COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..1913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(857..1849) product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 sequence02 source 1..55078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5055..6602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 6786..8309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(8640..9602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(9790..10761) product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906845.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(10758..11321) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 11453..12067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(12104..13138) product autolysin/adhesin Aaa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene aaa CDS 13646..14314 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047255.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(14378..15517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(15652..16635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(16757..17440) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360173.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 17576..17854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(17897..18853) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(18866..19366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(19758..20699) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085964407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(20799..21050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(21120..21830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(21850..23010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 23276..24157 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 24340..26199 product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene nrdD CDS 26196..26699 product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173331.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene nrdG CDS 26763..27848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 27919..28218 product DUF2316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(28271..29005) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(29153..29926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(29996..30772) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(30784..31494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(31495..32169) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 32242..32757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(32747..33697) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485368.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(33687..34550) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832114.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(34707..36365) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene argS CDS complement(36365..36772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(37025..37522) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(37532..38827) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 39179..40381 product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene mtnK CDS 40378..41400 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene mtnA CDS 41397..42419 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 42437..43816 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217684.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene rbsA CDS 43806..44798 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 44761..45930 product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene mtnW CDS 45915..46556 product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene mtnX CDS 46553..47155 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 47170..47688 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244952.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene mtnD CDS complement(47742..48137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(48156..48362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(48471..48944) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438748.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(48956..49447) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(49526..50641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615347.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(50659..51771) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(51935..52261) product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832090.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(52254..53093) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(53097..54086) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene pta CDS 54239..55003 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 sequence03 source 1..47126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..1238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(1278..1886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(1918..5028) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(5032..6276) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851154.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(6266..7786) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(8336..10162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 10616..10789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 10813..11130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(11317..12096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(12059..12364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(12429..12917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(12946..13455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(13552..14442) product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966620.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene mmuM CDS complement(14426..15766) product S-methylmethionine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene mmuP CDS complement(16013..16591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(16669..17313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(17415..18107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(18107..18436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(18433..19098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(19091..19891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(19888..21189) product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(21186..21770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(21834..23705) product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene nosZ CDS complement(23718..24167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 24603..24974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(25014..25331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(25388..25837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 25932..26111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(26152..27198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(27324..29477) product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(29912..30442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 30553..31455 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(31480..32586) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 32711..33094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(33146..34003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(33996..34763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(35045..35590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 35837..36814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 36836..37567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(37752..39554) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene glmS CDS complement(40079..41428) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521495.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene glmM CDS complement(41455..42390) product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894032.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(42390..43199) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene cdaA CDS complement(43231..44499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 44921..45364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(45407..46309) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene rocF tRNA complement(46510..46585) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(46592..46666) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(46673..46756) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(46785..46860) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(46864..46938) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(46943..47017) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 sequence04 source 1..36579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..1647 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 1657..2271 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene tmk CDS 2306..2635 product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 2684..3604 product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 3604..4404 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832240.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 4415..4747 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832238.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene yabA CDS 4785..5513 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 5506..5760 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 5757..6596 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene rsmI CDS complement(6642..6917) product transition state genes transcriptional regulator AbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226760.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene abrB CDS 7221..9194 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene metG CDS 9214..9477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 note possible pseudo, frameshifted CDS 9405..9986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 note possible pseudo, frameshifted CDS 10099..10662 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene rnmV CDS 10649..11539 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rsmA CDS 11638..11901 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 12023..12874 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832203.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ispE CDS 12936..13763 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene purR CDS 13779..14156 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 14193..14579 product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832195.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene spoVG CDS 14737..16095 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene glmU CDS 16183..17151 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 17365..18039 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 18123..18692 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene pth CDS 18689..22186 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154218.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene mfd CDS 22173..23681 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 23686..24855 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832236.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 24842..25111 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234988.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 25123..25506 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792417.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 25609..25995 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 26066..27289 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene tilS CDS 27293..27832 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene hpt CDS 27959..30034 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene ftsH CDS 30095..30967 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene hslO CDS 31056..31988 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832242.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene cysK CDS 32084..32872 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene folP CDS 32865..33221 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene folB CDS 33224..33700 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene folK CDS 33711..34724 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene dusB CDS 34729..36216 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288202.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene lysS rRNA 36486..36564 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 66 percent of the 5S ribosomal RNA locus_tag LOCUS_r00010 sequence05 source 1..33212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..1018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(1034..2371) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830028.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 2479..3366 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene pdxS CDS 3368..3928 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene pdxT CDS 4023..4688 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732215.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(4731..5960) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547794.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 6146..6607 product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 6619..7011 product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011443618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 7001..8011 product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438663.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 8024..10447 product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 10600..11961 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085219.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene radA CDS 11974..13029 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832313.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 13022..13702 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene ispD CDS 13702..14181 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene ispF CDS 14195..15646 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene gltX CDS 15896..16537 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene cysE CDS 16521..17915 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445731.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene cysS CDS 17908..18306 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370182.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 18306..19058 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rlmB CDS 19055..19573 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 19651..20277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 20429..20608 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene secE CDS 20620..21165 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288302.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene nusG CDS 21321..21743 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832298.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene rplK CDS 21852..22547 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene rplA CDS 22758..23282 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene rplJ CDS 23344..23709 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene rplL CDS 23822..24418 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 24610..28152 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918667.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene rpoB CDS 28283..31903 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rpoC CDS 32033..32221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 sequence06 source 1..31080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5029..11427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(11754..13076) product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene gtfB CDS complement(13073..14581) product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene gtfA CDS complement(14595..16982) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680945.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene secA2 CDS complement(16966..17475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(17477..19009) product accessory Sec system protein Asp2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene asp2 CDS complement(18975..20516) product accessory Sec system protein Asp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene asp1 CDS complement(20526..21749) product accessory Sec system protein translocase subunit SecY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916127.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene secY2 CDS complement(21852..22202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 22231..27615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 27817..28044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 29373..30860 product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 sequence07 source 1..21388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..1171) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(1226..1720) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene tadA CDS 1794..2414 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 2395..3051 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832291.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(3100..3792) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(3884..4918) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666172.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(5010..6080) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076036.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(6275..7228) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(7406..8596) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 8754..9929 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 9914..11086 product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene sndC CDS 11087..12265 product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene sndC CDS complement(12330..13517) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356194.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene tuf CDS complement(13666..15747) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene fusA CDS complement(15852..16322) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rpsG CDS complement(16437..16859) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142337.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene rpsL CDS complement(16946..17203) product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832275.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(17300..18925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(18925..20466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 sequence08 source 1..19788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..1043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(1125..2360) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829324.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene fabF CDS complement(2360..3313) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(3392..4399) product transcriptional regulator Med inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene med CDS 4488..4682 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829320.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(4709..7291) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene clpB CDS 7467..8162 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243241.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene fnr CDS complement(8191..8499) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 8596..9405 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 9417..10736 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(10779..11678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 note possible pseudo, frameshifted CDS complement(11675..12004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 12545..12712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 12739..12927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(13131..13682) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(13936..15861) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 16230..16544 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(16717..17616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 note possible pseudo, frameshifted CDS complement(17613..17942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(18178..19590) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042441161.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 sequence09 source 1..11864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..697) product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(707..1585) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832035.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene folE2 CDS complement(1599..2261) product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene bshB2 CDS complement(2275..2631) product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(2756..3586) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene thiD CDS 3694..4353 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455256.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 4350..4658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 4677..5039 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494334.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(5089..5214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(5280..6629) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546302.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 6830..7783 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 7776..8729 product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene yclO CDS 8722..9528 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 9624..10661 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754443.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 10872..11402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 sequence10 source 1..6671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..1803) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 1935..3377 product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(3493..4260) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 4477..4764 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene groES CDS 4818..6440 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene groL sequence11 source 1..3058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence12 source 1..1039148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..1597) product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(1685..2926) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene dcm CDS 3104..3508 product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 3635..4219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 4396..4653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 4783..5361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(5380..5598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 5872..6114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(6147..6383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 6720..6914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 6963..7493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 7553..7798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(8172..8339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 8668..8871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 9042..9539 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 9529..10185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(10450..10962) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(11018..11560) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058626055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 11685..13148 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117523.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 13150..13563 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282781.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 13686..14102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 14293..15183 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 15186..15413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 15502..15804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 15885..16700 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055294105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(16809..17123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 17300..18394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 18531..18926 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene cueR CDS 18964..20271 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 20387..21202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(21222..21434) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(21444..21923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 22185..23783 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(24170..24799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(24811..25338) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 25340..25528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 25590..25811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 note possible pseudo, frameshifted CDS 25874..26050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 26150..26800 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485259.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 27435..28577 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 28680..29345 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289749.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 29433..29756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 29756..29953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 30058..30906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 31025..32659 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(32704..33621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(33702..34388) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363261.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(34390..35298) product osmoprotectant ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(35298..35942) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(35945..37075) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831407.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 37195..38652 product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 38655..39623 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277968.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene hutG CDS complement(39583..40467) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691839.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 40591..41865 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077725.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 41886..43535 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene hutU CDS 43590..44819 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene hutI CDS 45205..46254 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002495598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene ribD CDS 46235..46858 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene ribE CDS 46858..48048 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene ribB CDS 48045..48509 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456446.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene ribE CDS complement(48758..49747) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196362.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(49916..50047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 50204..51298 product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 51310..52035 product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene pnuC CDS 52113..52487 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 52565..53227 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 53364..53696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(53736..54260) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 54344..55162 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266096.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 55195..55602 product SarA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(55645..56196) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(56197..57144) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830802.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 57233..58402 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 58739..61153 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene leuS CDS 61162..61458 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(61828..62103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 note possible pseudo, frameshifted CDS complement(62030..63076) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 note possible pseudo, frameshifted CDS 63234..64856 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004335.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 64853..65563 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 65632..66078 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 66200..67612 product Mn(2+)-dependent dipeptidase Sapep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene sapep CDS 67614..68453 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene dat CDS 68640..69431 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 69445..70080 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002493957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene trmB CDS 70192..71394 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(71432..71716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 71810..72874 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 73023..73787 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825921.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 73771..74490 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 74487..75215 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831593.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 75366..76364 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 76369..76677 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009915789.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 76755..77630 product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091387.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 77756..78352 product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 78362..81991 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456455.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 82003..83298 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene murC CDS 83381..83926 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 84025..84564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 84646..85716 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066378.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 85802..86791 product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ccpA CDS complement(86863..87999) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(87996..88634) product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(88644..89276) product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene acuA CDS 89408..91120 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene acsA CDS 91224..92891 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(92974..95376) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382391.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 95766..97022 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186029.