|my_center|LOCUS_41780 119755 118868 gene locus_tag LOCUS_41790 119755 118868 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489289.1 protein_id gnl|my_center|LOCUS_41790 119993 121489 gene locus_tag LOCUS_41800 119993 121489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41800 121429 122130 gene locus_tag LOCUS_41810 121429 122130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41810 123488 122472 gene locus_tag LOCUS_41820 gene galE 123488 122472 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 protein_id gnl|my_center|LOCUS_41820 125503 123542 gene locus_tag LOCUS_41830 125503 123542 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480854.1 protein_id gnl|my_center|LOCUS_41830 125934 126683 gene locus_tag LOCUS_41840 125934 126683 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455327.1 protein_id gnl|my_center|LOCUS_41840 126683 127366 gene locus_tag LOCUS_41850 126683 127366 CDS product carboxyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455306.1 protein_id gnl|my_center|LOCUS_41850 127363 128298 gene locus_tag LOCUS_41860 127363 128298 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479770.1 protein_id gnl|my_center|LOCUS_41860 129766 128333 gene locus_tag LOCUS_41870 129766 128333 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455312.1 protein_id gnl|my_center|LOCUS_41870 132577 130121 gene locus_tag LOCUS_41880 132577 130121 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479774.1 protein_id gnl|my_center|LOCUS_41880 133269 132574 gene locus_tag LOCUS_41890 133269 132574 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455354.1 protein_id gnl|my_center|LOCUS_41890 133268 133870 gene locus_tag LOCUS_41900 133268 133870 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455373.1 protein_id gnl|my_center|LOCUS_41900 133954 135153 gene locus_tag LOCUS_41910 133954 135153 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455363.1 protein_id gnl|my_center|LOCUS_41910 135340 137250 gene locus_tag LOCUS_41920 135340 137250 CDS product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479772.1 protein_id gnl|my_center|LOCUS_41920 137323 138978 gene locus_tag LOCUS_41930 137323 138978 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479764.1 protein_id gnl|my_center|LOCUS_41930 139713 139093 gene locus_tag LOCUS_41940 139713 139093 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455380.1 protein_id gnl|my_center|LOCUS_41940 140666 139827 gene locus_tag LOCUS_41950 140666 139827 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455357.1 protein_id gnl|my_center|LOCUS_41950 140890 141486 gene locus_tag LOCUS_41960 140890 141486 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455361.1 protein_id gnl|my_center|LOCUS_41960 141780 141448 gene locus_tag LOCUS_41970 141780 141448 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_41970 142041 141790 gene locus_tag LOCUS_41980 142041 141790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054775761.1 protein_id gnl|my_center|LOCUS_41980 143731 142025 gene locus_tag LOCUS_41990 143731 142025 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455375.1 protein_id gnl|my_center|LOCUS_41990 144044 143811 gene locus_tag LOCUS_42000 144044 143811 CDS product DUF3389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455381.1 protein_id gnl|my_center|LOCUS_42000 144496 144062 gene locus_tag LOCUS_42010 144496 144062 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455359.1 protein_id gnl|my_center|LOCUS_42010 144692 145477 gene locus_tag LOCUS_42020 144692 145477 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_42020 146625 145552 gene locus_tag LOCUS_42030 146625 145552 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261828.1 protein_id gnl|my_center|LOCUS_42030 146995 148245 gene locus_tag LOCUS_42040 146995 148245 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455385.1 protein_id gnl|my_center|LOCUS_42040 148266 150662 gene locus_tag LOCUS_42050 148266 150662 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455369.1 protein_id gnl|my_center|LOCUS_42050 150799 151008 gene locus_tag LOCUS_42060 150799 151008 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351843.1 protein_id gnl|my_center|LOCUS_42060 151267 151824 gene locus_tag LOCUS_42070 151267 151824 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455388.1 protein_id gnl|my_center|LOCUS_42070 151984 152901 gene locus_tag LOCUS_42080 151984 152901 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236427.1 protein_id gnl|my_center|LOCUS_42080 153193 153002 gene locus_tag LOCUS_42090 153193 153002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479763.1 protein_id gnl|my_center|LOCUS_42090 154492 153473 gene locus_tag LOCUS_42100 154492 153473 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455383.1 protein_id gnl|my_center|LOCUS_42100 156764 155022 gene locus_tag LOCUS_42110 156764 155022 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479759.1 protein_id gnl|my_center|LOCUS_42110 157039 158673 gene locus_tag LOCUS_42120 157039 158673 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489275.1 protein_id gnl|my_center|LOCUS_42120 159293 158814 gene locus_tag LOCUS_42130 159293 158814 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483841.1 protein_id gnl|my_center|LOCUS_42130 160487 159582 gene locus_tag LOCUS_42140 160487 159582 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005498809.1 protein_id gnl|my_center|LOCUS_42140 160773 162224 gene locus_tag LOCUS_42150 gene focA 160773 162224 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489212.1 protein_id gnl|my_center|LOCUS_42150 162914 162345 gene locus_tag LOCUS_42160 162914 162345 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477055.1 protein_id gnl|my_center|LOCUS_42160 163450 162911 gene locus_tag LOCUS_42170 163450 162911 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477057.1 protein_id gnl|my_center|LOCUS_42170 163867 163625 gene locus_tag LOCUS_42180 163867 163625 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489304.1 protein_id gnl|my_center|LOCUS_42180 164828 165616 gene locus_tag LOCUS_42190 164828 165616 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479139.1 protein_id gnl|my_center|LOCUS_42190 166901 165648 gene locus_tag LOCUS_42200 166901 165648 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479127.1 protein_id gnl|my_center|LOCUS_42200 167177 166977 gene locus_tag LOCUS_42210 167177 166977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42210 167575 167156 gene locus_tag LOCUS_42220 167575 167156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42220 167879 167721 gene locus_tag LOCUS_42230 167879 167721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 168255 169685 gene locus_tag LOCUS_42240 168255 169685 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479118.1 protein_id gnl|my_center|LOCUS_42240 170872 170210 gene locus_tag LOCUS_42250 170872 170210 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479135.1 protein_id gnl|my_center|LOCUS_42250 172894 171098 gene locus_tag LOCUS_42260 172894 171098 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479131.1 protein_id gnl|my_center|LOCUS_42260 173472 172963 gene locus_tag LOCUS_42270 173472 172963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454066.1 protein_id gnl|my_center|LOCUS_42270 173624 174097 gene locus_tag LOCUS_42280 173624 174097 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454218.1 protein_id gnl|my_center|LOCUS_42280 174229 175533 gene locus_tag LOCUS_42290 174229 175533 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454049.1 protein_id gnl|my_center|LOCUS_42290 175771 177519 gene locus_tag LOCUS_42300 175771 177519 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479111.1 protein_id gnl|my_center|LOCUS_42300 177887 179101 gene locus_tag LOCUS_42310 gene glgC 177887 179101 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454156.1 protein_id gnl|my_center|LOCUS_42310 182368 179213 gene locus_tag LOCUS_42320 182368 179213 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479129.1 protein_id gnl|my_center|LOCUS_42320 183710 182811 gene locus_tag LOCUS_42330 183710 182811 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479133.1 protein_id gnl|my_center|LOCUS_42330 183892 185040 gene locus_tag LOCUS_42340 183892 185040 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479145.1 protein_id gnl|my_center|LOCUS_42340 185278 185910 gene locus_tag LOCUS_42350 185278 185910 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479123.1 protein_id gnl|my_center|LOCUS_42350 187203 185935 gene locus_tag LOCUS_42360 187203 185935 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479108.1 protein_id gnl|my_center|LOCUS_42360 189484 187193 gene locus_tag LOCUS_42370 189484 187193 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106362.1 protein_id gnl|my_center|LOCUS_42370 190821 189556 gene locus_tag LOCUS_42380 190821 189556 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479109.1 protein_id gnl|my_center|LOCUS_42380 191109 192488 gene locus_tag LOCUS_42390 191109 192488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479116.1 protein_id gnl|my_center|LOCUS_42390 192618 194096 gene locus_tag LOCUS_42400 gene pyk 192618 194096 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479141.1 protein_id gnl|my_center|LOCUS_42400 194306 195040 gene locus_tag LOCUS_42410 194306 195040 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479122.1 protein_id gnl|my_center|LOCUS_42410 195044 195841 gene locus_tag LOCUS_42420 195044 195841 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479143.1 protein_id gnl|my_center|LOCUS_42420 195851 196669 gene locus_tag LOCUS_42430 195851 196669 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479113.1 protein_id gnl|my_center|LOCUS_42430 196748 197668 gene locus_tag LOCUS_42440 196748 197668 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479152.1 protein_id gnl|my_center|LOCUS_42440 197827 198579 gene locus_tag LOCUS_42450 197827 198579 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479128.1 protein_id gnl|my_center|LOCUS_42450 199238 198693 gene locus_tag LOCUS_42460 199238 198693 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478472.1 protein_id gnl|my_center|LOCUS_42460 199359 200252 gene locus_tag LOCUS_42470 199359 200252 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478417.1 protein_id gnl|my_center|LOCUS_42470 201297 200302 gene locus_tag LOCUS_42480 gene cra 201297 200302 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454171.1 protein_id gnl|my_center|LOCUS_42480 201714 202847 gene locus_tag LOCUS_42490 gene fruB 201714 202847 CDS product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478424.1 protein_id gnl|my_center|LOCUS_42490 202859 203833 gene locus_tag LOCUS_42500 gene pfkB 202859 203833 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478454.1 protein_id gnl|my_center|LOCUS_42500 203853 205598 gene locus_tag LOCUS_42510 gene fruA 203853 205598 CDS product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478462.1 protein_id gnl|my_center|LOCUS_42510 206527 205814 gene locus_tag LOCUS_42520 206527 205814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 209841 206782 gene locus_tag LOCUS_42530 gene vmeV 209841 206782 CDS product multidrug efflux RND transporter permease subunit VmeV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 protein_id gnl|my_center|LOCUS_42530 210902 209841 gene locus_tag LOCUS_42540 gene vmeU 210902 209841 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478445.1 protein_id gnl|my_center|LOCUS_42540 211975 210902 gene locus_tag LOCUS_42550 gene vmeT 211975 210902 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106358.1 protein_id gnl|my_center|LOCUS_42550 212139 212864 gene locus_tag LOCUS_42560 gene vdeR 212139 212864 CDS product efflux transporter transcriptional repressor VdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478460.1 protein_id gnl|my_center|LOCUS_42560 214218 213100 gene locus_tag LOCUS_42570 gene gcvT 214218 213100 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_42570 215109 214486 gene locus_tag LOCUS_42580 215109 214486 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478414.1 protein_id gnl|my_center|LOCUS_42580 215489 216784 gene locus_tag LOCUS_42590 215489 216784 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478453.1 protein_id gnl|my_center|LOCUS_42590 216838 217218 gene locus_tag LOCUS_42600 gene gcvH 216838 217218 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 protein_id gnl|my_center|LOCUS_42600 217348 218364 gene locus_tag LOCUS_42610 217348 218364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42610 218286 220211 gene locus_tag LOCUS_42620 218286 220211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42620 220514 220786 gene locus_tag LOCUS_42630 220514 220786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 222219 220744 gene locus_tag LOCUS_42640 222219 220744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 225745 223058 gene locus_tag LOCUS_42650 225745 223058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 227079 225997 gene locus_tag LOCUS_42660 227079 225997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 227724 228626 gene locus_tag LOCUS_42670 227724 228626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261726.1 protein_id gnl|my_center|LOCUS_42670 228878 229657 gene locus_tag LOCUS_42680 gene udp 228878 229657 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_42680 230744 230250 gene locus_tag LOCUS_42690 230744 230250 CDS product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478450.1 protein_id gnl|my_center|LOCUS_42690 231126 230911 gene locus_tag LOCUS_42700 231126 230911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 231461 231994 gene locus_tag LOCUS_42710 231461 231994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 232580 232101 gene locus_tag LOCUS_42720 232580 232101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 233154 232816 gene locus_tag LOCUS_42730 233154 232816 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059470.1 protein_id gnl|my_center|LOCUS_42730 233344 233769 gene locus_tag LOCUS_42740 233344 233769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 234119 233859 gene locus_tag LOCUS_42750 234119 233859 CDS product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376453.1 protein_id gnl|my_center|LOCUS_42750 234475 235113 gene locus_tag LOCUS_42760 234475 235113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 235333 237093 gene locus_tag LOCUS_42770 235333 237093 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478447.1 protein_id gnl|my_center|LOCUS_42770 238508 237351 gene locus_tag LOCUS_42780 238508 237351 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_42780 239069 238518 gene locus_tag LOCUS_42790 239069 238518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 239894 239481 gene locus_tag LOCUS_42800 239894 239481 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_42800 240208 239954 gene locus_tag LOCUS_42810 240208 239954 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462157.1 protein_id gnl|my_center|LOCUS_42810 240589 240248 gene locus_tag LOCUS_42820 240589 240248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455052.1 protein_id gnl|my_center|LOCUS_42820 242152 241961 gene locus_tag LOCUS_42830 242152 241961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423787.1 protein_id gnl|my_center|LOCUS_42830 242942 242352 gene locus_tag LOCUS_42840 242942 242352 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_42840 243332 242973 gene locus_tag LOCUS_42850 243332 242973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 243737 243453 gene locus_tag LOCUS_42860 gene yqfB 243737 243453 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028411.1 protein_id gnl|my_center|LOCUS_42860 244175 243828 gene locus_tag LOCUS_42870 244175 243828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 244981 244331 gene locus_tag LOCUS_42880 244981 244331 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 protein_id gnl|my_center|LOCUS_42880 245799 245110 gene locus_tag LOCUS_42890 245799 245110 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 protein_id gnl|my_center|LOCUS_42890 246850 245924 gene locus_tag LOCUS_42900 246850 245924 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_42900 247615 247157 gene locus_tag LOCUS_42910 247615 247157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454292.1 protein_id gnl|my_center|LOCUS_42910 248858 248025 gene locus_tag LOCUS_42920 248858 248025 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42920 249437 249042 gene locus_tag LOCUS_42930 249437 249042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 249773 250567 gene locus_tag LOCUS_42940 249773 250567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_42940 250679 252013 gene locus_tag LOCUS_42950 250679 252013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_42950 252491 252075 gene locus_tag LOCUS_42960 252491 252075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 253041 252706 gene locus_tag LOCUS_42970 253041 252706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 253734 253360 gene locus_tag LOCUS_42980 253734 253360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 254217 253888 gene locus_tag LOCUS_42990 254217 253888 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478428.1 protein_id gnl|my_center|LOCUS_42990 254938 254459 gene locus_tag LOCUS_43000 254938 254459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 255048 255869 gene locus_tag LOCUS_43010 255048 255869 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707711.1 protein_id gnl|my_center|LOCUS_43010 256224 255874 gene locus_tag LOCUS_43020 256224 255874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 257676 256342 gene locus_tag LOCUS_43030 257676 256342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 259422 258049 gene locus_tag LOCUS_43040 259422 258049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 260534 259632 gene locus_tag LOCUS_43050 260534 259632 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104375.1 protein_id gnl|my_center|LOCUS_43050 260753 261751 gene locus_tag LOCUS_43060 260753 261751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 261776 262246 gene locus_tag LOCUS_43070 261776 262246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 262252 262866 gene locus_tag LOCUS_43080 262252 262866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 262867 264525 gene locus_tag LOCUS_43090 262867 264525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 264636 265730 gene locus_tag LOCUS_43100 264636 265730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 265742 266311 gene locus_tag LOCUS_43110 265742 266311 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_43110 266304 266780 gene locus_tag LOCUS_43120 266304 266780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 266783 267112 gene locus_tag LOCUS_43130 266783 267112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 268067 267174 gene locus_tag LOCUS_43140 268067 267174 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_43140 268595 269140 gene locus_tag LOCUS_43150 268595 269140 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463613.1 protein_id gnl|my_center|LOCUS_43150 269240 270556 gene locus_tag LOCUS_43160 269240 270556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478449.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43160 270460 270732 gene locus_tag LOCUS_43170 270460 270732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43170 272332 270806 gene locus_tag LOCUS_43180 272332 270806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 273198 272638 gene locus_tag LOCUS_43190 273198 272638 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_43190 274297 273440 gene locus_tag LOCUS_43200 274297 273440 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_43200 275305 274421 gene locus_tag LOCUS_43210 275305 274421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 276812 275475 gene locus_tag LOCUS_43220 276812 275475 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883323.1 protein_id gnl|my_center|LOCUS_43220 277090 277527 gene locus_tag LOCUS_43230 277090 277527 CDS product YkgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543907.1 protein_id gnl|my_center|LOCUS_43230 278037 277567 gene locus_tag LOCUS_43240 278037 277567 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480622.1 protein_id gnl|my_center|LOCUS_43240 278524 278123 gene locus_tag LOCUS_43250 278524 278123 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454293.1 protein_id gnl|my_center|LOCUS_43250 278779 279165 gene locus_tag LOCUS_43260 gene gloA 278779 279165 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481322.1 protein_id gnl|my_center|LOCUS_43260 279177 280277 gene locus_tag LOCUS_43270 279177 280277 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_43270 280701 280426 gene locus_tag LOCUS_43280 280701 280426 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454233.1 protein_id gnl|my_center|LOCUS_43280 280955 282802 gene locus_tag LOCUS_43290 280955 282802 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481301.1 protein_id gnl|my_center|LOCUS_43290 283328 282858 gene locus_tag LOCUS_43300 283328 282858 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 protein_id gnl|my_center|LOCUS_43300 283782 283330 gene locus_tag LOCUS_43310 283782 283330 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481265.1 protein_id gnl|my_center|LOCUS_43310 285296 283896 gene locus_tag LOCUS_43320 285296 283896 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_43320 285567 286046 gene locus_tag LOCUS_43330 285567 286046 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486498.1 protein_id gnl|my_center|LOCUS_43330 287111 286134 gene locus_tag LOCUS_43340 287111 286134 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_43340 287578 288471 gene locus_tag LOCUS_43350 287578 288471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43350 288475 288864 gene locus_tag LOCUS_43360 288475 288864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43360 288910 291627 gene locus_tag LOCUS_43370 288910 291627 CDS product SO2930 family diheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072834.1 protein_id gnl|my_center|LOCUS_43370 293165 291753 gene locus_tag LOCUS_43380 293165 291753 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454152.1 protein_id gnl|my_center|LOCUS_43380 293704 293294 gene locus_tag LOCUS_43390 293704 293294 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 protein_id gnl|my_center|LOCUS_43390 294330 293770 gene locus_tag LOCUS_43400 294330 293770 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106347.1 protein_id gnl|my_center|LOCUS_43400 294796 294344 gene locus_tag LOCUS_43410 294796 294344 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454164.1 protein_id gnl|my_center|LOCUS_43410 294945 295847 gene locus_tag LOCUS_43420 294945 295847 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454103.1 protein_id gnl|my_center|LOCUS_43420 296248 295934 gene locus_tag LOCUS_43430 296248 295934 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454078.1 protein_id gnl|my_center|LOCUS_43430 298520 296412 gene locus_tag LOCUS_43440 298520 296412 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481254.1 protein_id gnl|my_center|LOCUS_43440 298872 298687 gene locus_tag LOCUS_43450 298872 298687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 298871 300232 gene locus_tag LOCUS_43460 298871 300232 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481245.1 protein_id gnl|my_center|LOCUS_43460 300858 300307 gene locus_tag LOCUS_43470 300858 300307 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020835216.1 protein_id gnl|my_center|LOCUS_43470 301747 301214 gene locus_tag LOCUS_43480 301747 301214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 302127 301741 gene locus_tag LOCUS_43490 302127 301741 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454090.1 protein_id gnl|my_center|LOCUS_43490 303197 302292 gene locus_tag LOCUS_43500 gene rarD 303197 302292 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481255.1 protein_id gnl|my_center|LOCUS_43500 304003 303281 gene locus_tag LOCUS_43510 304003 303281 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454206.1 protein_id gnl|my_center|LOCUS_43510 305447 304467 gene locus_tag LOCUS_43520 305447 304467 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481272.1 protein_id gnl|my_center|LOCUS_43520 306280 305699 gene locus_tag LOCUS_43530 306280 305699 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 protein_id gnl|my_center|LOCUS_43530 306716 307660 gene locus_tag LOCUS_43540 gene ylqF 306716 307660 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 protein_id gnl|my_center|LOCUS_43540 307957 309138 gene locus_tag LOCUS_43550 gene cqsA 307957 309138 CDS product quorum-sensing autoinducer CAI-1 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481314.1 protein_id gnl|my_center|LOCUS_43550 310789 309185 gene locus_tag LOCUS_43560 310789 309185 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106329.1 protein_id gnl|my_center|LOCUS_43560 312022 311474 gene locus_tag LOCUS_43570 312022 311474 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481267.1 protein_id gnl|my_center|LOCUS_43570 