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene tyrS CDS 97142..97735 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 97735..98583 product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(98628..99884) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 100108..100716 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(100720..100947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 101232..101651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(101669..101875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 102083..103573 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene nagE CDS 103770..105275 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene hutH CDS complement(105307..106617) product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173165.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(107025..107483) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131602.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 107777..108658 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(108703..109305) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090512.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rpsD CDS complement(109525..110001) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 110138..111838 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene ezrA CDS 111894..113030 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012840521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 113027..114238 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene thiI CDS 114251..115057 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(115104..115886) product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 115961..116725 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 116849..117859 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene sppA CDS 117869..118459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 118536..119033 product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832701.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene tpx CDS 119094..120023 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832682.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 120099..121298 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(121598..122095) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 122303..123418 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene ald CDS complement(123469..124101) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921934.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(124098..125168) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 125308..125991 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 126023..127324 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160435.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(127513..127866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 127939..128883 product pApA hydrolase Pde2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626082.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene pde2 CDS 128902..129834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 note possible pseudo, frameshifted CDS 129918..132050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 note possible pseudo, frameshifted CDS 132138..132581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 132587..133441 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene accD CDS 133444..134388 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832707.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 134597..135556 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440192.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene pfkA CDS 135652..137412 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene pyk CDS complement(137487..138905) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 139169..140287 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082708.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 140355..141617 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene icd CDS 141707..142648 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene mdh CDS 142799..143509 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 143506..145221 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 145471..148092 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470417.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene polA CDS 148101..149018 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene mutM CDS 149027..149614 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene coaE CDS 149734..150744 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106141.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene gap CDS 150862..151251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 151324..152217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 152373..152591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 152608..153276 product two-component system response regulator YbdJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene ybdJ CDS 153266..154270 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049577.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 154410..154730 product multidrug efflux SMR transporter subunit YkkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene ykkC CDS 154730..155044 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene sugE CDS complement(155086..155796) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 155946..156410 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene nrdR CDS 156419..157774 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 157774..158694 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene dnaI CDS 159012..160940 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene thrS CDS 161310..162800 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830900.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 162981..163517 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001791162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene infC CDS 163530..163730 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene rpmI CDS 163761..164120 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene rplT CDS 164295..165026 product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 165007..165435 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009659744.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 165465..167867 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118725.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene nirB CDS 167870..168184 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene nirD CDS 168172..169194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 169225..170589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 170693..171325 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623440.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 171399..172604 product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 172673..173740 product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 173799..174002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 174041..174616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 174691..175029 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116416.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 175019..175795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 176057..176596 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906104.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(176827..178473) product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 178615..179058 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 179089..179826 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435374.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 179849..180208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 180319..180501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 180482..180799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 180799..181332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 181316..181522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 181816..182886 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830082.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene pheS CDS 182873..185275 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908969.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene pheT CDS 185453..186355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(186779..187711) product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284282.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene rnhC CDS 187819..188094 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene zapA CDS 188087..188638 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 188684..190390 product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161938.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene polX CDS 190396..192732 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 192951..193265 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018928.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene trxA CDS 193366..195180 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830175.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene uvrC CDS 195268..195453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 195396..196007 product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene sdhC CDS 196037..197800 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830193.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene sdhA CDS 197803..198567 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene sdhB CDS 198814..199248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 199248..200054 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene racE CDS 200051..200638 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 200638..201138 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485782.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 tRNA 201319..201393 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 201589..202155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(202194..202931) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 203140..203760 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 203762..204721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280022.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 204890..206173 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene tig CDS 206382..207638 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472302.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene clpX CDS 207744..208334 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867697.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene yihA CDS 208432..209772 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485649.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene hemA CDS 209781..210614 product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157329.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 210630..211562 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene hemC CDS 211575..212258 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 212258..213241 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene hemB CDS 213243..214529 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene hemL CDS 214846..215313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 215468..216529 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 216824..219451 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425353.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 219456..220724 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108346.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 220818..222203 product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(222860..223000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 223124..223795 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene radC CDS 223795..224157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 224499..226235 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953783.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 226236..227975 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116616.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 227989..228468 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 228520..228936 product DUF4930 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 229071..230216 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene nagZ CDS 230249..231109 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene mreC CDS 231109..231612 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259925.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene mreD CDS 231753..232061 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rplU CDS 232061..232381 product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 232392..232676 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rpmA CDS 232784..233266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 233278..234567 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000496100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene obgE CDS 234579..235028 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 235038..235628 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene ruvA CDS 235643..236656 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene ruvB CDS 236659..237681 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene queA CDS 237696..238835 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene tgt CDS 238846..239118 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160682.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene yajC CDS 239294..241585 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene secDF CDS 241698..242801 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 242891..244003 product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 244070..246319 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440152.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene recJ CDS 246360..246881 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832698.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 246998..249187 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832683.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 249198..249650 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene dtd CDS 249647..250507 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 250811..252073 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590826.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene hisS CDS 252075..253880 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene aspS CDS 254213..254977 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 255134..256063 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 256056..257045 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(257068..258336) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 258421..258840 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(258879..259880) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484988.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(260146..261036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 261195..262334 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 262341..263459 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830892.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene mnmA CDS 263538..264197 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 264200..266620 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 266870..269494 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734075.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene alaS CDS 269556..269825 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 269818..270237 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene ruvX CDS 270252..270581 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 270600..271733 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene mltG CDS 271888..272514 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830827.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 272526..273449 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 273461..274720 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 274720..275343 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene udk CDS 275363..275839 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene greA CDS 275900..276592 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 276804..277328 product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 277476..277781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 277747..278595 product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 tRNA 278691..278761 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 278873..279970 product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene yqeH CDS 279984..280787 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene aroE CDS 280781..281074 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene yhbY CDS 281071..281646 product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene nadD CDS 281627..282190 product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019324.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene yqeK CDS 282209..282562 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene rsfS CDS 282562..283302 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 283371..284054 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 284134..284595 product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 284611..286914 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082702.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(286946..287080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 287178..288146 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282563.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene holA CDS complement(288181..288429) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene rpsT CDS 288605..290428 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene lepA CDS 290489..291604 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene hemW CDS 291729..292676 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene hrcA CDS 292690..293274 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene grpE CDS 293328..295154 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene dnaK CDS 295246..296364 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene dnaJ CDS 296367..297302 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene prmA CDS 297304..298041 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 298178..299533 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene mtaB CDS 299652..299828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 300003..300632 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 300651..301643 product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene floA CDS 301655..302236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 302314..302742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 302809..303753 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 303753..304217 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene ybeY CDS 304217..304564 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 304575..304988 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene cdd CDS 304978..305880 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene era CDS 305880..306632 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene recO CDS complement(306811..308199) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456487.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 308470..309117 product transcriptional regulator CcpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene ccpN CDS 309132..309941 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 309965..311725 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene dnaG CDS 311746..312849 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene rpoD CDS 312943..313290 product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene cccA CDS 313331..314035 product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624577.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 314025..315110 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(315152..316120) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene ispH CDS 316267..317595 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 317605..318501 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 318524..319333 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 319330..320181 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831102.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 320171..320578 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831164.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(320596..321186) product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(321179..322303) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene ispG CDS complement(322405..323124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 323282..323881 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 324023..326161 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 326342..327313 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 327398..328330 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene pstC CDS 328332..329225 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene pstA CDS 329251..330150 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831097.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene pstB CDS 330152..330781 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974847.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene phoU CDS 330870..331019 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene rpmG CDS 331110..331676 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831001.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 331673..333097 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 333102..333293 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087561.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 333290..334261 product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831113.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 334261..334572 product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(334609..334848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 334941..335570 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(335595..335843) product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 336053..337021 product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene comGA CDS 337008..338045 product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene comGB CDS 338057..338416 product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472256.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene comGC CDS 338364..338834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 338821..339066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 339008..339460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 339643..340149 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015120.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 340289..341371 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093349.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene gcvT CDS 341384..342727 product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene gcvPA CDS 342720..344189 product aminomethyl-transferring glycine dehydrogenase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene gcvPB CDS complement(344295..344678) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 344806..345648 product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(345745..346335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 346428..347483 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 347508..348065 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene efp CDS 348194..348661 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene accB CDS 348663..350009 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756612.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene accC CDS 350098..350445 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 350490..350882 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene nusB CDS 350890..352215 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440019.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene xseA CDS 352231..352425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 352418..353278 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 353373..355259 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene dxs CDS 355246..356079 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 356176..356628 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene argR CDS 356643..358310 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942210.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene recN CDS 358327..359019 product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene spo0A CDS 359012..359746 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(359776..360030) product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 360349..361449 product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(361665..361844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 362088..362537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 362524..363744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 363741..364400 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470536.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 365289..365792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 365867..366388 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(366472..366885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(366882..367316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 367492..368007 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 368022..368339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 368671..369138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 369138..369536 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273897.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 369616..369858 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443825.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 369852..370187 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548070.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(370261..371898) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021600.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene metG CDS 372501..373130 product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289561.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(373157..373441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(373420..374706) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 374866..375693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 375771..376442 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 376597..377097 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 377136..378209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 378314..378520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 378623..379537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 379551..379766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(379848..380213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(380315..380800) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966218.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 381145..381582 product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606884.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 381590..382558 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 382819..383922 product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 383983..385386 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene gndA CDS complement(385434..386270) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(386297..386875) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(387012..388490) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene zwf CDS 388599..389519 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene rnz CDS complement(389572..390375) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene proC CDS 390482..391237 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(391310..392299) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(392296..393213) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 393278..393817 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 393915..394394 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 394487..395374 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene xerD CDS 395384..395602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(395537..396046) product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831156.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 396076..396801 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 396791..397336 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene scpB CDS 397338..398075 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 398156..398686 product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene resA CDS 398700..400337 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene resB CDS 400330..401538 product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene resC CDS 401557..402264 product two-component system response regulator SrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064078.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene srrA CDS 402264..404012 product two-component system sensor histidine kinase SrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987774.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene srrB CDS 404228..404791 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(404879..405130) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 405236..406186 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163801.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 406183..407610 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470635.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 407673..408854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 408878..409519 product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172560.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 409570..410544 product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(410569..411531) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 411607..412263 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene cmk CDS 412345..413505 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831057.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rpsA CDS 413633..414943 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene der CDS 414956..415954 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 415964..416170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 416163..416876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 416997..417269 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 417388..417783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 417812..418531 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831089.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 418553..419524 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817755.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 419597..420043 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415883.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene ndk CDS 420231..421367 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 421364..421903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(422526..423776) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047210621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(423804..424805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 424930..425169 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 425172..425336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 425337..425606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 425621..425926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 425932..426081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 426078..427055 product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148333.