312314 313438 gene locus_tag LOCUS_43580 312314 313438 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454080.1 protein_id gnl|my_center|LOCUS_43580 313814 315181 gene locus_tag LOCUS_43590 gene dcuC 313814 315181 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454288.1 protein_id gnl|my_center|LOCUS_43590 315408 315998 gene locus_tag LOCUS_43600 315408 315998 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_43600 315998 317866 gene locus_tag LOCUS_43610 315998 317866 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_43610 318288 317932 gene locus_tag LOCUS_43620 318288 317932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454342.1 protein_id gnl|my_center|LOCUS_43620 318865 320097 gene locus_tag LOCUS_43630 318865 320097 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486542.1 protein_id gnl|my_center|LOCUS_43630 320193 321809 gene locus_tag LOCUS_43640 320193 321809 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477565.1 protein_id gnl|my_center|LOCUS_43640 322902 321829 gene locus_tag LOCUS_43650 322902 321829 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477581.1 protein_id gnl|my_center|LOCUS_43650 324235 322913 gene locus_tag LOCUS_43660 324235 322913 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477554.1 protein_id gnl|my_center|LOCUS_43660 324472 325200 gene locus_tag LOCUS_43670 324472 325200 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_43670 325367 326347 gene locus_tag LOCUS_43680 325367 326347 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261742.1 protein_id gnl|my_center|LOCUS_43680 326485 327132 gene locus_tag LOCUS_43690 326485 327132 CDS product AcfA family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477593.1 protein_id gnl|my_center|LOCUS_43690 327150 327485 gene locus_tag LOCUS_43700 327150 327485 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454158.1 protein_id gnl|my_center|LOCUS_43700 328442 327540 gene locus_tag LOCUS_43710 gene yegS 328442 327540 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477542.1 protein_id gnl|my_center|LOCUS_43710 329360 328455 gene locus_tag LOCUS_43720 329360 328455 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454286.1 protein_id gnl|my_center|LOCUS_43720 329841 329500 gene locus_tag LOCUS_43730 329841 329500 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477591.1 protein_id gnl|my_center|LOCUS_43730 331101 330166 gene locus_tag LOCUS_43740 331101 330166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43740 331499 331104 gene locus_tag LOCUS_43750 331499 331104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43750 333247 331496 gene locus_tag LOCUS_43760 333247 331496 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477597.1 protein_id gnl|my_center|LOCUS_43760 334331 333240 gene locus_tag LOCUS_43770 334331 333240 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477545.1 protein_id gnl|my_center|LOCUS_43770 334875 334324 gene locus_tag LOCUS_43780 334875 334324 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477551.1 protein_id gnl|my_center|LOCUS_43780 335838 334876 gene locus_tag LOCUS_43790 335838 334876 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477595.1 protein_id gnl|my_center|LOCUS_43790 336834 335851 gene locus_tag LOCUS_43800 336834 335851 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376549.1 protein_id gnl|my_center|LOCUS_43800 339314 336960 gene locus_tag LOCUS_43810 339314 336960 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477586.1 protein_id gnl|my_center|LOCUS_43810 341015 339468 gene locus_tag LOCUS_43820 341015 339468 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_43820 341361 342926 gene locus_tag LOCUS_43830 341361 342926 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262022.1 protein_id gnl|my_center|LOCUS_43830 343196 343954 gene locus_tag LOCUS_43840 343196 343954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 343951 345291 gene locus_tag LOCUS_43850 gene pirS 343951 345291 CDS product sensor histidine kinase PirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895528.1 protein_id gnl|my_center|LOCUS_43850 345400 347325 gene locus_tag LOCUS_43860 345400 347325 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073464.1 protein_id gnl|my_center|LOCUS_43860 348726 347485 gene locus_tag LOCUS_43870 348726 347485 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463732.1 protein_id gnl|my_center|LOCUS_43870 349366 348698 gene locus_tag LOCUS_43880 349366 348698 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463721.1 protein_id gnl|my_center|LOCUS_43880 349457 350680 gene locus_tag LOCUS_43890 349457 350680 CDS product DUF5666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477073.1 protein_id gnl|my_center|LOCUS_43890 350805 351140 gene locus_tag LOCUS_43900 350805 351140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 352338 351298 gene locus_tag LOCUS_43910 352338 351298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489206.1 protein_id gnl|my_center|LOCUS_43910 353961 352609 gene locus_tag LOCUS_43920 gene yegD 353961 352609 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483366.1 protein_id gnl|my_center|LOCUS_43920 354698 354078 gene locus_tag LOCUS_43930 354698 354078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483333.1 protein_id gnl|my_center|LOCUS_43930 355233 354913 gene locus_tag LOCUS_43940 355233 354913 CDS product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455725.1 protein_id gnl|my_center|LOCUS_43940 356592 355387 gene locus_tag LOCUS_43950 356592 355387 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073957.1 protein_id gnl|my_center|LOCUS_43950 357141 356599 gene locus_tag LOCUS_43960 357141 356599 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073956.1 protein_id gnl|my_center|LOCUS_43960 357779 358873 gene locus_tag LOCUS_43970 gene pdhA 357779 358873 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483380.1 protein_id gnl|my_center|LOCUS_43970 358866 359567 gene locus_tag LOCUS_43980 358866 359567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43980 359564 359851 gene locus_tag LOCUS_43990 359564 359851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43990 359848 360168 gene locus_tag LOCUS_44000 359848 360168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44000 360171 360989 gene locus_tag LOCUS_44010 360171 360989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44010 362085 361120 gene locus_tag LOCUS_44020 362085 361120 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073034.1 protein_id gnl|my_center|LOCUS_44020 362846 362097 gene locus_tag LOCUS_44030 362846 362097 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477113.1 protein_id gnl|my_center|LOCUS_44030 363140 364786 gene locus_tag LOCUS_44040 363140 364786 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483341.1 protein_id gnl|my_center|LOCUS_44040 <372221 364871 gene locus_tag LOCUS_44050 <372221 364871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012842498.1:VCBS domain-containing protein >Feature sequence049 1264 260 gene locus_tag LOCUS_44060 1264 260 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463707.1 protein_id gnl|my_center|LOCUS_44060 2199 1282 gene locus_tag LOCUS_44070 gene rbsK 2199 1282 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463705.1 protein_id gnl|my_center|LOCUS_44070 3341 2463 gene locus_tag LOCUS_44080 gene rbsB 3341 2463 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 protein_id gnl|my_center|LOCUS_44080 4416 3433 gene locus_tag LOCUS_44090 gene rbsC 4416 3433 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_44090 5918 4413 gene locus_tag LOCUS_44100 gene rbsA 5918 4413 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463701.1 protein_id gnl|my_center|LOCUS_44100 6362 5943 gene locus_tag LOCUS_44110 gene rbsD 6362 5943 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463700.1 protein_id gnl|my_center|LOCUS_44110 6817 9150 gene locus_tag LOCUS_44120 6817 9150 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463698.1 protein_id gnl|my_center|LOCUS_44120 9956 9201 gene locus_tag LOCUS_44130 9956 9201 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477258.1 protein_id gnl|my_center|LOCUS_44130 10266 10093 gene locus_tag LOCUS_44140 10266 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009696122.1 protein_id gnl|my_center|LOCUS_44140 10893 10276 gene locus_tag LOCUS_44150 10893 10276 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263556.1 protein_id gnl|my_center|LOCUS_44150 11485 11075 gene locus_tag LOCUS_44160 11485 11075 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110101.1 protein_id gnl|my_center|LOCUS_44160 12030 12701 gene locus_tag LOCUS_44170 12030 12701 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499139.1 protein_id gnl|my_center|LOCUS_44170 12956 12786 gene locus_tag LOCUS_44180 12956 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 13397 13714 gene locus_tag LOCUS_44190 13397 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477245.1 protein_id gnl|my_center|LOCUS_44190 14473 13793 gene locus_tag LOCUS_44200 14473 13793 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463688.1 protein_id gnl|my_center|LOCUS_44200 15570 15049 gene locus_tag LOCUS_44210 15570 15049 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463686.1 protein_id gnl|my_center|LOCUS_44210 16532 16080 gene locus_tag LOCUS_44220 16532 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 16523 17113 gene locus_tag LOCUS_44230 16523 17113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 17750 17346 gene locus_tag LOCUS_44240 17750 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 18494 17979 gene locus_tag LOCUS_44250 18494 17979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 19290 19835 gene locus_tag LOCUS_44260 19290 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 20630 20373 gene locus_tag LOCUS_44270 20630 20373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 20822 20640 gene locus_tag LOCUS_44280 20822 20640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 23854 20795 gene locus_tag LOCUS_44290 23854 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 23925 24215 gene locus_tag LOCUS_44300 23925 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 24286 24903 gene locus_tag LOCUS_44310 24286 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 25345 24986 gene locus_tag LOCUS_44320 25345 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 25867 25460 gene locus_tag LOCUS_44330 25867 25460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 27414 26875 gene locus_tag LOCUS_44340 27414 26875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 27617 27435 gene locus_tag LOCUS_44350 27617 27435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 28511 28098 gene locus_tag LOCUS_44360 28511 28098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 33353 28527 gene locus_tag LOCUS_44370 33353 28527 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156019039.1 protein_id gnl|my_center|LOCUS_44370 34261 33350 gene locus_tag LOCUS_44380 34261 33350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 35220 34258 gene locus_tag LOCUS_44390 35220 34258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 36171 35245 gene locus_tag LOCUS_44400 36171 35245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 37117 36191 gene locus_tag LOCUS_44410 37117 36191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 37985 37137 gene locus_tag LOCUS_44420 37985 37137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 39581 38064 gene locus_tag LOCUS_44430 39581 38064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 41647 39584 gene locus_tag LOCUS_44440 41647 39584 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212125.1 protein_id gnl|my_center|LOCUS_44440 42267 41749 gene locus_tag LOCUS_44450 gene hcp-2 42267 41749 CDS product type VI secretion system effector Hcp-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142947.1 protein_id gnl|my_center|LOCUS_44450 43176 42634 gene locus_tag LOCUS_44460 43176 42634 CDS product GAD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104019.1 protein_id gnl|my_center|LOCUS_44460 44191 43373 gene locus_tag LOCUS_44470 44191 43373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 44685 44179 gene locus_tag LOCUS_44480 44685 44179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 46194 44863 gene locus_tag LOCUS_44490 46194 44863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 47000 46365 gene locus_tag LOCUS_44500 47000 46365 CDS product GAD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266570.1 protein_id gnl|my_center|LOCUS_44500 48388 47123 gene locus_tag LOCUS_44510 