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 427012..427815 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 427815..427973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 428090..428362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 428517..428957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 428954..429502 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 430249..431160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 431749..432408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 432401..432787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 432812..433480 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 433502..433798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 433913..434452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 434449..434796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 434793..435125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 435513..436670 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene aroC CDS 436671..437795 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene aroB CDS 437785..439089 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831249.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene aroA CDS 439089..440303 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 440303..440860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 440850..441275 product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 441394..441897 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 441909..442583 product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene qcrB CDS 442616..443404 product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene qcrC CDS 443453..444037 product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 444092..444787 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(444910..445788) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 445849..446175 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 446172..446540 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene mgsA CDS 446550..447671 product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690025.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene bshA CDS 447691..448914 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831104.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 448907..449875 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 449885..452479 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 452554..453738 product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene aspB CDS 453741..455036 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene asnS CDS 455125..455802 product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 455792..456445 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene nth CDS 456442..456759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831277.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(456781..459240) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(459266..459868) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene recU CDS 459945..460283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 460294..460845 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 460856..461170 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831034.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene gpsB CDS 461721..462839 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 462950..463960 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(464009..465736) product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403093.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(465733..466212) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010102577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(466225..466392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 466526..469921 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 469925..470821 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 470818..471690 product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133021.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 471946..473436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(473723..474247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016514.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 474425..475363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 475394..476170 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989455.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(476177..476566) product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(476612..477295) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 477430..477612 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001838183.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 477622..478734 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404645.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 478739..479173 product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 479160..479969 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 480207..481157 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 481169..481648 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175746.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 481645..482364 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 482386..483231 product fatty acid kinase binding subunit FakB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831247.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene fakB2 CDS 483335..483775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 483780..484307 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159900.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene msrA CDS 484300..484725 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene msrB CDS 484784..485284 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 485284..485505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 485586..487067 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 487081..488145 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 488156..488776 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831017.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 488999..489598 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443797.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 489618..490298 product response regulator transcription factor ArlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192137.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene arlR CDS 490295..491671 product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 491766..494552 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 494566..495843 product dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene sucB CDS 495927..496886 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 496905..497108 product DUF6501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902175.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 497282..498064 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 498064..499905 product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 500023..501351 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039275.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene brnQ CDS complement(501396..502556) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(502549..503319) product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002476740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(503341..503607) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 503734..504030 product regulatory protein MsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene msaA CDS 504284..504484 product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831260.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene cspA CDS complement(504560..505831) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484813.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene lysA CDS complement(505828..506892) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(506882..508033) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(508088..508804) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene dapD CDS complement(508880..509605) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene dapB CDS complement(509606..510493) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831141.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene dapA CDS complement(510588..511574) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163523.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(511679..512920) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(513311..514906) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 515083..515949 product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene cvfB CDS complement(516014..516721) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(516794..518602) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077571.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene pepF CDS 518871..519260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470626.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 519427..521031 product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(521261..522622) product glycine glycyltransferase FemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene femB CDS complement(522643..523896) product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 524193..524858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 524852..525220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(525255..525911) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830963.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(526021..527061) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 527291..528124 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(528250..528714) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540524.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(528738..529976) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 530070..531674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(531720..533240) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100919.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(533654..535045) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(535177..536439) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(536575..537792) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(537912..538361) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837153.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(538372..538659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 note possible pseudo, internal stop codon, frameshifted CDS complement(538667..538903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(538978..539502) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282933.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(539630..540730) product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(540730..541098) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721477.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(541196..541612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(541762..542538) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(542605..544218) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene abc-f CDS complement(544254..544379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(544497..545243) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(545314..545901) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(545985..546509) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 546619..547233 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 547259..548035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(547973..549178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 549310..549756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 549938..551110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(551234..551731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(551780..552535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084813.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(552541..553026) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(553212..554102) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(554112..554852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 554932..555378 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(555423..555725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(555726..555965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(555990..557237) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(557612..557785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(557798..558292) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(558379..558789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(558814..559245) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623961.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(559296..560489) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837693.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(560739..561950) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399688.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(562539..562880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(563020..563727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(563786..564535) product DUF4111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170999871.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(564528..565175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 note possible pseudo, internal stop codon CDS complement(565203..565385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 note possible pseudo, internal stop codon CDS complement(565472..566461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(566522..567754) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886638.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene tyrS CDS complement(567720..567890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(568962..569489) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(569522..569989) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(570248..570718) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(570772..571599) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(571673..572707) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 572798..573865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(574055..574288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(574548..574856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(574926..575381) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(575383..576045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(576279..577016) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(577172..578050) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(578059..578826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(578845..579303) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 579396..579926 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(579963..580907) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(581148..581540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 581754..582758 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733112.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 582807..582992 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356318.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(583036..583488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(583578..584519) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831067.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 584646..585155 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024830.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene msrA CDS complement(585152..587695) product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene mprF CDS complement(587816..588973) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832647.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(589147..591243) product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene ptsG CDS complement(591406..592260) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 592396..593370 product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(593443..594951) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(595100..597511) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene parC CDS complement(597511..599529) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene parE CDS 599837..600424 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene plsY CDS 600433..600735 product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165377.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(600757..601185) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(601287..603995) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene acnA CDS complement(604158..605711) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 606020..606388 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910489.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene mscL CDS complement(606559..607059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(607169..610276) product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(610266..611381) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691301.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(611482..611706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(611729..611932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 612027..612524 product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(612564..613031) product CcdC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966142.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(613046..613720) product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene ccdA CDS 613917..614645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(614702..614932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(615057..617039) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481443.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene tkt CDS complement(617137..617373) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(617462..617683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 617829..618446 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene lexA CDS 618852..619061 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(619159..619314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 619467..620249 product metal-binding protein ZinT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(620293..620544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(620565..620945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(620966..621382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(621414..622424) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(622508..623491) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene guaC CDS complement(623679..623948) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene rpsN CDS complement(623964..625166) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(625295..626239) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047796704.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 626504..627700 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723690.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 627734..627883 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene rpmG CDS complement(628288..629766) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 630030..631469 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 631544..631861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(631888..632271) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789904.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(632272..633126) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene panC CDS complement(633129..633950) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene panB CDS 634063..634926 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(634970..635770) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(635818..636702) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829500.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene thrB CDS complement(636703..637764) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene thrC CDS complement(637766..639001) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 639115..640467 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(640506..641540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 642205..642537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(642643..643980) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126606.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene glnA CDS complement(643998..644360) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(644449..645708) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829506.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(645695..647005) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene hflX CDS 647072..647545 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(647654..647851) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829517.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene hfq CDS complement(647835..648773) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene miaA CDS complement(648766..649665) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136952.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(649796..651469) product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(651490..652983) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene glpK CDS complement(653002..653820) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103743.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(653954..654496) product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(654496..656457) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516269.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene mutL CDS complement(656466..659066) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456219.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene mutS CDS complement(659066..659563) product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene thiW CDS complement(659629..660054) product RicAFT regulatory complex protein RicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870461.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(660054..661586) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene miaB CDS 661739..661945 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(662020..662679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(662681..663331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(663486..664385) product phenol-soluble modulin export ABC transporter ATP-binding protein PmtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830432.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene pmtA CDS complement(664388..664759) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(664964..666814) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(666807..668522) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 668655..669296 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721665.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 669309..669851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(669919..670626) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(670619..671290) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(671356..671643) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(671643..672665) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(672996..673859) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(673860..675593) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468023.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(675700..676215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(676227..677018) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(677026..677787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(677799..678386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(678520..680079) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829512.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rny CDS complement(680306..681367) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene recA CDS complement(681677..682258) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025093.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene pgsA CDS complement(682296..683150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(683169..683963) product YmfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456221.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(683975..684685) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439542.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(684678..685952) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832569.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(685949..687178) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(687175..687897) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(687908..690196) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(690264..691937) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(692051..692305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(692369..693562) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(693623..695731) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832554.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene pnp CDS complement(695852..696121) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene rpsO CDS complement(696235..697179) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene ribF CDS complement(697245..698144) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282298.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene truB CDS complement(698203..698547) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene rbfA CDS complement(698859..699755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(699996..702182) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene infB CDS complement(702175..702507) product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(702504..702791) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727423.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(702800..703864) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene nusA CDS complement(703878..704345) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene rimP CDS complement(704459..708760) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(708832..710538) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(710694..711971) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829501.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene rseP CDS complement(711973..713109) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene dxr CDS complement(713221..714012) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(714023..714796) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(714928..715485) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene frr CDS complement(715529..716251) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene pyrH CDS complement(716455..717336) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene tsf CDS complement(717470..718246) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832557.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene rpsB CDS complement(718442..719215) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene codY CDS complement(719282..720664) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene hslU CDS complement(720678..721220) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene hslV CDS complement(721233..722108) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene xerC CDS complement(722178..723479) product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene trmFO CDS complement(723635..725701) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene topA CDS complement(725875..726747) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene dprA CDS complement(727013..727921) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene sucD CDS complement(727937..729106) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene sucC CDS complement(729259..730026) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(730016..730888) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene ylqF CDS 731003..731950 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 731940..732329 product flippase GtxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene gtxA CDS 732326..734959 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 735042..737594 product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 737608..739686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(739806..740156) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rplS CDS complement(740285..741010) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene trmD CDS complement(741007..741507) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene rimM CDS complement(741560..741787) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(741793..742068) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene rpsP CDS complement(742159..743208) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(743364..744719) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863468.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene ffh CDS complement(744732..745073) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531320.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(745066..746331) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ftsY CDS complement(746331..749918) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene smc CDS complement(749920..750645) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rnc CDS complement(750899..751132) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(751173..751907) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene fabG CDS complement(751898..752809) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene fabD CDS complement(752802..753785) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene plsX CDS complement(753778..754350) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene fapR CDS complement(754463..755134) product class A sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene srtA CDS complement(755145..757184) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene recG CDS complement(757159..758043) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene sdaAA CDS complement(758054..758719) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene sdaAB CDS complement(758841..760481) product fatty acid kinase catalytic subunit FakA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene fakA CDS complement(760495..760869) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 761069..761968 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 761955..763046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 763036..764055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 764144..764332 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene rpmB CDS complement(764388..765029) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(765031..765675) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164332.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene rpe CDS complement(765675..766556) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene rsgA CDS complement(766565..767404) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(767536..769518) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387003.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(769610..769933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 770024..770332 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904590.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(770374..771651) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(771703..772569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(772680..774737) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene pknB CDS complement(774738..775475) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(775480..776571) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene rlmN CDS complement(776574..777884) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572235.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene rsmB CDS complement(777874..778815) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene fmt CDS complement(778799..779287) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(780138..780281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(780462..780662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(780847..781170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(781203..781505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(781531..782199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 note possible pseudo, frameshifted CDS complement(782103..783908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 note possible pseudo, frameshifted CDS complement(783905..785098) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830125.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene coaBC CDS complement(785150..785356) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rpoZ CDS complement(785357..785977) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene gmk CDS 786145..787827 product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 787975..788721 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354840.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 note possible pseudo, internal stop codon, frameshifted CDS complement(788752..790104) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(790123..791109) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(791126..792115) product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(792137..793546) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene lpdA CDS complement(793564..794628) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene buk CDS complement(794640..795122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 note possible pseudo, frameshifted CDS complement(795116..795466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 note possible pseudo, frameshifted CDS complement(795634..796695) product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene buk CDS complement(796706..797602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(797614..798663) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(798679..800094) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289686.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene lpdA CDS complement(800102..801385) product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101671.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(801401..802378) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674460.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(802380..803486) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene pdhA CDS complement(803747..805816) product ATP-dependent Clp protease ATP-binding subunit ClpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene clpL CDS 806480..807211 product lytic transglycosylase SceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene sceD CDS 807434..808165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 808296..808961 product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(809005..809337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(809359..809946) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene lepB CDS complement(810039..810320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(810268..810552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(810567..811142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 811363..811566 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831346.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 811563..812303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(812377..812847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(812840..813037) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(813151..813357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(813387..814049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(814070..814258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(814507..815001) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(815013..815414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(815724..816107) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(816157..816567) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053116.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(816642..817127) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 817260..817457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(817459..818265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(818268..818774) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(818785..820179) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 820302..820916 product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 820966..821232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 821237..821512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 821517..821807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 821818..821982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 822067..823251 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676841.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(823294..823866) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(824031..824198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(824188..825081) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(825081..825929) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(826095..826616) product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene bstA CDS 826701..827003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 827021..827422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(827717..828205) product arsinothricin resistance N-acetyltransferase ArsN1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258843.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(828218..828688) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(828681..829151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 829279..829851 product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 829866..831086 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353352.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(831839..832279) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(832294..832794) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(832816..833088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(833112..833612) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229479.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(833628..833963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(833969..834838) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(834864..835277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(835514..836422) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(836419..836868) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(837007..837534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(837691..838164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(838173..838667) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(838642..839211) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181848.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(839204..839608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(839605..840243) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836334.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(840342..840764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(840869..841897) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905873.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(842059..842793) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721320.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 842939..844150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(844173..844850) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene tenA CDS complement(845027..845743) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791492.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene fabG CDS complement(845819..846118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(846534..848939) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(848950..850350) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene glgA CDS complement(850371..851474) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene glgD CDS complement(851474..852622) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(852674..854602) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene glgB CDS 854860..856935 product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene pulA CDS 857021..858670 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(858713..859435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(859495..860106) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene pyrE CDS complement(860096..860797) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830092.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene pyrF CDS complement(860798..861724) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(861721..862479) product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene pyrK CDS complement(862492..865665) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene carB CDS complement(865665..866753) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(866746..868029) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767028.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(868095..868973) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(869010..870326) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830174.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(870437..870961) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene pyrR CDS complement(871124..872029) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(872016..872507) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene lspA CDS complement(872705..875452) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene ileS CDS complement(875740..876234) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(876250..877020) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232511.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(877077..877370) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830086.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(877370..877924) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(877935..878597) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830146.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(878599..879387) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene pgeF CDS complement(879491..880618) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene ftsZ CDS complement(880652..882040) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene ftsA CDS complement(882179..883075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(883079..884419) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935991.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene murD CDS complement(884420..885397) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene mraY CDS complement(885424..887763) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(887750..888124) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830073.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene ftsL CDS complement(888136..889068) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830134.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene rsmH CDS complement(889078..889509) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene mraZ CDS complement(889682..891277) product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene bshC CDS complement(891394..891567) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene rpmF CDS complement(891589..892101) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082655.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 892226..893296 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830136.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(893445..893948) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401377.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene coaD CDS complement(893941..894480) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene rsmD CDS 894585..894974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(894958..895218) product DUF2129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439362.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 895308..896228 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(896256..896840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(896850..897272) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(897284..898363) product CAP-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 898492..898851 product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 898923..899972 product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene ytvI CDS complement(900018..900479) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(900489..901442) product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene ctaG CDS complement(901574..901927) product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene ctaF CDS complement(901927..902556) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene ctaE CDS complement(902556..904448) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene ctaD CDS complement(904471..905532) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene coxB CDS complement(905564..906487) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene cyoE CDS 906740..907648 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470218.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(907680..911117) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(911345..912532) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(912583..912858) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 912974..913204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 note possible pseudo, frameshifted CDS 913219..913452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 note possible pseudo, frameshifted CDS complement(913510..913851) product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(913855..915699) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182654.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene typA CDS 915816..916001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 916167..916733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(917034..917855) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 917991..918602 product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(918624..919463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(919573..920646) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(920643..921455) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(921452..922258) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831695.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(922260..923342) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(923352..923894) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(924003..924278) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565234.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(924347..925753) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831650.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene lpdA CDS complement(925758..927056) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(927181..928158) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(928162..929277) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene pdhA CDS complement(929470..930102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 930226..930780 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene def CDS complement(930828..931091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(931103..931879) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 932115..932327 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 932328..934040 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(934077..934739) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514290.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(934752..935771) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(935771..937114) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 937331..937564 product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831684.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 937557..938387 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(938432..940141) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040051.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene ptsP CDS complement(940141..940407) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(940588..941121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(941195..942364) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(942566..943846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831698.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 943987..944118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(944147..945379) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene purD CDS complement(945389..946867) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene purH CDS complement(946878..947444) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene purN CDS complement(947446..948477) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene purM CDS complement(948480..949898) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879025.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene purF CDS complement(949877..952057) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene purL CDS complement(952060..952722) product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene purQ CDS complement(952722..952982) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene purS CDS complement(952985..953686) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(953683..954801) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010413.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene purK CDS complement(954788..955207) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072353889.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene purE CDS 955479..956327 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831669.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene folD CDS complement(956369..957517) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954799.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 957695..958108 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene nsrR CDS complement(958145..958729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(958746..959312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(959392..960528) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(960558..961148) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462478.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(961145..962134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(962143..963345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(963384..965195) product type 8 capsular polysaccharide synthesis protein Cap8D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940790.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene cap8D CDS complement(965220..965921) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207193.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(965948..966616) product protein-tyrosine kinase activator TkmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227811.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene tkmA CDS complement(966788..968068) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(968096..969211) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392196.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(969255..970268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(970279..970902) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289363.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(970902..971822) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 971952..972521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(972562..973815) product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene cap8O CDS complement(974074..975849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(975886..976680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(976685..979318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(979321..980247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(980247..981452) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(981608..982891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(983018..983935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(984105..985004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(985056..985865) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(985898..986716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 987013..988476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 988493..988960 product osmotic stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 989207..992095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(992208..992654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 992847..993836 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833065.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 993992..995575 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(995605..996084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 996302..996775 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 996882..997061 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829339.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 997066..997665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(997673..998542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 998607..1000124 product sporulation kinase KinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886497.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene kinD CDS complement(1000182..1001525) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021865.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1001558..1003084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1003162..1003935) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1004014..1005576) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446117.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1005588..1005827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1005808..1007304) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1007429..1008145 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262755.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1008142..1009329 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475594.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1009472..1010641 product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1010688..1011818 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1011856..1012731) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721336.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene galU CDS complement(1012877..1013974) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 1014067..1014789 product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1014834..1015343 product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439146.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1015372..1016145) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933195.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene fabI CDS complement(1016299..1018137) product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395153.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1018147..1019523) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene mgtE CDS complement(1019549..1020409) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829311.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1020406..1021203) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1021216..1021845) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1021860..1022204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829330.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1022352..1022939 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1022987..1023352 product truncated hemoglobin YjbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214070.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1023372..1024154 product protease adaptor protein YjbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene yjbH CDS complement(1024479..1026287) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082725.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene pepF CDS complement(1026324..1027316) product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959282.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1027393..1028061) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829308.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene mecA CDS complement(1028205..1028600) product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene spxA CDS 1029075..1030067 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene trpS CDS complement(1030122..1031783) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823455.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1032124..1033344) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722315.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1033344..1034417) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1034432..1035490) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1035490..1036416) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470381.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1036572..1038209) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1038528..1038890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 sequence13 source 1..1680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(82..1633) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence14 source 1..1655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 sequence15 source 1..1432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence16 source 1..1167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 22..97 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 123..197 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 213..301 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 318..393 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 404..478 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 494..569 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 sequence18 source 1..534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence19 source 1..487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(113..188) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(221..297) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence22 source 1..360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(3..78) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA complement(86..161) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(177..252) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 sequence23 source 1..459952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 259..333 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 351..424 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 594..1295 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene yycF CDS 1302..3140 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871607.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene walK CDS 3118..4446 product YycH family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 4446..5237 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene yycI CDS 5255..6046 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 6345..6824 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458513.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene rlmH CDS 6854..7789 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 7931..8554 product transcriptional regulator YeiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 8651..9313 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(9412..9765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 9934..10131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 10453..11412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 11832..12023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(12489..12866) product mecA-type methicillin resistance repressor MecI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene mecI CDS complement(12883..14586) product beta-lactam sensor/signal transducer MecR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene mecR1 CDS 14686..16713 product PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene mecA CDS 16694..17158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 17242..17454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(17576..17842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(17896..18177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(18179..18475) product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 18628..18909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 18932..19537 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581575.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 19648..20541 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 20937..21269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 note possible pseudo, internal stop codon CDS 21532..21720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 21662..22354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 22397..22849 product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(22896..23312) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829641.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 23526..24098 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 24285..24911 product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890722.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 24889..25611 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400890.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 25738..26322 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 26345..26908 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350628.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 26934..27062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 27062..27340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(27400..28062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(28540..29157) product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531736.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(29237..31651) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485759.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(31644..32009) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 32281..32787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 33042..35090 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 35199..35651 product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 35789..36040 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene copZ CDS complement(36220..36837) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 37022..37225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 37542..38930 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 38923..39594 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(40101..40427) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(40633..42201) product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437604.