48388 47123 CDS product ImpA family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073080.1 protein_id gnl|my_center|LOCUS_44510 51988 48443 gene locus_tag LOCUS_44520 gene tssM 51988 48443 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 protein_id gnl|my_center|LOCUS_44520 53425 52004 gene locus_tag LOCUS_44530 gene vasJ 53425 52004 CDS product TssA family type VI secretion system protein VasJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426093.1 protein_id gnl|my_center|LOCUS_44530 54090 53434 gene locus_tag LOCUS_44540 gene vasI 54090 53434 CDS product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033927781.1 protein_id gnl|my_center|LOCUS_44540 55667 54087 gene locus_tag LOCUS_44550 gene vasH 55667 54087 CDS product sigma-54 dependent T6SS transcriptional regulator VasH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084793.1 protein_id gnl|my_center|LOCUS_44550 58279 55670 gene locus_tag LOCUS_44560 gene tssH 58279 55670 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619136.1 protein_id gnl|my_center|LOCUS_44560 59078 58305 gene locus_tag LOCUS_44570 gene icmH 59078 58305 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083409.1 protein_id gnl|my_center|LOCUS_44570 60415 59081 gene locus_tag LOCUS_44580 gene tssK 60415 59081 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458007.1 protein_id gnl|my_center|LOCUS_44580 60883 60422 gene locus_tag LOCUS_44590 gene tssJ 60883 60422 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045311.1 protein_id gnl|my_center|LOCUS_44590 62373 60904 gene locus_tag LOCUS_44600 gene tagH 62373 60904 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089704.1 protein_id gnl|my_center|LOCUS_44600 63278 62376 gene locus_tag LOCUS_44610 gene tssG 63278 62376 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 protein_id gnl|my_center|LOCUS_44610 65127 63358 gene locus_tag LOCUS_44620 gene tssF 65127 63358 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 protein_id gnl|my_center|LOCUS_44620 65570 65133 gene locus_tag LOCUS_44630 gene tssE 65570 65133 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221000.1 protein_id gnl|my_center|LOCUS_44630 66982 65573 gene locus_tag LOCUS_44640 gene tssC 66982 65573 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108140.1 protein_id gnl|my_center|LOCUS_44640 67607 67092 gene locus_tag LOCUS_44650 gene tssB 67607 67092 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031391.1 protein_id gnl|my_center|LOCUS_44650 68998 67994 gene locus_tag LOCUS_44660 68998 67994 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002052840.1 protein_id gnl|my_center|LOCUS_44660 69594 69521 gene locus_tag LOCUS_t01020 69594 69521 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 70289 69810 gene locus_tag LOCUS_44670 70289 69810 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_44670 >Feature sequence050 2312 312 gene locus_tag LOCUS_44680 2312 312 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482598.1 protein_id gnl|my_center|LOCUS_44680 3498 2380 gene locus_tag LOCUS_44690 3498 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482679.1 protein_id gnl|my_center|LOCUS_44690 4345 3632 gene locus_tag LOCUS_44700 4345 3632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_44700 5580 4345 gene locus_tag LOCUS_44710 5580 4345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_44710 6799 5570 gene locus_tag LOCUS_44720 6799 5570 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_44720 7612 6866 gene locus_tag LOCUS_44730 7612 6866 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_44730 9171 7729 gene locus_tag LOCUS_44740 9171 7729 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106293.1 protein_id gnl|my_center|LOCUS_44740 9504 10667 gene locus_tag LOCUS_44750 9504 10667 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419182.1 protein_id gnl|my_center|LOCUS_44750 10930 10664 gene locus_tag LOCUS_44760 10930 10664 CDS product ribosome alternative rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482651.1 protein_id gnl|my_center|LOCUS_44760 11300 11509 gene locus_tag LOCUS_44770 11300 11509 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_44770 11776 12051 gene locus_tag LOCUS_44780 11776 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44780 11988 12320 gene locus_tag LOCUS_44790 11988 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44790 12307 12849 gene locus_tag LOCUS_44800 12307 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482688.1 protein_id gnl|my_center|LOCUS_44800 12978 13337 gene locus_tag LOCUS_44810 12978 13337 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_44810 13940 13386 gene locus_tag LOCUS_44820 13940 13386 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482692.1 protein_id gnl|my_center|LOCUS_44820 14237 14869 gene locus_tag LOCUS_44830 14237 14869 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482658.1 protein_id gnl|my_center|LOCUS_44830 14884 15357 gene locus_tag LOCUS_44840 14884 15357 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461979.1 protein_id gnl|my_center|LOCUS_44840 16035 15433 gene locus_tag LOCUS_44850 16035 15433 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477314.1 protein_id gnl|my_center|LOCUS_44850 16605 18374 gene locus_tag LOCUS_44860 16605 18374 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477350.1 protein_id gnl|my_center|LOCUS_44860 21398 18471 gene locus_tag LOCUS_44870 gene vmeZ 21398 18471 CDS product multidrug efflux RND transporter permease subunit VmeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477161.1 protein_id gnl|my_center|LOCUS_44870 21622 21425 gene locus_tag LOCUS_44880 21622 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44880 22707 21631 gene locus_tag LOCUS_44890 gene vmeY 22707 21631 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_44890 23101 23559 gene locus_tag LOCUS_44900 23101 23559 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477123.1 protein_id gnl|my_center|LOCUS_44900 24800 23667 gene locus_tag LOCUS_44910 gene pepT 24800 23667 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477102.1 protein_id gnl|my_center|LOCUS_44910 25916 25062 gene locus_tag LOCUS_44920 25916 25062 CDS product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 protein_id gnl|my_center|LOCUS_44920 26173 26346 gene locus_tag LOCUS_44930 26173 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 27302 26394 gene locus_tag LOCUS_44940 27302 26394 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 protein_id gnl|my_center|LOCUS_44940 27399 27818 gene locus_tag LOCUS_44950 27399 27818 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463567.1 protein_id gnl|my_center|LOCUS_44950 28375 27815 gene locus_tag LOCUS_44960 28375 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106434.1 protein_id gnl|my_center|LOCUS_44960 29171 30577 gene locus_tag LOCUS_44970 gene clcA 29171 30577 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 protein_id gnl|my_center|LOCUS_44970 30789 31754 gene locus_tag LOCUS_44980 30789 31754 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463561.1 protein_id gnl|my_center|LOCUS_44980 33046 31805 gene locus_tag LOCUS_44990 33046 31805 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477169.1 protein_id gnl|my_center|LOCUS_44990 33027 33224 gene locus_tag LOCUS_45000 33027 33224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 33975 33322 gene locus_tag LOCUS_45010 gene folE 33975 33322 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477356.1 protein_id gnl|my_center|LOCUS_45010 34262 35497 gene locus_tag LOCUS_45020 gene moeA 34262 35497 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 protein_id gnl|my_center|LOCUS_45020 35507 36256 gene locus_tag LOCUS_45030 gene moeB 35507 36256 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477078.1 protein_id gnl|my_center|LOCUS_45030 36463 38577 gene locus_tag LOCUS_45040 36463 38577 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477345.1 protein_id gnl|my_center|LOCUS_45040 38589 39020 gene locus_tag LOCUS_45050 38589 39020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477075.1 protein_id gnl|my_center|LOCUS_45050 39477 40310 gene locus_tag LOCUS_45060 39477 40310 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_45060 40330 42621 gene locus_tag LOCUS_45070 40330 42621 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477305.1 protein_id gnl|my_center|LOCUS_45070 43946 42651 gene locus_tag LOCUS_45080 43946 42651 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477163.1 protein_id gnl|my_center|LOCUS_45080 45074 44073 gene locus_tag LOCUS_45090 45074 44073 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463541.1 protein_id gnl|my_center|LOCUS_45090 45540 46490 gene locus_tag LOCUS_45100 gene tal 45540 46490 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463537.1 protein_id gnl|my_center|LOCUS_45100 46616 48607 gene locus_tag LOCUS_45110 gene tkt 46616 48607 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477253.1 protein_id gnl|my_center|LOCUS_45110 49053 48724 gene locus_tag LOCUS_45120 49053 48724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45120 50288 49209 gene locus_tag LOCUS_45130 50288 49209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45130 51662 50484 gene locus_tag LOCUS_45140 51662 50484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 protein_id gnl|my_center|LOCUS_45140 52902 51850 gene locus_tag LOCUS_45150 gene aroG 52902 51850 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463529.1 protein_id gnl|my_center|LOCUS_45150 53332 54354 gene locus_tag LOCUS_45160 53332 54354 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463527.1 protein_id gnl|my_center|LOCUS_45160 55617 54703 gene locus_tag LOCUS_45170 gene cyoE 55617 54703 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482743.1 protein_id gnl|my_center|LOCUS_45170 56629 55610 gene locus_tag LOCUS_45180 56629 55610 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 protein_id gnl|my_center|LOCUS_45180 57178 56642 gene locus_tag LOCUS_45190 57178 56642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482681.1 protein_id gnl|my_center|LOCUS_45190 57879 57175 gene locus_tag LOCUS_45200 57879 57175 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106290.1 protein_id gnl|my_center|LOCUS_45200 57941 58177 gene locus_tag LOCUS_45210 57941 58177 CDS product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482739.1 protein_id gnl|my_center|LOCUS_45210 59064 58180 gene locus_tag LOCUS_45220 59064 58180 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482671.1 protein_id gnl|my_center|LOCUS_45220 59675 59076 gene locus_tag LOCUS_45230 59675 59076 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_45230 61327 59687 gene locus_tag LOCUS_45240 gene ctaD 61327 59687 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482647.1 protein_id gnl|my_center|LOCUS_45240 62487 61324 gene locus_tag LOCUS_45250 gene coxB 62487 61324 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 protein_id gnl|my_center|LOCUS_45250 >Feature sequence051 1557 388 gene locus_tag LOCUS_45260 1557 388 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477353.1 protein_id gnl|my_center|LOCUS_45260 2028 3638 gene locus_tag LOCUS_45270 2028 3638 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483430.1 protein_id gnl|my_center|LOCUS_45270 4167 3733 gene locus_tag LOCUS_45280 4167 3733 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_45280 4296 5198 gene locus_tag LOCUS_45290 4296 5198 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_45290 6074 5214 gene locus_tag LOCUS_45300 gene yghU 6074 5214 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 protein_id gnl|my_center|LOCUS_45300 6857 6291 gene locus_tag LOCUS_45310 6857 6291 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477081.1 protein_id gnl|my_center|LOCUS_45310 6957 7490 gene locus_tag LOCUS_45320 6957 7490 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477143.1 protein_id gnl|my_center|LOCUS_45320 9092 7638 gene locus_tag LOCUS_45330 9092 7638 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 protein_id gnl|my_center|LOCUS_45330 10047 9124 gene locus_tag LOCUS_45340 10047 9124 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_45340 11664 10213 gene locus_tag LOCUS_45350 11664 10213 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 protein_id gnl|my_center|LOCUS_45350 11888 12874 gene locus_tag LOCUS_45360 11888 12874 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157570.1 protein_id gnl|my_center|LOCUS_45360 14317 12938 gene locus_tag LOCUS_45370 14317 12938 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706779.1 protein_id gnl|my_center|LOCUS_45370 14937 