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 42346..42633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(42964..43197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 43412..43876 product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830560.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(43914..45830) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene thrS CDS 46216..46353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 46861..48210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(48537..48950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 49053..49466 product transcriptional regulator LrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene lrpC CDS 49666..50379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(50487..50684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 note possible pseudo, frameshifted CDS complement(50708..51031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 note possible pseudo, frameshifted CDS 51146..51307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 note possible pseudo, internal stop codon CDS 51374..51526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 51642..52646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 52950..53321 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(53529..54359) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 54464..55327 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 55470..56294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 56547..57323 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(57531..58073) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene hxlB CDS complement(58066..58701) product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485044.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene hxlA CDS 58804..59169 product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene hxlR CDS 59326..60477 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025477377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 60663..60983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 61014..61472 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(61515..61784) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027435.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(61777..62001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 62261..64522 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 64698..65516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(65640..66344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(66391..67824) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 67995..68492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 68760..69470 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 69528..70625 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074782808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 70625..71551 product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 71551..72489 product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene lacD CDS 72504..74282 product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 74288..74767 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364114.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 74814..75710 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 75697..76539 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 76553..76948 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 76964..78103 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene nagA CDS 78176..79771 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 79782..81011 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(81046..82506) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene galT CDS complement(82506..83495) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene galE CDS complement(83492..84670) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 84789..85805 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 85807..86952 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(87079..87354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 note possible pseudo, internal stop codon CDS 87955..88242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 88381..88941 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013212.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 89119..89664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(89739..89942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 90113..90808 product response regulator transcription factor SaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene saeR CDS 90798..91817 product two-component system sensor histidine kinase SaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244415.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene saeS CDS complement(91958..93436) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897439.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 93620..94552 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 94682..95284 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(95362..95835) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(95959..96480) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618765.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 96668..97492 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(97536..98984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 99249..100442 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 100577..101455 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009912616.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 101801..102364 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(102636..103064) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831844.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 103190..103636 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 103718..104068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 104167..105924 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 105998..106582 product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 106792..108093 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728170.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene brnQ CDS 108278..109876 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011178617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 109957..110478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(110511..111464) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 111647..112615 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 112744..113313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714116.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(113595..114548) product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 114731..116464 product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 116546..117034 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833486.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 117036..117398 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829969.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 117527..118036 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(118095..118418) product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene azlD CDS complement(118415..119119) product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene azlC CDS complement(119242..120543) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867835.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(120672..121223) product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene cobC CDS complement(121220..121612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 121992..122825 product branched-chain phosphotransacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360223.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene ptb CDS 122825..123895 product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369343.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene buk CDS 123982..124275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 124476..125870 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 126471..127511 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 127571..128248 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002493287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene sdaAB CDS 128296..129189 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene sdaAA CDS 129623..131623 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 131797..132906 product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 132988..133827 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 133829..134521 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(134546..135298) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(135298..135594) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661705.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(135600..135860) product persulfide-sensing transcriptional repressor CstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene cstR CDS 136022..138505 product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 138526..139866 product persulfide dioxygenase-sulfurtransferase CstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene cstB CDS 139940..140113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(140133..140504) product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(140494..141387) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 141615..143189 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570687.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 143252..144112 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 144109..145014 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(145026..145748) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456834.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 145822..146529 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 146642..147781 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014654825.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 147885..148196 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 148193..149740 product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(149806..150483) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(150485..151510) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761395.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 151592..152263 product DNA-binding heme response regulator HssR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249497.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene hssR CDS 152256..153605 product heme sensor histidine kinase HssS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477338.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene hssS CDS 153749..155059 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(155129..157783) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(157910..158698) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122725.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene metA CDS complement(158699..159976) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723401.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(160241..161101) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 161234..161701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(161743..162573) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(162689..163210) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989581.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 163540..164124 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 164125..165540 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 165524..166315 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273253.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 166602..167936 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 168176..168745 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene ahpC CDS 168855..170378 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ahpF CDS 170477..171253 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene modA CDS 171369..171965 product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291518.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 172140..173369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 173582..175465 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS 175582..176892 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 177082..178563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 178605..179771 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 179768..180697 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 180694..181365 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570070.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 181384..181755 product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene fra CDS 181901..182536 product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene azoRB CDS 182819..183595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 183613..184971 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 185159..186922 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 187000..188751 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484941.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 188751..189470 product response regulator transcription factor LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 189589..190020 product antiholin-like murein hydrolase modulator LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792906.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene lrgA CDS 190023..190736 product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831408.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene lrgB CDS 190896..191426 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454213.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 191439..193739 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461651.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 193726..194151 product Na+/H+ antiporter Mnh2 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832105.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene mnhB2 CDS 194148..194474 product Na+/H+ antiporter Mnh2 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene mnhC2 CDS 194467..195933 product Na+/H+ antiporter Mnh2 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene mnhD2 CDS 195986..196423 product Na+/H+ antiporter Mnh2 subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene mnhE2 CDS 196420..196698 product Na(+)/H(+) antiporter subunit F1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461656.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 196682..197077 product Na+/H+ antiporter Mnh2 subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832099.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene mnhG2 CDS 197091..198005 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(198030..198863) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(198928..201609) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456326.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(201749..202636) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene thiF CDS complement(202735..203502) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(203504..203701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(203685..204740) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456682.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene thiO CDS complement(204770..205351) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438172.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 205624..206070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(206137..206562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(206668..207447) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(207783..208391) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 208564..208923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(209003..209719) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene deoD CDS 209986..211044 product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 211060..212052 product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(212156..212827) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene modB CDS 212921..213877 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 213993..214592 product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 214603..215745 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438492.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 215878..216807 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 216925..217476 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093325.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 217607..217948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 217923..218210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(218246..219037) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103357582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene fdhD CDS 219229..222903 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514408.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 222893..224443 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438317.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene narH CDS 224436..225014 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001795300.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene narJ CDS 225007..225681 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene narI CDS 225698..226168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 226158..227198 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 227209..227859 product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene nreC CDS 227871..228377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 228541..229698 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 229716..230711 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 230723..231229 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(231230..231706) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene moaC CDS 231772..233019 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 233013..233516 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602950.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene mobB CDS 233503..233943 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808495.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 233949..234182 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438518.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene moaD CDS 234183..234815 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832403.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene mobA CDS 234796..235806 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230173.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene moaA CDS 236032..237045 product fatty acid desaturase DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene desE CDS complement(237103..238137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(238228..239418) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(239536..240987) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 241108..242304 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 242395..243279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(243529..244152) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832096.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(244301..245578) product penicillin-binding protein PBP4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene pbp4 CDS 245881..247086 product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002493541.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(247286..247822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 248167..249762 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 249825..250763 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031880.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 250900..251751 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 251764..252501 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene nagB CDS complement(252516..253553) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 253700..254512 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080809.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 254505..255521 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184741.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 255521..256519 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625878.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 256621..257685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 257695..259365 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 259502..261688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 261797..262498 product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene lutR CDS 262637..263371 product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene lutA CDS 263371..264804 product lactate utilization iron-sulfur protein LutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene lutB CDS 264804..265496 product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene lutC CDS complement(265589..266194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(266275..267498) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047210621.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(267511..268176) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 268371..268595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 268596..268865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 268885..269283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 269283..269468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 269465..269692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 269695..269928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 270095..270859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 270869..271210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 271197..272444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 272444..272635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 272670..273035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 273064..273252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 273255..273974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 273987..274289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 274351..274770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 274779..275171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 276013..276696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 277226..277906 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392690.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 277910..278674 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600967.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(278667..278924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 279043..280293 product lipid II:glycine glycyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413862.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene femX CDS 280324..281109 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene proC CDS 281552..282400 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400423.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 282525..285698 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 285943..286953 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119636.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 286954..287616 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342247.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 287701..288543 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 288555..289715 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(289748..290068) product membrane stabilizing protein MspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438539.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene mspA CDS complement(290065..291210) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(291304..291462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(291466..291939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 292017..292499 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene ybaK CDS 292489..293583 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822309.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 293598..294503 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829745.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(294550..295335) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485376.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(295354..296205) product glucose uptake protein GlcU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234455.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene glcU CDS complement(296485..297336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(297342..298154) product kanosamine-6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene ntdB CDS 298285..300414 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 300492..302009 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438863.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(302062..302778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 302976..304313 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800700.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(304352..304750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 305166..305474 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene rpsJ CDS 305501..306163 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082767.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rplC CDS 306192..306815 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829775.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene rplD CDS 306815..307090 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829755.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene rplW CDS 307138..307968 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985472.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene rplB CDS 308035..308313 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene rpsS CDS 308336..308713 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene rplV CDS 308741..309394 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene rpsC CDS 309397..309831 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene rplP CDS 309821..310033 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene rpmC CDS 310060..310323 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene rpsQ CDS 310354..310722 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615921.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene rplN CDS 310754..311062 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene rplX CDS 311086..311631 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene rplE CDS 311660..311845 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene rpsN CDS 311875..312273 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene rpsH CDS 312302..312838 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene rplF CDS 312866..313228 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829747.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene rplR CDS 313247..313744 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene rpsE CDS 313759..313938 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene rpmD CDS 313966..314406 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene rplO CDS 314406..315695 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829707.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene secY CDS 315713..316360 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 316412..316693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 316714..316932 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene infA CDS 317104..317469 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene rpsM CDS 317490..317879 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101625.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene rpsK CDS 317963..318907 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 318927..319295 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene rplQ CDS 319644..320444 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 320441..321295 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728531.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 321288..322091 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 322092..322910 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221853.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene truA CDS 323108..323545 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene rplM CDS 323565..323957 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001790547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene rpsI CDS 324339..326102 product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 326186..327217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 327964..328293 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207564.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 328334..328912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 329007..329561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 329570..330730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 330931..332106 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 332096..333463 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 333474..334142 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 334147..335517 product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene ykoH CDS 335501..336136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 336224..336574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(336679..337368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(337368..340337) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene fdhF CDS complement(340508..341047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 341208..341825 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 341812..342750 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 342766..343392 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 343430..344038 product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene paiB CDS 344231..344365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 344381..344851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 344856..346490 product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 346504..347121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 347123..347662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(347664..348338) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 348527..348967 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 349074..350285 product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 350404..350958 product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 350958..351410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 351427..351945 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966655.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(352027..353367) product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084416.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 353495..353863 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(353911..354231) product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127269.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(354243..354908) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911017.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(354918..355967) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477931.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 356194..357375 product type II sulfide:quinone oxidoreductase Sqr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033018.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene sqr CDS 357457..358011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 358181..359899 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968321.