15527 gene locus_tag LOCUS_45380 14937 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 15722 16216 gene locus_tag LOCUS_45390 15722 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 17121 16642 gene locus_tag LOCUS_45400 17121 16642 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016620.1 protein_id gnl|my_center|LOCUS_45400 17772 18110 gene locus_tag LOCUS_45410 17772 18110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263938.1 protein_id gnl|my_center|LOCUS_45410 18501 18286 gene locus_tag LOCUS_45420 18501 18286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 19144 18944 gene locus_tag LOCUS_45430 19144 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792246.1 protein_id gnl|my_center|LOCUS_45430 19474 19262 gene locus_tag LOCUS_45440 19474 19262 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483265.1 protein_id gnl|my_center|LOCUS_45440 20633 19914 gene locus_tag LOCUS_45450 20633 19914 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477266.1 protein_id gnl|my_center|LOCUS_45450 21074 22558 gene locus_tag LOCUS_45460 21074 22558 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_45460 22564 22902 gene locus_tag LOCUS_45470 22564 22902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45470 22902 23909 gene locus_tag LOCUS_45480 22902 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45480 24844 24038 gene locus_tag LOCUS_45490 24844 24038 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463336.1 protein_id gnl|my_center|LOCUS_45490 25774 24848 gene locus_tag LOCUS_45500 25774 24848 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492047.1 protein_id gnl|my_center|LOCUS_45500 26906 25764 gene locus_tag LOCUS_45510 26906 25764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478317.1 protein_id gnl|my_center|LOCUS_45510 27109 27762 gene locus_tag LOCUS_45520 27109 27762 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_45520 28063 27824 gene locus_tag LOCUS_45530 28063 27824 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 protein_id gnl|my_center|LOCUS_45530 28314 29348 gene locus_tag LOCUS_45540 28314 29348 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479922.1 protein_id gnl|my_center|LOCUS_45540 29521 30324 gene locus_tag LOCUS_45550 29521 30324 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_45550 30650 31522 gene locus_tag LOCUS_45560 30650 31522 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_45560 32500 31586 gene locus_tag LOCUS_45570 32500 31586 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974445.1 protein_id gnl|my_center|LOCUS_45570 33475 32606 gene locus_tag LOCUS_45580 33475 32606 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_45580 33606 34754 gene locus_tag LOCUS_45590 33606 34754 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464060.1 protein_id gnl|my_center|LOCUS_45590 35137 34811 gene locus_tag LOCUS_45600 35137 34811 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464102.1 protein_id gnl|my_center|LOCUS_45600 35681 35217 gene locus_tag LOCUS_45610 35681 35217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128261979.1 protein_id gnl|my_center|LOCUS_45610 35924 36631 gene locus_tag LOCUS_45620 35924 36631 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464070.1 protein_id gnl|my_center|LOCUS_45620 37121 36693 gene locus_tag LOCUS_45630 37121 36693 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479871.1 protein_id gnl|my_center|LOCUS_45630 37363 38925 gene locus_tag LOCUS_45640 37363 38925 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464136.1 protein_id gnl|my_center|LOCUS_45640 41875 38999 gene locus_tag LOCUS_45650 41875 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479899.1 protein_id gnl|my_center|LOCUS_45650 42098 43009 gene locus_tag LOCUS_45660 42098 43009 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479866.1 protein_id gnl|my_center|LOCUS_45660 43029 43406 gene locus_tag LOCUS_45670 43029 43406 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_45670 43409 43951 gene locus_tag LOCUS_45680 43409 43951 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644491.1 protein_id gnl|my_center|LOCUS_45680 44882 43959 gene locus_tag LOCUS_45690 44882 43959 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357040.1 protein_id gnl|my_center|LOCUS_45690 45004 45672 gene locus_tag LOCUS_45700 45004 45672 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816772.1 protein_id gnl|my_center|LOCUS_45700 45773 46960 gene locus_tag LOCUS_45710 45773 46960 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037802.1 protein_id gnl|my_center|LOCUS_45710 47040 47669 gene locus_tag LOCUS_45720 gene grxB 47040 47669 CDS product glutaredoxin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479838.1 protein_id gnl|my_center|LOCUS_45720 47680 48771 gene locus_tag LOCUS_45730 47680 48771 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088622.1 protein_id gnl|my_center|LOCUS_45730 48935 49138 gene locus_tag LOCUS_45740 48935 49138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 50620 49178 gene locus_tag LOCUS_45750 50620 49178 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261612.1 protein_id gnl|my_center|LOCUS_45750 51083 51604 gene locus_tag LOCUS_45760 51083 51604 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479918.1 protein_id gnl|my_center|LOCUS_45760 52152 51691 gene locus_tag LOCUS_45770 52152 51691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 52749 52357 gene locus_tag LOCUS_45780 52749 52357 CDS product ribosome recycling factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479876.1 protein_id gnl|my_center|LOCUS_45780 52985 53419 gene locus_tag LOCUS_45790 52985 53419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 53420 53947 gene locus_tag LOCUS_45800 53420 53947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45800 55440 54655 gene locus_tag LOCUS_45810 55440 54655 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005373812.1 protein_id gnl|my_center|LOCUS_45810 55548 55820 gene locus_tag LOCUS_45820 55548 55820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45820 55817 56803 gene locus_tag LOCUS_45830 55817 56803 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464135.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45830 56992 58566 gene locus_tag LOCUS_45840 56992 58566 CDS product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200913519.1 protein_id gnl|my_center|LOCUS_45840 59443 58607 gene locus_tag LOCUS_45850 59443 58607 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464081.1 protein_id gnl|my_center|LOCUS_45850 59793 62162 gene locus_tag LOCUS_45860 gene ppsA 59793 62162 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479906.1 protein_id gnl|my_center|LOCUS_45860 62349 63128 gene locus_tag LOCUS_45870 62349 63128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464130.1 protein_id gnl|my_center|LOCUS_45870 63250 64071 gene locus_tag LOCUS_45880 63250 64071 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479785.1 protein_id gnl|my_center|LOCUS_45880 64153 65409 gene locus_tag LOCUS_45890 gene tyrS 64153 65409 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479869.1 protein_id gnl|my_center|LOCUS_45890 65658 65870 gene locus_tag LOCUS_45900 65658 65870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 67412 65940 gene locus_tag LOCUS_45910 67412 65940 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261701.1 protein_id gnl|my_center|LOCUS_45910 67542 68567 gene locus_tag LOCUS_45920 67542 68567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 68693 69697 gene locus_tag LOCUS_45930 68693 69697 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263350.1 protein_id gnl|my_center|LOCUS_45930 70677 69751 gene locus_tag LOCUS_45940 70677 69751 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261703.1 protein_id gnl|my_center|LOCUS_45940 71066 70707 gene locus_tag LOCUS_45950 71066 70707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479810.1 protein_id gnl|my_center|LOCUS_45950 71180 72061 gene locus_tag LOCUS_45960 71180 72061 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479816.1 protein_id gnl|my_center|LOCUS_45960 72165 73247 gene locus_tag LOCUS_45970 72165 73247 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479920.1 protein_id gnl|my_center|LOCUS_45970 73257 76313 gene locus_tag LOCUS_45980 73257 76313 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479778.1 protein_id gnl|my_center|LOCUS_45980 76316 77806 gene locus_tag LOCUS_45990 76316 77806 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479783.1 protein_id gnl|my_center|LOCUS_45990 78014 79240 gene locus_tag LOCUS_46000 gene gltS 78014 79240 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176022.1 protein_id gnl|my_center|LOCUS_46000 79389 79643 gene locus_tag LOCUS_46010 79389 79643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106259.1 protein_id gnl|my_center|LOCUS_46010 80491 81072 gene locus_tag LOCUS_46020 80491 81072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 81140 81964 gene locus_tag LOCUS_46030 81140 81964 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479824.1 protein_id gnl|my_center|LOCUS_46030 84427 82019 gene locus_tag LOCUS_46040 84427 82019 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479868.1 protein_id gnl|my_center|LOCUS_46040 84675 85121 gene locus_tag LOCUS_46050 84675 85121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46050 85210 86304 gene locus_tag LOCUS_46060 85210 86304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46060 88012 86411 gene locus_tag LOCUS_46070 88012 86411 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_46070 88316 88975 gene locus_tag LOCUS_46080 88316 88975 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479924.1 protein_id gnl|my_center|LOCUS_46080 89988 89134 gene locus_tag LOCUS_46090 89988 89134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 91211 89988 gene locus_tag LOCUS_46100 91211 89988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479915.1 protein_id gnl|my_center|LOCUS_46100 93262 91388 gene locus_tag LOCUS_46110 93262 91388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 93819 93337 gene locus_tag LOCUS_46120 93819 93337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 94213 94776 gene locus_tag LOCUS_46130 94213 94776 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 protein_id gnl|my_center|LOCUS_46130 94763 96091 gene locus_tag LOCUS_46140 94763 96091 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 protein_id gnl|my_center|LOCUS_46140 96088 99189 gene locus_tag LOCUS_46150 96088 99189 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_46150 100147 99881 gene locus_tag LOCUS_46160 100147 99881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106255.1 protein_id gnl|my_center|LOCUS_46160 103587 100429 gene locus_tag LOCUS_46170 103587 100429 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479898.1 protein_id gnl|my_center|LOCUS_46170 104758 103601 gene locus_tag LOCUS_46180 104758 103601 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_46180 105344 106861 gene locus_tag LOCUS_46190 105344 106861 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479787.1 protein_id gnl|my_center|LOCUS_46190 106979 107566 gene locus_tag LOCUS_46200 106979 107566 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 protein_id gnl|my_center|LOCUS_46200 107588 108151 gene locus_tag LOCUS_46210 107588 108151 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181848.1 protein_id gnl|my_center|LOCUS_46210 108692 108207 gene locus_tag LOCUS_46220 108692 108207 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479843.1 protein_id gnl|my_center|LOCUS_46220 108860 109711 gene locus_tag LOCUS_46230 108860 109711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464201.1 protein_id gnl|my_center|LOCUS_46230 109714 110109 gene locus_tag LOCUS_46240 109714 110109 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464146.1 protein_id gnl|my_center|LOCUS_46240 110565 110125 gene locus_tag LOCUS_46250 gene soxR 110565 110125 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464169.1 protein_id gnl|my_center|LOCUS_46250 110659 111882 gene locus_tag LOCUS_46260 110659 111882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479795.1 protein_id gnl|my_center|LOCUS_46260 111920 112804 gene locus_tag LOCUS_46270 111920 112804 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479800.1 protein_id gnl|my_center|LOCUS_46270 112925 113617 gene locus_tag LOCUS_46280 112925 113617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46280 113614 113928 gene locus_tag LOCUS_46290 113614 113928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46290 113943 114929 gene locus_tag LOCUS_46300 gene ycjG 113943 114929 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479845.1 protein_id gnl|my_center|LOCUS_46300 115236 117260 gene locus_tag LOCUS_46310 gene fusA 115236 117260 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_46310 117526 117332 gene locus_tag LOCUS_46320 117526 117332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005373920.1 protein_id gnl|my_center|LOCUS_46320 118235 117621 gene locus_tag LOCUS_46330 118235 117621 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261923.1 protein_id gnl|my_center|LOCUS_46330 118435 119082 gene locus_tag LOCUS_46340 118435 119082 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490790.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46340 119418 119215 gene locus_tag LOCUS_46350 gene nqrM 119418 119215 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464141.1 protein_id gnl|my_center|LOCUS_46350 119915 119418 gene locus_tag LOCUS_46360 119915 119418 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479888.1 protein_id gnl|my_center|LOCUS_46360 120202 119912 gene locus_tag LOCUS_46370 120202 119912 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464150.1 protein_id gnl|my_center|LOCUS_46370 120544 121536 gene locus_tag LOCUS_46380 120544 121536 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339009.1 protein_id gnl|my_center|LOCUS_46380 121624 122523 gene locus_tag LOCUS_46390 121624 122523 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241012.1 protein_id gnl|my_center|LOCUS_46390 122516 123757 gene locus_tag LOCUS_46400 122516 123757 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 protein_id gnl|my_center|LOCUS_46400 124048 123815 gene locus_tag LOCUS_46410 124048 123815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 124248 124760 gene locus_tag LOCUS_46420 124248 124760 CDS product copper resistance protein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106247.1 protein_id gnl|my_center|LOCUS_46420 124953 125765 gene locus_tag LOCUS_46430 124953 125765 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073498.1 protein_id gnl|my_center|LOCUS_46430 126220 125834 gene locus_tag LOCUS_46440 126220 125834 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455301.1 protein_id gnl|my_center|LOCUS_46440 127181 126297 gene locus_tag LOCUS_46450 127181 126297 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479909.1 protein_id gnl|my_center|LOCUS_46450 127276 128184 gene locus_tag LOCUS_46460 127276 128184 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479806.1 protein_id gnl|my_center|LOCUS_46460 129028 128249 gene locus_tag LOCUS_46470 129028 128249 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479901.1 protein_id gnl|my_center|LOCUS_46470 130841 129159 gene locus_tag LOCUS_46480 130841 129159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 131283 132260 gene locus_tag LOCUS_46490 131283 132260 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261724.1 protein_id gnl|my_center|LOCUS_46490 132864 132346 gene locus_tag LOCUS_46500 132864 132346 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479777.1 protein_id gnl|my_center|LOCUS_46500 132770 132985 gene locus_tag LOCUS_46510 132770 132985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 133432 133085 gene locus_tag LOCUS_46520 133432 133085 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 protein_id gnl|my_center|LOCUS_46520 133810 133451 gene locus_tag LOCUS_46530 133810 133451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479882.1 protein_id gnl|my_center|LOCUS_46530 134038 134220 gene locus_tag LOCUS_46540 134038 134220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 135573 134263 gene locus_tag LOCUS_46550 gene pncB 135573 134263 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479835.1 protein_id gnl|my_center|LOCUS_46550 135964 136689 gene locus_tag LOCUS_46560 135964 136689 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463941.1 protein_id gnl|my_center|LOCUS_46560 136721 137374 gene locus_tag LOCUS_46570 136721 137374 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479858.1 protein_id gnl|my_center|LOCUS_46570 137587 137943 gene locus_tag LOCUS_46580 137587 137943 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463914.1 protein_id gnl|my_center|LOCUS_46580 138061 138384 gene locus_tag LOCUS_46590 138061 138384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46590 138369 138950 gene locus_tag LOCUS_46600 138369 138950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46600 139696 138956 gene locus_tag LOCUS_46610 139696 138956 CDS product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463954.1 protein_id gnl|my_center|LOCUS_46610 140177 139788 gene locus_tag LOCUS_46620 140177 139788 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481479.1 protein_id gnl|my_center|LOCUS_46620 140336 140815 gene locus_tag LOCUS_46630 140336 140815 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481508.1 protein_id gnl|my_center|LOCUS_46630 141374 141189 gene locus_tag LOCUS_46640 141374 141189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 141532 141972 gene locus_tag LOCUS_46650 141532 141972 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463920.1 protein_id gnl|my_center|LOCUS_46650 141984 143384 gene locus_tag LOCUS_46660 141984 143384 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463953.1 protein_id gnl|my_center|LOCUS_46660 143506 145926 gene locus_tag LOCUS_46670 143506 145926 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_46670 145926 148682 gene locus_tag LOCUS_46680 145926 148682 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_46680 151327 149363 gene locus_tag LOCUS_46690 151327 149363 CDS product siderophore amonabactin TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_46690 152950 151349 gene locus_tag LOCUS_46700 152950 151349 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 protein_id gnl|my_center|LOCUS_46700 153086 153766 gene locus_tag LOCUS_46710 153086 153766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46710 153919 154083 gene locus_tag LOCUS_46720 153919 154083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46720 154496 154134 gene locus_tag LOCUS_46730 154496 154134 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_46730 155444 154578 gene locus_tag LOCUS_46740 155444 154578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481469.1 protein_id gnl|my_center|LOCUS_46740 155548 156159 gene locus_tag LOCUS_46750 155548 156159 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481530.1 protein_id gnl|my_center|LOCUS_46750 156268 156618 gene locus_tag LOCUS_46760 156268 156618 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481539.1 protein_id gnl|my_center|LOCUS_46760 157780 156698 gene locus_tag LOCUS_46770 157780 156698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706391.1 protein_id gnl|my_center|LOCUS_46770 158778 157909 gene locus_tag LOCUS_46780 158778 157909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_46780 159383 158790 gene locus_tag LOCUS_46790 159383 158790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 159530 160075 gene locus_tag LOCUS_46800 159530 160075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 160206 160919 gene locus_tag LOCUS_46810 160206 160919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 161876 160926 gene locus_tag LOCUS_46820 161876 160926 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262928.1 protein_id gnl|my_center|LOCUS_46820 162066 162881 gene locus_tag LOCUS_46830 162066 162881 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262927.1 protein_id gnl|my_center|LOCUS_46830 163128 162958 gene locus_tag LOCUS_46840 163128 162958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 163227 164102 gene locus_tag LOCUS_46850 163227 164102 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061369.1 protein_id gnl|my_center|LOCUS_46850 164894 164355 gene locus_tag LOCUS_46860 164894 164355 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390831.1 protein_id gnl|my_center|LOCUS_46860 165044 165994 gene locus_tag LOCUS_46870 165044 165994 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_46870 166557 166111 gene locus_tag LOCUS_46880 166557 166111 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482653.1 protein_id gnl|my_center|LOCUS_46880 168294 166714 gene locus_tag LOCUS_46890 168294 166714 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151653465.1 protein_id gnl|my_center|LOCUS_46890 168939 168520 gene locus_tag LOCUS_46900 168939 168520 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071181.1 protein_id gnl|my_center|LOCUS_46900 169744 168944 gene locus_tag LOCUS_46910 169744 168944 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922383.1 protein_id gnl|my_center|LOCUS_46910 170229 169870 gene locus_tag LOCUS_46920 170229 169870 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337701.1 protein_id gnl|my_center|LOCUS_46920 170793 170269 gene locus_tag LOCUS_46930 170793 170269 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817532.1 protein_id gnl|my_center|LOCUS_46930 171249 170797 gene locus_tag LOCUS_46940 171249 170797 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062926.1 protein_id gnl|my_center|LOCUS_46940 171602 171273 gene locus_tag LOCUS_46950 171602 171273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 173500 171944 gene locus_tag LOCUS_46960 173500 171944 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482737.1 protein_id gnl|my_center|LOCUS_46960 176148 173710 gene locus_tag LOCUS_46970 176148 173710 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462748.1 protein_id gnl|my_center|LOCUS_46970 176939 176151 gene locus_tag LOCUS_46980 176939 176151 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462746.1 protein_id gnl|my_center|LOCUS_46980 177251 178021 gene locus_tag LOCUS_46990 177251 178021 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462744.1 protein_id gnl|my_center|LOCUS_46990 178995 178432 gene locus_tag LOCUS_47000 178995 178432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47000 179576 180733 gene locus_tag LOCUS_47010 179576 180733 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928508.1 protein_id gnl|my_center|LOCUS_47010 180896 181408 gene locus_tag LOCUS_47020 180896 181408 CDS product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462742.1 protein_id gnl|my_center|LOCUS_47020 181902 181444 gene locus_tag LOCUS_47030 181902 181444 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462739.1 protein_id gnl|my_center|LOCUS_47030 182453 181983 gene locus_tag LOCUS_47040 182453 181983 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480144.1 protein_id gnl|my_center|LOCUS_47040 182586 183572 gene locus_tag LOCUS_47050 182586 183572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480170.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47050 183503 183769 gene locus_tag LOCUS_47060 183503 183769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47060 183732 184712 gene locus_tag LOCUS_47070 gene yidZ 183732 184712 CDS product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480166.1 protein_id gnl|my_center|LOCUS_47070 185614 184736 gene locus_tag LOCUS_47080 185614 184736 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_47080 185817 186686 gene locus_tag LOCUS_47090 185817 186686 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480150.1 protein_id gnl|my_center|LOCUS_47090 187078 188898 gene locus_tag LOCUS_47100 187078 188898 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480180.