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 360011..361906 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 361939..362163 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 362204..362869 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 362961..364133 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 364136..364537 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282781.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 364675..364968 product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349637.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 364977..367355 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024139.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 367391..367594 product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene copZ CDS 367739..368743 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 368852..369499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(369550..369948) product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831775.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(369964..370323) product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491382.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(370483..372102) product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(372239..372673) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(372789..374183) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094341.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 374315..374899 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 374892..375593 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079949.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 375590..376111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 376267..376815 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641446.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 376905..378083 product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 378097..378786 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 378798..379286 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002393496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 379506..380537 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 380548..381150 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 381255..382115 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(382119..382445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 382807..384480 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene argS CDS 384590..384952 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237004.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(384987..385997) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286379.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 386193..388364 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 388416..389234 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286367.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 389320..389682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 389838..390095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 note possible pseudo, internal stop codon CDS 390099..390512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 note possible pseudo, internal stop codon CDS 390509..391390 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 391503..392252 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 392254..394224 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(394521..395060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 395340..397958 product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ppdK CDS 397972..398796 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 398934..400250 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064778.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(400287..401357) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267236.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 401486..402730 product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929863.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 402803..403231 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 403318..404271 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832877.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene corA CDS 404273..405109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(405186..405386) product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene cspA CDS complement(405738..405938) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(406294..406494) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(406766..407164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(407269..408210) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 408315..408494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 408581..409144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 409261..410445 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353378.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(410453..411691) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(411779..412045) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(412057..412428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(412442..412822) product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027789.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(412822..413280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 413438..414040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 414123..414560 product glyoxalase/bleomycin resistance/extradiol dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125705.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 414876..415751 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 415738..416475 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 416476..417546 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 417543..418139 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 418252..418560 product As(III)-sensing metalloregulatory transcriptional repressor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120603.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene arsR CDS 418563..418910 product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene arsD CDS 418923..420641 product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461627.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene arsA CDS 420638..421933 product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186433708.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene arsB CDS 421971..422366 product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene arsC CDS 422368..422553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 422751..424193 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(424272..424796) product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775369.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(424809..425891) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 425973..427412 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138565.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene nadB CDS 427378..428211 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene nadC CDS 428204..429295 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene nadA CDS 429362..429772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(429805..430269) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 430356..431075 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(431090..431908) product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene qqlR CDS complement(432031..432543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 432762..433916 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 434012..434542 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 434554..435312 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(435407..436540) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 436754..437383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 437464..437964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 438125..439471 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(439518..439817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(439814..440140) product heme oxygenase IsdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene isdG CDS complement(440153..440869) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(441280..441543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 441704..442867 product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(442886..443791) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019815.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene rarD CDS 443957..444652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 444636..445307 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 445517..446020 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147095.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 446092..447273 product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 447285..447533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 447649..448740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 448833..449801 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 449867..451426 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(451474..452448) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene galE CDS 452655..453125 product SepA family multidrug efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829729.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 453190..453600 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845472.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 453682..454656 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(454708..456165) product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836876.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 456337..457395 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 457408..458139 product KinB-signaling pathway activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399693.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene kbaA CDS 458188..459495 product multidrug efflux MFS transporter SdrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457000.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene sdrM sequence24 source 1..328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence25 source 1..322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 139..215 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence26 source 1..226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..313906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..490) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(641..1540) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670752.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1612..2655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(2652..6116) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054828577.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene addA CDS complement(6097..9456) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172350.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene addB CDS complement(9518..10078) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831955.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene lepB CDS complement(10090..10578) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene lepB CDS complement(10575..11174) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(11270..12616) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148852.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 12910..14115 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832499.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 14108..15484 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene argH CDS complement(15498..16370) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(16533..17693) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179100.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(17995..19242) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(19335..20528) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(20625..22169) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259555.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene pruA CDS complement(22321..22695) product S1 domain-containing post-transcriptional regulator Ygs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene ygs CDS complement(22770..23027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(23011..23214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(23575..24168) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 24231..24614 product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 24761..27136 product Na+/H+ antiporter Mnh1 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054612.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene mnhA1 CDS 27120..27548 product Na+/H+ antiporter Mnh1 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 gene mnhB1 CDS 27548..27889 product Na+/H+ antiporter Mnh1 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831949.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene mnhC1 CDS 27882..29354 product Na+/H+ antiporter Mnh1 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573077.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene mnhD1 CDS 29354..29833 product Na+/H+ antiporter Mnh1 subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290674.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene mnhE1 CDS 29830..30138 product Na+/H+ antiporter Mnh1 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene mnhF1 CDS 30104..30451 product Na+/H+ antiporter Mnh1 subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831900.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene mnhG1 CDS complement(30499..30891) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(30917..32230) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(32286..33341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(33354..33674) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027007.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(33686..34165) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(34250..35452) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(35611..35970) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(35984..36220) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 36379..37443 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794020.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(37473..37784) product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401414.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 37884..38126 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141883.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 38398..38679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 note possible pseudo, internal stop codon CDS 38728..39429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 note possible pseudo, internal stop codon CDS complement(39488..40444) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(40446..41228) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831998.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(41215..41652) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831932.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 41734..41997 product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(42033..42530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(42538..43452) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201875.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene lipA CDS complement(43526..44854) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(44870..45703) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(45715..46563) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 46621..47337 product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 47334..48107 product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene fetB CDS complement(48138..49535) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene sufB CDS complement(49550..49984) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(49974..51209) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(51239..52543) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene sufD CDS complement(52574..53350) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene sufC CDS complement(53676..54509) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732324.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(54562..55254) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520231.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(55247..56272) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(56489..56800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(56772..57161) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(57254..57622) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene gcvH CDS complement(57695..58048) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589549.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 58192..58512 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(58557..59090) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(59154..59882) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene aroD CDS 60077..60337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 tmRNA 60427..60781 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(60834..61373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(61503..61964) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723350.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene smpB CDS complement(61975..64311) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene rnr CDS complement(64328..65074) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(65162..65395) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene secG CDS complement(65514..66818) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene eno CDS complement(66927..68459) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene gpmI CDS complement(68459..69208) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260089.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene tpiA CDS complement(69225..70415) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(70532..71545) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829667.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene gap CDS complement(71734..72777) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(72934..73185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 73430..74023 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene clpP CDS 74324..75694 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714930.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 75773..76498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 76601..78004 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(78054..79004) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene whiA CDS complement(79006..79998) product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248939.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(79985..80887) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369722.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene rapZ CDS complement(80976..81902) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene trxB CDS complement(81958..83376) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468672.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(83409..83891) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224793.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(83869..84711) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468680.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene lgt CDS complement(84713..85642) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829649.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene hprK CDS complement(85751..88573) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene uvrA CDS complement(88578..90557) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene uvrB CDS complement(90689..90919) product CsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(90916..91563) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(91579..92118) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269085.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(92237..92677) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(93047..94075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(94199..94516) product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene cccB CDS complement(94625..95608) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene prfB CDS complement(95732..98260) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene secA CDS complement(98497..99060) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene raiA CDS complement(99122..99808) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057965.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(99798..101027) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171004420.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(101096..101950) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 102093..102722 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(102782..103828) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 104016..104972 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830043.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 105042..105896 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 105908..106972 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494710.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 107016..107774 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 107787..108272 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 108388..109611 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438906.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene pepT CDS complement(109672..110754) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(110831..111151) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene ytxJ CDS 111296..111508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(111539..112432) product EMYY motif lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829568.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 112537..113037 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287207.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 113095..114009 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene murB CDS complement(114073..114480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(114609..115577) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene nrdF CDS complement(115686..117791) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene nrdE CDS complement(117754..118149) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 gene nrdI CDS 118616..119113 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene queF CDS 119390..120901 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 121193..122698 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(122754..123665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 123780..124268 product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 124274..125395 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881328.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(125447..126049) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(126096..126377) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(126389..126796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(126833..127180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 127355..128269 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429006.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(128327..128857) product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197262.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(128966..130024) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663030.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene hisC CDS complement(130120..131634) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438893.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(131634..132557) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589248.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(132649..134418) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene recQ CDS complement(134422..136296) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468856.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 136441..137253 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(137302..139239) product polyglycerol-phosphate lipoteichoic acid synthase LtaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098285.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene ltaS CDS complement(139460..140422) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022323.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(140808..142541) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene pabB CDS complement(142531..143103) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602287.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene pabA CDS 143304..143972 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene queC CDS 143969..144382 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene queD CDS 144379..145089 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830330.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene queE CDS 145154..145756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 145865..146119 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466748.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(146153..146881) product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(146996..147832) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830355.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 147961..148746 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201260.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(148882..149592) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene rluF CDS complement(149637..149936) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(149929..151275) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(151501..152274) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(152479..154386) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266553.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(154397..155317) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene pfkB CDS complement(155328..156065) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957281.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(156261..157127) product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435109.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(157146..158054) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 158306..158743 product HTH-type transcriptional regulator MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene mgrA CDS complement(158789..159625) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831929.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(159752..161374) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485888.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene cydC CDS complement(161374..162960) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 163079..163933 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469894.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 164076..164495 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 164602..165540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 165527..165988 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708755.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(165985..166452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 166509..167081 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(167066..167518) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(167502..168068) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(168172..170550) product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(170700..172403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(172408..173955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725608.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(174032..174325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(174404..175309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 175456..175962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972731.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(176057..179536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(179838..180785) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233650.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 gene corA CDS complement(180778..181230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 181496..183745 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene pflB CDS 183787..184542 product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002446860.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene pflA CDS complement(184595..186637) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832160.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(186774..187247) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 187533..188624 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene rsgA CDS 188861..189184 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 189190..189759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 189871..190533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 190545..191249 product DUF1129 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993581.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(191288..191770) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(191767..192969) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(193056..193835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(193880..194536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(194610..195500) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832044.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(195516..196259) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(196520..197518) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022349.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene trpS CDS 197882..198751 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832349.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(198785..199315) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(199399..201174) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(201187..201837) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071419.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 201982..202527 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 202603..203970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(204535..204948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 note possible pseudo, frameshifted CDS complement(204967..205632) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261865.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(205622..206644) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622979.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(207000..208493) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(208544..209899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(209902..210450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(210422..211324) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(211311..211691) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(211845..212624) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(212762..213139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(213136..215892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(215958..216671) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242611.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(216785..217426) product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(217600..218967) product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(218964..220511) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876638.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene gntK CDS complement(220512..221201) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene gntR CDS complement(221345..221878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(221944..222954) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(222966..223583) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(223808..224725) product auxiliary protein GraX/ApsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene graX CDS complement(224792..225823) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030772.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(225910..227010) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(227094..228533) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 228762..229139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(229299..229802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832127.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(229893..231035) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(231028..231369) product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene phnA CDS complement(231384..231899) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246311.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene adaB CDS complement(231901..232362) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(232599..233024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(233026..233235) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538359.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(233379..234023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(234445..234948) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS complement(234953..235219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(235311..235766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 236149..237627 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(237683..238240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(238654..239556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(239727..240755) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene adhP CDS 240961..241425 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(241411..242370) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(242764..244254) product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(244437..245816) product multidrug efflux MFS transporter NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006441.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene norC CDS 246040..246456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(246473..246634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(246726..246851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(246889..247371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(247505..248320) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990045.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(248383..249822) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226994.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene bglA CDS complement(249835..251739) product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 251874..252578 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226988.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 252629..252808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 252805..252978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 253002..253166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(253215..253697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(253736..254245) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(254390..254782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 254966..255556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 255690..256097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(256164..256328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(256721..257515) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438495.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(257576..258184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 258322..258747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(258763..258912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(259113..259247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 259476..261545 product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(261565..262335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(262447..263343) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 263484..263912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(263997..264860) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860720.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene rbsK CDS 264957..265415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(265371..266069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(266264..267280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(267423..267941) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830525.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(268131..269141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 269337..269801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(270116..272176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(272173..274017) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040066179.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(274154..274810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(274905..275855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(276020..276343) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 276539..276949 product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831494.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(276999..278654) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(278676..279785) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818915.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene ugpC CDS complement(279796..280764) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(280777..281823) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163820.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(281824..282840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(282842..283555) product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(283552..284562) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256319.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(284563..285375) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(285375..286241) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(286299..287591) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(287770..288612) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181832.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(288614..290053) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(290068..290952) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene murQ CDS complement(290958..291986) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296173.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 292204..293496 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 293506..294438 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(294487..295407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(295583..295999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(296249..296911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(297039..297683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(297821..298099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(298246..298704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(298725..299480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(299783..300232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 300410..300982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(301194..302165) product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108863.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(302228..303580) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(303586..305004) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287282.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene araA CDS complement(305006..305713) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(305706..307304) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(307457..308539) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(308827..309729) product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(309778..311076) product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(311069..313420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 sequence29 source 1..134392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 351..773 product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(801..1259) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene perR CDS complement(1390..2340) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485153.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2353..2808) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2889..4187 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 4242..5327 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS complement(5356..5961) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(6092..7690) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484956.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(7751..9496) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(9545..10093) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(10166..11209) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485156.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene mutY CDS 11306..12298 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379098.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(12330..13193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(13203..14735) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830434.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(14747..15067) product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(15064..15858) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene recX CDS complement(15916..16635) product monofunctional peptidoglycan glycosyltransferase SgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene sgtB CDS complement(17077..17595) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(17686..19065) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene rlmD CDS complement(19077..19235) product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 19370..20494 product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene yfkAB CDS 20621..21139 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(21173..21691) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830371.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(21841..22014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(22070..23305) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(23332..23529) product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 23710..24015 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830401.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 24049..25077 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037068.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 25097..25669 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(25716..26339) product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene vraR CDS complement(26341..27363) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(27360..28055) product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene liaF CDS complement(28071..28421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(28524..29279) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457092.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene map CDS 29360..30442 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(30472..31149) product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene ric CDS complement(31218..32351) product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(32533..33261) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(33254..34573) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830445.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 34749..35252 product H-type ferritin FtnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830392.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene ftnA CDS 35317..35628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 35621..37615 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432915.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene feoB CDS 37627..37800 product FeoB-associated Cys-rich membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 37885..38784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(38793..39008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(39024..40091) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830390.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene dinB CDS complement(40168..40485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(40466..40735) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994775.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(40885..42216) product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(42398..42895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(43031..44395) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361260.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene rlmD CDS complement(44475..46286) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 46399..47217 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(47258..48214) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(48227..48415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(48415..49866) product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921977.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(49965..50492) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 50817..51611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(51658..52461) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(52627..54054) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene gatB CDS complement(54067..55512) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458553.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene gatA CDS complement(55516..55815) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457086.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene gatC CDS 55990..57519 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484895.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene putP CDS complement(57944..59122) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484897.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(59142..61124) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene ligA CDS complement(61128..63296) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene pcrA CDS complement(63301..63984) product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272056.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(64079..64975) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(64997..65704) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082532.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(65778..66080) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830443.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(66307..67602) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene purB CDS complement(67796..67972) product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669862.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(67962..68528) product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830398.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(68570..69394) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174989.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene nadE CDS complement(69395..70852) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284436.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 70998..72161 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 72236..73279 product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(73292..74428) product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457082.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 74531..75088 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 75131..76048 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830428.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 76067..76336 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484947.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(76436..77398) product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene iolU CDS 77475..78845 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(78903..81815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(82271..83041) product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 83135..83593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 83705..84034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(84218..85249) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181315.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 85457..86965 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860979.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 86968..87393 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418655.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene speD CDS 87407..88267 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965891.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene speE CDS 88251..89102 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene speB CDS 89195..90436 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104062.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 90522..90923 product YolD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS complement(91087..91698) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(91709..92548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(92545..93189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(93665..94477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(94479..94658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 94970..96244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(96282..96803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(96863..97033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 97165..97542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 97791..99314 product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(99331..99489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(99541..99915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(99927..100133) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428510.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 100254..101291 product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(101323..102090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 102270..103310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 103310..103963 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 104024..104470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 104588..105622 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(105734..106963) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(107055..107537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 107820..108371 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002445400.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(108383..108859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(108852..110924) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene helD CDS complement(110921..111205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 111503..111937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(111969..113084) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(113100..113714) product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene kynB CDS complement(113799..114530) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722505.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(114561..114833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(114900..116975) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(116968..117327) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 117496..117729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(117780..118424) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989538.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(118526..119278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(119275..119835) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032393.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(119828..120154) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117500.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 120427..121761 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 121847..122098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(122136..122315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 122388..122576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(122888..124066) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075809.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 124279..124725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 124878..126431 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 126592..127920 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383526.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(127959..128474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(128464..129426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(129676..130095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(130173..130709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(131024..131173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(131540..132754) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106642.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(133004..134131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 sequence30 source 1..113672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(186..259) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(285..368) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(505..577) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(746..1195) product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058111.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(1185..3335) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370122.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(3416..4183) product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440602.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene sigB CDS complement(4194..4634) product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 gene rsbW CDS complement(4636..4962) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829952.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(5052..6059) product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(6109..6471) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(6472..6618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(6681..7826) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457107.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene alr CDS complement(7883..8221) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581197.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene acpS CDS complement(8214..8693) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371349.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(8686..10191) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294626.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(10178..10657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(11171..12688) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178942.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(12956..14293) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(14299..15369) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 15540..16751 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002486299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(16865..16999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 17207..18682 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457116.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene cls CDS complement(18719..18838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 18948..19577 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165965.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 repeat_region 19607..20066 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acggaagtggcttcaaatctattttgacgacac CDS complement(20078..20938) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725802.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene yidC CDS complement(21018..21659) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505076.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene thiE CDS complement(21663..22445) product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469583.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene thiM CDS complement(22445..23233) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene thiD CDS complement(23235..23909) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829894.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene tenA CDS complement(24176..24739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS complement(25060..25899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(26131..26871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 27080..27514 product YwpF-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789631.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(27567..28004) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene fabZ CDS complement(28004..28228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(28261..29544) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene murA CDS complement(29672..29893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(29990..30391) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094394.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(30412..31827) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829930.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 gene atpD CDS complement(31846..32712) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene atpG CDS complement(32748..34259) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene atpA CDS complement(34282..34815) product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene atpH CDS complement(34815..35339) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140679.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(35427..35639) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048816.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene atpE CDS complement(35688..36419) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349655.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene atpB CDS complement(36443..36796) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001801792.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(36977..38125) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene wecB CDS complement(38143..38772) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829916.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene upp CDS complement(38839..40074) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene glyA CDS complement(40098..40619) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829927.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(40612..41058) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 gene rpiB CDS complement(41154..41579) product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(41588..42592) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829923.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(42680..43525) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene prmC CDS complement(43509..44585) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460242.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene prfA CDS complement(44628..45203) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(45341..45595) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829959.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(45712..47028) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene rho CDS complement(47193..48170) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene glpX CDS complement(48321..48650) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451438.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(48772..50028) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(50216..51073) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829938.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS complement(51165..51512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 51578..52072 product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829945.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(52446..53339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(53455..55053) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829895.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(55188..55712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(55788..56603) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468299.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 56761..57573 product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440556.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 gene coaW CDS complement(57783..58961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440553.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(58951..60135) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291497.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(60347..61984) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(61981..62655) product two-component system response regulator YvrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene yvrH CDS complement(62776..63318) product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948551.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 63472..64992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 64995..66140 product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829386.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 66155..66640 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(66701..67309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 67471..68151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 68230..68496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(68539..69708) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene deoB CDS complement(69821..71125) product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(71182..71844) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene deoC CDS complement(71928..72857) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356565.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(72972..73424) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 73554..74234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(74342..75616) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660710.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 76057..77106 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(77190..77690) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(77761..78711) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001792529.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(78765..79409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217519.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 80043..80477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(80524..81966) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711547.