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47100 188811 189260 gene locus_tag LOCUS_47110 188811 189260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47110 189271 190956 gene locus_tag LOCUS_47120 189271 190956 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462727.1 protein_id gnl|my_center|LOCUS_47120 190956 191159 gene locus_tag LOCUS_47130 190956 191159 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462724.1 protein_id gnl|my_center|LOCUS_47130 191172 192059 gene locus_tag LOCUS_47140 191172 192059 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480130.1 protein_id gnl|my_center|LOCUS_47140 192079 192765 gene locus_tag LOCUS_47150 192079 192765 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 protein_id gnl|my_center|LOCUS_47150 192758 193903 gene locus_tag LOCUS_47160 192758 193903 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462714.1 protein_id gnl|my_center|LOCUS_47160 194158 194778 gene locus_tag LOCUS_47170 194158 194778 CDS product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 protein_id gnl|my_center|LOCUS_47170 196036 194828 gene locus_tag LOCUS_47180 196036 194828 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459233.1 protein_id gnl|my_center|LOCUS_47180 196598 196681 gene locus_tag LOCUS_t01030 196598 196681 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 196711 197322 gene locus_tag LOCUS_47190 196711 197322 CDS product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459325.1 protein_id gnl|my_center|LOCUS_47190 198816 197416 gene locus_tag LOCUS_47200 198816 197416 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479941.1 protein_id gnl|my_center|LOCUS_47200 200357 199113 gene locus_tag LOCUS_47210 200357 199113 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704471.1 protein_id gnl|my_center|LOCUS_47210 200511 200918 gene locus_tag LOCUS_47220 200511 200918 CDS product cystatin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459310.1 protein_id gnl|my_center|LOCUS_47220 201231 200965 gene locus_tag LOCUS_47230 201231 200965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47230 201485 201228 gene locus_tag LOCUS_47240 201485 201228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 202857 201625 gene locus_tag LOCUS_47250 gene lhgO 202857 201625 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479979.1 protein_id gnl|my_center|LOCUS_47250 204989 202866 gene locus_tag LOCUS_47260 204989 202866 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459237.1 protein_id gnl|my_center|LOCUS_47260 206088 205078 gene locus_tag LOCUS_47270 206088 205078 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_47270 206925 208235 gene locus_tag LOCUS_47280 gene brnQ 206925 208235 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459306.1 protein_id gnl|my_center|LOCUS_47280 209649 208300 gene locus_tag LOCUS_47290 209649 208300 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459318.1 protein_id gnl|my_center|LOCUS_47290 209827 211887 gene locus_tag LOCUS_47300 209827 211887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459312.1 protein_id gnl|my_center|LOCUS_47300 212086 213213 gene locus_tag LOCUS_47310 212086 213213 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025860.1 protein_id gnl|my_center|LOCUS_47310 213423 214814 gene locus_tag LOCUS_47320 gene ascB 213423 214814 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459314.1 protein_id gnl|my_center|LOCUS_47320 216938 214902 gene locus_tag LOCUS_47330 216938 214902 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_47330 217142 216957 gene locus_tag LOCUS_47340 217142 216957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 217201 217539 gene locus_tag LOCUS_47350 217201 217539 CDS product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459294.1 protein_id gnl|my_center|LOCUS_47350 219071 218205 gene locus_tag LOCUS_47360 219071 218205 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459287.1 protein_id gnl|my_center|LOCUS_47360 219238 219483 gene locus_tag LOCUS_47370 219238 219483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459280.1 protein_id gnl|my_center|LOCUS_47370 219984 220883 gene locus_tag LOCUS_47380 219984 220883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 protein_id gnl|my_center|LOCUS_47380 221222 220851 gene locus_tag LOCUS_47390 221222 220851 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035581.1 protein_id gnl|my_center|LOCUS_47390 222305 221292 gene locus_tag LOCUS_47400 222305 221292 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205669729.1 protein_id gnl|my_center|LOCUS_47400 222461 223075 gene locus_tag LOCUS_47410 222461 223075 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262989.1 protein_id gnl|my_center|LOCUS_47410 223399 224304 gene locus_tag LOCUS_47420 gene rimK 223399 224304 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_47420 224368 224796 gene locus_tag LOCUS_47430 224368 224796 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_47430 225646 224846 gene locus_tag LOCUS_47440 225646 224846 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451066.1 protein_id gnl|my_center|LOCUS_47440 225947 227857 gene locus_tag LOCUS_47450 gene speA 225947 227857 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459323.1 protein_id gnl|my_center|LOCUS_47450 227859 228779 gene locus_tag LOCUS_47460 gene speB 227859 228779 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393578.1 protein_id gnl|my_center|LOCUS_47460 229044 230249 gene locus_tag LOCUS_47470 gene emrD 229044 230249 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459347.1 protein_id gnl|my_center|LOCUS_47470 230528 232693 gene locus_tag LOCUS_47480 230528 232693 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459357.1 protein_id gnl|my_center|LOCUS_47480 233848 232868 gene locus_tag LOCUS_47490 233848 232868 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459338.1 protein_id gnl|my_center|LOCUS_47490 234932 234063 gene locus_tag LOCUS_47500 234932 234063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459366.1 protein_id gnl|my_center|LOCUS_47500 235822 234947 gene locus_tag LOCUS_47510 235822 234947 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479618.1 protein_id gnl|my_center|LOCUS_47510 236556 235822 gene locus_tag LOCUS_47520 236556 235822 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459358.1 protein_id gnl|my_center|LOCUS_47520 237491 236556 gene locus_tag LOCUS_47530 237491 236556 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459333.1 protein_id gnl|my_center|LOCUS_47530 238105 237554 gene locus_tag LOCUS_47540 238105 237554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479626.1 protein_id gnl|my_center|LOCUS_47540 238422 238102 gene locus_tag LOCUS_47550 238422 238102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479615.1 protein_id gnl|my_center|LOCUS_47550 239297 238467 gene locus_tag LOCUS_47560 239297 238467 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479623.1 protein_id gnl|my_center|LOCUS_47560 239808 239314 gene locus_tag LOCUS_47570 239808 239314 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479631.1 protein_id gnl|my_center|LOCUS_47570 240505 239876 gene locus_tag LOCUS_47580 240505 239876 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479632.1 protein_id gnl|my_center|LOCUS_47580 241487 240642 gene locus_tag LOCUS_47590 241487 240642 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263031.1 protein_id gnl|my_center|LOCUS_47590 241965 241660 gene locus_tag LOCUS_47600 241965 241660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47600 242831 241857 gene locus_tag LOCUS_47610 242831 241857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47610 243448 242828 gene locus_tag LOCUS_47620 243448 242828 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484262.1 protein_id gnl|my_center|LOCUS_47620 243852 243448 gene locus_tag LOCUS_47630 243852 243448 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459364.1 protein_id gnl|my_center|LOCUS_47630 244403 243849 gene locus_tag LOCUS_47640 244403 243849 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479627.1 protein_id gnl|my_center|LOCUS_47640 245770 244403 gene locus_tag LOCUS_47650 245770 244403 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459330.1 protein_id gnl|my_center|LOCUS_47650 246538 245771 gene locus_tag LOCUS_47660 246538 245771 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029797603.1 protein_id gnl|my_center|LOCUS_47660 248694 246613 gene locus_tag LOCUS_47670 gene peuA 248694 246613 CDS product TonB-dependent siderophore enterobactin receptor PeuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479624.1 protein_id gnl|my_center|LOCUS_47670 250273 248900 gene locus_tag LOCUS_47680 250273 248900 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459362.1 protein_id gnl|my_center|LOCUS_47680 250944 250273 gene locus_tag LOCUS_47690 250944 250273 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459337.1 protein_id gnl|my_center|LOCUS_47690 252054 251101 gene locus_tag LOCUS_47700 252054 251101 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479617.1 protein_id gnl|my_center|LOCUS_47700 252311 253027 gene locus_tag LOCUS_47710 252311 253027 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459332.1 protein_id gnl|my_center|LOCUS_47710 253530 253048 gene locus_tag LOCUS_47720 253530 253048 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479613.1 protein_id gnl|my_center|LOCUS_47720 253705 254700 gene locus_tag LOCUS_47730 253705 254700 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479619.1 protein_id gnl|my_center|LOCUS_47730 254743 255141 gene locus_tag LOCUS_47740 254743 255141 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467110.1 protein_id gnl|my_center|LOCUS_47740 255294 255142 gene locus_tag LOCUS_47750 255294 255142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 255564 255474 gene locus_tag LOCUS_t01040 255564 255474 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 255749 255638 gene locus_tag LOCUS_r00100 255749 255638 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence052 >Feature sequence053 585 256 gene locus_tag LOCUS_47760 585 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 >Feature sequence054 98 173 gene locus_tag LOCUS_t01050 98 173 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 176 251 gene locus_tag LOCUS_t01060 176 251 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 261 336 gene locus_tag LOCUS_t01070 261 336 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 375 450 gene locus_tag LOCUS_t01080 375 450 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 247 20 gene locus_tag LOCUS_47770 247 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 513 391 gene locus_tag LOCUS_47780 513 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 >Feature sequence056 472 272 gene locus_tag LOCUS_47790 472 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 >Feature sequence057 420 674 gene locus_tag LOCUS_47800 420 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 671 838 gene locus_tag LOCUS_47810 671 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 >Feature sequence058 261 521 gene locus_tag LOCUS_47820 261 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 575 865 gene locus_tag LOCUS_47830 575 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 >Feature sequence059 >Feature sequence060 >Feature sequence061 >Feature sequence062 782 246 gene locus_tag LOCUS_47840 782 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47840 1001 1189 gene locus_tag LOCUS_47850 1001 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 >Feature sequence063 >Feature sequence064 1093 836 gene locus_tag LOCUS_47860 1093 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 1255 2022 gene locus_tag LOCUS_47870 1255 2022 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 protein_id gnl|my_center|LOCUS_47870 2180 2776 gene locus_tag LOCUS_47880 2180 2776 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 protein_id gnl|my_center|LOCUS_47880 2917 3759 gene locus_tag LOCUS_47890 2917 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 4734 4456 gene locus_tag LOCUS_47900 4734 4456 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483280.1 protein_id gnl|my_center|LOCUS_47900 5015 4731 gene locus_tag LOCUS_47910 5015 4731 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483196.1 protein_id gnl|my_center|LOCUS_47910 5281 6339 gene locus_tag LOCUS_47920 5281 6339 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_47920 6326 6913 gene locus_tag LOCUS_47930 6326 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 >Feature sequence065 1823 291 gene locus_tag LOCUS_47940 1823 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 2112 2639 gene locus_tag LOCUS_47950 2112 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 2641 2868 gene locus_tag LOCUS_47960 2641 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 4168 3740 gene locus_tag LOCUS_47970 4168 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 5581 4337 gene locus_tag LOCUS_47980 5581 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 6849 6367 gene locus_tag LOCUS_47990 6849 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 8157 7534 gene locus_tag LOCUS_48000 8157 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 8323 8141 gene locus_tag LOCUS_48010 8323 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 >Feature sequence066 1251 358 gene locus_tag LOCUS_48020 1251 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 >Feature sequence067 713 231 gene locus_tag LOCUS_48030 713 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 1477 710 gene locus_tag LOCUS_48040 1477 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 2676 1765 gene locus_tag LOCUS_48050 2676 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 3274 2819 gene locus_tag