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene nhaC CDS complement(82128..82415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(82437..82787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(82771..82953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(83091..84701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 85283..85828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 note possible pseudo, internal stop codon, frameshifted CDS 85829..86311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 note possible pseudo, internal stop codon CDS 86589..88349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(88459..89274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS complement(89372..90229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 90692..91477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 91470..92711 product poly-beta-1,6 N-acetyl-D-glucosamine synthase IcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene icaA CDS 92672..93124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 93121..93975 product intercellular adhesin biosynthesis polysaccharide N-deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877369.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene icaB CDS complement(94066..94977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 95370..95504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(95787..97019) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(97037..98953) product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156285909.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(98943..101057) product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(101054..102064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(102068..103288) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(103281..104432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(104460..105155) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(105163..105843) product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393150.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(106267..106401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(106613..107812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(108272..109855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(109988..111562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(111806..111934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 misc_feature complement(112056..>113672) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082831.1:MSCRAMM family adhesin SdrF locus_tag LOCUS_24360 sequence31 source 1..73171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(504..1127) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045135.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(1105..2238) product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829819.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2259..3800) product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 3924..4742 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669376.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 4822..5433 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(5510..7660) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(7719..9251) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene ppx CDS complement(9282..10667) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116228.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 gene fumC CDS complement(10777..10920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(10933..11544) product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(11874..12611) product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485228.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(12624..13097) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene trmL CDS complement(13098..14222) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene queG CDS complement(14378..15100) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(15093..16541) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082742.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 16703..17857 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777577.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(18032..19078) product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(19170..19520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 19686..20240 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721539.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(20534..21028) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(21054..21863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 21940..22152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(22157..22963) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(22994..23386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(23388..24203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 24382..25293 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242891.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(25318..25611) product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(25693..26970) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888369.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 27076..28314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(28356..28733) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(28817..29509) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503137.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(29835..30029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(30201..30323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(30542..30961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 note possible pseudo, frameshifted CDS complement(31042..31806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(31807..32148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(32187..32627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(32627..32917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(32970..33326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(33338..35290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(35331..35978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(36046..39651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(39657..41705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(41719..45579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(45572..45916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(45943..46533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(46622..47164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(47179..47625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(47638..48024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(48021..48347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(48349..48645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(48654..48992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(49021..49956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(49972..50553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(50724..50933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(50930..51868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(51849..53225) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(53237..54544) product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830192.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(54534..55013) product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047635.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(55235..55666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(55743..55886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(55900..56292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(56341..56562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(56596..56868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(57002..57295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(57292..57612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(57605..58003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(58000..58212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(58279..58701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(58704..59123) product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(59110..59499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(59589..60125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(60118..60240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(60242..60427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(60424..60798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(60816..60974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(60964..61755) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(61765..62493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(62495..63157) product putative HNHc nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(63170..63715) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene ssb CDS complement(63708..64295) product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231960.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(64317..64856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(64866..65171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(65354..65488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(65488..65619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(65616..65933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(65945..66712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368666.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(66709..67611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(67629..67841) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702380.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 68040..68687 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 68741..69187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 69205..69654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 69719..70765 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857180.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 tRNA complement(70920..71002) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(71270..71344) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(71359..71432) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(71437..71509) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(71525..71598) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(71601..71674) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(71695..71778) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(71783..71858) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(71873..71948) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(71955..72030) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(72038..72113) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(72170..72262) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(72282..72356) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(72395..72469) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(72490..72565) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(72588..72661) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(72681..72757) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(72761..72849) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA complement(72890..72964) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(72969..73052) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(73075..73150) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 sequence32 source 1..63944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..1156) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 1286..2173 product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 2265..3038 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene phnC CDS 3038..3817 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800868.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene phnE CDS 3814..4620 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191092.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene phnE CDS complement(4695..5291) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559159.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene recR CDS complement(5293..5613) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS complement(5632..7293) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene dnaX CDS complement(7412..9118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(9613..10347) product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118675.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene treR CDS complement(10399..12036) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031490.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene treC CDS complement(12132..13601) product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279361.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene treP CDS 13782..14510 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(14489..15397) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(15381..16478) product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244980.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene ykfB tRNA complement(16594..16686) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(16760..17128) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642398.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(17647..19188) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424963.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene guaA CDS complement(19252..20721) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264071.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene guaB CDS complement(20766..22034) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(22036..22611) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene xpt CDS 23177..24127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS 24256..24864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(24919..25467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(25699..25941) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene rpsR CDS complement(25975..26505) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene ssb CDS complement(26530..26820) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene rpsF CDS complement(26944..27267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(27289..28389) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 gene ychF CDS complement(28402..28593) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(28583..29470) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(29480..30328) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(30321..31082) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(31195..32040) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831794.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 gene noc CDS complement(32088..32804) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215587.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene rsmG CDS complement(32805..34679) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene mnmG CDS complement(34692..36074) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 gene mnmE CDS complement(36206..37021) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(37043..37390) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832522.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 gene rnpA CDS complement(37495..37632) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene rpmH CDS 38104..39441 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene dnaA CDS 39618..40751 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene dnaN CDS 40922..41818 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 41811..43052 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548702.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 43182..43901 product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene bdbD CDS 43901..44320 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 44470..44688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 44769..45797 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775113.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene recF CDS 45814..47727 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831817.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene gyrB CDS 47755..50418 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831812.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene gyrA CDS 50610..52277 product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989867.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene alsS CDS 52288..52989 product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723157.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene budA CDS complement(53025..53834) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS 54193..55464 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485584.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene serS CDS 55660..56247 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181124.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 56385..57305 product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001800884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 57330..59297 product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081640.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene gdpP CDS 59300..59746 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831811.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene rplI CDS 59765..61162 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375647.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene dnaB CDS 61487..62782 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470559.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(62864..63652) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 sequence33 source 1..62110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..2038) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989412.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 2235..3020 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(3069..3338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(3338..4525) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619903.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(4656..4859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(5032..5784) product divalent heavy-metal cations transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775812.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(5891..6253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(6343..7989) product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(8080..9294) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831227.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(9314..10066) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261793.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene pxpA CDS complement(10069..11418) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(11430..11861) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930864.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene accB CDS complement(11861..12832) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023319.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(12832..13539) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831296.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene pxpB CDS complement(13717..14427) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096495.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 14610..14909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS 14950..15300 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944500.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene crcB CDS 15297..15620 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944501.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene crcB CDS 15724..17838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS complement(17878..18792) product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366163.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 19037..19225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(19402..20595) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 gene metK CDS 21005..22594 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene pckA CDS complement(22773..23522) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002489377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(23506..23976) product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672013.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 gene ytkD CDS 24021..24794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 24804..25034 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene yidD CDS complement(25082..26062) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485317.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 gene menC CDS complement(26043..27446) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082721.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene menE CDS complement(27615..28622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(28733..29551) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485272.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene menB CDS complement(29544..30338) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene menH CDS complement(30325..31992) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833068.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene menD CDS complement(31985..33289) product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439285.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 33433..34353 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831680.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(34402..34662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(34678..35145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 tRNA complement(35361..35451) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(35496..35567) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(35572..35646) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(35654..35727) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(35736..35811) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(35828..35903) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(35907..35982) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(35989..36064) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(36290..37210) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296177.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 tRNA complement(37452..37542) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA complement(37543..37617) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(37697..38254) product competence protein ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 38499..38708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(38784..39770) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(39838..41214) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167542.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene hemY CDS complement(41230..42150) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 gene hemH CDS complement(42151..43209) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966929.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene hemE CDS 43349..43867 product signal transduction protein TRAP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485184.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene traP CDS complement(43890..45107) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551836.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(45100..45834) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216874.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 45975..46400 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 46460..46816 product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648118.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 47007..47552 product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS 48228..49154 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(49263..50204) product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene yhaM CDS complement(50201..53125) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584628.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(53122..54300) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238227.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(54397..55860) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245132.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(55957..56325) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485196.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(56393..57523) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(57610..58074) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829807.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS complement(58257..59561) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814809.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 59789..60655 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723362.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS complement(60697..61137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(61124..61549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 61689..61958 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405647.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 sequence34 source 1..56025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 1414..2265 product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene catE CDS 2290..2913 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522381.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(2971..3822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(3987..4937) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(4934..6418) product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(6465..7439) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167747.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 7508..8431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(8689..9444) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene tatC CDS complement(9506..9700) product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001794540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(9713..10345) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283612.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 10502..12418 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene abc-f CDS 13007..13252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 13252..13425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(13491..15080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(15073..15414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(15436..15876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(15876..16166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(16244..20029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(20059..20217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(20401..23886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(23902..25077) product phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567408.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(25393..29541) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504568.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(29580..29729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(29762..30100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(30126..30317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(30395..31003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(31018..31428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565498.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(31425..31820) product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114226.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(31810..32184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(32168..32455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(32464..32625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(32669..33883) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154559.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(33896..34747) product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426975.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(34744..35844) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025274.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(35909..37591) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625088.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(37588..37881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(38010..38327) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988332.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(38434..38871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590122.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(38937..39116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(39137..39286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(39441..39800) product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(39797..40060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(40082..40312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(40529..40759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(40756..41058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(41101..41541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(41522..41704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(41720..42472) product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002373786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(42473..42733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(42746..43168) product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401969.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(43155..43313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(43303..43815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(43912..44337) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454700.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene dut CDS complement(44324..44446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(44446..44640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(44624..44881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(44891..45127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(45117..45332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(45348..45836) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene ssb CDS complement(45826..46188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(46181..46498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(46491..47507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(47504..47776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(47763..48497) product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057801863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(48610..48801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(48798..48962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(49251..49451) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115060.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 49609..50010 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429766.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 50022..50450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 50452..51180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 51308..52507 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387264.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(52814..53830) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159041.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene tsaD CDS complement(53812..54267) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829994.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene rimI CDS complement(54246..54908) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832485.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene tsaB CDS complement(54880..55350) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049629.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene tsaE rRNA complement(55605..55714) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030