LOCUS_48060 3274 2819 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887668.1 protein_id gnl|my_center|LOCUS_48060 4126 5094 gene locus_tag LOCUS_48070 4126 5094 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478343.1 protein_id gnl|my_center|LOCUS_48070 >Feature sequence068 408 1043 gene locus_tag LOCUS_48080 408 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 >Feature sequence069 1749 619 gene locus_tag LOCUS_48090 1749 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 3141 2518 gene locus_tag LOCUS_48100 3141 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 3839 3186 gene locus_tag LOCUS_48110 3839 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 4647 4012 gene locus_tag LOCUS_48120 4647 4012 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080009.1 protein_id gnl|my_center|LOCUS_48120 5148 4798 gene locus_tag LOCUS_48130 5148 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 6054 5881 gene locus_tag LOCUS_48140 6054 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 7092 6589 gene locus_tag LOCUS_48150 gene def 7092 6589 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395192.1 protein_id gnl|my_center|LOCUS_48150 >Feature sequence070 331 813 gene locus_tag LOCUS_48160 331 813 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382331.1 protein_id gnl|my_center|LOCUS_48160 1451 954 gene locus_tag LOCUS_48170 1451 954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982260.1 protein_id gnl|my_center|LOCUS_48170 1720 1448 gene locus_tag LOCUS_48180 1720 1448 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070963.1 protein_id gnl|my_center|LOCUS_48180 1971 2786 gene locus_tag LOCUS_48190 1971 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 2953 4905 gene locus_tag LOCUS_48200 2953 4905 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_48200 >Feature sequence071 268 1188 gene locus_tag LOCUS_48210 268 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626336.1 protein_id gnl|my_center|LOCUS_48210 1332 1949 gene locus_tag LOCUS_48220 1332 1949 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479900.1 protein_id gnl|my_center|LOCUS_48220 2091 2744 gene locus_tag LOCUS_48230 2091 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 3253 2951 gene locus_tag LOCUS_48240 3253 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088427844.1 protein_id gnl|my_center|LOCUS_48240 3526 4008 gene locus_tag LOCUS_48250 3526 4008 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072147.1 protein_id gnl|my_center|LOCUS_48250 >Feature sequence072 787 221 gene locus_tag LOCUS_48260 787 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 2315 1887 gene locus_tag LOCUS_48270 2315 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 3335 2625 gene locus_tag LOCUS_48280 3335 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 3922 3482 gene locus_tag LOCUS_48290 3922 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 4118 3945 gene locus_tag LOCUS_48300 4118 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 6686 6300 gene locus_tag LOCUS_48310 6686 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 7892 7446 gene locus_tag LOCUS_48320 7892 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 8109 10136 gene locus_tag LOCUS_48330 8109 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 10636 10334 gene locus_tag LOCUS_48340 10636 10334 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 protein_id gnl|my_center|LOCUS_48340 10881 10624 gene locus_tag LOCUS_48350 10881 10624 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861987.1 protein_id gnl|my_center|LOCUS_48350 11329 11075 gene locus_tag LOCUS_48360 11329 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 11760 11344 gene locus_tag LOCUS_48370 11760 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 12437 11901 gene locus_tag LOCUS_48380 12437 11901 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888173.1 protein_id gnl|my_center|LOCUS_48380 13122 12568 gene locus_tag LOCUS_48390 13122 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 13550 13371 gene locus_tag LOCUS_48400 13550 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 14980 14465 gene locus_tag LOCUS_48410 14980 14465 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261925.1 protein_id gnl|my_center|LOCUS_48410 15559 15182 gene locus_tag LOCUS_48420 15559 15182 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096589.1 protein_id gnl|my_center|LOCUS_48420 16735 16370 gene locus_tag LOCUS_48430 16735 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 18713 18102 gene locus_tag LOCUS_48440 18713 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 20729 20085 gene locus_tag LOCUS_48450 20729 20085 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640263.1 protein_id gnl|my_center|LOCUS_48450 >Feature sequence073 779 120 gene locus_tag LOCUS_48460 779 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017019626.1 protein_id gnl|my_center|LOCUS_48460 1397 924 gene locus_tag LOCUS_48470 1397 924 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161076.1 protein_id gnl|my_center|LOCUS_48470 2063 1539 gene locus_tag LOCUS_48480 2063 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071868.1 protein_id gnl|my_center|LOCUS_48480 2337 2218 gene locus_tag LOCUS_48490 2337 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 >Feature sequence074 332 589 gene locus_tag LOCUS_48500 332 589 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861987.1 protein_id gnl|my_center|LOCUS_48500 577 879 gene locus_tag LOCUS_48510 577 879 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 protein_id gnl|my_center|LOCUS_48510 1698 2174 gene locus_tag LOCUS_48520 1698 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 2372 2650 gene locus_tag LOCUS_48530 2372 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 2800 3375 gene locus_tag LOCUS_48540 2800 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 >Feature sequence075 959 261 gene locus_tag LOCUS_48550 959 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48550 1417 1109 gene locus_tag LOCUS_48560 1417 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 2218 1625 gene locus_tag LOCUS_48570 2218 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 >Feature sequence076 1 423 gene locus_tag LOCUS_48580 1 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 1585 908 gene locus_tag LOCUS_48590 1585 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 2562 1585 gene locus_tag LOCUS_48600 2562 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 >Feature sequence077 1205 675 gene locus_tag LOCUS_48610 1205 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 1673 1371 gene locus_tag LOCUS_48620 1673 1371 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 protein_id gnl|my_center|LOCUS_48620 1918 1661 gene locus_tag LOCUS_48630 1918 1661 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861987.1 protein_id gnl|my_center|LOCUS_48630 2693 2115 gene locus_tag LOCUS_48640 2693 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 3523 2798 gene locus_tag LOCUS_48650 3523 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 3917 3594 gene locus_tag LOCUS_48660 3917 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 4059 3907 gene locus_tag LOCUS_48670 4059 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 >Feature sequence078 >Feature sequence079 113 188 gene locus_tag LOCUS_t01090 113 188 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 230 305 gene locus_tag LOCUS_t01100 230 305 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1170 991 gene locus_tag LOCUS_48680 1170 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 >Feature sequence080 490 59 gene locus_tag LOCUS_48690 490 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48690 1584 499 gene locus_tag LOCUS_48700 1584 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48700 2101 1853 gene locus_tag LOCUS_48710 2101 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 3116 2889 gene locus_tag LOCUS_48720 3116 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 3430 3260 gene locus_tag LOCUS_48730 3430 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 4385 3411 gene locus_tag LOCUS_48740 4385 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 4764 4378 gene locus_tag LOCUS_48750 4764 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 5527 4832 gene locus_tag LOCUS_48760 gene mobC 5527 4832 CDS product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 protein_id gnl|my_center|LOCUS_48760 6340 5540 gene locus_tag LOCUS_48770 6340 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48770 7434 6349 gene locus_tag LOCUS_48780 7434 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48780 7953 7678 gene locus_tag LOCUS_48790 7953 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 >Feature sequence081 521 354 gene locus_tag LOCUS_48800 521 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 1056 589 gene locus_tag LOCUS_48810 1056 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 2350 1034 gene locus_tag LOCUS_48820 2350 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 2664 2404 gene locus_tag LOCUS_48830 2664 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 2863 2675 gene locus_tag LOCUS_48840 2863 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 3152 2955 gene locus_tag LOCUS_48850 3152 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 4295 3243 gene locus_tag LOCUS_48860 4295 3243 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222005.1 protein_id gnl|my_center|LOCUS_48860 4514 4708 gene locus_tag LOCUS_48870 4514 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 4933 4766 gene locus_tag LOCUS_48880 4933 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 >Feature sequence082 193 480 gene locus_tag LOCUS_48890 193 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48890 >Feature sequence083 91 270 gene locus_tag LOCUS_48900 91 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 >Feature sequence084 1308 1383 gene locus_tag LOCUS_t01110 1308 1383 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1386 1461 gene locus_tag LOCUS_t01120 1386 1461 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1492 1567 gene locus_tag LOCUS_t01130 1492 1567 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 >Feature sequence086 >Feature sequence087 781 473 gene locus_tag LOCUS_48910 781 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 >Feature sequence088 >Feature sequence089 >Feature sequence090 38 1051 gene locus_tag LOCUS_48920 38 1051 CDS product IS110-like element ISVpa1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477109.1 protein_id gnl|my_center|LOCUS_48920 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 1336 1109 gene locus_tag LOCUS_48930 1336 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 >Feature sequence095 >Feature sequence096 274 350 gene locus_tag LOCUS_t01140 274 350 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 390 465 gene locus_tag LOCUS_t01150 390 465 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence097 >Feature sequence098 677 54 gene locus_tag LOCUS_48940 677 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 1438 674 gene locus_tag LOCUS_48950 gene mobC 1438 674 CDS product MobC family replication-relaxation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909124.1 protein_id gnl|my_center|LOCUS_48950 >Feature sequence099 546 319 gene locus_tag LOCUS_48960 546 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 858 688 gene locus_tag LOCUS_48970 858 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 1813 839 gene locus_tag LOCUS_48980 1813 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 >Feature sequence100 667 556 gene locus_tag LOCUS_r00110 667 556 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 400 2085 gene locus_tag LOCUS_48990 400 2085 CDS product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602685.1 protein_id gnl|my_center|LOCUS_48990 2099 2290 gene locus_tag LOCUS_49000 2099 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 >Feature sequence105 42 118 gene locus_tag LOCUS_t01160 42 118 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 158 233 gene locus_tag LOCUS_t01170 158 233 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 >Feature sequence107 495 94 gene locus_tag LOCUS_49010 495 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 629 486 gene locus_tag LOCUS_49020 629 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence108 280 391 gene locus_tag LOCUS_r00120 280 391 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence109 >Feature sequence110 308 383 gene locus_tag LOCUS_t01180 308 383 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence111